>Feature sequence001 <1 2917 gene locus_tag LOCUS_00010 <1 2917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943492.1:DNA-directed RNA polymerase subunit beta' 3275 4666 gene locus_tag LOCUS_00020 3275 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 5049 7205 gene locus_tag LOCUS_00030 5049 7205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 7263 8282 gene locus_tag LOCUS_00040 7263 8282 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_00040 8543 8965 gene locus_tag LOCUS_00050 8543 8965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 8986 10557 gene locus_tag LOCUS_00060 gene glgA 8986 10557 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246015.1 protein_id gnl|my_center|LOCUS_00060 10559 12616 gene locus_tag LOCUS_00070 10559 12616 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787605.1 protein_id gnl|my_center|LOCUS_00070 12645 13334 gene locus_tag LOCUS_00080 gene ispD 12645 13334 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393964.1 protein_id gnl|my_center|LOCUS_00080 13341 14099 gene locus_tag LOCUS_00090 13341 14099 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_00090 14140 14634 gene locus_tag LOCUS_00100 14140 14634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 <18031 15116 gene locus_tag LOCUS_00110 <18031 15116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009873312.1:DEAD/DEAH box helicase >Feature sequence002 1124 519 gene locus_tag LOCUS_00120 1124 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 2521 1478 gene locus_tag LOCUS_00130 2521 1478 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_00130 3668 4060 gene locus_tag LOCUS_00140 3668 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 4579 5259 gene locus_tag LOCUS_00150 4579 5259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00150 5281 7743 gene locus_tag LOCUS_00160 5281 7743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00160 7763 9586 gene locus_tag LOCUS_00170 7763 9586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 9677 10846 gene locus_tag LOCUS_00180 9677 10846 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764020.1 protein_id gnl|my_center|LOCUS_00180 10872 11717 gene locus_tag LOCUS_00190 10872 11717 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028849.1 protein_id gnl|my_center|LOCUS_00190 11738 14689 gene locus_tag LOCUS_00200 11738 14689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 14691 15473 gene locus_tag LOCUS_00210 14691 15473 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_00210 15543 16415 gene locus_tag LOCUS_00220 15543 16415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 16440 17084 gene locus_tag LOCUS_00230 16440 17084 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871236.1 protein_id gnl|my_center|LOCUS_00230 >Feature sequence003 3120 520 gene locus_tag LOCUS_00240 3120 520 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068264.1 protein_id gnl|my_center|LOCUS_00240 5056 3683 gene locus_tag LOCUS_00250 5056 3683 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021695.1 protein_id gnl|my_center|LOCUS_00250 5633 5067 gene locus_tag LOCUS_00260 5633 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 5901 5620 gene locus_tag LOCUS_00270 5901 5620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 6797 6621 gene locus_tag LOCUS_00280 6797 6621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 7631 7828 gene locus_tag LOCUS_00290 7631 7828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 11634 8938 gene locus_tag LOCUS_00300 11634 8938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 12225 12402 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttccaagtgaacttaaagccgaaaggc 13208 14563 gene locus_tag LOCUS_00310 gene dnaA 13208 14563 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428021.1 protein_id gnl|my_center|LOCUS_00310 15356 15901 gene locus_tag LOCUS_00320 15356 15901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 16030 16419 gene locus_tag LOCUS_00330 16030 16419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 >Feature sequence004 11977 110 gene locus_tag LOCUS_00340 11977 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 13087 11981 gene locus_tag LOCUS_00350 13087 11981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 14958 14122 gene locus_tag LOCUS_00360 14958 14122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 >Feature sequence005 <1 1575 gene locus_tag LOCUS_00370 <1 1575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971714.1:protein translocase subunit SecDF 1585 1672 gene locus_tag LOCUS_t00010 1585 1672 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2340 3488 gene locus_tag LOCUS_00380 gene pdxB 2340 3488 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267266.1 protein_id gnl|my_center|LOCUS_00380 4984 3560 gene locus_tag LOCUS_00390 4984 3560 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082901032.1 protein_id gnl|my_center|LOCUS_00390 5485 4988 gene locus_tag LOCUS_00400 5485 4988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 6575 5571 gene locus_tag LOCUS_00410 6575 5571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 7578 6586 gene locus_tag LOCUS_00420 7578 6586 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460176.1 protein_id gnl|my_center|LOCUS_00420 10336 7586 gene locus_tag LOCUS_00430 10336 7586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 11587 10340 gene locus_tag LOCUS_00440 11587 10340 CDS product hexokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680422.1 protein_id gnl|my_center|LOCUS_00440 13142 11553 gene locus_tag LOCUS_00450 13142 11553 CDS product bifunctional shikimate kinase/3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052140.1 protein_id gnl|my_center|LOCUS_00450 14847 13153 gene locus_tag LOCUS_00460 gene recN 14847 13153 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_00460 <16465 15353 gene locus_tag LOCUS_00470 <16465 15353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389825.1:aspartate--tRNA ligase >Feature sequence006 515 21 gene locus_tag LOCUS_00480 515 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 1847 516 gene locus_tag LOCUS_00490 gene sctN 1847 516 CDS product type III secretion system ATPase SctN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176697.1 protein_id gnl|my_center|LOCUS_00490 2482 1865 gene locus_tag LOCUS_00500 gene bscL 2482 1865 CDS product SctL family type III secretion system stator protein BscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930820.1 protein_id gnl|my_center|LOCUS_00500 2907 2470 gene locus_tag LOCUS_00510 2907 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 3236 2892 gene locus_tag LOCUS_00520 3236 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 3822 3238 gene locus_tag LOCUS_00530 3822 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 4244 3864 gene locus_tag LOCUS_00540 4244 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 4609 4241 gene locus_tag LOCUS_00550 4609 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 4914 4609 gene locus_tag LOCUS_00560 4914 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 5273 5061 gene locus_tag LOCUS_00570 5273 5061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 6558 5284 gene locus_tag LOCUS_00580 6558 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 8645 6555 gene locus_tag LOCUS_00590 gene lcrD 8645 6555 CDS product SctV family type III secretion system export apparatus subunit LcrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117635.1 protein_id gnl|my_center|LOCUS_00590 9041 8661 gene locus_tag LOCUS_00600 9041 8661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 9430 9038 gene locus_tag LOCUS_00610 9430 9038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 10608 9427 gene locus_tag LOCUS_00620 10608 9427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 11182 10598 gene locus_tag LOCUS_00630 11182 10598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 13151 11172 gene locus_tag LOCUS_00640 gene vscC 13151 11172 CDS product SctC family type III secretion system outer membrane ring subunit VscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105906.1 protein_id gnl|my_center|LOCUS_00640 13567 13169 gene locus_tag LOCUS_00650 13567 13169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 14076 14426 gene locus_tag LOCUS_00660 14076 14426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 >Feature sequence007 <1 1436 gene locus_tag LOCUS_00670 <1 1436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109085.1:glycoside hydrolase family 2 TIM barrel-domain containing protein 3360 1888 gene locus_tag LOCUS_00680 3360 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 3493 5760 gene locus_tag LOCUS_00690 gene rnr 3493 5760 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081010.1 protein_id gnl|my_center|LOCUS_00690 5757 6566 gene locus_tag LOCUS_00700 5757 6566 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_00700 6594 7970 gene locus_tag LOCUS_00710 gene rseP 6594 7970 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881281.1 protein_id gnl|my_center|LOCUS_00710 7984 9060 gene locus_tag LOCUS_00720 gene ispG 7984 9060 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_00720 9071 9793 gene locus_tag LOCUS_00730 9071 9793 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_00730 9826 10851 gene locus_tag LOCUS_00740 9826 10851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 11398 10907 gene locus_tag LOCUS_00750 gene nrdR 11398 10907 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865386.1 protein_id gnl|my_center|LOCUS_00750 12178 11414 gene locus_tag LOCUS_00760 12178 11414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 13673 12267 gene locus_tag LOCUS_00770 13673 12267 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986917.1 protein_id gnl|my_center|LOCUS_00770 <14686 13708 gene locus_tag LOCUS_00780 <14686 13708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392538.1:iron-containing alcohol dehydrogenase family protein >Feature sequence008 1766 684 gene locus_tag LOCUS_00790 1766 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 3038 1773 gene locus_tag LOCUS_00800 gene icd 3038 1773 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814059.1 protein_id gnl|my_center|LOCUS_00800 3731 4045 gene locus_tag LOCUS_00810 gene rplU 3731 4045 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896540.1 protein_id gnl|my_center|LOCUS_00810 4068 4313 gene locus_tag LOCUS_00820 gene rpmA 4068 4313 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228914.1 protein_id gnl|my_center|LOCUS_00820 4343 5446 gene locus_tag LOCUS_00830 gene obgE 4343 5446 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933866.1 protein_id gnl|my_center|LOCUS_00830 5486 5716 gene locus_tag LOCUS_00840 5486 5716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 5928 6965 gene locus_tag LOCUS_00850 5928 6965 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262368.1 protein_id gnl|my_center|LOCUS_00850 7296 8096 gene locus_tag LOCUS_00860 7296 8096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 8121 8312 gene locus_tag LOCUS_00870 8121 8312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 8323 8877 gene locus_tag LOCUS_00880 8323 8877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 8895 9434 gene locus_tag LOCUS_00890 gene atpH 8895 9434 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288590.1 protein_id gnl|my_center|LOCUS_00890 9496 11025 gene locus_tag LOCUS_00900 gene atpA 9496 11025 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056290.1 protein_id gnl|my_center|LOCUS_00900 11029 11904 gene locus_tag LOCUS_00910 gene atpG 11029 11904 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940788.1 protein_id gnl|my_center|LOCUS_00910 >Feature sequence009 <1 1269 gene locus_tag LOCUS_00920 <1 1269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255954.1:phosphomannomutase/phosphoglucomutase 1344 2519 gene locus_tag LOCUS_00930 gene galK 1344 2519 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456582.1 protein_id gnl|my_center|LOCUS_00930 2739 2590 gene locus_tag LOCUS_00940 2739 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 2818 3510 gene locus_tag LOCUS_00950 2818 3510 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880976.1 protein_id gnl|my_center|LOCUS_00950 3540 4031 gene locus_tag LOCUS_00960 3540 4031 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930707.1 protein_id gnl|my_center|LOCUS_00960 4127 4660 gene locus_tag LOCUS_00970 4127 4660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 4657 5463 gene locus_tag LOCUS_00980 4657 5463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 5480 7189 gene locus_tag LOCUS_00990 5480 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 7192 8076 gene locus_tag LOCUS_01000 7192 8076 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136348290.1 protein_id gnl|my_center|LOCUS_01000 8099 8989 gene locus_tag LOCUS_01010 8099 8989 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256414.1 protein_id gnl|my_center|LOCUS_01010 9048 10646 gene locus_tag LOCUS_01020 9048 10646 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727481.1 protein_id gnl|my_center|LOCUS_01020 10251 10177 gene locus_tag LOCUS_t00020 10251 10177 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 10682 11131 gene locus_tag LOCUS_01030 10682 11131 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258700.1 protein_id gnl|my_center|LOCUS_01030 >Feature sequence010 <1 11659 gene locus_tag LOCUS_01040 <1 11659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_137607921.1:Ig-like domain-containing protein >Feature sequence011 2865 1300 gene locus_tag LOCUS_01050 2865 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 3749 2862 gene locus_tag LOCUS_01060 gene hslO 3749 2862 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674924.1 protein_id gnl|my_center|LOCUS_01060 4826 3789 gene locus_tag LOCUS_01070 4826 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 5877 4840 gene locus_tag LOCUS_01080 5877 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 7056 6166 gene locus_tag LOCUS_01090 7056 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 7232 8926 gene locus_tag LOCUS_01100 7232 8926 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_01100 9534 10433 gene locus_tag LOCUS_01110 9534 10433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 >Feature sequence012 1 162 gene locus_tag LOCUS_01120 1 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 1394 267 gene locus_tag LOCUS_01130 1394 267 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_01130 2562 1432 gene locus_tag LOCUS_01140 2562 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 3567 2584 gene locus_tag LOCUS_01150 3567 2584 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_01150 4054 3620 gene locus_tag LOCUS_01160 4054 3620 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870072.1 protein_id gnl|my_center|LOCUS_01160 5155 4100 gene locus_tag LOCUS_01170 5155 4100 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393491.1 protein_id gnl|my_center|LOCUS_01170 6911 5157 gene locus_tag LOCUS_01180 6911 5157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 7532 6930 gene locus_tag LOCUS_01190 gene coaE 7532 6930 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941181.1 protein_id gnl|my_center|LOCUS_01190 8090 7686 gene locus_tag LOCUS_01200 8090 7686 CDS product peptide chain release factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945928.1 protein_id gnl|my_center|LOCUS_01200 9377 8106 gene locus_tag LOCUS_01210 gene tyrS 9377 8106 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808246.1 protein_id gnl|my_center|LOCUS_01210 9570 10238 gene locus_tag LOCUS_01220 9570 10238 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939073.1 protein_id gnl|my_center|LOCUS_01220 >Feature sequence013 2521 974 gene locus_tag LOCUS_01230 2521 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 3416 2772 gene locus_tag LOCUS_01240 3416 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 5220 3430 gene locus_tag LOCUS_01250 gene glaB 5220 3430 CDS product alpha-1,3-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202199.1 protein_id gnl|my_center|LOCUS_01250 6212 5235 gene locus_tag LOCUS_01260 6212 5235 CDS product DUF814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583848.1 protein_id gnl|my_center|LOCUS_01260 6453 8138 gene locus_tag LOCUS_01270 6453 8138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 8155 9033 gene locus_tag LOCUS_01280 gene rfbA 8155 9033 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476438.1 protein_id gnl|my_center|LOCUS_01280 9047 9601 gene locus_tag LOCUS_01290 gene rfbC 9047 9601 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107717.1 protein_id gnl|my_center|LOCUS_01290 9586 10368 gene locus_tag LOCUS_01300 9586 10368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 10813 10568 gene locus_tag LOCUS_01310 10813 10568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 >Feature sequence014 150 2573 gene locus_tag LOCUS_01320 150 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 2575 3333 gene locus_tag LOCUS_01330 2575 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 4393 3650 gene locus_tag LOCUS_01340 4393 3650 CDS product DUF3944 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014660168.1 protein_id gnl|my_center|LOCUS_01340 5652 5068 gene locus_tag LOCUS_01350 5652 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 7672 5654 gene locus_tag LOCUS_01360 7672 5654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 9288 7993 gene locus_tag LOCUS_01370 9288 7993 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245035.1 protein_id gnl|my_center|LOCUS_01370 <10436 9313 gene locus_tag LOCUS_01380 <10436 9313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108456.1:DUF4091 domain-containing protein >Feature sequence015 2060 1131 gene locus_tag LOCUS_01390 2060 1131 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140077.1 protein_id gnl|my_center|LOCUS_01390 5110 2060 gene locus_tag LOCUS_01400 5110 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 6729 5173 gene locus_tag LOCUS_01410 gene der 6729 5173 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426959.1 protein_id gnl|my_center|LOCUS_01410 8212 9783 gene locus_tag LOCUS_01420 8212 9783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 >Feature sequence016 152 658 gene locus_tag LOCUS_01430 152 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 848 1312 gene locus_tag LOCUS_01440 848 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 1325 1795 gene locus_tag LOCUS_01450 1325 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01450 2542 1787 gene locus_tag LOCUS_01460 2542 1787 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942121.1 protein_id gnl|my_center|LOCUS_01460 3527 2556 gene locus_tag LOCUS_01470 3527 2556 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583050.1 protein_id gnl|my_center|LOCUS_01470 4686 3559 gene locus_tag LOCUS_01480 4686 3559 CDS product anaerobic sulfatase-maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789094.1 protein_id gnl|my_center|LOCUS_01480 5165 4695 gene locus_tag LOCUS_01490 5165 4695 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793479.1 protein_id gnl|my_center|LOCUS_01490 5422 6543 gene locus_tag LOCUS_01500 gene eboE 5422 6543 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_01500 8171 6669 gene locus_tag LOCUS_01510 8171 6669 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_01510 8626 8168 gene locus_tag LOCUS_01520 gene sixA 8626 8168 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072979.1 protein_id gnl|my_center|LOCUS_01520 <9955 8668 gene locus_tag LOCUS_01530 <9955 8668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001062037.1:polynucleotide adenylyltransferase PcnB >Feature sequence017 269 353 gene locus_tag LOCUS_t00030 269 353 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 410 1609 gene locus_tag LOCUS_01540 gene rodA 410 1609 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_01540 1633 3210 gene locus_tag LOCUS_01550 gene rng 1633 3210 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_01550 3210 5690 gene locus_tag LOCUS_01560 3210 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 5702 5778 gene locus_tag LOCUS_t00040 5702 5778 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5920 6606 gene locus_tag LOCUS_01570 gene rph 5920 6606 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247093.1 protein_id gnl|my_center|LOCUS_01570 6618 7805 gene locus_tag LOCUS_01580 6618 7805 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262085.1 protein_id gnl|my_center|LOCUS_01580 7829 9190 gene locus_tag LOCUS_01590 7829 9190 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_01590 >Feature sequence018 1468 275 gene locus_tag LOCUS_01600 1468 275 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_01600 2348 1461 gene locus_tag LOCUS_01610 gene argB 2348 1461 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335411.1 protein_id gnl|my_center|LOCUS_01610 3568 2345 gene locus_tag LOCUS_01620 gene argJ 3568 2345 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259189.1 protein_id gnl|my_center|LOCUS_01620 9425 4437 gene locus_tag LOCUS_01630 9425 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 >Feature sequence019 1593 1132 gene locus_tag LOCUS_01640 1593 1132 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836832.1 protein_id gnl|my_center|LOCUS_01640 2169 1675 gene locus_tag LOCUS_01650 2169 1675 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941709.1 protein_id gnl|my_center|LOCUS_01650 3216 2188 gene locus_tag LOCUS_01660 3216 2188 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392580.1 protein_id gnl|my_center|LOCUS_01660 3440 4105 gene locus_tag LOCUS_01670 3440 4105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 4105 5871 gene locus_tag LOCUS_01680 4105 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 6043 8751 gene locus_tag LOCUS_01690 gene adhE 6043 8751 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056082.1 protein_id gnl|my_center|LOCUS_01690 >Feature sequence020 <1 616 gene locus_tag LOCUS_01700 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615922.1:ATPase, T2SS/T4P/T4SS family 709 2163 gene locus_tag LOCUS_01710 709 2163 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460522.1 protein_id gnl|my_center|LOCUS_01710 2738 4147 gene locus_tag LOCUS_01720 2738 4147 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_01720 4384 6303 gene locus_tag LOCUS_01730 4384 6303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 6300 7820 gene locus_tag LOCUS_01740 6300 7820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 >Feature sequence021 2591 735 gene locus_tag LOCUS_01750 2591 735 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626097.1 protein_id gnl|my_center|LOCUS_01750 4834 2648 gene locus_tag LOCUS_01760 4834 2648 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679930.1 protein_id gnl|my_center|LOCUS_01760 6811 4859 gene locus_tag LOCUS_01770 6811 4859 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001970104.1 protein_id gnl|my_center|LOCUS_01770 7352 6813 gene locus_tag LOCUS_01780 gene tadA 7352 6813 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815124.1 protein_id gnl|my_center|LOCUS_01780 8511 7336 gene locus_tag LOCUS_01790 8511 7336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 9008 8520 gene locus_tag LOCUS_01800 9008 8520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 >Feature sequence022 1183 398 gene locus_tag LOCUS_01810 1183 398 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 protein_id gnl|my_center|LOCUS_01810 2507 1296 gene locus_tag LOCUS_01820 2507 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 4343 3018 gene locus_tag LOCUS_01830 4343 3018 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068386.1 protein_id gnl|my_center|LOCUS_01830 5929 4622 gene locus_tag LOCUS_01840 gene clpX 5929 4622 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546526.1 protein_id gnl|my_center|LOCUS_01840 6077 5988 gene locus_tag LOCUS_t00050 6077 5988 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6155 6081 gene locus_tag LOCUS_t00060 6155 6081 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 6252 6168 gene locus_tag LOCUS_t00070 6252 6168 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6339 6263 gene locus_tag LOCUS_t00080 6339 6263 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7180 8628 gene locus_tag LOCUS_01850 7180 8628 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461272.1 protein_id gnl|my_center|LOCUS_01850 >Feature sequence023 120 193 gene locus_tag LOCUS_t00090 120 193 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 213 398 gene locus_tag LOCUS_01860 213 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 432 1070 gene locus_tag LOCUS_01870 gene nusG 432 1070 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108028.1 protein_id gnl|my_center|LOCUS_01870 1168 1593 gene locus_tag LOCUS_01880 gene rplK 1168 1593 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870243.1 protein_id gnl|my_center|LOCUS_01880 1608 2291 gene locus_tag LOCUS_01890 gene rplA 1608 2291 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002020168.1 protein_id gnl|my_center|LOCUS_01890 2298 2846 gene locus_tag LOCUS_01900 gene rplJ 2298 2846 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832306.1 protein_id gnl|my_center|LOCUS_01900 2966 3331 gene locus_tag LOCUS_01910 gene rplL 2966 3331 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088160.1 protein_id gnl|my_center|LOCUS_01910 3790 5169 gene locus_tag LOCUS_01920 3790 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 5275 6036 gene locus_tag LOCUS_01930 5275 6036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 6138 6623 gene locus_tag LOCUS_01940 6138 6623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 6639 7445 gene locus_tag LOCUS_01950 6639 7445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 >Feature sequence024 981 1772 gene locus_tag LOCUS_01960 981 1772 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053924.1 protein_id gnl|my_center|LOCUS_01960 1774 2721 gene locus_tag LOCUS_01970 1774 2721 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963617.1 protein_id gnl|my_center|LOCUS_01970 2737 4026 gene locus_tag LOCUS_01980 2737 4026 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769170.1 protein_id gnl|my_center|LOCUS_01980 4087 5484 gene locus_tag LOCUS_01990 4087 5484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 5488 6825 gene locus_tag LOCUS_02000 5488 6825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 6806 7549 gene locus_tag LOCUS_02010 6806 7549 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091117.1 protein_id gnl|my_center|LOCUS_02010 7561 8412 gene locus_tag LOCUS_02020 7561 8412 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073864.1 protein_id gnl|my_center|LOCUS_02020 >Feature sequence025 <1 890 gene locus_tag LOCUS_02030 <1 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943707.1:THUMP domain-containing protein 914 1537 gene locus_tag LOCUS_02040 914 1537 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669725.1 protein_id gnl|my_center|LOCUS_02040 1538 2308 gene locus_tag LOCUS_02050 1538 2308 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144051.1 protein_id gnl|my_center|LOCUS_02050 2355 3458 gene locus_tag LOCUS_02060 2355 3458 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968194.1 protein_id gnl|my_center|LOCUS_02060 3478 5385 gene locus_tag LOCUS_02070 3478 5385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 5415 7418 gene locus_tag LOCUS_02080 5415 7418 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057023.1 protein_id gnl|my_center|LOCUS_02080 7488 8180 gene locus_tag LOCUS_02090 7488 8180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 >Feature sequence026 <1 2107 gene locus_tag LOCUS_02100 <1 2107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000249994.1:DNA polymerase I 2121 5309 gene locus_tag LOCUS_02110 2121 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 6117 5425 gene locus_tag LOCUS_02120 6117 5425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 6330 8459 gene locus_tag LOCUS_02130 6330 8459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 >Feature sequence027 2414 2617 gene locus_tag LOCUS_02140 2414 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 3073 4161 gene locus_tag LOCUS_02150 3073 4161 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326127.1 protein_id gnl|my_center|LOCUS_02150 4209 4466 gene locus_tag LOCUS_02160 4209 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02160 4488 6230 gene locus_tag LOCUS_02170 4488 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02170 6441 8255 gene locus_tag LOCUS_02180 6441 8255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 >Feature sequence028 2617 1367 gene locus_tag LOCUS_02190 2617 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 3054 2617 gene locus_tag LOCUS_02200 3054 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 3681 4859 gene locus_tag LOCUS_02210 3681 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 8070 4945 gene locus_tag LOCUS_02220 8070 4945 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202548.1 protein_id gnl|my_center|LOCUS_02220 >Feature sequence029 262 2112 gene locus_tag LOCUS_02230 262 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 2277 2915 gene locus_tag LOCUS_02240 gene bioD 2277 2915 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795149.1 protein_id gnl|my_center|LOCUS_02240 2970 3335 gene locus_tag LOCUS_02250 2970 3335 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_02250 3391 4686 gene locus_tag LOCUS_02260 3391 4686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 4679 6697 gene locus_tag LOCUS_02270 4679 6697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 6690 8003 gene locus_tag LOCUS_02280 gene mnmE 6690 8003 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207681.1 protein_id gnl|my_center|LOCUS_02280 >Feature sequence030 346 1662 gene locus_tag LOCUS_02290 346 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 1677 2420 gene locus_tag LOCUS_02300 1677 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 2552 4330 gene locus_tag LOCUS_02310 2552 4330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 4374 5168 gene locus_tag LOCUS_02320 4374 5168 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464970.1 protein_id gnl|my_center|LOCUS_02320 5214 6032 gene locus_tag LOCUS_02330 5214 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 6029 7132 gene locus_tag LOCUS_02340 gene ychF 6029 7132 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938722.1 protein_id gnl|my_center|LOCUS_02340 7142 8251 gene locus_tag LOCUS_02350 7142 8251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 >Feature sequence031 <1 545 gene locus_tag LOCUS_02360 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001284165.1:LL-diaminopimelate aminotransferase 608 1393 gene locus_tag LOCUS_02370 608 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02370 1384 1803 gene locus_tag LOCUS_02380 1384 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 1941 3920 gene locus_tag LOCUS_02390 1941 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 3936 5585 gene locus_tag LOCUS_02400 3936 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 5598 6578 gene locus_tag LOCUS_02410 5598 6578 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083810.1 protein_id gnl|my_center|LOCUS_02410 6575 7306 gene locus_tag LOCUS_02420 6575 7306 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016610.1 protein_id gnl|my_center|LOCUS_02420 >Feature sequence032 302 1348 gene locus_tag LOCUS_02430 gene nadA 302 1348 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461809.1 protein_id gnl|my_center|LOCUS_02430 1857 1438 gene locus_tag LOCUS_02440 1857 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 3761 1854 gene locus_tag LOCUS_02450 3761 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 3988 3767 gene locus_tag LOCUS_02460 gene infA 3988 3767 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942395.1 protein_id gnl|my_center|LOCUS_02460 6349 4247 gene locus_tag LOCUS_02470 6349 4247 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_02470 7560 6430 gene locus_tag LOCUS_02480 7560 6430 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202494.1 protein_id gnl|my_center|LOCUS_02480 >Feature sequence033 1912 1520 gene locus_tag LOCUS_02490 gene rplQ 1912 1520 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258259.1 protein_id gnl|my_center|LOCUS_02490 2935 1940 gene locus_tag LOCUS_02500 2935 1940 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_02500 3612 3007 gene locus_tag LOCUS_02510 gene rpsD 3612 3007 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762050.1 protein_id gnl|my_center|LOCUS_02510 4101 3616 gene locus_tag LOCUS_02520 gene rpsK 4101 3616 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883265.1 protein_id gnl|my_center|LOCUS_02520 4479 4120 gene locus_tag LOCUS_02530 gene rpsM 4479 4120 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879984.1 protein_id gnl|my_center|LOCUS_02530 5512 4709 gene locus_tag LOCUS_02540 gene map 5512 4709 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_02540 6182 5532 gene locus_tag LOCUS_02550 6182 5532 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_02550 7571 6201 gene locus_tag LOCUS_02560 gene secY 7571 6201 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_02560 8122 7676 gene locus_tag LOCUS_02570 gene rplO 8122 7676 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225819.1 protein_id gnl|my_center|LOCUS_02570 >Feature sequence034 1229 120 gene locus_tag LOCUS_02580 1229 120 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942544.1 protein_id gnl|my_center|LOCUS_02580 1998 1222 gene locus_tag LOCUS_02590 1998 1222 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433117.1 protein_id gnl|my_center|LOCUS_02590 2773 1988 gene locus_tag LOCUS_02600 2773 1988 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147518.1 protein_id gnl|my_center|LOCUS_02600 4079 2775 gene locus_tag LOCUS_02610 4079 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 4977 4093 gene locus_tag LOCUS_02620 gene zupT 4977 4093 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940881.1 protein_id gnl|my_center|LOCUS_02620 5716 5003 gene locus_tag LOCUS_02630 5716 5003 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095898.1 protein_id gnl|my_center|LOCUS_02630 6555 5713 gene locus_tag LOCUS_02640 gene dapF 6555 5713 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881196.1 protein_id gnl|my_center|LOCUS_02640 6944 6633 gene locus_tag LOCUS_02650 6944 6633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 7248 6937 gene locus_tag LOCUS_02660 7248 6937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 7665 7486 gene locus_tag LOCUS_02670 7665 7486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 7895 7662 gene locus_tag LOCUS_02680 7895 7662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 >Feature sequence035 3455 2520 gene locus_tag LOCUS_02690 3455 2520 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125980453.1 protein_id gnl|my_center|LOCUS_02690 5130 3670 gene locus_tag LOCUS_02700 5130 3670 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202208.1 protein_id gnl|my_center|LOCUS_02700 5983 5123 gene locus_tag LOCUS_02710 5983 5123 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_02710 6651 5986 gene locus_tag LOCUS_02720 gene rnc 6651 5986 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938733.1 protein_id gnl|my_center|LOCUS_02720 7568 6654 gene locus_tag LOCUS_02730 7568 6654 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669950.1 protein_id gnl|my_center|LOCUS_02730 >Feature sequence036 882 508 gene locus_tag LOCUS_02740 882 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 1478 882 gene locus_tag LOCUS_02750 gene pth 1478 882 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814896.1 protein_id gnl|my_center|LOCUS_02750 1816 1523 gene locus_tag LOCUS_02760 1816 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 2802 1855 gene locus_tag LOCUS_02770 2802 1855 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325730.1 protein_id gnl|my_center|LOCUS_02770 3827 2814 gene locus_tag LOCUS_02780 3827 2814 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045756603.1 protein_id gnl|my_center|LOCUS_02780 2917 2844 gene locus_tag LOCUS_t00100 2917 2844 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4841 4137 gene locus_tag LOCUS_02790 4841 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 5070 7391 gene locus_tag LOCUS_02800 5070 7391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 >Feature sequence037 5191 2768 gene locus_tag LOCUS_02810 5191 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 6568 5225 gene locus_tag LOCUS_02820 6568 5225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 >Feature sequence038 668 1774 gene locus_tag LOCUS_02830 668 1774 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208294.1 protein_id gnl|my_center|LOCUS_02830 1820 2689 gene locus_tag LOCUS_02840 1820 2689 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_02840 2682 3002 gene locus_tag LOCUS_02850 2682 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 2999 5344 gene locus_tag LOCUS_02860 2999 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 5363 6301 gene locus_tag LOCUS_02870 gene pdxA 5363 6301 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940791.1 protein_id gnl|my_center|LOCUS_02870 6298 6843 gene locus_tag LOCUS_02880 6298 6843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 6840 7445 gene locus_tag LOCUS_02890 gene rsmD 6840 7445 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743275.1 protein_id gnl|my_center|LOCUS_02890 >Feature sequence039 <1 2371 gene locus_tag LOCUS_02900 <1 2371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405515.1:glycoside hydrolase family 18 protein 2791 4650 gene locus_tag LOCUS_02910 gene oadA 2791 4650 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870743.1 protein_id gnl|my_center|LOCUS_02910 4882 6906 gene locus_tag LOCUS_02920 4882 6906 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966836.1 protein_id gnl|my_center|LOCUS_02920 >Feature sequence040 323 6349 gene locus_tag LOCUS_02930 323 6349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 <7585 6952 gene locus_tag LOCUS_02940 <7585 6952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791960.1:glycoside hydrolase family 95 protein >Feature sequence041 683 976 gene locus_tag LOCUS_02950 683 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 973 3624 gene locus_tag LOCUS_02960 973 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 4129 3752 gene locus_tag LOCUS_02970 4129 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 4299 5543 gene locus_tag LOCUS_02980 gene tolB 4299 5543 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038134.1 protein_id gnl|my_center|LOCUS_02980 5572 6132 gene locus_tag LOCUS_02990 gene pal 5572 6132 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932322.1 protein_id gnl|my_center|LOCUS_02990 6239 6742 gene locus_tag LOCUS_03000 6239 6742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 >Feature sequence042 1945 1277 gene locus_tag LOCUS_03010 gene aat 1945 1277 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 protein_id gnl|my_center|LOCUS_03010 3033 2095 gene locus_tag LOCUS_03020 gene ahbD 3033 2095 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938155.1 protein_id gnl|my_center|LOCUS_03020 3704 3030 gene locus_tag LOCUS_03030 3704 3030 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877395.1 protein_id gnl|my_center|LOCUS_03030 4614 3682 gene locus_tag LOCUS_03040 4614 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 5426 4692 gene locus_tag LOCUS_03050 5426 4692 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_03050 5838 5434 gene locus_tag LOCUS_03060 5838 5434 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_03060 <7453 5858 gene locus_tag LOCUS_03070 <7453 5858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384550.1:type I DNA topoisomerase >Feature sequence043 487 1062 gene locus_tag LOCUS_03080 487 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 1052 1444 gene locus_tag LOCUS_03090 1052 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 1465 2616 gene locus_tag LOCUS_03100 1465 2616 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053675.1 protein_id gnl|my_center|LOCUS_03100 2675 3469 gene locus_tag LOCUS_03110 2675 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 3487 4344 gene locus_tag LOCUS_03120 3487 4344 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228638.1 protein_id gnl|my_center|LOCUS_03120 4360 5403 gene locus_tag LOCUS_03130 gene serC 4360 5403 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256881.1 protein_id gnl|my_center|LOCUS_03130 5417 5665 gene locus_tag LOCUS_03140 5417 5665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 6584 5760 gene locus_tag LOCUS_03150 6584 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 >Feature sequence044 68 144 gene locus_tag LOCUS_t00110 68 144 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 356 1366 gene locus_tag LOCUS_03160 356 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 1382 2176 gene locus_tag LOCUS_03170 1382 2176 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_03170 2176 2934 gene locus_tag LOCUS_03180 2176 2934 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105300.1 protein_id gnl|my_center|LOCUS_03180 2943 3776 gene locus_tag LOCUS_03190 2943 3776 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179240768.1 protein_id gnl|my_center|LOCUS_03190 3786 4055 gene locus_tag LOCUS_03200 3786 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 4163 5986 gene locus_tag LOCUS_03210 4163 5986 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667902.1 protein_id gnl|my_center|LOCUS_03210 >Feature sequence045 2168 942 gene locus_tag LOCUS_03220 2168 942 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993669.1 protein_id gnl|my_center|LOCUS_03220 2952 2224 gene locus_tag LOCUS_03230 gene hisA 2952 2224 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393528.1 protein_id gnl|my_center|LOCUS_03230 3560 2976 gene locus_tag LOCUS_03240 gene hisB 3560 2976 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083477.1 protein_id gnl|my_center|LOCUS_03240 4618 3575 gene locus_tag LOCUS_03250 gene hisC 4618 3575 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063930.1 protein_id gnl|my_center|LOCUS_03250 7271 4659 gene locus_tag LOCUS_03260 7271 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 >Feature sequence046 <1 793 gene locus_tag LOCUS_03270 <1 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038794.1:peptide chain release factor 1 793 1566 gene locus_tag LOCUS_03280 793 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 1634 2638 gene locus_tag LOCUS_03290 gene argF 1634 2638 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869677.1 protein_id gnl|my_center|LOCUS_03290 2669 3760 gene locus_tag LOCUS_03300 2669 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 3769 4731 gene locus_tag LOCUS_03310 gene rnhC 3769 4731 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883701.1 protein_id gnl|my_center|LOCUS_03310 4770 6062 gene locus_tag LOCUS_03320 gene aroA 4770 6062 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141040.1 protein_id gnl|my_center|LOCUS_03320 >Feature sequence047 728 207 gene locus_tag LOCUS_03330 728 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 859 1044 gene locus_tag LOCUS_03340 859 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 1714 2019 gene locus_tag LOCUS_03350 1714 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 2045 2296 gene locus_tag LOCUS_03360 2045 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 2311 2796 gene locus_tag LOCUS_03370 gene smpB 2311 2796 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391819.1 protein_id gnl|my_center|LOCUS_03370 2823 3029 gene locus_tag LOCUS_03380 2823 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 3225 5840 gene locus_tag LOCUS_03390 3225 5840 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391709.1 protein_id gnl|my_center|LOCUS_03390 6003 6779 gene locus_tag LOCUS_03400 gene soj 6003 6779 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_03400 >Feature sequence048 351 1121 gene locus_tag LOCUS_03410 351 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 1118 3358 gene locus_tag LOCUS_03420 1118 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 3423 4322 gene locus_tag LOCUS_03430 3423 4322 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015868484.1 protein_id gnl|my_center|LOCUS_03430 4379 6004 gene locus_tag LOCUS_03440 4379 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 6113 6188 gene locus_tag LOCUS_t00120 6113 6188 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6197 6272 gene locus_tag LOCUS_t00130 6197 6272 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 6312 6387 gene locus_tag LOCUS_t00140 6312 6387 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6400 6475 gene locus_tag LOCUS_t00150 6400 6475 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence049 1729 812 gene locus_tag LOCUS_03450 1729 812 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184147291.1 protein_id gnl|my_center|LOCUS_03450 2116 2041 gene locus_tag LOCUS_t00160 2116 2041 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2512 2159 gene locus_tag LOCUS_tm00010 2512 2159 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 3955 2714 gene locus_tag LOCUS_03460 3955 2714 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212817996.1 protein_id gnl|my_center|LOCUS_03460 6999 4336 gene locus_tag LOCUS_03470 6999 4336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 >Feature sequence050 470 2152 gene locus_tag LOCUS_03480 470 2152 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943604.1 protein_id gnl|my_center|LOCUS_03480 2162 3019 gene locus_tag LOCUS_03490 2162 3019 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405853.1 protein_id gnl|my_center|LOCUS_03490 3036 5267 gene locus_tag LOCUS_03500 gene priA 3036 5267 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_03500 5693 6169 gene locus_tag LOCUS_03510 5693 6169 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868903.1 protein_id gnl|my_center|LOCUS_03510 >Feature sequence051 <1 982 gene locus_tag LOCUS_03520 <1 982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946906.1:Dot/Icm type IV secretion system effector LidL 1595 2413 gene locus_tag LOCUS_03530 1595 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 2448 4124 gene locus_tag LOCUS_03540 2448 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 4131 5252 gene locus_tag LOCUS_03550 4131 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 5270 6394 gene locus_tag LOCUS_03560 5270 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 >Feature sequence052 1376 2548 gene locus_tag LOCUS_03570 1376 2548 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058190.1 protein_id gnl|my_center|LOCUS_03570 2563 4734 gene locus_tag LOCUS_03580 2563 4734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 4734 5603 gene locus_tag LOCUS_03590 gene speB 4734 5603 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937728.1 protein_id gnl|my_center|LOCUS_03590 5639 6640 gene locus_tag LOCUS_03600 5639 6640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 >Feature sequence053 2453 1428 gene locus_tag LOCUS_03610 gene aroF 2453 1428 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545770.1 protein_id gnl|my_center|LOCUS_03610 4336 3386 gene locus_tag LOCUS_03620 gene rhuM 4336 3386 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957909.1 protein_id gnl|my_center|LOCUS_03620 5130 4657 gene locus_tag LOCUS_03630 5130 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 5617 5174 gene locus_tag LOCUS_03640 5617 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 6009 5746 gene locus_tag LOCUS_03650 gene rpsT 6009 5746 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113577.1 protein_id gnl|my_center|LOCUS_03650 <6914 6385 gene locus_tag LOCUS_03660 <6914 6385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938513.1:MATE family efflux transporter >Feature sequence054 506 1657 gene locus_tag LOCUS_03670 506 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 1660 2856 gene locus_tag LOCUS_03680 gene ahbC 1660 2856 CDS product 12,18-didecarboxysiroheme deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938157.1 protein_id gnl|my_center|LOCUS_03680 2879 3436 gene locus_tag LOCUS_03690 2879 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 3436 5631 gene locus_tag LOCUS_03700 3436 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 >Feature sequence055 141 944 gene locus_tag LOCUS_03710 gene panB 141 944 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062269.1 protein_id gnl|my_center|LOCUS_03710 2614 1436 gene locus_tag LOCUS_03720 2614 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 4643 2775 gene locus_tag LOCUS_03730 4643 2775 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401212.1 protein_id gnl|my_center|LOCUS_03730 5997 4834 gene locus_tag LOCUS_03740 5997 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 >Feature sequence056 181 2880 gene locus_tag LOCUS_03750 181 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 2877 3338 gene locus_tag LOCUS_03760 2877 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 3417 6056 gene locus_tag LOCUS_03770 3417 6056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 >Feature sequence057 >Feature sequence058 367 1383 gene locus_tag LOCUS_03780 gene pheS 367 1383 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_03780 1480 1992 gene locus_tag LOCUS_03790 1480 1992 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392726.1 protein_id gnl|my_center|LOCUS_03790 1992 3002 gene locus_tag LOCUS_03800 gene mutY 1992 3002 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404847.1 protein_id gnl|my_center|LOCUS_03800 3173 4057 gene locus_tag LOCUS_03810 3173 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 4217 4405 gene locus_tag LOCUS_03820 4217 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 4405 5070 gene locus_tag LOCUS_03830 4405 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 5067 5429 gene locus_tag LOCUS_03840 5067 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 6606 5497 gene locus_tag LOCUS_03850 6606 5497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 >Feature sequence059 805 1257 gene locus_tag LOCUS_03860 805 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 1328 2461 gene locus_tag LOCUS_03870 gene lpxB 1328 2461 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113865.1 protein_id gnl|my_center|LOCUS_03870 4997 2892 gene locus_tag LOCUS_03880 gene fusA 4997 2892 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_03880 5521 6261 gene locus_tag LOCUS_03890 5521 6261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 >Feature sequence060 751 320 gene locus_tag LOCUS_03900 751 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 1302 763 gene locus_tag LOCUS_03910 1302 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262447.1 protein_id gnl|my_center|LOCUS_03910 2832 1504 gene locus_tag LOCUS_03920 2832 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 4873 3797 gene locus_tag LOCUS_03930 4873 3797 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202293.1 protein_id gnl|my_center|LOCUS_03930 >Feature sequence061 511 1461 gene locus_tag LOCUS_03940 511 1461 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783522.1 protein_id gnl|my_center|LOCUS_03940 1488 3026 gene locus_tag LOCUS_03950 1488 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 3032 3595 gene locus_tag LOCUS_03960 3032 3595 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067038.1 protein_id gnl|my_center|LOCUS_03960 3603 4382 gene locus_tag LOCUS_03970 3603 4382 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063245668.1 protein_id gnl|my_center|LOCUS_03970 4399 5406 gene locus_tag LOCUS_03980 4399 5406 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403834.1 protein_id gnl|my_center|LOCUS_03980 <6285 5487 gene locus_tag LOCUS_03990 <6285 5487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004539151.1:methyltransferase >Feature sequence062 496 681 gene locus_tag LOCUS_04000 496 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 771 1319 gene locus_tag LOCUS_04010 771 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 1420 2364 gene locus_tag LOCUS_04020 1420 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 2601 4160 gene locus_tag LOCUS_04030 2601 4160 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814537.1 protein_id gnl|my_center|LOCUS_04030 4173 5006 gene locus_tag LOCUS_04040 4173 5006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 5003 5701 gene locus_tag LOCUS_04050 5003 5701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 >Feature sequence063 411 253 gene locus_tag LOCUS_04060 411 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 684 1202 gene locus_tag LOCUS_04070 684 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 1223 2479 gene locus_tag LOCUS_04080 1223 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 2500 3378 gene locus_tag LOCUS_04090 2500 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 3378 4811 gene locus_tag LOCUS_04100 3378 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817955.1 protein_id gnl|my_center|LOCUS_04100 4858 5280 gene locus_tag LOCUS_04110 4858 5280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 5351 5938 gene locus_tag LOCUS_04120 5351 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 >Feature sequence064 683 411 gene locus_tag LOCUS_04130 683 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 1404 706 gene locus_tag LOCUS_04140 1404 706 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079728.1 protein_id gnl|my_center|LOCUS_04140 2602 1547 gene locus_tag LOCUS_04150 gene recA 2602 1547 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030442.1 protein_id gnl|my_center|LOCUS_04150 3710 2652 gene locus_tag LOCUS_04160 gene tsaD 3710 2652 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056353.1 protein_id gnl|my_center|LOCUS_04160 >Feature sequence065 746 21 gene locus_tag LOCUS_04170 746 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 1525 755 gene locus_tag LOCUS_04180 1525 755 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877800.1 protein_id gnl|my_center|LOCUS_04180 2514 1681 gene locus_tag LOCUS_04190 gene rfbN 2514 1681 CDS product O antigen biosynthesis rhamnosyltransferase RfbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705149.1 protein_id gnl|my_center|LOCUS_04190 3730 2525 gene locus_tag LOCUS_04200 3730 2525 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056064.1 protein_id gnl|my_center|LOCUS_04200 4914 3727 gene locus_tag LOCUS_04210 4914 3727 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938142.1 protein_id gnl|my_center|LOCUS_04210 6157 4928 gene locus_tag LOCUS_04220 6157 4928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 >Feature sequence066 890 486 gene locus_tag LOCUS_04230 890 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 1513 890 gene locus_tag LOCUS_04240 1513 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 4600 1532 gene locus_tag LOCUS_04250 4600 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 5544 4747 gene locus_tag LOCUS_04260 5544 4747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 >Feature sequence067 941 3619 gene locus_tag LOCUS_04270 941 3619 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460907.1 protein_id gnl|my_center|LOCUS_04270 3767 4318 gene locus_tag LOCUS_04280 3767 4318 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987052.1 protein_id gnl|my_center|LOCUS_04280 4337 5812 gene locus_tag LOCUS_04290 gene rpoN 4337 5812 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435015.1 protein_id gnl|my_center|LOCUS_04290 >Feature sequence068 <1 1059 gene locus_tag LOCUS_04300 <1 1059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228428.1:UDP-N-acetylmuramate--L-alanine ligase 1123 2187 gene locus_tag LOCUS_04310 1123 2187 CDS product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_04310 2221 3012 gene locus_tag LOCUS_04320 2221 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 3026 3964 gene locus_tag LOCUS_04330 3026 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 4305 4826 gene locus_tag LOCUS_04340 4305 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 5005 5304 gene locus_tag LOCUS_04350 5005 5304 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422948.1 protein_id gnl|my_center|LOCUS_04350 >Feature sequence069 37 2127 gene locus_tag LOCUS_04360 37 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 2154 4286 gene locus_tag LOCUS_04370 2154 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 4283 4888 gene locus_tag LOCUS_04380 gene vioB 4283 4888 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose acetyltransferase VioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382700.1 protein_id gnl|my_center|LOCUS_04380 4899 5597 gene locus_tag LOCUS_04390 4899 5597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 5607 5822 gene locus_tag LOCUS_04400 5607 5822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 >Feature sequence070 569 775 gene locus_tag LOCUS_04410 569 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 2169 865 gene locus_tag LOCUS_04420 2169 865 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765682.1 protein_id gnl|my_center|LOCUS_04420 4725 2191 gene locus_tag LOCUS_04430 4725 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 <5978 4786 gene locus_tag LOCUS_04440 <5978 4786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001029133.1:threonine synthase >Feature sequence071 29 295 gene locus_tag LOCUS_04450 29 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 992 273 gene locus_tag LOCUS_04460 992 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 1890 1039 gene locus_tag LOCUS_04470 gene hemB 1890 1039 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_04470 2184 3656 gene locus_tag LOCUS_04480 2184 3656 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198738.1 protein_id gnl|my_center|LOCUS_04480 4477 3713 gene locus_tag LOCUS_04490 4477 3713 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541081.1 protein_id gnl|my_center|LOCUS_04490 5013 4459 gene locus_tag LOCUS_04500 5013 4459 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_04500 5630 5010 gene locus_tag LOCUS_04510 5630 5010 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948278.1 protein_id gnl|my_center|LOCUS_04510 >Feature sequence072 <1 2549 gene locus_tag LOCUS_04520 <1 2549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948403.1:DEAD/DEAH box helicase family protein 4697 3168 gene locus_tag LOCUS_04530 4697 3168 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_04530 <5949 4699 gene locus_tag LOCUS_04540 <5949 4699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005822184.1:family 20 glycosylhydrolase >Feature sequence073 1609 845 gene locus_tag LOCUS_04550 gene truA 1609 845 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_04550 3901 2162 gene locus_tag LOCUS_04560 gene rpsA 3901 2162 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872374.1 protein_id gnl|my_center|LOCUS_04560 4518 5225 gene locus_tag LOCUS_04570 4518 5225 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582696.1 protein_id gnl|my_center|LOCUS_04570 5218 5583 gene locus_tag LOCUS_04580 5218 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 >Feature sequence074 232 402 gene locus_tag LOCUS_04590 232 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 1459 2181 gene locus_tag LOCUS_04600 1459 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 2521 2258 gene locus_tag LOCUS_04610 2521 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 2958 3785 gene locus_tag LOCUS_04620 gene kdsA 2958 3785 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023041482.1 protein_id gnl|my_center|LOCUS_04620 3785 4351 gene locus_tag LOCUS_04630 3785 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 4363 4917 gene locus_tag LOCUS_04640 4363 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 4917 5660 gene locus_tag LOCUS_04650 gene lptB 4917 5660 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077984407.1 protein_id gnl|my_center|LOCUS_04650 >Feature sequence075 1012 482 gene locus_tag LOCUS_04660 1012 482 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318917.1 protein_id gnl|my_center|LOCUS_04660 2114 1038 gene locus_tag LOCUS_04670 2114 1038 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_04670 2983 2114 gene locus_tag LOCUS_04680 gene prmA 2983 2114 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941115.1 protein_id gnl|my_center|LOCUS_04680 4668 2992 gene locus_tag LOCUS_04690 gene yidC 4668 2992 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931700.1 protein_id gnl|my_center|LOCUS_04690 5304 4933 gene locus_tag LOCUS_04700 gene rnpA 5304 4933 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768230.1 protein_id gnl|my_center|LOCUS_04700 5525 5388 gene locus_tag LOCUS_04710 gene rpmH 5525 5388 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938373.1 protein_id gnl|my_center|LOCUS_04710 >Feature sequence076 297 2129 gene locus_tag LOCUS_04720 297 2129 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948279.1 protein_id gnl|my_center|LOCUS_04720 2147 2665 gene locus_tag LOCUS_04730 2147 2665 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256836.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04730 2689 3393 gene locus_tag LOCUS_04740 2689 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 3446 4300 gene locus_tag LOCUS_04750 3446 4300 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676763.1 protein_id gnl|my_center|LOCUS_04750 >Feature sequence077 529 272 gene locus_tag LOCUS_04760 529 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 1301 564 gene locus_tag LOCUS_04770 1301 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 2380 1298 gene locus_tag LOCUS_04780 2380 1298 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_04780 3470 2394 gene locus_tag LOCUS_04790 gene queA 3470 2394 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 protein_id gnl|my_center|LOCUS_04790 4290 3451 gene locus_tag LOCUS_04800 4290 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 >Feature sequence078 75 779 gene locus_tag LOCUS_04810 75 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 776 1189 gene locus_tag LOCUS_04820 776 1189 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208353.1 protein_id gnl|my_center|LOCUS_04820 1186 1791 gene locus_tag LOCUS_04830 1186 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 1788 4721 gene locus_tag LOCUS_04840 1788 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 >Feature sequence079 1153 263 gene locus_tag LOCUS_04850 1153 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 2237 1155 gene locus_tag LOCUS_04860 2237 1155 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037252469.1 protein_id gnl|my_center|LOCUS_04860 3562 2285 gene locus_tag LOCUS_04870 3562 2285 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368546.1 protein_id gnl|my_center|LOCUS_04870 4043 3612 gene locus_tag LOCUS_04880 4043 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 5548 4055 gene locus_tag LOCUS_04890 5548 4055 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_04890 >Feature sequence080 <1 777 gene locus_tag LOCUS_04900 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_216358298.1:beta-ketoacyl-[acyl-carrier-protein] synthase family protein 779 1501 gene locus_tag LOCUS_04910 779 1501 CDS product 3-ketoacyl-ACP reductase FabG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074036.1 protein_id gnl|my_center|LOCUS_04910 1501 2724 gene locus_tag LOCUS_04920 1501 2724 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261528.1 protein_id gnl|my_center|LOCUS_04920 2721 3335 gene locus_tag LOCUS_04930 2721 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 3442 4179 gene locus_tag LOCUS_04940 3442 4179 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074021.1 protein_id gnl|my_center|LOCUS_04940 4839 5084 gene locus_tag LOCUS_04950 4839 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 >Feature sequence081 2290 1334 gene locus_tag LOCUS_04960 gene fba 2290 1334 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582459.1 protein_id gnl|my_center|LOCUS_04960 3535 2513 gene locus_tag LOCUS_04970 3535 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 4003 4695 gene locus_tag LOCUS_04980 4003 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04980 4753 5097 gene locus_tag LOCUS_04990 4753 5097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04990 >Feature sequence082 2335 986 gene locus_tag LOCUS_05000 2335 986 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_05000 4046 3048 gene locus_tag LOCUS_05010 4046 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 4213 5295 gene locus_tag LOCUS_05020 4213 5295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 >Feature sequence083 665 1447 gene locus_tag LOCUS_05030 gene lpxA 665 1447 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942904.1 protein_id gnl|my_center|LOCUS_05030 2525 2938 gene locus_tag LOCUS_05040 2525 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 2949 3884 gene locus_tag LOCUS_05050 gene rsmH 2949 3884 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_05050 3888 4331 gene locus_tag LOCUS_05060 3888 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 >Feature sequence084 1286 84 gene locus_tag LOCUS_05070 1286 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 3560 1338 gene locus_tag LOCUS_05080 3560 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 4000 3557 gene locus_tag LOCUS_05090 gene folK 4000 3557 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 protein_id gnl|my_center|LOCUS_05090 4785 4015 gene locus_tag LOCUS_05100 gene dapB 4785 4015 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387915.1 protein_id gnl|my_center|LOCUS_05100 <5325 4797 gene locus_tag LOCUS_05110 <5325 4797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545135.1:4-hydroxy-tetrahydrodipicolinate synthase >Feature sequence085 1103 1187 gene locus_tag LOCUS_t00170 1103 1187 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1220 1699 gene locus_tag LOCUS_05120 gene ispF 1220 1699 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459082.1 protein_id gnl|my_center|LOCUS_05120 1810 4698 gene locus_tag LOCUS_05130 1810 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 >Feature sequence086 1301 576 gene locus_tag LOCUS_05140 1301 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 2532 1327 gene locus_tag LOCUS_05150 gene ilvA 2532 1327 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890721.1 protein_id gnl|my_center|LOCUS_05150 3877 2582 gene locus_tag LOCUS_05160 3877 2582 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_05160 4326 3877 gene locus_tag LOCUS_05170 4326 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 5048 4335 gene locus_tag LOCUS_05180 gene pyrF 5048 4335 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_05180 >Feature sequence087 <1 1983 gene locus_tag LOCUS_05190 <1 1983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389849.1:DNA translocase FtsK 2036 3268 gene locus_tag LOCUS_05200 2036 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 3282 3863 gene locus_tag LOCUS_05210 3282 3863 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640290.1 protein_id gnl|my_center|LOCUS_05210 3879 4238 gene locus_tag LOCUS_05220 gene rsfS 3879 4238 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633572.1 protein_id gnl|my_center|LOCUS_05220 >Feature sequence088 790 1446 gene locus_tag LOCUS_05230 gene sctR 790 1446 CDS product type III secretion system export apparatus subunit SctR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176700.1 protein_id gnl|my_center|LOCUS_05230 1446 1715 gene locus_tag LOCUS_05240 gene sctS 1446 1715 CDS product type III secretion system export apparatus subunit SctS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176681.1 protein_id gnl|my_center|LOCUS_05240 1716 2501 gene locus_tag LOCUS_05250 gene vscT 1716 2501 CDS product SctT family type III secretion system export apparatus subunit VscT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464642.1 protein_id gnl|my_center|LOCUS_05250 2501 3592 gene locus_tag LOCUS_05260 gene yscU 2501 3592 CDS product type III secretion system export apparatus switch protein YscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176440.1 protein_id gnl|my_center|LOCUS_05260 4158 3637 gene locus_tag LOCUS_05270 4158 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 4444 4713 gene locus_tag LOCUS_05280 4444 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 4731 5075 gene locus_tag LOCUS_05290 4731 5075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 >Feature sequence089 24 1841 gene locus_tag LOCUS_05300 24 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 2419 3342 gene locus_tag LOCUS_05310 2419 3342 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_05310 <5170 3623 gene locus_tag LOCUS_05320 <5170 3623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006313182.1:DNA mismatch repair endonuclease MutL >Feature sequence090 72 1274 gene locus_tag LOCUS_05330 gene ftsA 72 1274 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073897.1 protein_id gnl|my_center|LOCUS_05330 1281 2438 gene locus_tag LOCUS_05340 gene ftsZ 1281 2438 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017491.1 protein_id gnl|my_center|LOCUS_05340 2435 2698 gene locus_tag LOCUS_05350 2435 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 2700 3143 gene locus_tag LOCUS_05360 gene dtd 2700 3143 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108726.1 protein_id gnl|my_center|LOCUS_05360 3151 3798 gene locus_tag LOCUS_05370 3151 3798 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014470.1 protein_id gnl|my_center|LOCUS_05370 >Feature sequence091 1826 87 gene locus_tag LOCUS_05380 1826 87 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329982.1 protein_id gnl|my_center|LOCUS_05380 3611 1890 gene locus_tag LOCUS_05390 3611 1890 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329982.1 protein_id gnl|my_center|LOCUS_05390 4198 3659 gene locus_tag LOCUS_05400 4198 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 4581 4258 gene locus_tag LOCUS_05410 gene trxA 4581 4258 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018928.1 protein_id gnl|my_center|LOCUS_05410 >Feature sequence092 <1 2416 gene locus_tag LOCUS_05420 <1 2416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142029.1:efflux RND transporter permease subunit 2413 3675 gene locus_tag LOCUS_05430 2413 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 3967 3644 gene locus_tag LOCUS_05440 3967 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 3849 4151 gene locus_tag LOCUS_05450 3849 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 4118 4966 gene locus_tag LOCUS_05460 4118 4966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 >Feature sequence093 378 983 gene locus_tag LOCUS_05470 378 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 2240 990 gene locus_tag LOCUS_05480 2240 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 3027 2248 gene locus_tag LOCUS_05490 3027 2248 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325468.1 protein_id gnl|my_center|LOCUS_05490 3896 3024 gene locus_tag LOCUS_05500 3896 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 <5035 3925 gene locus_tag LOCUS_05510 <5035 3925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002669886.1:UDP-N-acetylglucosamine 1-carboxyvinyltransferase >Feature sequence094 679 1518 gene locus_tag LOCUS_05520 679 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 1515 2882 gene locus_tag LOCUS_05530 1515 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 2899 4140 gene locus_tag LOCUS_05540 2899 4140 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933548.1 protein_id gnl|my_center|LOCUS_05540 <5021 4143 gene locus_tag LOCUS_05550 <5021 4143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005816469.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB >Feature sequence095 1625 1200 gene locus_tag LOCUS_05560 1625 1200 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_05560 3017 1644 gene locus_tag LOCUS_05570 3017 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05570 3745 3038 gene locus_tag LOCUS_05580 3745 3038 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141998.1 protein_id gnl|my_center|LOCUS_05580 <5006 3768 gene locus_tag LOCUS_05590 <5006 3768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005794794.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence096 226 813 gene locus_tag LOCUS_05600 226 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 1411 2832 gene locus_tag LOCUS_05610 gene xseA 1411 2832 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113813.1 protein_id gnl|my_center|LOCUS_05610 4339 2807 gene locus_tag LOCUS_05620 4339 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 <4967 4413 gene locus_tag LOCUS_05630 <4967 4413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393617.1:dihydroorotate dehydrogenase >Feature sequence097 <1 513 gene locus_tag LOCUS_05640 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786594.1:DNA/RNA non-specific endonuclease 513 1025 gene locus_tag LOCUS_05650 gene ruvC 513 1025 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_05650 1081 2022 gene locus_tag LOCUS_05660 1081 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 3915 2155 gene locus_tag LOCUS_05670 gene sulP 3915 2155 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926914.1 protein_id gnl|my_center|LOCUS_05670 4543 4618 gene locus_tag LOCUS_t00180 4543 4618 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence098 >Feature sequence099 331 209 gene locus_tag LOCUS_05680 331 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 1221 331 gene locus_tag LOCUS_05690 gene nadC 1221 331 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920753.1 protein_id gnl|my_center|LOCUS_05690 2343 1261 gene locus_tag LOCUS_05700 2343 1261 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942836.1 protein_id gnl|my_center|LOCUS_05700 3170 2484 gene locus_tag LOCUS_05710 3170 2484 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087625.1 protein_id gnl|my_center|LOCUS_05710 4468 3170 gene locus_tag LOCUS_05720 4468 3170 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783481.1 protein_id gnl|my_center|LOCUS_05720 >Feature sequence100 1073 75 gene locus_tag LOCUS_05730 gene gap 1073 75 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038299.1 protein_id gnl|my_center|LOCUS_05730 1331 1861 gene locus_tag LOCUS_05740 1331 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 1920 2990 gene locus_tag LOCUS_05750 1920 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 4495 3401 gene locus_tag LOCUS_05760 4495 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 >Feature sequence101 592 77 gene locus_tag LOCUS_05770 592 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 1614 598 gene locus_tag LOCUS_05780 1614 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 3778 1682 gene locus_tag LOCUS_05790 3778 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 4898 4017 gene locus_tag LOCUS_05800 gene lsrF 4898 4017 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774169.1 protein_id gnl|my_center|LOCUS_05800 >Feature sequence102 <1 898 gene locus_tag LOCUS_05810 <1 898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011791443.1:phosphoribosylaminoimidazolecarboxamide formyltransferase 918 1517 gene locus_tag LOCUS_05820 918 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 1569 2249 gene locus_tag LOCUS_05830 1569 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 2354 2815 gene locus_tag LOCUS_05840 2354 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 3151 3285 gene locus_tag LOCUS_05850 3151 3285 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875795.1 protein_id gnl|my_center|LOCUS_05850 4419 3370 gene locus_tag LOCUS_05860 4419 3370 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943878.1 protein_id gnl|my_center|LOCUS_05860 4598 4416 gene locus_tag LOCUS_05870 4598 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 >Feature sequence103 1475 1119 gene locus_tag LOCUS_05880 gene folB 1475 1119 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809748.1 protein_id gnl|my_center|LOCUS_05880 2547 1468 gene locus_tag LOCUS_05890 2547 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 3379 2540 gene locus_tag LOCUS_05900 3379 2540 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_05900 3912 3436 gene locus_tag LOCUS_05910 gene ilvN 3912 3436 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545180.1 protein_id gnl|my_center|LOCUS_05910 <4880 3925 gene locus_tag LOCUS_05920 <4880 3925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938671.1:biosynthetic-type acetolactate synthase large subunit >Feature sequence104 483 1790 gene locus_tag LOCUS_05930 483 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 1861 2460 gene locus_tag LOCUS_05940 gene ruvA 1861 2460 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245442.1 protein_id gnl|my_center|LOCUS_05940 2569 4332 gene locus_tag LOCUS_05950 2569 4332 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337137.1 protein_id gnl|my_center|LOCUS_05950 >Feature sequence105 47 409 gene locus_tag LOCUS_05960 gene rplT 47 409 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722591.1 protein_id gnl|my_center|LOCUS_05960 547 1899 gene locus_tag LOCUS_05970 547 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 1931 2812 gene locus_tag LOCUS_05980 1931 2812 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121256.1 protein_id gnl|my_center|LOCUS_05980 <4830 2981 gene locus_tag LOCUS_05990 <4830 2981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112868.1:YfaP family protein >Feature sequence106 >Feature sequence107 1336 305 gene locus_tag LOCUS_06000 gene purM 1336 305 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942402.1 protein_id gnl|my_center|LOCUS_06000 2315 1380 gene locus_tag LOCUS_06010 2315 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 3175 2312 gene locus_tag LOCUS_06020 3175 2312 CDS product metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942637.1 protein_id gnl|my_center|LOCUS_06020 4076 3423 gene locus_tag LOCUS_06030 4076 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06030 >Feature sequence108 265 1665 gene locus_tag LOCUS_06040 gene dnaB 265 1665 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941663.1 protein_id gnl|my_center|LOCUS_06040 1693 4083 gene locus_tag LOCUS_06050 gene bamA 1693 4083 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546857.1 protein_id gnl|my_center|LOCUS_06050 >Feature sequence109 1203 2519 gene locus_tag LOCUS_06060 1203 2519 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_06060 2570 3931 gene locus_tag LOCUS_06070 2570 3931 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931234.1 protein_id gnl|my_center|LOCUS_06070 >Feature sequence110 97 1044 gene locus_tag LOCUS_06080 97 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 1048 1794 gene locus_tag LOCUS_06090 1048 1794 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081998.1 protein_id gnl|my_center|LOCUS_06090 1794 3143 gene locus_tag LOCUS_06100 1794 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 3180 3857 gene locus_tag LOCUS_06110 3180 3857 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272485.1 protein_id gnl|my_center|LOCUS_06110 >Feature sequence111 1506 2543 gene locus_tag LOCUS_06120 gene lpxD 1506 2543 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055887.1 protein_id gnl|my_center|LOCUS_06120 2681 3841 gene locus_tag LOCUS_06130 gene aroC 2681 3841 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933099.1 protein_id gnl|my_center|LOCUS_06130 >Feature sequence112 925 149 gene locus_tag LOCUS_06140 925 149 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454839.1 protein_id gnl|my_center|LOCUS_06140 2029 929 gene locus_tag LOCUS_06150 2029 929 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454927.1 protein_id gnl|my_center|LOCUS_06150 3162 2041 gene locus_tag LOCUS_06160 3162 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 <4593 3426 gene locus_tag LOCUS_06170 <4593 3426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000672448.1:phenylalanine--tRNA ligase subunit beta >Feature sequence113 1188 325 gene locus_tag LOCUS_06180 1188 325 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229920.1 protein_id gnl|my_center|LOCUS_06180 2773 1277 gene locus_tag LOCUS_06190 gene guaB 2773 1277 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192833.1 protein_id gnl|my_center|LOCUS_06190 3031 3603 gene locus_tag LOCUS_06200 3031 3603 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053883.1 protein_id gnl|my_center|LOCUS_06200 >Feature sequence114 924 487 gene locus_tag LOCUS_06210 924 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329952.1 protein_id gnl|my_center|LOCUS_06210 1699 929 gene locus_tag LOCUS_06220 gene hisF 1699 929 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937595.1 protein_id gnl|my_center|LOCUS_06220 2313 1690 gene locus_tag LOCUS_06230 gene hisH 2313 1690 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318304.1 protein_id gnl|my_center|LOCUS_06230 3068 2376 gene locus_tag LOCUS_06240 3068 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 4497 3160 gene locus_tag LOCUS_06250 4497 3160 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_06250 >Feature sequence115 3350 60 gene locus_tag LOCUS_06260 3350 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06260 <4506 3347 gene locus_tag LOCUS_06270 <4506 3347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071759.1:type I polyketide synthase >Feature sequence116 1616 1059 gene locus_tag LOCUS_06280 1616 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 4016 1800 gene locus_tag LOCUS_06290 4016 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 >Feature sequence117 1675 1433 gene locus_tag LOCUS_06300 1675 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 2112 1909 gene locus_tag LOCUS_06310 2112 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 2539 2225 gene locus_tag LOCUS_06320 2539 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 3481 2651 gene locus_tag LOCUS_06330 3481 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 >Feature sequence118 100 570 gene locus_tag LOCUS_06340 100 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 601 1638 gene locus_tag LOCUS_06350 601 1638 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121996.1 protein_id gnl|my_center|LOCUS_06350 1638 3383 gene locus_tag LOCUS_06360 1638 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 3424 4356 gene locus_tag LOCUS_06370 3424 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 >Feature sequence119 2637 856 gene locus_tag LOCUS_06380 2637 856 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932515.1 protein_id gnl|my_center|LOCUS_06380 2894 2682 gene locus_tag LOCUS_06390 2894 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 <4393 3060 gene locus_tag LOCUS_06400 <4393 3060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869758.1:excinuclease ABC subunit UvrC >Feature sequence120 854 303 gene locus_tag LOCUS_06410 854 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 2025 844 gene locus_tag LOCUS_06420 2025 844 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037914.1 protein_id gnl|my_center|LOCUS_06420 2794 2027 gene locus_tag LOCUS_06430 2794 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 3900 2791 gene locus_tag LOCUS_06440 3900 2791 CDS product ATP--guanido phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870145.1 protein_id gnl|my_center|LOCUS_06440 >Feature sequence121 2351 2121 gene locus_tag LOCUS_06450 2351 2121 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390222.1 protein_id gnl|my_center|LOCUS_06450 3508 2711 gene locus_tag LOCUS_06460 3508 2711 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943898.1 protein_id gnl|my_center|LOCUS_06460 <4333 3542 gene locus_tag LOCUS_06470 <4333 3542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088646.1:bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase >Feature sequence122 1504 374 gene locus_tag LOCUS_06480 gene prfB 1504 374 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096948712.1 protein_id gnl|my_center|LOCUS_06480 2212 1721 gene locus_tag LOCUS_06490 2212 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06490 2665 2270 gene locus_tag LOCUS_06500 2665 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06500 <4324 2671 gene locus_tag LOCUS_06510 <4324 2671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940909.1:Tex family protein >Feature sequence123 499 2067 gene locus_tag LOCUS_06520 gene leuA 499 2067 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930807.1 protein_id gnl|my_center|LOCUS_06520 2176 2754 gene locus_tag LOCUS_06530 2176 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 >Feature sequence124 <1 561 gene locus_tag LOCUS_06540 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011976196.1:sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC 770 3247 gene locus_tag LOCUS_06550 770 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 >Feature sequence125 1587 2285 gene locus_tag LOCUS_06560 1587 2285 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941865.1 protein_id gnl|my_center|LOCUS_06560 3592 2420 gene locus_tag LOCUS_06570 3592 2420 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948736.1 protein_id gnl|my_center|LOCUS_06570 >Feature sequence126 627 175 gene locus_tag LOCUS_06580 627 175 CDS product ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669353.1 protein_id gnl|my_center|LOCUS_06580 2466 643 gene locus_tag LOCUS_06590 2466 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 3077 2463 gene locus_tag LOCUS_06600 3077 2463 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679385.1 protein_id gnl|my_center|LOCUS_06600 <4227 3109 gene locus_tag LOCUS_06610 <4227 3109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002556695.1:V-type ATP synthase subunit B >Feature sequence127 1500 238 gene locus_tag LOCUS_06620 1500 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 3511 1598 gene locus_tag LOCUS_06630 3511 1598 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108029.1 protein_id gnl|my_center|LOCUS_06630 >Feature sequence128 <1 753 gene locus_tag LOCUS_06640 <1 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946687.1:patatin-like phospholipase RssA 750 1865 gene locus_tag LOCUS_06650 750 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 1905 3077 gene locus_tag LOCUS_06660 gene glf 1905 3077 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015466.1 protein_id gnl|my_center|LOCUS_06660 3123 4130 gene locus_tag LOCUS_06670 3123 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 >Feature sequence129 345 1067 gene locus_tag LOCUS_06680 345 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 1094 2164 gene locus_tag LOCUS_06690 1094 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 2195 2914 gene locus_tag LOCUS_06700 gene pdxJ 2195 2914 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772027.1 protein_id gnl|my_center|LOCUS_06700 >Feature sequence130 3699 1423 gene locus_tag LOCUS_06710 3699 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 >Feature sequence131 586 194 gene locus_tag LOCUS_06720 gene rpsI 586 194 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000035940.1 protein_id gnl|my_center|LOCUS_06720 1046 612 gene locus_tag LOCUS_06730 gene rplM 1046 612 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295975.1 protein_id gnl|my_center|LOCUS_06730 <4074 1350 gene locus_tag LOCUS_06740 <4074 1350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922191.1:sialidase family protein >Feature sequence132 161 1630 gene locus_tag LOCUS_06750 161 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 2425 1799 gene locus_tag LOCUS_06760 2425 1799 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_06760 3757 2468 gene locus_tag LOCUS_06770 3757 2468 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680036.1 protein_id gnl|my_center|LOCUS_06770 >Feature sequence133 260 1426 gene locus_tag LOCUS_06780 gene nspC 260 1426 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937726.1 protein_id gnl|my_center|LOCUS_06780 >Feature sequence134 1044 286 gene locus_tag LOCUS_06790 1044 286 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706625.1 protein_id gnl|my_center|LOCUS_06790 2304 1111 gene locus_tag LOCUS_06800 2304 1111 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919503.1 protein_id gnl|my_center|LOCUS_06800 <3993 2533 gene locus_tag LOCUS_06810 <3993 2533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940774.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase >Feature sequence135 1600 290 gene locus_tag LOCUS_06820 gene hisD 1600 290 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970966.1 protein_id gnl|my_center|LOCUS_06820 2377 1658 gene locus_tag LOCUS_06830 2377 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 3093 2377 gene locus_tag LOCUS_06840 3093 2377 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301793.1 protein_id gnl|my_center|LOCUS_06840 >Feature sequence136 1066 1221 gene locus_tag LOCUS_06850 1066 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 1372 3303 gene locus_tag LOCUS_06860 1372 3303 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080037.1 protein_id gnl|my_center|LOCUS_06860 3362 3886 gene locus_tag LOCUS_06870 3362 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 >Feature sequence137 1937 327 gene locus_tag LOCUS_06880 gene rtcR 1937 327 CDS product RNA repair transcriptional activator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122266.1 protein_id gnl|my_center|LOCUS_06880 2216 3313 gene locus_tag LOCUS_06890 gene rtcA 2216 3313 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922229.1 protein_id gnl|my_center|LOCUS_06890 >Feature sequence138 >Feature sequence139 53 1300 gene locus_tag LOCUS_06900 53 1300 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393061.1 protein_id gnl|my_center|LOCUS_06900 1331 1708 gene locus_tag LOCUS_06910 gene gspG 1331 1708 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202879.1 protein_id gnl|my_center|LOCUS_06910 1737 3392 gene locus_tag LOCUS_06920 1737 3392 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674349.1 protein_id gnl|my_center|LOCUS_06920 >Feature sequence140 1706 2032 gene locus_tag LOCUS_06930 1706 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 2036 2290 gene locus_tag LOCUS_06940 2036 2290 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074023.1 protein_id gnl|my_center|LOCUS_06940 2315 2731 gene locus_tag LOCUS_06950 2315 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 >Feature sequence141 1923 211 gene locus_tag LOCUS_06960 gene argS 1923 211 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016438.1 protein_id gnl|my_center|LOCUS_06960 2414 2339 gene locus_tag LOCUS_t00190 2414 2339 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3355 3816 gene locus_tag LOCUS_06970 3355 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 >Feature sequence142 <1 2217 gene locus_tag LOCUS_06980 <1 2217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010882923.1:DNA topoisomerase (ATP-hydrolyzing) subunit B 2286 2786 gene locus_tag LOCUS_06990 2286 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 2834 3481 gene locus_tag LOCUS_07000 2834 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 >Feature sequence143 <1 843 gene locus_tag LOCUS_07010 <1 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007328922.1:phosphoenolpyruvate--protein phosphotransferase note possible pseudo, frameshifted 819 1178 gene locus_tag LOCUS_07020 819 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07020 1190 2668 gene locus_tag LOCUS_07030 1190 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 2665 3072 gene locus_tag LOCUS_07040 2665 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 >Feature sequence144 >Feature sequence145 2200 665 gene locus_tag LOCUS_07050 gene hcp 2200 665 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433949.1 protein_id gnl|my_center|LOCUS_07050 3879 2935 gene locus_tag LOCUS_07060 3879 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 >Feature sequence146 604 203 gene locus_tag LOCUS_07070 gene tolR 604 203 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003018371.1 protein_id gnl|my_center|LOCUS_07070 1230 610 gene locus_tag LOCUS_07080 1230 610 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920671.1 protein_id gnl|my_center|LOCUS_07080 2850 1303 gene locus_tag LOCUS_07090 2850 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 3704 2859 gene locus_tag LOCUS_07100 3704 2859 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942056.1 protein_id gnl|my_center|LOCUS_07100 >Feature sequence147 181 846 gene locus_tag LOCUS_07110 181 846 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005947811.1 protein_id gnl|my_center|LOCUS_07110 859 2070 gene locus_tag LOCUS_07120 859 2070 CDS product UDP-N-acetylglucosamine 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202418.1 protein_id gnl|my_center|LOCUS_07120 3062 2151 gene locus_tag LOCUS_07130 gene trxB 3062 2151 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 protein_id gnl|my_center|LOCUS_07130 <3853 3174 gene locus_tag LOCUS_07140 <3853 3174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403234.1:isoleucine--tRNA ligase >Feature sequence148 1388 465 gene locus_tag LOCUS_07150 gene cysK 1388 465 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257225.1 protein_id gnl|my_center|LOCUS_07150 2285 1419 gene locus_tag LOCUS_07160 2285 1419 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207638.1 protein_id gnl|my_center|LOCUS_07160 2821 2746 gene locus_tag LOCUS_t00200 2821 2746 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3727 2891 gene locus_tag LOCUS_07170 gene nfo 3727 2891 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795638.1 protein_id gnl|my_center|LOCUS_07170 >Feature sequence149 757 1620 gene locus_tag LOCUS_07180 757 1620 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887660.1 protein_id gnl|my_center|LOCUS_07180 1655 2059 gene locus_tag LOCUS_07190 1655 2059 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016840.1 protein_id gnl|my_center|LOCUS_07190 2131 3054 gene locus_tag LOCUS_07200 2131 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 3190 3390 gene locus_tag LOCUS_07210 gene rpmE 3190 3390 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_07210 >Feature sequence150 2882 2196 gene locus_tag LOCUS_07220 2882 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 <3801 2910 gene locus_tag LOCUS_07230 <3801 2910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943823.1:30S ribosomal protein S12 methylthiotransferase RimO >Feature sequence151 <1 903 gene locus_tag LOCUS_07240 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545621.1:penicillin-binding protein 2 900 1565 gene locus_tag LOCUS_07250 900 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 >Feature sequence152 3158 552 gene locus_tag LOCUS_07260 3158 552 CDS product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119311.1 protein_id gnl|my_center|LOCUS_07260 >Feature sequence153 <1 515 gene locus_tag LOCUS_07270 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011017012.1:polysaccharide deacetylase family protein 559 1491 gene locus_tag LOCUS_07280 559 1491 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003018480.1 protein_id gnl|my_center|LOCUS_07280 1706 2329 gene locus_tag LOCUS_07290 1706 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 2513 3160 gene locus_tag LOCUS_07300 2513 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07300 3161 3436 gene locus_tag LOCUS_07310 3161 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07310 >Feature sequence154 364 1770 gene locus_tag LOCUS_07320 364 1770 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_07320 1838 3088 gene locus_tag LOCUS_07330 gene ybdG 1838 3088 CDS product mechanosensitive ion channel YbdG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153146.1 protein_id gnl|my_center|LOCUS_07330 >Feature sequence155 468 1478 gene locus_tag LOCUS_07340 468 1478 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940306.1 protein_id gnl|my_center|LOCUS_07340 1508 1966 gene locus_tag LOCUS_07350 1508 1966 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666808.1 protein_id gnl|my_center|LOCUS_07350 >Feature sequence156 >Feature sequence157 695 604 gene locus_tag LOCUS_t00210 695 604 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1147 1761 gene locus_tag LOCUS_07360 1147 1761 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417903.1 protein_id gnl|my_center|LOCUS_07360 1774 3588 gene locus_tag LOCUS_07370 1774 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 >Feature sequence158 1027 776 gene locus_tag LOCUS_07380 1027 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 1861 1049 gene locus_tag LOCUS_07390 1861 1049 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360266.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07390 3526 1964 gene locus_tag LOCUS_07400 3526 1964 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048134.1 protein_id gnl|my_center|LOCUS_07400 >Feature sequence159 1257 433 gene locus_tag LOCUS_07410 1257 433 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938977.1 protein_id gnl|my_center|LOCUS_07410 2108 1293 gene locus_tag LOCUS_07420 2108 1293 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762413.1 protein_id gnl|my_center|LOCUS_07420 <3683 2967 gene locus_tag LOCUS_07430 <3683 2967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267808.1:metallophosphoesterase >Feature sequence160 1830 502 gene locus_tag LOCUS_07440 1830 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 2298 3278 gene locus_tag LOCUS_07450 2298 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 >Feature sequence161 1347 730 gene locus_tag LOCUS_07460 gene recR 1347 730 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143488.1 protein_id gnl|my_center|LOCUS_07460 1677 1366 gene locus_tag LOCUS_07470 1677 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 3192 1705 gene locus_tag LOCUS_07480 3192 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 >Feature sequence162 1147 329 gene locus_tag LOCUS_07490 1147 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 1965 1144 gene locus_tag LOCUS_07500 1965 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 3181 2042 gene locus_tag LOCUS_07510 3181 2042 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355975.1 protein_id gnl|my_center|LOCUS_07510 >Feature sequence163 <3610 804 gene locus_tag LOCUS_07520 <3610 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122194.1:alpha-2-macroglobulin family protein >Feature sequence164 654 2174 gene locus_tag LOCUS_07530 654 2174 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357216.1 protein_id gnl|my_center|LOCUS_07530 2301 3338 gene locus_tag LOCUS_07540 2301 3338 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818730.1 protein_id gnl|my_center|LOCUS_07540 >Feature sequence165 <1 955 gene locus_tag LOCUS_07550 <1 955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680111.1:phospho-N-acetylmuramoyl-pentapeptide-transferase 955 1416 gene locus_tag LOCUS_07560 gene lspA 955 1416 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943757.1 protein_id gnl|my_center|LOCUS_07560 1413 2288 gene locus_tag LOCUS_07570 gene miaA 1413 2288 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804679.1 protein_id gnl|my_center|LOCUS_07570 2285 3052 gene locus_tag LOCUS_07580 gene radC 2285 3052 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259440.1 protein_id gnl|my_center|LOCUS_07580 >Feature sequence166 1344 634 gene locus_tag LOCUS_07590 1344 634 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228813.1 protein_id gnl|my_center|LOCUS_07590 2787 1366 gene locus_tag LOCUS_07600 gene hydG 2787 1366 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079985.1 protein_id gnl|my_center|LOCUS_07600 3445 2993 gene locus_tag LOCUS_07610 3445 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 >Feature sequence167 <1 1650 gene locus_tag LOCUS_07620 <1 1650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_207301211.1:transketolase 1662 3113 gene locus_tag LOCUS_07630 gene lysS 1662 3113 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296055.1 protein_id gnl|my_center|LOCUS_07630 >Feature sequence168 286 2130 gene locus_tag LOCUS_07640 286 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 2102 3532 gene locus_tag LOCUS_07650 2102 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 >Feature sequence169 245 478 gene locus_tag LOCUS_07660 245 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 475 2811 gene locus_tag LOCUS_07670 475 2811 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229101.1 protein_id gnl|my_center|LOCUS_07670 >Feature sequence170 >Feature sequence171 <1 524 gene locus_tag LOCUS_07680 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000578367.1:type III pantothenate kinase 524 1447 gene locus_tag LOCUS_07690 524 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 1437 1727 gene locus_tag LOCUS_07700 gene yggU 1437 1727 CDS product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173614.1 protein_id gnl|my_center|LOCUS_07700 1771 2238 gene locus_tag LOCUS_07710 1771 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 3004 2486 gene locus_tag LOCUS_07720 3004 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 >Feature sequence172 1606 1163 gene locus_tag LOCUS_07730 gene dut 1606 1163 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964734.1 protein_id gnl|my_center|LOCUS_07730 <3490 1618 gene locus_tag LOCUS_07740 <3490 1618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202102.1:alpha-N-acetylglucosaminidase >Feature sequence173 1662 940 gene locus_tag LOCUS_07750 1662 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 2468 1665 gene locus_tag LOCUS_07760 2468 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 2804 2493 gene locus_tag LOCUS_07770 2804 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07770 <3485 2815 gene locus_tag LOCUS_07780 <3485 2815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032555717.1:SGNH/GDSL hydrolase family protein >Feature sequence174 2 133 gene locus_tag LOCUS_07790 2 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 163 306 gene locus_tag LOCUS_07800 163 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 322 558 gene locus_tag LOCUS_07810 322 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 606 1145 gene locus_tag LOCUS_07820 606 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 1145 2521 gene locus_tag LOCUS_07830 1145 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 2770 3291 gene locus_tag LOCUS_07840 2770 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 >Feature sequence175 <1 1081 gene locus_tag LOCUS_07850 <1 1081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393219.1:NADH-dependent [FeFe] hydrogenase, group A6 1423 1851 gene locus_tag LOCUS_07860 1423 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 2105 2779 gene locus_tag LOCUS_07870 2105 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 >Feature sequence176 <1 1574 gene locus_tag LOCUS_07880 <1 1574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120247.1:ATP-binding cassette domain-containing protein 2644 1769 gene locus_tag LOCUS_07890 2644 1769 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408383.1 protein_id gnl|my_center|LOCUS_07890 3117 2653 gene locus_tag LOCUS_07900 3117 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 3428 3186 gene locus_tag LOCUS_07910 3428 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 >Feature sequence177 <1 2115 gene locus_tag LOCUS_07920 <1 2115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002361258.1:NAD-dependent DNA ligase LigA 2122 2292 gene locus_tag LOCUS_07930 2122 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 >Feature sequence178 <1 1112 gene locus_tag LOCUS_07940 <1 1112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002311357.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase 1133 2461 gene locus_tag LOCUS_07950 1133 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 >Feature sequence179 1621 722 gene locus_tag LOCUS_07960 1621 722 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_07960 2392 1739 gene locus_tag LOCUS_07970 2392 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 <3411 2385 gene locus_tag LOCUS_07980 <3411 2385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003377639.1:putative lipid II flippase FtsW >Feature sequence180 >Feature sequence181 <1 1168 gene locus_tag LOCUS_07990 <1 1168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459055.1:anaerobic ribonucleoside triphosphate reductase 1348 1833 gene locus_tag LOCUS_08000 gene nrdG 1348 1833 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810328.1 protein_id gnl|my_center|LOCUS_08000 2010 2375 gene locus_tag LOCUS_08010 2010 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 >Feature sequence182 328 401 gene locus_tag LOCUS_t00220 328 401 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 468 950 gene locus_tag LOCUS_08020 468 950 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968070.1 protein_id gnl|my_center|LOCUS_08020 953 2119 gene locus_tag LOCUS_08030 953 2119 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808537.1 protein_id gnl|my_center|LOCUS_08030 2132 3019 gene locus_tag LOCUS_08040 2132 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 >Feature sequence183 1386 133 gene locus_tag LOCUS_08050 1386 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 <3379 1386 gene locus_tag LOCUS_08060 <3379 1386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012263639.1:DNA-directed RNA polymerase subunit beta >Feature sequence184 667 1956 gene locus_tag LOCUS_08070 667 1956 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_08070 2029 2826 gene locus_tag LOCUS_08080 2029 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 >Feature sequence185 83 532 gene locus_tag LOCUS_08090 83 532 CDS product DUF3332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787692.1 protein_id gnl|my_center|LOCUS_08090 775 2976 gene locus_tag LOCUS_08100 775 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 >Feature sequence186 1064 366 gene locus_tag LOCUS_08110 1064 366 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928863.1 protein_id gnl|my_center|LOCUS_08110 2390 1068 gene locus_tag LOCUS_08120 2390 1068 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389453.1 protein_id gnl|my_center|LOCUS_08120 3332 2421 gene locus_tag LOCUS_08130 3332 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 >Feature sequence187 1231 362 gene locus_tag LOCUS_08140 gene hisG 1231 362 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_08140 1962 3233 gene locus_tag LOCUS_08150 gene purD 1962 3233 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393539.1 protein_id gnl|my_center|LOCUS_08150 >Feature sequence188 309 917 gene locus_tag LOCUS_08160 309 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 1001 3046 gene locus_tag LOCUS_08170 gene uvrB 1001 3046 CDS product excinuclease ABC subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000441064.1 protein_id gnl|my_center|LOCUS_08170 >Feature sequence189 1788 364 gene locus_tag LOCUS_08180 1788 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 3076 1763 gene locus_tag LOCUS_08190 3076 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 >Feature sequence190 1607 396 gene locus_tag LOCUS_08200 1607 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 2833 1640 gene locus_tag LOCUS_08210 2833 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 >Feature sequence191 823 53 gene locus_tag LOCUS_08220 823 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 1702 866 gene locus_tag LOCUS_08230 gene rsmA 1702 866 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966268.1 protein_id gnl|my_center|LOCUS_08230 2661 1699 gene locus_tag LOCUS_08240 2661 1699 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940693.1 protein_id gnl|my_center|LOCUS_08240 <3306 2737 gene locus_tag LOCUS_08250 <3306 2737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249379.1:bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD >Feature sequence192 >Feature sequence193 326 1513 gene locus_tag LOCUS_08260 326 1513 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064402.1 protein_id gnl|my_center|LOCUS_08260 1524 2018 gene locus_tag LOCUS_08270 1524 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 2276 2890 gene locus_tag LOCUS_08280 2276 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 >Feature sequence194 2546 1563 gene locus_tag LOCUS_08290 2546 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 >Feature sequence195 84 896 gene locus_tag LOCUS_08300 84 896 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174202.1 protein_id gnl|my_center|LOCUS_08300 990 2387 gene locus_tag LOCUS_08310 990 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 >Feature sequence196 579 655 gene locus_tag LOCUS_t00230 579 655 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 666 742 gene locus_tag LOCUS_t00240 666 742 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1065 2342 gene locus_tag LOCUS_08320 gene serS 1065 2342 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880145.1 protein_id gnl|my_center|LOCUS_08320 2449 2910 gene locus_tag LOCUS_08330 2449 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 >Feature sequence197 1826 1500 gene locus_tag LOCUS_08340 1826 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08340 2576 3085 gene locus_tag LOCUS_08350 gene blc 2576 3085 CDS product lipocalin Blc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238378.1 protein_id gnl|my_center|LOCUS_08350 >Feature sequence198 1612 113 gene locus_tag LOCUS_08360 1612 113 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728610.1 protein_id gnl|my_center|LOCUS_08360 >Feature sequence199 >Feature sequence200 668 2023 gene locus_tag LOCUS_08370 668 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 2045 2737 gene locus_tag LOCUS_08380 gene phoU 2045 2737 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880553.1 protein_id gnl|my_center|LOCUS_08380 >Feature sequence201 1736 1812 gene locus_tag LOCUS_t00250 1736 1812 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2539 1946 gene locus_tag LOCUS_08390 2539 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 >Feature sequence202 1222 398 gene locus_tag LOCUS_08400 gene lgt 1222 398 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880125.1 protein_id gnl|my_center|LOCUS_08400 1756 1244 gene locus_tag LOCUS_08410 1756 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 2367 1753 gene locus_tag LOCUS_08420 2367 1753 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108280.1 protein_id gnl|my_center|LOCUS_08420 <3087 2364 gene locus_tag LOCUS_08430 <3087 2364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011791323.1:SO_0444 family Cu/Zn efflux transporter >Feature sequence203 522 1838 gene locus_tag LOCUS_08440 gene rhlE 522 1838 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007058.1 protein_id gnl|my_center|LOCUS_08440 1876 2298 gene locus_tag LOCUS_08450 gene queD 1876 2298 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225595.1 protein_id gnl|my_center|LOCUS_08450 >Feature sequence204 128 1207 gene locus_tag LOCUS_08460 128 1207 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_08460 1293 2144 gene locus_tag LOCUS_08470 1293 2144 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114915.1 protein_id gnl|my_center|LOCUS_08470 2191 2772 gene locus_tag LOCUS_08480 2191 2772 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887849.1 protein_id gnl|my_center|LOCUS_08480 >Feature sequence205 467 1723 gene locus_tag LOCUS_08490 467 1723 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392434.1 protein_id gnl|my_center|LOCUS_08490 1770 2231 gene locus_tag LOCUS_08500 gene ribE 1770 2231 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811752.1 protein_id gnl|my_center|LOCUS_08500 2243 2743 gene locus_tag LOCUS_08510 2243 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 >Feature sequence206 2702 1452 gene locus_tag LOCUS_08520 2702 1452 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704930.1 protein_id gnl|my_center|LOCUS_08520 >Feature sequence207 >Feature sequence208 244 792 gene locus_tag LOCUS_08530 244 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 963 2195 gene locus_tag LOCUS_08540 963 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 2406 2744 gene locus_tag LOCUS_08550 2406 2744 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943754.1 protein_id gnl|my_center|LOCUS_08550 >Feature sequence209 <1 632 gene locus_tag LOCUS_08560 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202260.1:polysaccharide biosynthesis protein 671 1093 gene locus_tag LOCUS_08570 671 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 1090 2211 gene locus_tag LOCUS_08580 1090 2211 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963418.1 protein_id gnl|my_center|LOCUS_08580 >Feature sequence210 2391 307 gene locus_tag LOCUS_08590 2391 307 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768314.1 protein_id gnl|my_center|LOCUS_08590 2436 2600 gene locus_tag LOCUS_08600 2436 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 >Feature sequence211 3 218 gene locus_tag LOCUS_08610 3 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 >Feature sequence212 <1 910 gene locus_tag LOCUS_08620 <1 910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938640.1:proline--tRNA ligase 932 1291 gene locus_tag LOCUS_08630 932 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 1365 2624 gene locus_tag LOCUS_08640 gene hisS 1365 2624 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903476.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence213 1 231 gene locus_tag LOCUS_08650 1 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 1463 1572 gene locus_tag LOCUS_r00010 1463 1572 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 <2990 1886 gene locus_tag LOCUS_08660 <2990 1886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121674.1:formylglycine-generating enzyme family protein >Feature sequence214 803 78 gene locus_tag LOCUS_08670 gene pyrH 803 78 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531760.1 protein_id gnl|my_center|LOCUS_08670 2428 1745 gene locus_tag LOCUS_08680 2428 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 <2963 2445 gene locus_tag LOCUS_08690 <2963 2445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803772.1:sulfatase >Feature sequence215 2391 1264 gene locus_tag LOCUS_08700 2391 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 2876 2388 gene locus_tag LOCUS_08710 2876 2388 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421374.1 protein_id gnl|my_center|LOCUS_08710 >Feature sequence216 363 1061 gene locus_tag LOCUS_08720 363 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 1107 2006 gene locus_tag LOCUS_08730 gene dusB 1107 2006 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391694.1 protein_id gnl|my_center|LOCUS_08730 <2933 2239 gene locus_tag LOCUS_08740 <2933 2239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002214867.1:chaperonin GroEL >Feature sequence217 2770 269 gene locus_tag LOCUS_08750 gene mutS 2770 269 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_08750 >Feature sequence218 64 1410 gene locus_tag LOCUS_08760 64 1410 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172762.1 protein_id gnl|my_center|LOCUS_08760 2555 1401 gene locus_tag LOCUS_08770 2555 1401 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582790.1 protein_id gnl|my_center|LOCUS_08770 2928 2662 gene locus_tag LOCUS_08780 2928 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 >Feature sequence219 >Feature sequence220 <1 617 gene locus_tag LOCUS_08790 <1 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140102.1:ABC-F family ATP-binding cassette domain-containing protein 733 1311 gene locus_tag LOCUS_08800 733 1311 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252838.1 protein_id gnl|my_center|LOCUS_08800 1491 2753 gene locus_tag LOCUS_08810 gene guaA 1491 2753 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764094.1 protein_id gnl|my_center|LOCUS_08810 >Feature sequence221 1388 498 gene locus_tag LOCUS_08820 gene xerC 1388 498 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_08820 2437 1442 gene locus_tag LOCUS_08830 gene hydE 2437 1442 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393236.1 protein_id gnl|my_center|LOCUS_08830 2877 2455 gene locus_tag LOCUS_08840 2877 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 >Feature sequence222 542 1591 gene locus_tag LOCUS_08850 542 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 1600 2796 gene locus_tag LOCUS_08860 1600 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 >Feature sequence223 2750 1257 gene locus_tag LOCUS_08870 2750 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 >Feature sequence224 944 768 gene locus_tag LOCUS_08880 gene rpmF 944 768 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638547.1 protein_id gnl|my_center|LOCUS_08880 1720 1439 gene locus_tag LOCUS_08890 1720 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08890 1990 1745 gene locus_tag LOCUS_08900 1990 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08900 >Feature sequence225 <1 545 gene locus_tag LOCUS_08910 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095020.1:bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase 638 1483 gene locus_tag LOCUS_08920 638 1483 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870266.1 protein_id gnl|my_center|LOCUS_08920 1508 2044 gene locus_tag LOCUS_08930 1508 2044 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107760.1 protein_id gnl|my_center|LOCUS_08930 2070 2666 gene locus_tag LOCUS_08940 gene yhgN 2070 2666 CDS product NAAT family transporter YhgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002544.1 protein_id gnl|my_center|LOCUS_08940 >Feature sequence226 >Feature sequence227 <1 1636 gene locus_tag LOCUS_08950 <1 1636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071541506.1:translation initiation factor IF-2 1649 2023 gene locus_tag LOCUS_08960 gene rbfA 1649 2023 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325039.1 protein_id gnl|my_center|LOCUS_08960 >Feature sequence228 527 964 gene locus_tag LOCUS_08970 gene aroQ 527 964 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_08970 977 1699 gene locus_tag LOCUS_08980 gene plsY 977 1699 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880403.1 protein_id gnl|my_center|LOCUS_08980 1696 2685 gene locus_tag LOCUS_08990 1696 2685 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724031.1 protein_id gnl|my_center|LOCUS_08990 >Feature sequence229 1446 1165 gene locus_tag LOCUS_09000 gene gatC 1446 1165 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_09000 2449 1478 gene locus_tag LOCUS_09010 2449 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 >Feature sequence230 <2776 898 gene locus_tag LOCUS_09020 <2776 898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037393549.1:multidrug efflux RND transporter permease subunit >Feature sequence231 2185 446 gene locus_tag LOCUS_09030 2185 446 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828680.1 protein_id gnl|my_center|LOCUS_09030 <2769 2202 gene locus_tag LOCUS_09040 <2769 2202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002225597.1:7-cyano-7-deazaguanine synthase QueC >Feature sequence232 272 141 gene locus_tag LOCUS_09050 272 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 1647 277 gene locus_tag LOCUS_09060 1647 277 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939339.1 protein_id gnl|my_center|LOCUS_09060 >Feature sequence233 107 832 gene locus_tag LOCUS_09070 107 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 829 1587 gene locus_tag LOCUS_09080 829 1587 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675715.1 protein_id gnl|my_center|LOCUS_09080 >Feature sequence234 555 67 gene locus_tag LOCUS_09090 555 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 2045 600 gene locus_tag LOCUS_09100 2045 600 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798358.1 protein_id gnl|my_center|LOCUS_09100 2327 2067 gene locus_tag LOCUS_09110 2327 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 >Feature sequence235 348 1625 gene locus_tag LOCUS_09120 348 1625 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_09120 <2748 1737 gene locus_tag LOCUS_09130 <2748 1737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121186.1:UDPGP type 1 family protein >Feature sequence236 1324 134 gene locus_tag LOCUS_09140 1324 134 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729942.1 protein_id gnl|my_center|LOCUS_09140 2545 1346 gene locus_tag LOCUS_09150 2545 1346 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937725.1 protein_id gnl|my_center|LOCUS_09150 >Feature sequence237 <1 1183 gene locus_tag LOCUS_09160 <1 1183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922133.1:homoserine O-acetyltransferase 1167 2048 gene locus_tag LOCUS_09170 1167 2048 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_09170 2051 2638 gene locus_tag LOCUS_09180 2051 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 >Feature sequence238 1557 244 gene locus_tag LOCUS_09190 1557 244 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214414.1 protein_id gnl|my_center|LOCUS_09190 1871 2635 gene locus_tag LOCUS_09200 1871 2635 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948640.1 protein_id gnl|my_center|LOCUS_09200 >Feature sequence239 1974 1366 gene locus_tag LOCUS_09210 1974 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 >Feature sequence240 <1 702 gene locus_tag LOCUS_09220 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005694053.1:excinuclease ABC subunit UvrA 740 1906 gene locus_tag LOCUS_09230 740 1906 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949005.1 protein_id gnl|my_center|LOCUS_09230 <2653 2001 gene locus_tag LOCUS_09240 <2653 2001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_149366214.1:efflux transporter outer membrane subunit >Feature sequence241 282 1460 gene locus_tag LOCUS_09250 282 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 >Feature sequence242 601 2058 gene locus_tag LOCUS_09260 601 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 >Feature sequence243 2184 583 gene locus_tag LOCUS_09270 2184 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 >Feature sequence244 1694 1146 gene locus_tag LOCUS_09280 1694 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 2454 1723 gene locus_tag LOCUS_09290 2454 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 >Feature sequence245 2087 1005 gene locus_tag LOCUS_09300 2087 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 >Feature sequence246 1806 2174 gene locus_tag LOCUS_09310 1806 2174 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462292.1 protein_id gnl|my_center|LOCUS_09310 >Feature sequence247 3 1427 gene locus_tag LOCUS_09320 3 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 1502 2584 gene locus_tag LOCUS_09330 1502 2584 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108695.1 protein_id gnl|my_center|LOCUS_09330 >Feature sequence248 337 1917 gene locus_tag LOCUS_09340 337 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 >Feature sequence249 <1 757 gene locus_tag LOCUS_09350 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941298.1:YfhO family protein 754 2433 gene locus_tag LOCUS_09360 754 2433 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940378.1 protein_id gnl|my_center|LOCUS_09360 >Feature sequence250 >Feature sequence251 547 290 gene locus_tag LOCUS_09370 gene rpsO 547 290 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808855.1 protein_id gnl|my_center|LOCUS_09370 853 1716 gene locus_tag LOCUS_09380 853 1716 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259407.1 protein_id gnl|my_center|LOCUS_09380 >Feature sequence252 237 1880 gene locus_tag LOCUS_09390 gene mrdA 237 1880 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583753.1 protein_id gnl|my_center|LOCUS_09390 2094 2324 gene locus_tag LOCUS_09400 2094 2324 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141883.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence253 65 352 gene locus_tag LOCUS_09410 65 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 1010 573 gene locus_tag LOCUS_09420 1010 573 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760530.1 protein_id gnl|my_center|LOCUS_09420 1591 1043 gene locus_tag LOCUS_09430 1591 1043 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483406.1 protein_id gnl|my_center|LOCUS_09430 2274 1825 gene locus_tag LOCUS_09440 2274 1825 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174302.1 protein_id gnl|my_center|LOCUS_09440 2449 2285 gene locus_tag LOCUS_09450 2449 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 >Feature sequence254 1371 532 gene locus_tag LOCUS_09460 gene lpxI 1371 532 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546653.1 protein_id gnl|my_center|LOCUS_09460 1719 1429 gene locus_tag LOCUS_09470 1719 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 1887 2048 gene locus_tag LOCUS_09480 1887 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 >Feature sequence255 1417 122 gene locus_tag LOCUS_09490 gene fabF 1417 122 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673329.1 protein_id gnl|my_center|LOCUS_09490 2418 1447 gene locus_tag LOCUS_09500 2418 1447 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_09500 >Feature sequence256 >Feature sequence257 <1 864 gene locus_tag LOCUS_09510 <1 864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000444659.1:glycosyltransferase family 2 protein 960 2057 gene locus_tag LOCUS_09520 960 2057 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141777.1 protein_id gnl|my_center|LOCUS_09520 >Feature sequence258 <1 775 gene locus_tag LOCUS_09530 <1 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986279.1:homoserine kinase 781 1929 gene locus_tag LOCUS_09540 781 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 >Feature sequence259 1650 451 gene locus_tag LOCUS_09550 gene lpxK 1650 451 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626176.1 protein_id gnl|my_center|LOCUS_09550 2501 1665 gene locus_tag LOCUS_09560 2501 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 >Feature sequence260 110 874 gene locus_tag LOCUS_09570 110 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329496.1 protein_id gnl|my_center|LOCUS_09570 901 1260 gene locus_tag LOCUS_09580 901 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 1310 2128 gene locus_tag LOCUS_09590 gene prmC 1310 2128 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393873.1 protein_id gnl|my_center|LOCUS_09590 >Feature sequence261 <2495 1737 gene locus_tag LOCUS_09600 <2495 1737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121674.1:formylglycine-generating enzyme family protein >Feature sequence262 480 112 gene locus_tag LOCUS_09610 480 112 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_09610 1351 596 gene locus_tag LOCUS_09620 1351 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 2262 1525 gene locus_tag LOCUS_09630 2262 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 >Feature sequence263 1132 2019 gene locus_tag LOCUS_09640 1132 2019 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192079.1 protein_id gnl|my_center|LOCUS_09640 >Feature sequence264 317 964 gene locus_tag LOCUS_09650 317 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 1197 1919 gene locus_tag LOCUS_09660 1197 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 1994 2302 gene locus_tag LOCUS_09670 1994 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 >Feature sequence265 966 1637 gene locus_tag LOCUS_09680 966 1637 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815942.1 protein_id gnl|my_center|LOCUS_09680 1771 2109 gene locus_tag LOCUS_09690 1771 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 >Feature sequence266 >Feature sequence267 1092 139 gene locus_tag LOCUS_09700 1092 139 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939846.1 protein_id gnl|my_center|LOCUS_09700 2420 1140 gene locus_tag LOCUS_09710 2420 1140 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870788.1 protein_id gnl|my_center|LOCUS_09710 >Feature sequence268 <1 588 gene locus_tag LOCUS_09720 <1 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259690.1:carbohydrate ABC transporter permease >Feature sequence269 315 947 gene locus_tag LOCUS_09730 315 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09730 944 1699 gene locus_tag LOCUS_09740 gene bioC 944 1699 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107785.1 protein_id gnl|my_center|LOCUS_09740 >Feature sequence270 1036 197 gene locus_tag LOCUS_09750 1036 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 1751 1023 gene locus_tag LOCUS_09760 gene ccsA 1751 1023 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201987.1 protein_id gnl|my_center|LOCUS_09760 2353 1748 gene locus_tag LOCUS_09770 2353 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 >Feature sequence271 1848 499 gene locus_tag LOCUS_09780 1848 499 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986767.1 protein_id gnl|my_center|LOCUS_09780 1955 2164 gene locus_tag LOCUS_09790 1955 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 >Feature sequence272 1381 1010 gene locus_tag LOCUS_09800 1381 1010 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812106.1 protein_id gnl|my_center|LOCUS_09800 1724 1401 gene locus_tag LOCUS_09810 1724 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 <2330 1721 gene locus_tag LOCUS_09820 <2330 1721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933490.1:3-deoxy-manno-octulosonate cytidylyltransferase >Feature sequence273 2027 435 gene locus_tag LOCUS_09830 2027 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 >Feature sequence274 >Feature sequence275 1510 377 gene locus_tag LOCUS_09840 gene rlmD 1510 377 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056786.1 protein_id gnl|my_center|LOCUS_09840 2314 1532 gene locus_tag LOCUS_09850 2314 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 >Feature sequence276 <1 1716 gene locus_tag LOCUS_09860 <1 1716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001262543.1:methionine--tRNA ligase >Feature sequence277 >Feature sequence278 1407 262 gene locus_tag LOCUS_09870 1407 262 CDS product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681770.1 protein_id gnl|my_center|LOCUS_09870 1916 1449 gene locus_tag LOCUS_09880 gene fabZ 1916 1449 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670104.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence279 <1 673 gene locus_tag LOCUS_09890 <1 673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032828442.1:molecular chaperone DnaJ 707 2059 gene locus_tag LOCUS_09900 gene purB 707 2059 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113371.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence280 2093 1458 gene locus_tag LOCUS_09910 gene tmk 2093 1458 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886759.1 protein_id gnl|my_center|LOCUS_09910 >Feature sequence281 938 333 gene locus_tag LOCUS_09920 938 333 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686506.1 protein_id gnl|my_center|LOCUS_09920 2128 938 gene locus_tag LOCUS_09930 2128 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 >Feature sequence282 <1 898 gene locus_tag LOCUS_09940 <1 898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940789.1:F0F1 ATP synthase subunit beta 915 1190 gene locus_tag LOCUS_09950 915 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 >Feature sequence283 1835 906 gene locus_tag LOCUS_09960 1835 906 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760658.1 protein_id gnl|my_center|LOCUS_09960 >Feature sequence284 <1 834 gene locus_tag LOCUS_09970 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938554.1:glutamine synthetase III >Feature sequence285 1291 578 gene locus_tag LOCUS_09980 1291 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 2125 1301 gene locus_tag LOCUS_09990 2125 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 >Feature sequence286 >Feature sequence287 >Feature sequence288 1649 537 gene locus_tag LOCUS_10000 1649 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 >Feature sequence289 >Feature sequence290 <2090 124 gene locus_tag LOCUS_10010 <2090 124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015909312.1:amylo-alpha-1,6-glucosidase >Feature sequence291 >Feature sequence292 2022 1195 gene locus_tag LOCUS_10020 2022 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 >Feature sequence293 7 91 gene locus_tag LOCUS_t00260 7 91 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 114 190 gene locus_tag LOCUS_t00270 114 190 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 797 435 gene locus_tag LOCUS_10030 797 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 >Feature sequence294 825 142 gene locus_tag LOCUS_10040 825 142 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383693.1 protein_id gnl|my_center|LOCUS_10040 1496 822 gene locus_tag LOCUS_10050 1496 822 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942096.1 protein_id gnl|my_center|LOCUS_10050 >Feature sequence295 1066 404 gene locus_tag LOCUS_10060 1066 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 <2035 1087 gene locus_tag LOCUS_10070 <2035 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941738.1:Holliday junction branch migration DNA helicase RuvB >Feature sequence296 2 190 gene locus_tag LOCUS_10080 2 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 736 287 gene locus_tag LOCUS_10090 736 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 1916 729 gene locus_tag LOCUS_10100 1916 729 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119310.1 protein_id gnl|my_center|LOCUS_10100 >Feature sequence297 2 298 gene locus_tag LOCUS_10110 2 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 295 1467 gene locus_tag LOCUS_10120 295 1467 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_10120 >Feature sequence298 392 482 gene locus_tag LOCUS_t00280 392 482 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 651 1421 gene locus_tag LOCUS_10130 gene rlmB 651 1421 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257938.1 protein_id gnl|my_center|LOCUS_10130 >Feature sequence299 1530 109 gene locus_tag LOCUS_10140 1530 109 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060885.1 protein_id gnl|my_center|LOCUS_10140 >Feature sequence300 >Feature sequence301 <1 827 gene locus_tag LOCUS_10150 <1 827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383930.1:trigger factor >Feature sequence302 34 294 gene locus_tag LOCUS_10160 34 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 328 1857 gene locus_tag LOCUS_10170 328 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 >Feature sequence303 <1 1167 gene locus_tag LOCUS_10180 <1 1167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109237.1:beta-N-acetylglucosaminidase domain-containing protein >Feature sequence304 1568 1777 gene locus_tag LOCUS_10190 1568 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 >Feature sequence305 624 1394 gene locus_tag LOCUS_10200 624 1394 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402843.1 protein_id gnl|my_center|LOCUS_10200 >Feature sequence306 <1 587 gene locus_tag LOCUS_10210 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392478.1:amidohydrolase 587 1417 gene locus_tag LOCUS_10220 587 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 1548 1844 gene locus_tag LOCUS_10230 1548 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 >Feature sequence307 1095 28 gene locus_tag LOCUS_10240 1095 28 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760854.1 protein_id gnl|my_center|LOCUS_10240 <1860 1239 gene locus_tag LOCUS_10250 <1860 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760855.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme >Feature sequence308 278 958 gene locus_tag LOCUS_10260 gene deoC 278 958 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933101.1 protein_id gnl|my_center|LOCUS_10260 <1859 1065 gene locus_tag LOCUS_10270 <1859 1065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545075.1:RNA polymerase-binding protein DksA >Feature sequence309 779 507 gene locus_tag LOCUS_10280 779 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 >Feature sequence310 >Feature sequence311 <1 1813 gene locus_tag LOCUS_10290 <1 1813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005800561.1:GH92 family glycosyl hydrolase >Feature sequence312 371 1711 gene locus_tag LOCUS_10300 gene miaB 371 1711 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942838.1 protein_id gnl|my_center|LOCUS_10300 >Feature sequence313 >Feature sequence314 147 575 gene locus_tag LOCUS_10310 gene hisI 147 575 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903699.1 protein_id gnl|my_center|LOCUS_10310 >Feature sequence315 >Feature sequence316 857 282 gene locus_tag LOCUS_10320 857 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 1465 881 gene locus_tag LOCUS_10330 1465 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 >Feature sequence317 1520 252 gene locus_tag LOCUS_10340 1520 252 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_10340 >Feature sequence318 334 1410 gene locus_tag LOCUS_10350 gene queA 334 1410 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 protein_id gnl|my_center|LOCUS_10350 >Feature sequence319 <1 905 gene locus_tag LOCUS_10360 <1 905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764577.1:YncE family protein >Feature sequence320 633 1472 gene locus_tag LOCUS_10370 gene nifU 633 1472 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937968.1 protein_id gnl|my_center|LOCUS_10370 >Feature sequence321 <1 925 gene locus_tag LOCUS_10380 <1 925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403121.1:MlaD family protein 936 1475 gene locus_tag LOCUS_10390 936 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 >Feature sequence322 <1 1046 gene locus_tag LOCUS_10400 <1 1046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011067938.1:family 20 glycosylhydrolase >Feature sequence323 316 1092 gene locus_tag LOCUS_10410 gene proC 316 1092 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796496.1 protein_id gnl|my_center|LOCUS_10410 >Feature sequence324 1009 440 gene locus_tag LOCUS_10420 1009 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 >Feature sequence325 150 638 gene locus_tag LOCUS_10430 150 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 >Feature sequence326 573 1148 gene locus_tag LOCUS_10440 gene pyrE 573 1148 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460653.1 protein_id gnl|my_center|LOCUS_10440 >Feature sequence327 >Feature sequence328 >Feature sequence329 1419 277 gene locus_tag LOCUS_10450 1419 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 >Feature sequence330 >Feature sequence331 934 62 gene locus_tag LOCUS_10460 934 62 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933356.1 protein_id gnl|my_center|LOCUS_10460 >Feature sequence332 727 2 gene locus_tag LOCUS_10470 727 2 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966824.1 protein_id gnl|my_center|LOCUS_10470 <1556 843 gene locus_tag LOCUS_10480 <1556 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000953417.1:ferric-rhodotorulic acid/ferric-coprogen receptor FhuE >Feature sequence333 <1 561 gene locus_tag LOCUS_10490 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940358.1:protein TolQ 563 976 gene locus_tag LOCUS_10500 563 976 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118000.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence334 1395 475 gene locus_tag LOCUS_10510 1395 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510