>Feature sequence01 614 529 gene locus_tag LOCUS_t0010 614 529 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1681 671 gene locus_tag LOCUS_0010 1681 671 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125980453.1 protein_id gnl|my_center|LOCUS_0010 2093 1920 gene locus_tag LOCUS_0020 2093 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0020 2188 5820 gene locus_tag LOCUS_0030 2188 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0030 5817 8096 gene locus_tag LOCUS_0040 5817 8096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143321.1 protein_id gnl|my_center|LOCUS_0040 10350 8188 gene locus_tag LOCUS_0050 10350 8188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143321.1 protein_id gnl|my_center|LOCUS_0050 10493 10768 gene locus_tag LOCUS_0060 10493 10768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0060 13097 10851 gene locus_tag LOCUS_0070 13097 10851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143321.1 protein_id gnl|my_center|LOCUS_0070 13228 15108 gene locus_tag LOCUS_0080 13228 15108 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068688.1 protein_id gnl|my_center|LOCUS_0080 15287 16321 gene locus_tag LOCUS_0090 15287 16321 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383751.1 protein_id gnl|my_center|LOCUS_0090 16453 17298 gene locus_tag LOCUS_0100 16453 17298 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068684.1 protein_id gnl|my_center|LOCUS_0100 17298 19241 gene locus_tag LOCUS_0110 17298 19241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0110 19249 21507 gene locus_tag LOCUS_0120 19249 21507 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055427524.1 protein_id gnl|my_center|LOCUS_0120 23540 21555 gene locus_tag LOCUS_0130 23540 21555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0130 24872 23718 gene locus_tag LOCUS_0140 gene glf 24872 23718 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068697.1 protein_id gnl|my_center|LOCUS_0140 25405 25572 gene locus_tag LOCUS_0150 25405 25572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0150 26110 27210 gene locus_tag LOCUS_0160 26110 27210 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055559.1 protein_id gnl|my_center|LOCUS_0160 27343 30228 gene locus_tag LOCUS_0170 gene topA 27343 30228 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390327.1 protein_id gnl|my_center|LOCUS_0170 30225 30881 gene locus_tag LOCUS_0180 gene tmk 30225 30881 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051604.1 protein_id gnl|my_center|LOCUS_0180 30878 32053 gene locus_tag LOCUS_0190 30878 32053 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390325.1 protein_id gnl|my_center|LOCUS_0190 32218 32793 gene locus_tag LOCUS_0200 32218 32793 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817572.1 protein_id gnl|my_center|LOCUS_0200 32993 34522 gene locus_tag LOCUS_0210 32993 34522 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994262.1 protein_id gnl|my_center|LOCUS_0210 34750 36357 gene locus_tag LOCUS_0220 34750 36357 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162862732.1 protein_id gnl|my_center|LOCUS_0220 36506 36580 gene locus_tag LOCUS_t0020 36506 36580 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 37440 36820 gene locus_tag LOCUS_0230 gene dcd 37440 36820 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814973.1 protein_id gnl|my_center|LOCUS_0230 39041 37590 gene locus_tag LOCUS_0240 39041 37590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0240 39776 39186 gene locus_tag LOCUS_0250 39776 39186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0250 40058 39891 gene locus_tag LOCUS_0260 40058 39891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0260 40477 40106 gene locus_tag LOCUS_0270 40477 40106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0270 40582 40965 gene locus_tag LOCUS_0280 40582 40965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0280 41092 40880 gene locus_tag LOCUS_0290 41092 40880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0290 41361 41089 gene locus_tag LOCUS_0300 41361 41089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_0300 42182 41559 gene locus_tag LOCUS_0310 42182 41559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0310 42713 44431 gene locus_tag LOCUS_0320 42713 44431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0320 45001 44534 gene locus_tag LOCUS_0330 45001 44534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0330 46104 45019 gene locus_tag LOCUS_0340 46104 45019 CDS product G5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389571.1 protein_id gnl|my_center|LOCUS_0340 46624 46307 gene locus_tag LOCUS_0350 gene trxA 46624 46307 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821172.1 protein_id gnl|my_center|LOCUS_0350 46822 47802 gene locus_tag LOCUS_0360 46822 47802 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051340.1 protein_id gnl|my_center|LOCUS_0360 47848 48243 gene locus_tag LOCUS_0370 gene gcvH 47848 48243 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079361.1 protein_id gnl|my_center|LOCUS_0370 48382 49590 gene locus_tag LOCUS_0380 48382 49590 CDS product DUF2183 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057650.1 protein_id gnl|my_center|LOCUS_0380 49587 52034 gene locus_tag LOCUS_0390 49587 52034 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389575.1 protein_id gnl|my_center|LOCUS_0390 52185 53525 gene locus_tag LOCUS_0400 52185 53525 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054746.1 protein_id gnl|my_center|LOCUS_0400 53539 54192 gene locus_tag LOCUS_0410 53539 54192 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814265.1 protein_id gnl|my_center|LOCUS_0410 54185 54907 gene locus_tag LOCUS_0420 54185 54907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0420 54993 55289 gene locus_tag LOCUS_0430 gene gatC 54993 55289 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815962.1 protein_id gnl|my_center|LOCUS_0430 55292 56827 gene locus_tag LOCUS_0440 gene gatA 55292 56827 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814276.1 protein_id gnl|my_center|LOCUS_0440 56829 58328 gene locus_tag LOCUS_0450 gene gatB 56829 58328 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051530.1 protein_id gnl|my_center|LOCUS_0450 58483 59562 gene locus_tag LOCUS_0460 58483 59562 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051529.1 protein_id gnl|my_center|LOCUS_0460 59559 59876 gene locus_tag LOCUS_0470 59559 59876 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820018.1 protein_id gnl|my_center|LOCUS_0470 59981 61564 gene locus_tag LOCUS_0480 59981 61564 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363938.1 protein_id gnl|my_center|LOCUS_0480 62382 62747 gene locus_tag LOCUS_0490 gene rplS 62382 62747 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114457.1 protein_id gnl|my_center|LOCUS_0490 62879 63592 gene locus_tag LOCUS_0500 gene lepB 62879 63592 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081174.1 protein_id gnl|my_center|LOCUS_0500 63637 64416 gene locus_tag LOCUS_0510 63637 64416 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114467.1 protein_id gnl|my_center|LOCUS_0510 64715 65575 gene locus_tag LOCUS_0520 gene trmB 64715 65575 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068780.1 protein_id gnl|my_center|LOCUS_0520 65577 66722 gene locus_tag LOCUS_0530 65577 66722 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057648.1 protein_id gnl|my_center|LOCUS_0530 69042 66886 gene locus_tag LOCUS_0540 69042 66886 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811993.1 protein_id gnl|my_center|LOCUS_0540 69284 70900 gene locus_tag LOCUS_0550 gene gadC 69284 70900 CDS product glutamate:gamma-aminobutyrate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989972.1 protein_id gnl|my_center|LOCUS_0550 71074 72690 gene locus_tag LOCUS_0560 gene gadC 71074 72690 CDS product glutamate:gamma-aminobutyrate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287851.1 protein_id gnl|my_center|LOCUS_0560 73172 72786 gene locus_tag LOCUS_0570 73172 72786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0570 73810 73169 gene locus_tag LOCUS_0580 73810 73169 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389580.1 protein_id gnl|my_center|LOCUS_0580 73857 74780 gene locus_tag LOCUS_0590 73857 74780 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230424.1 protein_id gnl|my_center|LOCUS_0590 76203 74764 gene locus_tag LOCUS_0600 gene radA 76203 74764 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390212.1 protein_id gnl|my_center|LOCUS_0600 76291 76914 gene locus_tag LOCUS_0610 76291 76914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052313.1 protein_id gnl|my_center|LOCUS_0610 78658 77204 gene locus_tag LOCUS_0620 78658 77204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0620 79568 79242 gene locus_tag LOCUS_0630 79568 79242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0630 79819 80400 gene locus_tag LOCUS_0640 79819 80400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0640 82266 80593 gene locus_tag LOCUS_0650 gene pgm 82266 80593 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994669.1 protein_id gnl|my_center|LOCUS_0650 83413 82271 gene locus_tag LOCUS_0660 83413 82271 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053825.1 protein_id gnl|my_center|LOCUS_0660 83545 84837 gene locus_tag LOCUS_0670 gene serS 83545 84837 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052327.1 protein_id gnl|my_center|LOCUS_0670 84883 84970 gene locus_tag LOCUS_t0030 84883 84970 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 85058 85831 gene locus_tag LOCUS_0680 gene map 85058 85831 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004132877.1 protein_id gnl|my_center|LOCUS_0680 85898 87028 gene locus_tag LOCUS_0690 gene prfB 85898 87028 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004120869.1 protein_id gnl|my_center|LOCUS_0690 87227 87709 gene locus_tag LOCUS_0700 gene smpB 87227 87709 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812219.1 protein_id gnl|my_center|LOCUS_0700 87918 89774 gene locus_tag LOCUS_0710 gene glmS 87918 89774 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051287.1 protein_id gnl|my_center|LOCUS_0710 89794 90918 gene locus_tag LOCUS_0720 89794 90918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0720 90918 91661 gene locus_tag LOCUS_0730 90918 91661 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013410317.1 protein_id gnl|my_center|LOCUS_0730 91868 92800 gene locus_tag LOCUS_0740 91868 92800 CDS product metal ABC transporter solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783577.1 protein_id gnl|my_center|LOCUS_0740 93014 94459 gene locus_tag LOCUS_0750 gene alr 93014 94459 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068317.1 protein_id gnl|my_center|LOCUS_0750 94471 95784 gene locus_tag LOCUS_0760 94471 95784 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740616.1 protein_id gnl|my_center|LOCUS_0760 95893 97941 gene locus_tag LOCUS_0770 gene dnaG 95893 97941 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817922.1 protein_id gnl|my_center|LOCUS_0770 98034 97960 gene locus_tag LOCUS_t0040 98034 97960 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 98436 98083 gene locus_tag LOCUS_0780 98436 98083 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812098.1 protein_id gnl|my_center|LOCUS_0780 99779 98514 gene locus_tag LOCUS_0790 gene xseA 99779 98514 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389606.1 protein_id gnl|my_center|LOCUS_0790 99840 101093 gene locus_tag LOCUS_0800 99840 101093 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068564.1 protein_id gnl|my_center|LOCUS_0800 101491 104811 gene locus_tag LOCUS_0810 gene ileS 101491 104811 CDS product mupirocin-resistant isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390135.1 protein_id gnl|my_center|LOCUS_0810 106823 105066 gene locus_tag LOCUS_0820 106823 105066 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174157.1 protein_id gnl|my_center|LOCUS_0820 106720 107118 gene locus_tag LOCUS_0830 106720 107118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0830 107196 108158 gene locus_tag LOCUS_0840 107196 108158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0840 108840 108181 gene locus_tag LOCUS_0850 108840 108181 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054040.1 protein_id gnl|my_center|LOCUS_0850 108907 109779 gene locus_tag LOCUS_0860 108907 109779 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054041.1 protein_id gnl|my_center|LOCUS_0860 110093 109848 gene locus_tag LOCUS_0870 110093 109848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0870 112021 110090 gene locus_tag LOCUS_0880 112021 110090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0880 112082 113695 gene locus_tag LOCUS_0890 112082 113695 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389619.1 protein_id gnl|my_center|LOCUS_0890 115480 113840 gene locus_tag LOCUS_0900 115480 113840 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389620.1 protein_id gnl|my_center|LOCUS_0900 115627 116427 gene locus_tag LOCUS_0910 115627 116427 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389621.1 protein_id gnl|my_center|LOCUS_0910 116493 116930 gene locus_tag LOCUS_0920 116493 116930 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812151.1 protein_id gnl|my_center|LOCUS_0920 117408 117061 gene locus_tag LOCUS_0930 117408 117061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0930 117506 117431 gene locus_tag LOCUS_t0050 117506 117431 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 117642 118076 gene locus_tag LOCUS_0940 117642 118076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0940 118073 119818 gene locus_tag LOCUS_0950 118073 119818 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143601.1 protein_id gnl|my_center|LOCUS_0950 119921 119994 gene locus_tag LOCUS_t0060 119921 119994 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 120581 120501 gene locus_tag LOCUS_t0070 120581 120501 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 120708 120635 gene locus_tag LOCUS_t0080 120708 120635 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 120828 122048 gene locus_tag LOCUS_0960 120828 122048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0960 122144 123838 gene locus_tag LOCUS_0970 gene pgi 122144 123838 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389549.1 protein_id gnl|my_center|LOCUS_0970 124173 126077 gene locus_tag LOCUS_0980 gene rho 124173 126077 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116351.1 protein_id gnl|my_center|LOCUS_0980 126349 126158 gene locus_tag LOCUS_0990 126349 126158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0990 129416 126654 gene locus_tag LOCUS_1000 gene valS 129416 126654 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390284.1 protein_id gnl|my_center|LOCUS_1000 131018 129477 gene locus_tag LOCUS_1010 131018 129477 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057799.1 protein_id gnl|my_center|LOCUS_1010 131064 131756 gene locus_tag LOCUS_1020 gene nth 131064 131756 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051520.1 protein_id gnl|my_center|LOCUS_1020 132490 133158 gene locus_tag LOCUS_1030 132490 133158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1030 133778 133275 gene locus_tag LOCUS_1040 133778 133275 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054759.1 protein_id gnl|my_center|LOCUS_1040 134081 134521 gene locus_tag LOCUS_1050 134081 134521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1050 134729 136465 gene locus_tag LOCUS_1060 gene oxc 134729 136465 CDS product oxalyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044304031.1 protein_id gnl|my_center|LOCUS_1060 137751 139088 gene locus_tag LOCUS_1070 gene frc 137751 139088 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549137.1 protein_id gnl|my_center|LOCUS_1070 139276 140298 gene locus_tag LOCUS_1080 gene yfdV 139276 140298 CDS product transporter YfdV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955028.1 protein_id gnl|my_center|LOCUS_1080 140921 140845 gene locus_tag LOCUS_t0090 140921 140845 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 141306 142202 gene locus_tag LOCUS_1090 gene atpB 141306 142202 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814317.1 protein_id gnl|my_center|LOCUS_1090 142274 142501 gene locus_tag LOCUS_1100 gene atpE 142274 142501 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003831420.1 protein_id gnl|my_center|LOCUS_1100 142551 143111 gene locus_tag LOCUS_1110 142551 143111 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819064.1 protein_id gnl|my_center|LOCUS_1110 143147 143950 gene locus_tag LOCUS_1120 143147 143950 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775941.1 protein_id gnl|my_center|LOCUS_1120 143988 145640 gene locus_tag LOCUS_1130 gene atpA 143988 145640 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051480.1 protein_id gnl|my_center|LOCUS_1130 145644 146582 gene locus_tag LOCUS_1140 145644 146582 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051479.1 protein_id gnl|my_center|LOCUS_1140 146590 148098 gene locus_tag LOCUS_1150 gene atpD 146590 148098 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814333.1 protein_id gnl|my_center|LOCUS_1150 148098 148415 gene locus_tag LOCUS_1160 148098 148415 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054766.1 protein_id gnl|my_center|LOCUS_1160 148662 149276 gene locus_tag LOCUS_1170 gene nucS 148662 149276 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363923.1 protein_id gnl|my_center|LOCUS_1170 150199 149396 gene locus_tag LOCUS_1180 150199 149396 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389466.1 protein_id gnl|my_center|LOCUS_1180 150174 150440 gene locus_tag LOCUS_1190 150174 150440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1190 150453 152579 gene locus_tag LOCUS_1200 150453 152579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1200 152576 153604 gene locus_tag LOCUS_1210 152576 153604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399332.1 protein_id gnl|my_center|LOCUS_1210 153648 154616 gene locus_tag LOCUS_1220 153648 154616 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740584.1 protein_id gnl|my_center|LOCUS_1220 154671 154744 gene locus_tag LOCUS_t0100 154671 154744 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 154814 156586 gene locus_tag LOCUS_1230 gene argS 154814 156586 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820794.1 protein_id gnl|my_center|LOCUS_1230 156695 157792 gene locus_tag LOCUS_1240 gene thrB 156695 157792 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110130.1 protein_id gnl|my_center|LOCUS_1240 157857 159161 gene locus_tag LOCUS_1250 157857 159161 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389479.1 protein_id gnl|my_center|LOCUS_1250 159348 161876 gene locus_tag LOCUS_1260 159348 161876 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582944.1 protein_id gnl|my_center|LOCUS_1260 162066 162374 gene locus_tag LOCUS_1270 gene rplU 162066 162374 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053062.1 protein_id gnl|my_center|LOCUS_1270 162400 162675 gene locus_tag LOCUS_1280 gene rpmA 162400 162675 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811713.1 protein_id gnl|my_center|LOCUS_1280 162822 164429 gene locus_tag LOCUS_1290 gene obgE 162822 164429 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815401.1 protein_id gnl|my_center|LOCUS_1290 164532 164605 gene locus_tag LOCUS_t0110 164532 164605 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 164635 164865 gene locus_tag LOCUS_1300 gene secE 164635 164865 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389486.1 protein_id gnl|my_center|LOCUS_1300 164951 165652 gene locus_tag LOCUS_1310 gene nusG 164951 165652 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389487.1 protein_id gnl|my_center|LOCUS_1310 165851 166288 gene locus_tag LOCUS_1320 gene rplK 165851 166288 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112010.1 protein_id gnl|my_center|LOCUS_1320 166359 167051 gene locus_tag LOCUS_1330 gene rplA 166359 167051 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829786.1 protein_id gnl|my_center|LOCUS_1330 >Feature sequence02 1106 171 gene locus_tag LOCUS_1340 1106 171 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058548.1 protein_id gnl|my_center|LOCUS_1340 1711 1103 gene locus_tag LOCUS_1350 1711 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1350 2079 2243 gene locus_tag LOCUS_1360 2079 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1360 2538 2720 gene locus_tag LOCUS_1370 2538 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1370 2720 3652 gene locus_tag LOCUS_1380 2720 3652 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053618.1 protein_id gnl|my_center|LOCUS_1380 3784 4851 gene locus_tag LOCUS_1390 gene pheS 3784 4851 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813536.1 protein_id gnl|my_center|LOCUS_1390 4859 7474 gene locus_tag LOCUS_1400 gene pheT 4859 7474 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390025.1 protein_id gnl|my_center|LOCUS_1400 7611 8420 gene locus_tag LOCUS_1410 7611 8420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1410 8554 9417 gene locus_tag LOCUS_1420 8554 9417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1420 9443 9883 gene locus_tag LOCUS_1430 9443 9883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1430 10694 10041 gene locus_tag LOCUS_1440 10694 10041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1440 10797 11675 gene locus_tag LOCUS_1450 10797 11675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1450 11679 12815 gene locus_tag LOCUS_1460 11679 12815 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390014.1 protein_id gnl|my_center|LOCUS_1460 12812 13681 gene locus_tag LOCUS_1470 12812 13681 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818085.1 protein_id gnl|my_center|LOCUS_1470 13760 14650 gene locus_tag LOCUS_1480 13760 14650 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818094.1 protein_id gnl|my_center|LOCUS_1480 14640 16655 gene locus_tag LOCUS_1490 gene recN 14640 16655 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068268.1 protein_id gnl|my_center|LOCUS_1490 16668 17297 gene locus_tag LOCUS_1500 16668 17297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053591.1 protein_id gnl|my_center|LOCUS_1500 17303 18025 gene locus_tag LOCUS_1510 gene nadD 17303 18025 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994703.1 protein_id gnl|my_center|LOCUS_1510 18064 19095 gene locus_tag LOCUS_1520 18064 19095 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032836384.1 protein_id gnl|my_center|LOCUS_1520 19192 19263 gene locus_tag LOCUS_t0120 19192 19263 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 20419 20958 gene locus_tag LOCUS_1530 20419 20958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1530 21388 23424 gene locus_tag LOCUS_1540 21388 23424 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476616.1 protein_id gnl|my_center|LOCUS_1540 23417 23566 gene locus_tag LOCUS_1550 23417 23566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1550 24000 24209 gene locus_tag LOCUS_1560 24000 24209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1560 24362 24769 gene locus_tag LOCUS_1570 24362 24769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1570 25341 26789 gene locus_tag LOCUS_1580 gene glmU 25341 26789 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390003.1 protein_id gnl|my_center|LOCUS_1580 26786 27163 gene locus_tag LOCUS_1590 gene rsfS 26786 27163 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052031.1 protein_id gnl|my_center|LOCUS_1590 27168 28040 gene locus_tag LOCUS_1600 27168 28040 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813453.1 protein_id gnl|my_center|LOCUS_1600 28075 29415 gene locus_tag LOCUS_1610 28075 29415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1610 29517 29590 gene locus_tag LOCUS_t0130 29517 29590 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 29708 30595 gene locus_tag LOCUS_1620 29708 30595 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012471745.1 protein_id gnl|my_center|LOCUS_1620 30713 33667 gene locus_tag LOCUS_1630 gene leuS 30713 33667 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389976.1 protein_id gnl|my_center|LOCUS_1630 33780 34757 gene locus_tag LOCUS_1640 33780 34757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1640 35133 36203 gene locus_tag LOCUS_1650 35133 36203 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775770.1 protein_id gnl|my_center|LOCUS_1650 36249 36905 gene locus_tag LOCUS_1660 36249 36905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1660 36898 37845 gene locus_tag LOCUS_1670 gene tsaB 36898 37845 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389971.1 protein_id gnl|my_center|LOCUS_1670 37859 38344 gene locus_tag LOCUS_1680 gene rimI 37859 38344 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783284.1 protein_id gnl|my_center|LOCUS_1680 38341 39387 gene locus_tag LOCUS_1690 gene tsaD 38341 39387 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363525.1 protein_id gnl|my_center|LOCUS_1690 39506 39581 gene locus_tag LOCUS_t0140 39506 39581 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 39719 40978 gene locus_tag LOCUS_1700 39719 40978 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068211.1 protein_id gnl|my_center|LOCUS_1700 41668 41003 gene locus_tag LOCUS_1710 41668 41003 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390059.1 protein_id gnl|my_center|LOCUS_1710 41852 43207 gene locus_tag LOCUS_1720 41852 43207 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068205.1 protein_id gnl|my_center|LOCUS_1720 43649 44740 gene locus_tag LOCUS_1730 gene ychF 43649 44740 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813598.1 protein_id gnl|my_center|LOCUS_1730 44754 45353 gene locus_tag LOCUS_1740 gene pth 44754 45353 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812652.1 protein_id gnl|my_center|LOCUS_1740 45353 48952 gene locus_tag LOCUS_1750 gene mfd 45353 48952 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389755.1 protein_id gnl|my_center|LOCUS_1750 49060 50355 gene locus_tag LOCUS_1760 gene eno 49060 50355 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051126.1 protein_id gnl|my_center|LOCUS_1760 50437 50991 gene locus_tag LOCUS_1770 50437 50991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1770 50988 51689 gene locus_tag LOCUS_1780 50988 51689 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068253.1 protein_id gnl|my_center|LOCUS_1780 51682 52707 gene locus_tag LOCUS_1790 51682 52707 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068252.1 protein_id gnl|my_center|LOCUS_1790 52759 52839 gene locus_tag LOCUS_t0150 52759 52839 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 53751 52930 gene locus_tag LOCUS_1800 53751 52930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1800 53941 54351 gene locus_tag LOCUS_1810 53941 54351 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051894.1 protein_id gnl|my_center|LOCUS_1810 54371 54856 gene locus_tag LOCUS_1820 54371 54856 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112265.1 protein_id gnl|my_center|LOCUS_1820 55753 54992 gene locus_tag LOCUS_1830 55753 54992 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389762.1 protein_id gnl|my_center|LOCUS_1830 55984 57507 gene locus_tag LOCUS_1840 55984 57507 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051898.1 protein_id gnl|my_center|LOCUS_1840 58358 57621 gene locus_tag LOCUS_1850 58358 57621 CDS product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027675.1 protein_id gnl|my_center|LOCUS_1850 58688 58404 gene locus_tag LOCUS_1860 58688 58404 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003835265.1 protein_id gnl|my_center|LOCUS_1860 60804 59245 gene locus_tag LOCUS_1870 60804 59245 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068246.1 protein_id gnl|my_center|LOCUS_1870 62329 60881 gene locus_tag LOCUS_1880 62329 60881 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947073.1 protein_id gnl|my_center|LOCUS_1880 62821 62417 gene locus_tag LOCUS_1890 62821 62417 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080545171.1 protein_id gnl|my_center|LOCUS_1890 64432 63344 gene locus_tag LOCUS_1900 64432 63344 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389772.1 protein_id gnl|my_center|LOCUS_1900 65241 64498 gene locus_tag LOCUS_1910 65241 64498 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051909.1 protein_id gnl|my_center|LOCUS_1910 65466 66101 gene locus_tag LOCUS_1920 65466 66101 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812708.1 protein_id gnl|my_center|LOCUS_1920 67202 66342 gene locus_tag LOCUS_1930 67202 66342 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068242.1 protein_id gnl|my_center|LOCUS_1930 68131 67199 gene locus_tag LOCUS_1940 68131 67199 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053564.1 protein_id gnl|my_center|LOCUS_1940 68266 69174 gene locus_tag LOCUS_1950 68266 69174 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053562.1 protein_id gnl|my_center|LOCUS_1950 69448 70926 gene locus_tag LOCUS_1960 gene rpsA 69448 70926 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113153.1 protein_id gnl|my_center|LOCUS_1960 71056 71400 gene locus_tag LOCUS_1970 71056 71400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_1970 71431 73173 gene locus_tag LOCUS_1980 gene uvrB 71431 73173 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389776.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_1980 73217 74305 gene locus_tag LOCUS_1990 73217 74305 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812727.1 protein_id gnl|my_center|LOCUS_1990 74396 75832 gene locus_tag LOCUS_2000 gene pyk 74396 75832 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055467.1 protein_id gnl|my_center|LOCUS_2000 76527 76012 gene locus_tag LOCUS_2010 76527 76012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2010 76700 76774 gene locus_tag LOCUS_t0160 76700 76774 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 76844 77434 gene locus_tag LOCUS_2020 76844 77434 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805096.1 protein_id gnl|my_center|LOCUS_2020 77570 80680 gene locus_tag LOCUS_2030 gene polA 77570 80680 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389778.1 protein_id gnl|my_center|LOCUS_2030 80725 81750 gene locus_tag LOCUS_2040 80725 81750 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389779.1 protein_id gnl|my_center|LOCUS_2040 82758 82114 gene locus_tag LOCUS_2050 82758 82114 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068381.1 protein_id gnl|my_center|LOCUS_2050 82852 84342 gene locus_tag LOCUS_2060 82852 84342 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128519551.1 protein_id gnl|my_center|LOCUS_2060 84383 85492 gene locus_tag LOCUS_2070 84383 85492 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224434606.1 protein_id gnl|my_center|LOCUS_2070 85568 86482 gene locus_tag LOCUS_2080 85568 86482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_2080 86562 87203 gene locus_tag LOCUS_2090 86562 87203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2090 87262 87474 gene locus_tag LOCUS_2100 87262 87474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2100 88404 87382 gene locus_tag LOCUS_2110 88404 87382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2110 89561 88416 gene locus_tag LOCUS_2120 89561 88416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2120 90923 89577 gene locus_tag LOCUS_2130 90923 89577 CDS product O-antigen polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254557.1 protein_id gnl|my_center|LOCUS_2130 92053 90923 gene locus_tag LOCUS_2140 92053 90923 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_2140 92214 92954 gene locus_tag LOCUS_2150 92214 92954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2150 93238 92963 gene locus_tag LOCUS_2160 gene yafQ 93238 92963 CDS product type II toxin-antitoxin system mRNA interferase toxin YafQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303998.1 protein_id gnl|my_center|LOCUS_2160 93581 93656 gene locus_tag LOCUS_t0170 93581 93656 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 93793 93996 gene locus_tag LOCUS_2170 93793 93996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2170 94419 93895 gene locus_tag LOCUS_2180 94419 93895 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057255.1 protein_id gnl|my_center|LOCUS_2180 95694 94447 gene locus_tag LOCUS_2190 95694 94447 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804838.1 protein_id gnl|my_center|LOCUS_2190 96704 95757 gene locus_tag LOCUS_2200 96704 95757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2200 98457 96889 gene locus_tag LOCUS_2210 98457 96889 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068002.1 protein_id gnl|my_center|LOCUS_2210 98578 100065 gene locus_tag LOCUS_2220 98578 100065 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389673.1 protein_id gnl|my_center|LOCUS_2220 100985 100116 gene locus_tag LOCUS_2230 100985 100116 CDS product DUF4422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476440.1 protein_id gnl|my_center|LOCUS_2230 101140 102594 gene locus_tag LOCUS_2240 101140 102594 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068360.1 protein_id gnl|my_center|LOCUS_2240 102591 103073 gene locus_tag LOCUS_2250 102591 103073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2250 103073 104722 gene locus_tag LOCUS_2260 103073 104722 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068382.1 protein_id gnl|my_center|LOCUS_2260 106728 104902 gene locus_tag LOCUS_2270 106728 104902 CDS product DUF4012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060618734.1 protein_id gnl|my_center|LOCUS_2270 106882 106957 gene locus_tag LOCUS_t0180 106882 106957 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 107365 107021 gene locus_tag LOCUS_2280 107365 107021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2280 108768 107542 gene locus_tag LOCUS_2290 108768 107542 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068227.1 protein_id gnl|my_center|LOCUS_2290 110651 108897 gene locus_tag LOCUS_2300 gene pta 110651 108897 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582495.1 protein_id gnl|my_center|LOCUS_2300 113344 110825 gene locus_tag LOCUS_2310 113344 110825 CDS product phosphoketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112522.1 protein_id gnl|my_center|LOCUS_2310 113944 114816 gene locus_tag LOCUS_2320 113944 114816 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674118.1 protein_id gnl|my_center|LOCUS_2320 116407 115760 gene locus_tag LOCUS_2330 116407 115760 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393503.1 protein_id gnl|my_center|LOCUS_2330 116503 117279 gene locus_tag LOCUS_2340 116503 117279 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785293.1 protein_id gnl|my_center|LOCUS_2340 117827 117408 gene locus_tag LOCUS_2350 117827 117408 CDS product DUF2871 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803846.1 protein_id gnl|my_center|LOCUS_2350 118047 118628 gene locus_tag LOCUS_2360 118047 118628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2360 119770 118769 gene locus_tag LOCUS_2370 119770 118769 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582853.1 protein_id gnl|my_center|LOCUS_2370 120031 120468 gene locus_tag LOCUS_2380 120031 120468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_2380 120559 120825 gene locus_tag LOCUS_2390 120559 120825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_2390 122019 121021 gene locus_tag LOCUS_2400 122019 121021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2400 122047 124677 gene locus_tag LOCUS_2410 122047 124677 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389805.1 protein_id gnl|my_center|LOCUS_2410 124934 125560 gene locus_tag LOCUS_2420 gene rpsD 124934 125560 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052130.1 protein_id gnl|my_center|LOCUS_2420 125677 126372 gene locus_tag LOCUS_2430 125677 126372 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055085.1 protein_id gnl|my_center|LOCUS_2430 126496 126921 gene locus_tag LOCUS_2440 126496 126921 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812859.1 protein_id gnl|my_center|LOCUS_2440 126923 127177 gene locus_tag LOCUS_2450 126923 127177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812861.1 protein_id gnl|my_center|LOCUS_2450 127256 129955 gene locus_tag LOCUS_2460 gene alaS 127256 129955 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053385.1 protein_id gnl|my_center|LOCUS_2460 129957 130436 gene locus_tag LOCUS_2470 gene ruvX 129957 130436 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053384.1 protein_id gnl|my_center|LOCUS_2470 130808 130509 gene locus_tag LOCUS_2480 130808 130509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2480 130875 132170 gene locus_tag LOCUS_2490 gene mltG 130875 132170 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053383.1 protein_id gnl|my_center|LOCUS_2490 132688 134355 gene locus_tag LOCUS_2500 132688 134355 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052143.1 protein_id gnl|my_center|LOCUS_2500 134521 136032 gene locus_tag LOCUS_2510 gene sufB 134521 136032 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994877.1 protein_id gnl|my_center|LOCUS_2510 136032 137255 gene locus_tag LOCUS_2520 gene sufD 136032 137255 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389813.1 protein_id gnl|my_center|LOCUS_2520 137255 138031 gene locus_tag LOCUS_2530 gene sufC 137255 138031 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113429.1 protein_id gnl|my_center|LOCUS_2530 138028 139329 gene locus_tag LOCUS_2540 138028 139329 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389815.1 protein_id gnl|my_center|LOCUS_2540 139326 140000 gene locus_tag LOCUS_2550 139326 140000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2550 139997 140452 gene locus_tag LOCUS_2560 139997 140452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2560 >Feature sequence03 1284 103 gene locus_tag LOCUS_2570 1284 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2570 1620 2942 gene locus_tag LOCUS_2580 1620 2942 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363673.1 protein_id gnl|my_center|LOCUS_2580 3016 3891 gene locus_tag LOCUS_2590 3016 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_2590 3893 4690 gene locus_tag LOCUS_2600 3893 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2600 5893 4832 gene locus_tag LOCUS_2610 5893 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2610 6696 6445 gene locus_tag LOCUS_2620 6696 6445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2620 10114 6725 gene locus_tag LOCUS_2630 10114 6725 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401853.1 protein_id gnl|my_center|LOCUS_2630 10210 10827 gene locus_tag LOCUS_2640 10210 10827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2640 11089 12387 gene locus_tag LOCUS_2650 11089 12387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2650 13049 12486 gene locus_tag LOCUS_2660 13049 12486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2660 14032 13052 gene locus_tag LOCUS_2670 gene bsh 14032 13052 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546965.1 protein_id gnl|my_center|LOCUS_2670 15187 14228 gene locus_tag LOCUS_2680 15187 14228 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052404.1 protein_id gnl|my_center|LOCUS_2680 18148 15242 gene locus_tag LOCUS_2690 gene secA 18148 15242 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390085.1 protein_id gnl|my_center|LOCUS_2690 19007 18357 gene locus_tag LOCUS_2700 gene raiA 19007 18357 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052648.1 protein_id gnl|my_center|LOCUS_2700 20194 19661 gene locus_tag LOCUS_2710 20194 19661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2710 21349 20216 gene locus_tag LOCUS_2720 gene recA 21349 20216 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052644.1 protein_id gnl|my_center|LOCUS_2720 21771 21535 gene locus_tag LOCUS_2730 21771 21535 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813799.1 protein_id gnl|my_center|LOCUS_2730 22314 21784 gene locus_tag LOCUS_2740 22314 21784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2740 25681 24380 gene locus_tag LOCUS_2750 25681 24380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2750 26585 25668 gene locus_tag LOCUS_2760 26585 25668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2760 28306 27791 gene locus_tag LOCUS_2770 28306 27791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2770 29406 28555 gene locus_tag LOCUS_2780 29406 28555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2780 31323 30751 gene locus_tag LOCUS_2790 31323 30751 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068035.1 protein_id gnl|my_center|LOCUS_2790 31979 31320 gene locus_tag LOCUS_2800 gene pgsA 31979 31320 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813804.1 protein_id gnl|my_center|LOCUS_2800 35149 32099 gene locus_tag LOCUS_2810 35149 32099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2810 36438 35323 gene locus_tag LOCUS_2820 gene miaA 36438 35323 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052636.1 protein_id gnl|my_center|LOCUS_2820 37940 36435 gene locus_tag LOCUS_2830 gene miaB 37940 36435 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032743317.1 protein_id gnl|my_center|LOCUS_2830 38062 38853 gene locus_tag LOCUS_2840 38062 38853 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052631.1 protein_id gnl|my_center|LOCUS_2840 40611 39583 gene locus_tag LOCUS_2850 40611 39583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2850 42012 40726 gene locus_tag LOCUS_2860 42012 40726 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389698.1 protein_id gnl|my_center|LOCUS_2860 42934 42002 gene locus_tag LOCUS_2870 42934 42002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2870 43850 42960 gene locus_tag LOCUS_2880 43850 42960 CDS product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068026.1 protein_id gnl|my_center|LOCUS_2880 44784 43915 gene locus_tag LOCUS_2890 44784 43915 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058594.1 protein_id gnl|my_center|LOCUS_2890 45875 44850 gene locus_tag LOCUS_2900 45875 44850 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058617.1 protein_id gnl|my_center|LOCUS_2900 45912 46241 gene locus_tag LOCUS_2910 45912 46241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2910 46662 46204 gene locus_tag LOCUS_2920 46662 46204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574855.1 protein_id gnl|my_center|LOCUS_2920 48664 46712 gene locus_tag LOCUS_2930 gene typA 48664 46712 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114597.1 protein_id gnl|my_center|LOCUS_2930 49591 48752 gene locus_tag LOCUS_2940 49591 48752 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389684.1 protein_id gnl|my_center|LOCUS_2940 50575 49634 gene locus_tag LOCUS_2950 gene xerD 50575 49634 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068014.1 protein_id gnl|my_center|LOCUS_2950 51108 50725 gene locus_tag LOCUS_2960 gene rplT 51108 50725 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068013.1 protein_id gnl|my_center|LOCUS_2960 51349 51155 gene locus_tag LOCUS_2970 gene rpmI 51349 51155 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812404.1 protein_id gnl|my_center|LOCUS_2970 52016 51330 gene locus_tag LOCUS_2980 gene infC 52016 51330 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817101.1 protein_id gnl|my_center|LOCUS_2980 52347 53405 gene locus_tag LOCUS_2990 gene gap 52347 53405 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812396.1 protein_id gnl|my_center|LOCUS_2990 54143 54310 gene locus_tag LOCUS_3000 54143 54310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3000 54827 54588 gene locus_tag LOCUS_3010 54827 54588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3010 55714 55256 gene locus_tag LOCUS_3020 55714 55256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3020 56520 55861 gene locus_tag LOCUS_3030 56520 55861 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057260.1 protein_id gnl|my_center|LOCUS_3030 56664 57452 gene locus_tag LOCUS_3040 56664 57452 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113025.1 protein_id gnl|my_center|LOCUS_3040 57608 59182 gene locus_tag LOCUS_3050 57608 59182 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054433.1 protein_id gnl|my_center|LOCUS_3050 60559 59333 gene locus_tag LOCUS_3060 60559 59333 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052436.1 protein_id gnl|my_center|LOCUS_3060 61420 61493 gene locus_tag LOCUS_t0190 61420 61493 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 63049 61574 gene locus_tag LOCUS_3070 gene tyrP 63049 61574 CDS product tyrosine-tyramine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355453.1 protein_id gnl|my_center|LOCUS_3070 63990 63508 gene locus_tag LOCUS_3080 63990 63508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_3080 64896 64564 gene locus_tag LOCUS_3090 64896 64564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3090 67909 64928 gene locus_tag LOCUS_3100 67909 64928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3100 68631 67909 gene locus_tag LOCUS_3110 68631 67909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3110 70063 69743 gene locus_tag LOCUS_3120 70063 69743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3120 72668 72269 gene locus_tag LOCUS_tm0010 72668 72269 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 73161 72679 gene locus_tag LOCUS_3130 gene dtd 73161 72679 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928208.1 protein_id gnl|my_center|LOCUS_3130 74282 73194 gene locus_tag LOCUS_3140 74282 73194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3140 76009 74282 gene locus_tag LOCUS_3150 gene murC 76009 74282 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054402.1 protein_id gnl|my_center|LOCUS_3150 75914 76005 gene locus_tag LOCUS_t0200 75914 76005 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 77226 76012 gene locus_tag LOCUS_3160 77226 76012 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812327.1 protein_id gnl|my_center|LOCUS_3160 78450 77266 gene locus_tag LOCUS_3170 78450 77266 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389663.1 protein_id gnl|my_center|LOCUS_3170 80077 78632 gene locus_tag LOCUS_3180 gene murD 80077 78632 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067983.1 protein_id gnl|my_center|LOCUS_3180 81260 80157 gene locus_tag LOCUS_3190 gene mraY 81260 80157 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817007.1 protein_id gnl|my_center|LOCUS_3190 82798 81311 gene locus_tag LOCUS_3200 82798 81311 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054398.1 protein_id gnl|my_center|LOCUS_3200 83737 82814 gene locus_tag LOCUS_3210 83737 82814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389660.1 protein_id gnl|my_center|LOCUS_3210 85700 83793 gene locus_tag LOCUS_3220 85700 83793 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052544.1 protein_id gnl|my_center|LOCUS_3220 86176 85769 gene locus_tag LOCUS_3230 86176 85769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3230 87264 86173 gene locus_tag LOCUS_3240 gene rsmH 87264 86173 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389657.1 protein_id gnl|my_center|LOCUS_3240 87496 89793 gene locus_tag LOCUS_3250 87496 89793 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363236.1 protein_id gnl|my_center|LOCUS_3250 90375 89839 gene locus_tag LOCUS_3260 gene nrdR 90375 89839 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056380.1 protein_id gnl|my_center|LOCUS_3260 90499 91227 gene locus_tag LOCUS_3270 gene lexA 90499 91227 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052535.1 protein_id gnl|my_center|LOCUS_3270 92403 91297 gene locus_tag LOCUS_3280 gene fni 92403 91297 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254369.1 protein_id gnl|my_center|LOCUS_3280 95440 93272 gene locus_tag LOCUS_3290 95440 93272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3290 97190 96090 gene locus_tag LOCUS_3300 97190 96090 CDS product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569800.1 protein_id gnl|my_center|LOCUS_3300 98281 97187 gene locus_tag LOCUS_3310 gene mvaD 98281 97187 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547574.1 protein_id gnl|my_center|LOCUS_3310 99197 98283 gene locus_tag LOCUS_3320 gene mvk 99197 98283 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547572.1 protein_id gnl|my_center|LOCUS_3320 100541 99201 gene locus_tag LOCUS_3330 100541 99201 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389676.1 protein_id gnl|my_center|LOCUS_3330 101042 100623 gene locus_tag LOCUS_3340 101042 100623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3340 103525 102149 gene locus_tag LOCUS_3350 103525 102149 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547458.1 protein_id gnl|my_center|LOCUS_3350 103698 103925 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgggaattagcatccatcctctttgatagactgg 104311 103976 gene locus_tag LOCUS_3360 104311 103976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3360 105233 104298 gene locus_tag LOCUS_3370 gene cas1 105233 104298 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_3370 107569 105230 gene locus_tag LOCUS_3380 107569 105230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3380 108735 107509 gene locus_tag LOCUS_3390 108735 107509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3390 110130 109168 gene locus_tag LOCUS_3400 110130 109168 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812295.1 protein_id gnl|my_center|LOCUS_3400 111812 110253 gene locus_tag LOCUS_3410 gene hflX 111812 110253 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812294.1 protein_id gnl|my_center|LOCUS_3410 112051 112689 gene locus_tag LOCUS_3420 112051 112689 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389654.1 protein_id gnl|my_center|LOCUS_3420 >Feature sequence04 3865 5544 gene locus_tag LOCUS_3430 gene ettA 3865 5544 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068794.1 protein_id gnl|my_center|LOCUS_3430 5596 6549 gene locus_tag LOCUS_3440 5596 6549 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068793.1 protein_id gnl|my_center|LOCUS_3440 7668 7027 gene locus_tag LOCUS_3450 7668 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3450 8849 8268 gene locus_tag LOCUS_3460 8849 8268 CDS product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814779.1 protein_id gnl|my_center|LOCUS_3460 9799 8846 gene locus_tag LOCUS_3470 9799 8846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3470 10790 9792 gene locus_tag LOCUS_3480 gene folP 10790 9792 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068790.1 protein_id gnl|my_center|LOCUS_3480 11409 10792 gene locus_tag LOCUS_3490 gene folE 11409 10792 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052379.1 protein_id gnl|my_center|LOCUS_3490 13501 11402 gene locus_tag LOCUS_3500 gene ftsH 13501 11402 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363794.1 protein_id gnl|my_center|LOCUS_3500 14070 13498 gene locus_tag LOCUS_3510 gene hpt 14070 13498 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816281.1 protein_id gnl|my_center|LOCUS_3510 15202 14057 gene locus_tag LOCUS_3520 gene tilS 15202 14057 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390178.1 protein_id gnl|my_center|LOCUS_3520 16691 15213 gene locus_tag LOCUS_3530 gene dacB 16691 15213 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068787.1 protein_id gnl|my_center|LOCUS_3530 17990 16719 gene locus_tag LOCUS_3540 17990 16719 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814758.1 protein_id gnl|my_center|LOCUS_3540 19715 17997 gene locus_tag LOCUS_3550 19715 17997 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068783.1 protein_id gnl|my_center|LOCUS_3550 19853 20776 gene locus_tag LOCUS_3560 19853 20776 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068782.1 protein_id gnl|my_center|LOCUS_3560 21829 20819 gene locus_tag LOCUS_3570 gene galE 21829 20819 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068781.1 protein_id gnl|my_center|LOCUS_3570 22570 21902 gene locus_tag LOCUS_3580 22570 21902 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811906.1 protein_id gnl|my_center|LOCUS_3580 23391 22609 gene locus_tag LOCUS_3590 gene rph 23391 22609 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058292.1 protein_id gnl|my_center|LOCUS_3590 23579 24373 gene locus_tag LOCUS_3600 23579 24373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3600 24552 24731 gene locus_tag LOCUS_3610 24552 24731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3610 24805 26199 gene locus_tag LOCUS_3620 24805 26199 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055715.1 protein_id gnl|my_center|LOCUS_3620 26761 26333 gene locus_tag LOCUS_3630 26761 26333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3630 28457 26916 gene locus_tag LOCUS_3640 28457 26916 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547458.1 protein_id gnl|my_center|LOCUS_3640 28899 28627 gene locus_tag LOCUS_3650 28899 28627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3650 29040 29669 gene locus_tag LOCUS_3660 29040 29669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3660 29756 30394 gene locus_tag LOCUS_3670 29756 30394 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811890.1 protein_id gnl|my_center|LOCUS_3670 30465 30659 gene locus_tag LOCUS_3680 gene rpmF 30465 30659 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811892.1 protein_id gnl|my_center|LOCUS_3680 30785 31642 gene locus_tag LOCUS_3690 gene rnc 30785 31642 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117354.1 protein_id gnl|my_center|LOCUS_3690 33635 31722 gene locus_tag LOCUS_3700 33635 31722 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729311.1 protein_id gnl|my_center|LOCUS_3700 33733 35313 gene locus_tag LOCUS_3710 gene cysS 33733 35313 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068414.1 protein_id gnl|my_center|LOCUS_3710 36455 38062 gene locus_tag LOCUS_3720 gene ffh 36455 38062 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022527326.1 protein_id gnl|my_center|LOCUS_3720 38138 39460 gene locus_tag LOCUS_3730 38138 39460 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068417.1 protein_id gnl|my_center|LOCUS_3730 39663 40106 gene locus_tag LOCUS_3740 39663 40106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3740 40109 40342 gene locus_tag LOCUS_3750 40109 40342 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051427.1 protein_id gnl|my_center|LOCUS_3750 40339 40899 gene locus_tag LOCUS_3760 gene rimM 40339 40899 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389537.1 protein_id gnl|my_center|LOCUS_3760 40982 41479 gene locus_tag LOCUS_3770 40982 41479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3770 41553 42425 gene locus_tag LOCUS_3780 gene trmD 41553 42425 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054789.1 protein_id gnl|my_center|LOCUS_3780 43407 43096 gene locus_tag LOCUS_3790 43407 43096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_3790 43585 43415 gene locus_tag LOCUS_3800 43585 43415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3800 44305 43889 gene locus_tag LOCUS_3810 44305 43889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3810 45368 44718 gene locus_tag LOCUS_3820 45368 44718 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811847.1 protein_id gnl|my_center|LOCUS_3820 47709 45379 gene locus_tag LOCUS_3830 47709 45379 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994858.1 protein_id gnl|my_center|LOCUS_3830 48099 47902 gene locus_tag LOCUS_3840 gene rpmB 48099 47902 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051452.1 protein_id gnl|my_center|LOCUS_3840 49433 48216 gene locus_tag LOCUS_3850 49433 48216 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389489.1 protein_id gnl|my_center|LOCUS_3850 50428 49430 gene locus_tag LOCUS_3860 50428 49430 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811732.1 protein_id gnl|my_center|LOCUS_3860 51564 50596 gene locus_tag LOCUS_3870 51564 50596 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081634.1 protein_id gnl|my_center|LOCUS_3870 52916 51609 gene locus_tag LOCUS_3880 gene murA 52916 51609 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399439.1 protein_id gnl|my_center|LOCUS_3880 54509 53019 gene locus_tag LOCUS_3890 54509 53019 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389459.1 protein_id gnl|my_center|LOCUS_3890 54786 54712 gene locus_tag LOCUS_t0210 54786 54712 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 54906 54833 gene locus_tag LOCUS_t0220 54906 54833 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 56423 54954 gene locus_tag LOCUS_3900 gene gltX 56423 54954 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051591.1 protein_id gnl|my_center|LOCUS_3900 58489 59619 gene locus_tag LOCUS_3910 58489 59619 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389455.1 protein_id gnl|my_center|LOCUS_3910 59652 60545 gene locus_tag LOCUS_3920 59652 60545 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389454.1 protein_id gnl|my_center|LOCUS_3920 61331 60660 gene locus_tag LOCUS_3930 61331 60660 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051596.1 protein_id gnl|my_center|LOCUS_3930 61848 61351 gene locus_tag LOCUS_3940 61848 61351 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114300.1 protein_id gnl|my_center|LOCUS_3940 63370 61916 gene locus_tag LOCUS_3950 63370 61916 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389574.1 protein_id gnl|my_center|LOCUS_3950 64042 63587 gene locus_tag LOCUS_3960 gene rplI 64042 63587 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389496.1 protein_id gnl|my_center|LOCUS_3960 64310 64062 gene locus_tag LOCUS_3970 gene rpsR 64310 64062 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051545.1 protein_id gnl|my_center|LOCUS_3970 64932 64354 gene locus_tag LOCUS_3980 64932 64354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3980 65275 65000 gene locus_tag LOCUS_3990 gene rpsF 65275 65000 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101886572.1 protein_id gnl|my_center|LOCUS_3990 67769 65454 gene locus_tag LOCUS_4000 67769 65454 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068304.1 protein_id gnl|my_center|LOCUS_4000 68712 68098 gene locus_tag LOCUS_4010 68712 68098 CDS product DUF5701 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051613.1 protein_id gnl|my_center|LOCUS_4010 69389 68793 gene locus_tag LOCUS_4020 gene recR 69389 68793 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051621.1 protein_id gnl|my_center|LOCUS_4020 71623 69398 gene locus_tag LOCUS_4030 71623 69398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4030 72112 72612 gene locus_tag LOCUS_4040 72112 72612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_4040 72650 73741 gene locus_tag LOCUS_4050 72650 73741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4050 73848 74639 gene locus_tag LOCUS_4060 73848 74639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013364002.1 protein_id gnl|my_center|LOCUS_4060 74838 74911 gene locus_tag LOCUS_t0230 74838 74911 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 76025 75711 gene locus_tag LOCUS_4070 76025 75711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4070 76275 76550 gene locus_tag LOCUS_4080 76275 76550 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975406.1 protein_id gnl|my_center|LOCUS_4080 79604 78147 gene locus_tag LOCUS_4090 gene tet(38) 79604 78147 CDS product tetracycline efflux MFS transporter Tet(38) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100299.1 protein_id gnl|my_center|LOCUS_4090 81011 79674 gene locus_tag LOCUS_4100 81011 79674 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125979625.1 protein_id gnl|my_center|LOCUS_4100 81635 81282 gene locus_tag LOCUS_4110 81635 81282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4110 81830 81648 gene locus_tag LOCUS_4120 81830 81648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4120 84196 82769 gene locus_tag LOCUS_4130 84196 82769 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958259.1 protein_id gnl|my_center|LOCUS_4130 84698 84399 gene locus_tag LOCUS_4140 84698 84399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4140 86253 84739 gene locus_tag LOCUS_4150 86253 84739 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513876.1 protein_id gnl|my_center|LOCUS_4150 88053 86491 gene locus_tag LOCUS_4160 88053 86491 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379815.1 protein_id gnl|my_center|LOCUS_4160 89236 88256 gene locus_tag LOCUS_4170 89236 88256 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363756.1 protein_id gnl|my_center|LOCUS_4170 89530 92106 gene locus_tag LOCUS_4180 89530 92106 CDS product YhgE/Pip family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143686.1 protein_id gnl|my_center|LOCUS_4180 92103 94469 gene locus_tag LOCUS_4190 92103 94469 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068490.1 protein_id gnl|my_center|LOCUS_4190 94956 94459 gene locus_tag LOCUS_4200 94956 94459 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390371.1 protein_id gnl|my_center|LOCUS_4200 96107 95748 gene locus_tag LOCUS_4210 96107 95748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4210 96134 96781 gene locus_tag LOCUS_4220 gene upp 96134 96781 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114100.1 protein_id gnl|my_center|LOCUS_4220 97487 96843 gene locus_tag LOCUS_4230 97487 96843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4230 98493 97558 gene locus_tag LOCUS_4240 98493 97558 CDS product histidine decarboxylase, pyruvoyl type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786245.1 protein_id gnl|my_center|LOCUS_4240 100183 98939 gene locus_tag LOCUS_4250 gene pyrB 100183 98939 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993908.1 protein_id gnl|my_center|LOCUS_4250 100550 101173 gene locus_tag LOCUS_4260 100550 101173 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052016.1 protein_id gnl|my_center|LOCUS_4260 101823 101251 gene locus_tag LOCUS_4270 101823 101251 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054672.1 protein_id gnl|my_center|LOCUS_4270 102864 101878 gene locus_tag LOCUS_4280 102864 101878 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390361.1 protein_id gnl|my_center|LOCUS_4280 103871 103044 gene locus_tag LOCUS_4290 103871 103044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4290 105742 103868 gene locus_tag LOCUS_4300 gene dnaK 105742 103868 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051640.1 protein_id gnl|my_center|LOCUS_4300 107079 106000 gene locus_tag LOCUS_4310 107079 106000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4310 107018 107284 gene locus_tag LOCUS_4320 107018 107284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4320 108166 107978 gene locus_tag LOCUS_4330 108166 107978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4330 109067 108627 gene locus_tag LOCUS_4340 109067 108627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4340 110215 109658 gene locus_tag LOCUS_4350 110215 109658 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965770.1 protein_id gnl|my_center|LOCUS_4350 <112273 110401 gene locus_tag LOCUS_4360 <112273 110401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389508.1:ATP-dependent chaperone ClpB >Feature sequence05 951 85 gene locus_tag LOCUS_4370 951 85 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812896.1 protein_id gnl|my_center|LOCUS_4370 2642 948 gene locus_tag LOCUS_4380 2642 948 CDS product bifunctional aspartate transaminase/aspartate 4-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549954.1 protein_id gnl|my_center|LOCUS_4380 2796 2707 gene locus_tag LOCUS_t0240 2796 2707 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2930 3304 gene locus_tag LOCUS_4390 2930 3304 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055091.1 protein_id gnl|my_center|LOCUS_4390 3388 4416 gene locus_tag LOCUS_4400 3388 4416 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389817.1 protein_id gnl|my_center|LOCUS_4400 4413 5048 gene locus_tag LOCUS_4410 gene ybeY 4413 5048 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113111.1 protein_id gnl|my_center|LOCUS_4410 5051 6427 gene locus_tag LOCUS_4420 5051 6427 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052157.1 protein_id gnl|my_center|LOCUS_4420 6436 7566 gene locus_tag LOCUS_4430 gene era 6436 7566 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994154.1 protein_id gnl|my_center|LOCUS_4430 10770 8803 gene locus_tag LOCUS_4440 10770 8803 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582533.1 protein_id gnl|my_center|LOCUS_4440 12246 12848 gene locus_tag LOCUS_4450 12246 12848 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812918.1 protein_id gnl|my_center|LOCUS_4450 12933 13196 gene locus_tag LOCUS_4460 gene rpsT 12933 13196 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113577.1 protein_id gnl|my_center|LOCUS_4460 13320 15197 gene locus_tag LOCUS_4470 gene lepA 13320 15197 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363424.1 protein_id gnl|my_center|LOCUS_4470 15194 16555 gene locus_tag LOCUS_4480 gene hemW 15194 16555 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101886487.1 protein_id gnl|my_center|LOCUS_4480 16608 17042 gene locus_tag LOCUS_4490 16608 17042 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068160.1 protein_id gnl|my_center|LOCUS_4490 17335 19098 gene locus_tag LOCUS_4500 17335 19098 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014012.1 protein_id gnl|my_center|LOCUS_4500 19100 21043 gene locus_tag LOCUS_4510 19100 21043 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776694.1 protein_id gnl|my_center|LOCUS_4510 21121 22323 gene locus_tag LOCUS_4520 21121 22323 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068134.1 protein_id gnl|my_center|LOCUS_4520 23384 22593 gene locus_tag LOCUS_4530 23384 22593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4530 25037 23436 gene locus_tag LOCUS_4540 25037 23436 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813299.1 protein_id gnl|my_center|LOCUS_4540 25276 28215 gene locus_tag LOCUS_4550 gene uvrA 25276 28215 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813285.1 protein_id gnl|my_center|LOCUS_4550 28290 30560 gene locus_tag LOCUS_4560 gene uvrC 28290 30560 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389954.1 protein_id gnl|my_center|LOCUS_4560 30648 31556 gene locus_tag LOCUS_4570 gene rapZ 30648 31556 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363500.1 protein_id gnl|my_center|LOCUS_4570 31553 32488 gene locus_tag LOCUS_4580 gene yvcK 31553 32488 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028061.1 protein_id gnl|my_center|LOCUS_4580 32631 33608 gene locus_tag LOCUS_4590 gene whiA 32631 33608 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813277.1 protein_id gnl|my_center|LOCUS_4590 33649 34845 gene locus_tag LOCUS_4600 33649 34845 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032737730.1 protein_id gnl|my_center|LOCUS_4600 34866 35675 gene locus_tag LOCUS_4610 gene tpiA 34866 35675 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389952.1 protein_id gnl|my_center|LOCUS_4610 35802 36065 gene locus_tag LOCUS_4620 gene secG 35802 36065 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813271.1 protein_id gnl|my_center|LOCUS_4620 37357 36248 gene locus_tag LOCUS_4630 gene tal 37357 36248 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813255.1 protein_id gnl|my_center|LOCUS_4630 39631 37427 gene locus_tag LOCUS_4640 gene tkt 39631 37427 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117899.1 protein_id gnl|my_center|LOCUS_4640 39891 40946 gene locus_tag LOCUS_4650 gene hrcA 39891 40946 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068110.1 protein_id gnl|my_center|LOCUS_4650 40996 42141 gene locus_tag LOCUS_4660 gene dnaJ 40996 42141 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813250.1 protein_id gnl|my_center|LOCUS_4660 43129 42161 gene locus_tag LOCUS_4670 43129 42161 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068111.1 protein_id gnl|my_center|LOCUS_4670 43295 43368 gene locus_tag LOCUS_t0250 43295 43368 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 43394 43465 gene locus_tag LOCUS_t0260 43394 43465 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 43504 43577 gene locus_tag LOCUS_t0270 43504 43577 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 43617 43690 gene locus_tag LOCUS_t0280 43617 43690 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 43834 45885 gene locus_tag LOCUS_4680 gene thrS 43834 45885 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054284.1 protein_id gnl|my_center|LOCUS_4680 46017 46775 gene locus_tag LOCUS_4690 46017 46775 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052855.1 protein_id gnl|my_center|LOCUS_4690 46788 47375 gene locus_tag LOCUS_4700 gene ruvC 46788 47375 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052856.1 protein_id gnl|my_center|LOCUS_4700 47431 48054 gene locus_tag LOCUS_4710 gene ruvA 47431 48054 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113653.1 protein_id gnl|my_center|LOCUS_4710 48054 49100 gene locus_tag LOCUS_4720 gene ruvB 48054 49100 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054282.1 protein_id gnl|my_center|LOCUS_4720 49152 49649 gene locus_tag LOCUS_4730 49152 49649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4730 49691 50287 gene locus_tag LOCUS_4740 49691 50287 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068112.1 protein_id gnl|my_center|LOCUS_4740 50383 50676 gene locus_tag LOCUS_4750 50383 50676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813210.1 protein_id gnl|my_center|LOCUS_4750 52004 51045 gene locus_tag LOCUS_4760 52004 51045 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052865.1 protein_id gnl|my_center|LOCUS_4760 52223 53002 gene locus_tag LOCUS_4770 52223 53002 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052866.1 protein_id gnl|my_center|LOCUS_4770 52999 55191 gene locus_tag LOCUS_4780 gene der 52999 55191 CDS product bifunctional cytidylate kinase/GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055764.1 protein_id gnl|my_center|LOCUS_4780 55354 56742 gene locus_tag LOCUS_4790 55354 56742 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389920.1 protein_id gnl|my_center|LOCUS_4790 56880 58739 gene locus_tag LOCUS_4800 56880 58739 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817902.1 protein_id gnl|my_center|LOCUS_4800 58744 59064 gene locus_tag LOCUS_4810 58744 59064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389921.1 protein_id gnl|my_center|LOCUS_4810 59161 61674 gene locus_tag LOCUS_4820 59161 61674 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068114.1 protein_id gnl|my_center|LOCUS_4820 61773 62126 gene locus_tag LOCUS_4830 61773 62126 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813163.1 protein_id gnl|my_center|LOCUS_4830 62732 62184 gene locus_tag LOCUS_4840 62732 62184 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052293.1 protein_id gnl|my_center|LOCUS_4840 63167 62742 gene locus_tag LOCUS_4850 63167 62742 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821296.1 protein_id gnl|my_center|LOCUS_4850 63861 63232 gene locus_tag LOCUS_4860 63861 63232 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389928.1 protein_id gnl|my_center|LOCUS_4860 64582 63917 gene locus_tag LOCUS_4870 gene rpe 64582 63917 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111648.1 protein_id gnl|my_center|LOCUS_4870 65579 65292 gene locus_tag LOCUS_4880 65579 65292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4880 65565 65882 gene locus_tag LOCUS_4890 65565 65882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4890 67182 66175 gene locus_tag LOCUS_4900 gene lgt 67182 66175 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052284.1 protein_id gnl|my_center|LOCUS_4900 68455 67196 gene locus_tag LOCUS_4910 gene rlmN 68455 67196 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068098.1 protein_id gnl|my_center|LOCUS_4910 69498 68533 gene locus_tag LOCUS_4920 69498 68533 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052757.1 protein_id gnl|my_center|LOCUS_4920 70172 69618 gene locus_tag LOCUS_4930 gene frr 70172 69618 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813334.1 protein_id gnl|my_center|LOCUS_4930 70945 70217 gene locus_tag LOCUS_4940 gene pyrH 70945 70217 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052755.1 protein_id gnl|my_center|LOCUS_4940 71954 71094 gene locus_tag LOCUS_4950 gene tsf 71954 71094 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117867.1 protein_id gnl|my_center|LOCUS_4950 72768 71986 gene locus_tag LOCUS_4960 gene rpsB 72768 71986 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816510.1 protein_id gnl|my_center|LOCUS_4960 73483 73001 gene locus_tag LOCUS_4970 gene def 73483 73001 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052751.1 protein_id gnl|my_center|LOCUS_4970 73655 73729 gene locus_tag LOCUS_t0290 73655 73729 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 76002 74407 gene locus_tag LOCUS_4980 76002 74407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4980 76722 78557 gene locus_tag LOCUS_4990 76722 78557 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389968.1 protein_id gnl|my_center|LOCUS_4990 79373 78696 gene locus_tag LOCUS_5000 79373 78696 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816849.1 protein_id gnl|my_center|LOCUS_5000 80011 79373 gene locus_tag LOCUS_5010 80011 79373 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112615.1 protein_id gnl|my_center|LOCUS_5010 81576 80152 gene locus_tag LOCUS_5020 gene tig 81576 80152 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068214.1 protein_id gnl|my_center|LOCUS_5020 82891 81608 gene locus_tag LOCUS_5030 82891 81608 CDS product HRDC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390066.1 protein_id gnl|my_center|LOCUS_5030 83407 83000 gene locus_tag LOCUS_5040 83407 83000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5040 85152 83461 gene locus_tag LOCUS_5050 85152 83461 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390069.1 protein_id gnl|my_center|LOCUS_5050 85361 86791 gene locus_tag LOCUS_5060 85361 86791 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812447.1 protein_id gnl|my_center|LOCUS_5060 88263 86938 gene locus_tag LOCUS_5070 88263 86938 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994719.1 protein_id gnl|my_center|LOCUS_5070 91129 88502 gene locus_tag LOCUS_5080 91129 88502 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067921.1 protein_id gnl|my_center|LOCUS_5080 92955 91162 gene locus_tag LOCUS_5090 gene aspS 92955 91162 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067913.1 protein_id gnl|my_center|LOCUS_5090 94366 92960 gene locus_tag LOCUS_5100 gene hisS 94366 92960 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812547.1 protein_id gnl|my_center|LOCUS_5100 94470 95855 gene locus_tag LOCUS_5110 94470 95855 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389724.1 protein_id gnl|my_center|LOCUS_5110 98436 96055 gene locus_tag LOCUS_5120 98436 96055 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390076.1 protein_id gnl|my_center|LOCUS_5120 98903 98442 gene locus_tag LOCUS_5130 gene dut 98903 98442 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816978.1 protein_id gnl|my_center|LOCUS_5130 99468 99178 gene locus_tag LOCUS_5140 99468 99178 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112589.1 protein_id gnl|my_center|LOCUS_5140 99577 100827 gene locus_tag LOCUS_5150 gene sepH 99577 100827 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813754.1 protein_id gnl|my_center|LOCUS_5150 102107 100902 gene locus_tag LOCUS_5160 102107 100902 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054496.1 protein_id gnl|my_center|LOCUS_5160 102240 105002 gene locus_tag LOCUS_5170 102240 105002 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813761.1 protein_id gnl|my_center|LOCUS_5170 105552 105478 gene locus_tag LOCUS_t0300 105552 105478 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 107979 105649 gene locus_tag LOCUS_5180 107979 105649 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068045.1 protein_id gnl|my_center|LOCUS_5180 >Feature sequence06 1042 968 gene locus_tag LOCUS_t0310 1042 968 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1461 3104 gene locus_tag LOCUS_5190 gene lysS 1461 3104 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115592.1 protein_id gnl|my_center|LOCUS_5190 3129 4139 gene locus_tag LOCUS_5200 gene menA 3129 4139 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814664.1 protein_id gnl|my_center|LOCUS_5200 4228 4965 gene locus_tag LOCUS_5210 4228 4965 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112459.1 protein_id gnl|my_center|LOCUS_5210 5495 5082 gene locus_tag LOCUS_5220 5495 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5220 5658 6530 gene locus_tag LOCUS_5230 5658 6530 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390192.1 protein_id gnl|my_center|LOCUS_5230 6549 6749 gene locus_tag LOCUS_5240 6549 6749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5240 7081 6668 gene locus_tag LOCUS_5250 7081 6668 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390191.1 protein_id gnl|my_center|LOCUS_5250 8081 8881 gene locus_tag LOCUS_5260 8081 8881 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574972.1 protein_id gnl|my_center|LOCUS_5260 8927 9478 gene locus_tag LOCUS_5270 8927 9478 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818243.1 protein_id gnl|my_center|LOCUS_5270 9788 9715 gene locus_tag LOCUS_t0320 9788 9715 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 9893 9819 gene locus_tag LOCUS_t0330 9893 9819 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 10086 10790 gene locus_tag LOCUS_5280 10086 10790 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053023.1 protein_id gnl|my_center|LOCUS_5280 10780 11553 gene locus_tag LOCUS_5290 10780 11553 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390230.1 protein_id gnl|my_center|LOCUS_5290 11723 11923 gene locus_tag LOCUS_5300 11723 11923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5300 12856 13302 gene locus_tag LOCUS_5310 gene rplM 12856 13302 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114349.1 protein_id gnl|my_center|LOCUS_5310 13329 13817 gene locus_tag LOCUS_5320 gene rpsI 13329 13817 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114350.1 protein_id gnl|my_center|LOCUS_5320 14094 14408 gene locus_tag LOCUS_5330 gene rpsJ 14094 14408 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003827292.1 protein_id gnl|my_center|LOCUS_5330 14428 15084 gene locus_tag LOCUS_5340 gene rplC 14428 15084 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053031.1 protein_id gnl|my_center|LOCUS_5340 15086 15763 gene locus_tag LOCUS_5350 gene rplD 15086 15763 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114353.1 protein_id gnl|my_center|LOCUS_5350 15769 16068 gene locus_tag LOCUS_5360 gene rplW 15769 16068 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053033.1 protein_id gnl|my_center|LOCUS_5360 16099 16929 gene locus_tag LOCUS_5370 gene rplB 16099 16929 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114355.1 protein_id gnl|my_center|LOCUS_5370 16945 17223 gene locus_tag LOCUS_5380 gene rpsS 16945 17223 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814508.1 protein_id gnl|my_center|LOCUS_5380 17245 17610 gene locus_tag LOCUS_5390 gene rplV 17245 17610 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814510.1 protein_id gnl|my_center|LOCUS_5390 17610 18416 gene locus_tag LOCUS_5400 gene rpsC 17610 18416 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994481.1 protein_id gnl|my_center|LOCUS_5400 18422 18835 gene locus_tag LOCUS_5410 gene rplP 18422 18835 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814515.1 protein_id gnl|my_center|LOCUS_5410 18837 19139 gene locus_tag LOCUS_5420 gene rpmC 18837 19139 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814517.1 protein_id gnl|my_center|LOCUS_5420 19142 19408 gene locus_tag LOCUS_5430 gene rpsQ 19142 19408 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814519.1 protein_id gnl|my_center|LOCUS_5430 19488 19856 gene locus_tag LOCUS_5440 gene rplN 19488 19856 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829893.1 protein_id gnl|my_center|LOCUS_5440 19856 20194 gene locus_tag LOCUS_5450 gene rplX 19856 20194 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814523.1 protein_id gnl|my_center|LOCUS_5450 20191 20754 gene locus_tag LOCUS_5460 gene rplE 20191 20754 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814525.1 protein_id gnl|my_center|LOCUS_5460 20755 20940 gene locus_tag LOCUS_5470 20755 20940 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114370.1 protein_id gnl|my_center|LOCUS_5470 21037 21435 gene locus_tag LOCUS_5480 gene rpsH 21037 21435 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114372.1 protein_id gnl|my_center|LOCUS_5480 21452 21991 gene locus_tag LOCUS_5490 gene rplF 21452 21991 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814536.1 protein_id gnl|my_center|LOCUS_5490 21993 22364 gene locus_tag LOCUS_5500 gene rplR 21993 22364 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114376.1 protein_id gnl|my_center|LOCUS_5500 22361 23098 gene locus_tag LOCUS_5510 gene rpsE 22361 23098 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815670.1 protein_id gnl|my_center|LOCUS_5510 23098 23292 gene locus_tag LOCUS_5520 gene rpmD 23098 23292 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114379.1 protein_id gnl|my_center|LOCUS_5520 23295 23768 gene locus_tag LOCUS_5530 gene rplO 23295 23768 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814543.1 protein_id gnl|my_center|LOCUS_5530 23891 25201 gene locus_tag LOCUS_5540 gene secY 23891 25201 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053045.1 protein_id gnl|my_center|LOCUS_5540 25306 25869 gene locus_tag LOCUS_5550 25306 25869 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815675.1 protein_id gnl|my_center|LOCUS_5550 26041 26259 gene locus_tag LOCUS_5560 gene infA 26041 26259 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808114.1 protein_id gnl|my_center|LOCUS_5560 26539 26916 gene locus_tag LOCUS_5570 gene rpsM 26539 26916 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808138.1 protein_id gnl|my_center|LOCUS_5570 26976 27374 gene locus_tag LOCUS_5580 gene rpsK 26976 27374 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829907.1 protein_id gnl|my_center|LOCUS_5580 27456 28454 gene locus_tag LOCUS_5590 27456 28454 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114387.1 protein_id gnl|my_center|LOCUS_5590 28528 29166 gene locus_tag LOCUS_5600 28528 29166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5600 29293 30162 gene locus_tag LOCUS_5610 gene truA 29293 30162 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053050.1 protein_id gnl|my_center|LOCUS_5610 30367 30233 gene locus_tag LOCUS_5620 30367 30233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5620 30942 31244 gene locus_tag LOCUS_5630 30942 31244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5630 33163 33074 gene locus_tag LOCUS_t0340 33163 33074 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 33619 33308 gene locus_tag LOCUS_5640 33619 33308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5640 34138 34221 gene locus_tag LOCUS_t0350 34138 34221 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 34222 34296 gene locus_tag LOCUS_t0360 34222 34296 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 34298 34372 gene locus_tag LOCUS_t0370 34298 34372 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 34420 34587 gene locus_tag LOCUS_5650 gene rpmG 34420 34587 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100510685.1 protein_id gnl|my_center|LOCUS_5650 34794 36050 gene locus_tag LOCUS_5660 34794 36050 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390234.1 protein_id gnl|my_center|LOCUS_5660 36099 36422 gene locus_tag LOCUS_5670 36099 36422 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993619.1 protein_id gnl|my_center|LOCUS_5670 37863 36517 gene locus_tag LOCUS_5680 gene dinB 37863 36517 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390232.1 protein_id gnl|my_center|LOCUS_5680 38230 37904 gene locus_tag LOCUS_5690 38230 37904 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356887.1 protein_id gnl|my_center|LOCUS_5690 38255 38713 gene locus_tag LOCUS_5700 38255 38713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5700 38918 38831 gene locus_tag LOCUS_t0380 38918 38831 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 39312 39073 gene locus_tag LOCUS_5710 39312 39073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5710 40814 39357 gene locus_tag LOCUS_5720 40814 39357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5720 40976 45676 gene locus_tag LOCUS_5730 40976 45676 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389589.1 protein_id gnl|my_center|LOCUS_5730 45669 50240 gene locus_tag LOCUS_5740 45669 50240 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068346.1 protein_id gnl|my_center|LOCUS_5740 50456 52288 gene locus_tag LOCUS_5750 50456 52288 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812067.1 protein_id gnl|my_center|LOCUS_5750 52311 54935 gene locus_tag LOCUS_5760 gene pepN 52311 54935 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993767.1 protein_id gnl|my_center|LOCUS_5760 55033 55200 gene locus_tag LOCUS_5770 55033 55200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5770 56700 55234 gene locus_tag LOCUS_5780 56700 55234 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390136.1 protein_id gnl|my_center|LOCUS_5780 56904 58259 gene locus_tag LOCUS_5790 gene glmM 56904 58259 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812074.1 protein_id gnl|my_center|LOCUS_5790 58268 58915 gene locus_tag LOCUS_5800 58268 58915 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816189.1 protein_id gnl|my_center|LOCUS_5800 59149 59805 gene locus_tag LOCUS_5810 59149 59805 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476292.1 protein_id gnl|my_center|LOCUS_5810 62230 59768 gene locus_tag LOCUS_5820 62230 59768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143321.1 protein_id gnl|my_center|LOCUS_5820 62139 62339 gene locus_tag LOCUS_5830 62139 62339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5830 62404 65865 gene locus_tag LOCUS_5840 62404 65865 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582850.1 protein_id gnl|my_center|LOCUS_5840 66002 67195 gene locus_tag LOCUS_5850 66002 67195 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994898.1 protein_id gnl|my_center|LOCUS_5850 67268 68545 gene locus_tag LOCUS_5860 67268 68545 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575994.1 protein_id gnl|my_center|LOCUS_5860 68689 69855 gene locus_tag LOCUS_5870 68689 69855 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594933.1 protein_id gnl|my_center|LOCUS_5870 69842 72502 gene locus_tag LOCUS_5880 gene ligA 69842 72502 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389738.1 protein_id gnl|my_center|LOCUS_5880 72505 73836 gene locus_tag LOCUS_5890 72505 73836 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054010.1 protein_id gnl|my_center|LOCUS_5890 74530 74255 gene locus_tag LOCUS_5900 74530 74255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5900 74780 75412 gene locus_tag LOCUS_5910 74780 75412 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254592.1 protein_id gnl|my_center|LOCUS_5910 75571 77280 gene locus_tag LOCUS_5920 75571 77280 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777012.1 protein_id gnl|my_center|LOCUS_5920 78058 77369 gene locus_tag LOCUS_5930 78058 77369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5930 78206 79924 gene locus_tag LOCUS_5940 78206 79924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5940 80701 81819 gene locus_tag LOCUS_5950 80701 81819 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475604.1 protein_id gnl|my_center|LOCUS_5950 82727 81999 gene locus_tag LOCUS_5960 82727 81999 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051180.1 protein_id gnl|my_center|LOCUS_5960 84357 82816 gene locus_tag LOCUS_5970 84357 82816 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051179.1 protein_id gnl|my_center|LOCUS_5970 85017 84376 gene locus_tag LOCUS_5980 85017 84376 CDS product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582465.1 protein_id gnl|my_center|LOCUS_5980 85081 86487 gene locus_tag LOCUS_5990 85081 86487 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112492.1 protein_id gnl|my_center|LOCUS_5990 86696 87481 gene locus_tag LOCUS_6000 86696 87481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6000 87478 88149 gene locus_tag LOCUS_6010 87478 88149 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782764.1 protein_id gnl|my_center|LOCUS_6010 88149 90689 gene locus_tag LOCUS_6020 88149 90689 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116779.1 protein_id gnl|my_center|LOCUS_6020 91535 91813 gene locus_tag LOCUS_6030 91535 91813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6030 92145 91825 gene locus_tag LOCUS_6040 92145 91825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6040 92938 92162 gene locus_tag LOCUS_6050 92938 92162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6050 93019 93228 gene locus_tag LOCUS_6060 93019 93228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6060 93225 96638 gene locus_tag LOCUS_6070 93225 96638 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068835.1 protein_id gnl|my_center|LOCUS_6070 >Feature sequence07 583 1839 gene locus_tag LOCUS_6080 gene tyrS 583 1839 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642093.1 protein_id gnl|my_center|LOCUS_6080 1839 2441 gene locus_tag LOCUS_6090 gene gmk 1839 2441 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053267.1 protein_id gnl|my_center|LOCUS_6090 2613 3095 gene locus_tag LOCUS_6100 2613 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6100 3242 4453 gene locus_tag LOCUS_6110 gene metK 3242 4453 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068839.1 protein_id gnl|my_center|LOCUS_6110 4453 6705 gene locus_tag LOCUS_6120 4453 6705 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137656711.1 protein_id gnl|my_center|LOCUS_6120 6759 7454 gene locus_tag LOCUS_6130 6759 7454 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068841.1 protein_id gnl|my_center|LOCUS_6130 7458 8477 gene locus_tag LOCUS_6140 gene fmt 7458 8477 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815830.1 protein_id gnl|my_center|LOCUS_6140 8470 9888 gene locus_tag LOCUS_6150 8470 9888 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296596.1 protein_id gnl|my_center|LOCUS_6150 10010 10732 gene locus_tag LOCUS_6160 10010 10732 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057155.1 protein_id gnl|my_center|LOCUS_6160 11188 10907 gene locus_tag LOCUS_6170 11188 10907 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112617.1 protein_id gnl|my_center|LOCUS_6170 13800 11347 gene locus_tag LOCUS_6180 13800 11347 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068847.1 protein_id gnl|my_center|LOCUS_6180 14469 13870 gene locus_tag LOCUS_6190 14469 13870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6190 15485 14466 gene locus_tag LOCUS_6200 15485 14466 CDS product vWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782716.1 protein_id gnl|my_center|LOCUS_6200 16675 15482 gene locus_tag LOCUS_6210 16675 15482 CDS product vWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812506.1 protein_id gnl|my_center|LOCUS_6210 17160 16672 gene locus_tag LOCUS_6220 17160 16672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021975282.1 protein_id gnl|my_center|LOCUS_6220 18095 17157 gene locus_tag LOCUS_6230 18095 17157 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389715.1 protein_id gnl|my_center|LOCUS_6230 19090 18092 gene locus_tag LOCUS_6240 19090 18092 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053183.1 protein_id gnl|my_center|LOCUS_6240 20102 19212 gene locus_tag LOCUS_6250 20102 19212 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389717.1 protein_id gnl|my_center|LOCUS_6250 20465 20211 gene locus_tag LOCUS_6260 20465 20211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6260 20524 20778 gene locus_tag LOCUS_6270 20524 20778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6270 20950 21156 gene locus_tag LOCUS_6280 20950 21156 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816407.1 protein_id gnl|my_center|LOCUS_6280 21397 23013 gene locus_tag LOCUS_6290 gene groL 21397 23013 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812522.1 protein_id gnl|my_center|LOCUS_6290 23633 24205 gene locus_tag LOCUS_6300 23633 24205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6300 24569 25312 gene locus_tag LOCUS_6310 24569 25312 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389720.1 protein_id gnl|my_center|LOCUS_6310 25408 27249 gene locus_tag LOCUS_6320 25408 27249 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812532.1 protein_id gnl|my_center|LOCUS_6320 27319 27708 gene locus_tag LOCUS_6330 27319 27708 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812533.1 protein_id gnl|my_center|LOCUS_6330 27710 28609 gene locus_tag LOCUS_6340 27710 28609 CDS product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053194.1 protein_id gnl|my_center|LOCUS_6340 28686 31268 gene locus_tag LOCUS_6350 28686 31268 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067907.1 protein_id gnl|my_center|LOCUS_6350 31269 32765 gene locus_tag LOCUS_6360 31269 32765 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966618.1 protein_id gnl|my_center|LOCUS_6360 32779 33771 gene locus_tag LOCUS_6370 32779 33771 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053235.1 protein_id gnl|my_center|LOCUS_6370 33774 34163 gene locus_tag LOCUS_6380 33774 34163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6380 34166 35425 gene locus_tag LOCUS_6390 34166 35425 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054004.1 protein_id gnl|my_center|LOCUS_6390 35708 36646 gene locus_tag LOCUS_6400 35708 36646 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113476.1 protein_id gnl|my_center|LOCUS_6400 36719 38074 gene locus_tag LOCUS_6410 36719 38074 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642434.1 protein_id gnl|my_center|LOCUS_6410 38142 39107 gene locus_tag LOCUS_6420 38142 39107 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112414.1 protein_id gnl|my_center|LOCUS_6420 41115 39277 gene locus_tag LOCUS_6430 41115 39277 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389514.1 protein_id gnl|my_center|LOCUS_6430 41214 42701 gene locus_tag LOCUS_6440 41214 42701 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112416.1 protein_id gnl|my_center|LOCUS_6440 42907 43782 gene locus_tag LOCUS_6450 42907 43782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6450 44205 43813 gene locus_tag LOCUS_6460 44205 43813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6460 45578 45505 gene locus_tag LOCUS_t0390 45578 45505 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 45717 47093 gene locus_tag LOCUS_6470 45717 47093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6470 47225 48967 gene locus_tag LOCUS_6480 47225 48967 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067955.1 protein_id gnl|my_center|LOCUS_6480 48969 49694 gene locus_tag LOCUS_6490 gene recO 48969 49694 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055411.1 protein_id gnl|my_center|LOCUS_6490 49691 50476 gene locus_tag LOCUS_6500 49691 50476 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055433.1 protein_id gnl|my_center|LOCUS_6500 50603 52207 gene locus_tag LOCUS_6510 50603 52207 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389978.1 protein_id gnl|my_center|LOCUS_6510 52374 53906 gene locus_tag LOCUS_6520 52374 53906 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363202.1 protein_id gnl|my_center|LOCUS_6520 53910 55220 gene locus_tag LOCUS_6530 gene dusB 53910 55220 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812184.1 protein_id gnl|my_center|LOCUS_6530 55334 56554 gene locus_tag LOCUS_6540 gene ftsZ 55334 56554 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112391.1 protein_id gnl|my_center|LOCUS_6540 56600 57058 gene locus_tag LOCUS_6550 56600 57058 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812187.1 protein_id gnl|my_center|LOCUS_6550 57084 57362 gene locus_tag LOCUS_6560 57084 57362 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054068.1 protein_id gnl|my_center|LOCUS_6560 57452 58765 gene locus_tag LOCUS_6570 57452 58765 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812192.1 protein_id gnl|my_center|LOCUS_6570 58779 59285 gene locus_tag LOCUS_6580 58779 59285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6580 59289 60233 gene locus_tag LOCUS_6590 59289 60233 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389630.1 protein_id gnl|my_center|LOCUS_6590 60208 60690 gene locus_tag LOCUS_6600 60208 60690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6600 60740 64312 gene locus_tag LOCUS_6610 gene dnaE 60740 64312 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582833.1 protein_id gnl|my_center|LOCUS_6610 64392 65045 gene locus_tag LOCUS_6620 64392 65045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815225.1 protein_id gnl|my_center|LOCUS_6620 65240 65479 gene locus_tag LOCUS_6630 65240 65479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6630 65702 67147 gene locus_tag LOCUS_6640 65702 67147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6640 <68278 67348 gene locus_tag LOCUS_6650 <68278 67348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033514771.1:ATP-dependent RNA helicase HrpA >Feature sequence08 127 1029 gene locus_tag LOCUS_6660 127 1029 CDS product polyphenol oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390256.1 protein_id gnl|my_center|LOCUS_6660 1692 1042 gene locus_tag LOCUS_6670 1692 1042 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814393.1 protein_id gnl|my_center|LOCUS_6670 1828 3258 gene locus_tag LOCUS_6680 1828 3258 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068425.1 protein_id gnl|my_center|LOCUS_6680 3674 4351 gene locus_tag LOCUS_6690 gene mtnN 3674 4351 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814409.1 protein_id gnl|my_center|LOCUS_6690 4381 4842 gene locus_tag LOCUS_6700 4381 4842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6700 5171 5692 gene locus_tag LOCUS_6710 gene rplJ 5171 5692 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814430.1 protein_id gnl|my_center|LOCUS_6710 5789 6166 gene locus_tag LOCUS_6720 gene rplL 5789 6166 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053002.1 protein_id gnl|my_center|LOCUS_6720 6275 7711 gene locus_tag LOCUS_6730 6275 7711 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053003.1 protein_id gnl|my_center|LOCUS_6730 7714 11481 gene locus_tag LOCUS_6740 7714 11481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053004.1 protein_id gnl|my_center|LOCUS_6740 11478 11792 gene locus_tag LOCUS_6750 11478 11792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6750 12597 12037 gene locus_tag LOCUS_6760 gene mscL 12597 12037 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815058.1 protein_id gnl|my_center|LOCUS_6760 13334 13504 gene locus_tag LOCUS_6770 13334 13504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6770 13662 13459 gene locus_tag LOCUS_6780 13662 13459 CDS product evolved beta-galactosidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815625.1 protein_id gnl|my_center|LOCUS_6780 13828 14844 gene locus_tag LOCUS_6790 13828 14844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6790 15018 15311 gene locus_tag LOCUS_6800 gene groES 15018 15311 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114319.1 protein_id gnl|my_center|LOCUS_6800 15451 16899 gene locus_tag LOCUS_6810 15451 16899 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564276.1 protein_id gnl|my_center|LOCUS_6810 17022 18137 gene locus_tag LOCUS_6820 gene prfA 17022 18137 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052437.1 protein_id gnl|my_center|LOCUS_6820 18134 19321 gene locus_tag LOCUS_6830 gene prmC 18134 19321 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818926.1 protein_id gnl|my_center|LOCUS_6830 19358 20071 gene locus_tag LOCUS_6840 19358 20071 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814862.1 protein_id gnl|my_center|LOCUS_6840 20068 21210 gene locus_tag LOCUS_6850 20068 21210 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113078.1 protein_id gnl|my_center|LOCUS_6850 21212 21625 gene locus_tag LOCUS_6860 21212 21625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6860 21675 22376 gene locus_tag LOCUS_6870 gene orn 21675 22376 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994424.1 protein_id gnl|my_center|LOCUS_6870 22405 23769 gene locus_tag LOCUS_6880 22405 23769 CDS product PIF1 family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068808.1 protein_id gnl|my_center|LOCUS_6880 23893 25683 gene locus_tag LOCUS_6890 23893 25683 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055676.1 protein_id gnl|my_center|LOCUS_6890 26773 25907 gene locus_tag LOCUS_6900 26773 25907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6900 26949 28076 gene locus_tag LOCUS_6910 gene nusA 26949 28076 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782965.1 protein_id gnl|my_center|LOCUS_6910 28201 30990 gene locus_tag LOCUS_6920 gene infB 28201 30990 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068747.1 protein_id gnl|my_center|LOCUS_6920 30993 31499 gene locus_tag LOCUS_6930 gene rbfA 30993 31499 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052308.1 protein_id gnl|my_center|LOCUS_6930 31496 32641 gene locus_tag LOCUS_6940 31496 32641 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068748.1 protein_id gnl|my_center|LOCUS_6940 32673 33869 gene locus_tag LOCUS_6950 32673 33869 CDS product riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003823255.1 protein_id gnl|my_center|LOCUS_6950 34068 37625 gene locus_tag LOCUS_6960 34068 37625 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053735.1 protein_id gnl|my_center|LOCUS_6960 37686 41846 gene locus_tag LOCUS_6970 37686 41846 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399740.1 protein_id gnl|my_center|LOCUS_6970 42049 42795 gene locus_tag LOCUS_6980 42049 42795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6980 43485 42865 gene locus_tag LOCUS_6990 43485 42865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816173.1 protein_id gnl|my_center|LOCUS_6990 44471 43554 gene locus_tag LOCUS_7000 44471 43554 CDS product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003823894.1 protein_id gnl|my_center|LOCUS_7000 44816 45187 gene locus_tag LOCUS_7010 gene rpsL 44816 45187 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813881.1 protein_id gnl|my_center|LOCUS_7010 45187 45657 gene locus_tag LOCUS_7020 gene rpsG 45187 45657 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813834.1 protein_id gnl|my_center|LOCUS_7020 45682 47829 gene locus_tag LOCUS_7030 gene fusA 45682 47829 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813832.1 protein_id gnl|my_center|LOCUS_7030 >Feature sequence09 495 1238 gene locus_tag LOCUS_7040 495 1238 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783033.1 protein_id gnl|my_center|LOCUS_7040 1478 1870 gene locus_tag LOCUS_7050 1478 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7050 2869 2129 gene locus_tag LOCUS_7060 2869 2129 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815995.1 protein_id gnl|my_center|LOCUS_7060 2988 3599 gene locus_tag LOCUS_7070 2988 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7070 3650 4783 gene locus_tag LOCUS_7080 gene ftsY 3650 4783 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056312.1 protein_id gnl|my_center|LOCUS_7080 4898 6184 gene locus_tag LOCUS_7090 4898 6184 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054727.1 protein_id gnl|my_center|LOCUS_7090 6184 6522 gene locus_tag LOCUS_7100 6184 6522 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814240.1 protein_id gnl|my_center|LOCUS_7100 6868 8244 gene locus_tag LOCUS_7110 gene dnaB 6868 8244 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054729.1 protein_id gnl|my_center|LOCUS_7110 8253 9716 gene locus_tag LOCUS_7120 8253 9716 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068484.1 protein_id gnl|my_center|LOCUS_7120 9713 10534 gene locus_tag LOCUS_7130 9713 10534 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051560.1 protein_id gnl|my_center|LOCUS_7130 11207 11668 gene locus_tag LOCUS_7140 11207 11668 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296550.1 protein_id gnl|my_center|LOCUS_7140 11665 12051 gene locus_tag LOCUS_7150 gene crcB 11665 12051 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227866.1 protein_id gnl|my_center|LOCUS_7150 12982 12233 gene locus_tag LOCUS_7160 12982 12233 CDS product NAD-dependent deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414678.1 protein_id gnl|my_center|LOCUS_7160 13647 13024 gene locus_tag LOCUS_7170 13647 13024 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254011.1 protein_id gnl|my_center|LOCUS_7170 14559 13786 gene locus_tag LOCUS_7180 14559 13786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7180 16331 14556 gene locus_tag LOCUS_7190 16331 14556 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225543.1 protein_id gnl|my_center|LOCUS_7190 17284 16310 gene locus_tag LOCUS_7200 17284 16310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7200 19645 17387 gene locus_tag LOCUS_7210 gene nrdJ 19645 17387 CDS product ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674848.1 protein_id gnl|my_center|LOCUS_7210 19969 20910 gene locus_tag LOCUS_7220 gene rsmI 19969 20910 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783206.1 protein_id gnl|my_center|LOCUS_7220 21350 20907 gene locus_tag LOCUS_7230 21350 20907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7230 21349 23229 gene locus_tag LOCUS_7240 gene metG 21349 23229 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947106.1 protein_id gnl|my_center|LOCUS_7240 23239 24192 gene locus_tag LOCUS_7250 23239 24192 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068671.1 protein_id gnl|my_center|LOCUS_7250 24425 26884 gene locus_tag LOCUS_7260 24425 26884 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816051.1 protein_id gnl|my_center|LOCUS_7260 26907 28367 gene locus_tag LOCUS_7270 gene gndA 26907 28367 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399773.1 protein_id gnl|my_center|LOCUS_7270 28605 29768 gene locus_tag LOCUS_7280 28605 29768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7280 29893 30879 gene locus_tag LOCUS_7290 29893 30879 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068827.1 protein_id gnl|my_center|LOCUS_7290 31802 30930 gene locus_tag LOCUS_7300 gene pgl 31802 30930 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143563.1 protein_id gnl|my_center|LOCUS_7300 32752 31799 gene locus_tag LOCUS_7310 32752 31799 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114280.1 protein_id gnl|my_center|LOCUS_7310 34326 32749 gene locus_tag LOCUS_7320 gene zwf 34326 32749 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817686.1 protein_id gnl|my_center|LOCUS_7320 34502 35371 gene locus_tag LOCUS_7330 34502 35371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7330 37449 35383 gene locus_tag LOCUS_7340 37449 35383 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068542.1 protein_id gnl|my_center|LOCUS_7340 38845 37766 gene locus_tag LOCUS_7350 38845 37766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389652.1 protein_id gnl|my_center|LOCUS_7350 38897 39352 gene locus_tag LOCUS_7360 38897 39352 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055942.1 protein_id gnl|my_center|LOCUS_7360 40024 39374 gene locus_tag LOCUS_7370 40024 39374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7370 40313 40014 gene locus_tag LOCUS_7380 40313 40014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7380 40597 41217 gene locus_tag LOCUS_7390 40597 41217 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894834.1 protein_id gnl|my_center|LOCUS_7390 >Feature sequence10 772 74 gene locus_tag LOCUS_7400 772 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7400 1779 4007 gene locus_tag LOCUS_7410 1779 4007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7410 4023 5030 gene locus_tag LOCUS_7420 4023 5030 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068007.1 protein_id gnl|my_center|LOCUS_7420 5450 5193 gene locus_tag LOCUS_7430 5450 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7430 6276 5638 gene locus_tag LOCUS_7440 6276 5638 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943410.1 protein_id gnl|my_center|LOCUS_7440 7665 6508 gene locus_tag LOCUS_7450 7665 6508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7450 7821 7750 gene locus_tag LOCUS_t0400 7821 7750 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9485 8019 gene locus_tag LOCUS_7460 9485 8019 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068540.1 protein_id gnl|my_center|LOCUS_7460 11545 9623 gene locus_tag LOCUS_7470 11545 9623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7470 11738 13021 gene locus_tag LOCUS_7480 gene tgt 11738 13021 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174143107.1 protein_id gnl|my_center|LOCUS_7480 13476 13129 gene locus_tag LOCUS_7490 13476 13129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7490 13691 14797 gene locus_tag LOCUS_7500 gene trpS 13691 14797 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815099.1 protein_id gnl|my_center|LOCUS_7500 14852 15844 gene locus_tag LOCUS_7510 gene rlmB 14852 15844 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814978.1 protein_id gnl|my_center|LOCUS_7510 17336 16206 gene locus_tag LOCUS_7520 gene ugpC 17336 16206 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815886.1 protein_id gnl|my_center|LOCUS_7520 17503 19758 gene locus_tag LOCUS_7530 17503 19758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143321.1 protein_id gnl|my_center|LOCUS_7530 19765 22230 gene locus_tag LOCUS_7540 19765 22230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7540 22377 23351 gene locus_tag LOCUS_7550 22377 23351 CDS product protein disulfide-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390383.1 protein_id gnl|my_center|LOCUS_7550 24171 23449 gene locus_tag LOCUS_7560 24171 23449 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100881.1 protein_id gnl|my_center|LOCUS_7560 25002 24181 gene locus_tag LOCUS_7570 25002 24181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7570 26227 24992 gene locus_tag LOCUS_7580 gene cbiM 26227 24992 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641709.1 protein_id gnl|my_center|LOCUS_7580 27375 26524 gene locus_tag LOCUS_7590 27375 26524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7590 28031 27417 gene locus_tag LOCUS_7600 gene ureG 28031 27417 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002477667.1 protein_id gnl|my_center|LOCUS_7600 28829 28089 gene locus_tag LOCUS_7610 28829 28089 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565254.1 protein_id gnl|my_center|LOCUS_7610 29312 28845 gene locus_tag LOCUS_7620 gene ureE 29312 28845 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832382.1 protein_id gnl|my_center|LOCUS_7620 31125 29404 gene locus_tag LOCUS_7630 gene ureC 31125 29404 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008673.1 protein_id gnl|my_center|LOCUS_7630 31557 31168 gene locus_tag LOCUS_7640 31557 31168 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832383.1 protein_id gnl|my_center|LOCUS_7640 31871 31569 gene locus_tag LOCUS_7650 31871 31569 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857708.1 protein_id gnl|my_center|LOCUS_7650 33406 32135 gene locus_tag LOCUS_7660 33406 32135 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296683.1 protein_id gnl|my_center|LOCUS_7660 34062 33532 gene locus_tag LOCUS_7670 gene ureI 34062 33532 CDS product acid-activated urea channel protein UreI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901247.1 protein_id gnl|my_center|LOCUS_7670 35315 34680 gene locus_tag LOCUS_7680 35315 34680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7680 35967 36287 gene locus_tag LOCUS_7690 35967 36287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7690 36966 38372 gene locus_tag LOCUS_7700 36966 38372 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 protein_id gnl|my_center|LOCUS_7700 38365 38793 gene locus_tag LOCUS_7710 38365 38793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7710 38941 39519 gene locus_tag LOCUS_7720 38941 39519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_7720 39519 39803 gene locus_tag LOCUS_7730 39519 39803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7730 >Feature sequence11 1661 2422 gene locus_tag LOCUS_7740 1661 2422 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566220.1 protein_id gnl|my_center|LOCUS_7740 2700 2554 gene locus_tag LOCUS_7750 2700 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7750 2951 4528 gene locus_tag LOCUS_7760 gene arcD 2951 4528 CDS product arginine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286721.1 protein_id gnl|my_center|LOCUS_7760 4718 5578 gene locus_tag LOCUS_7770 4718 5578 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003572070.1 protein_id gnl|my_center|LOCUS_7770 5667 5885 gene locus_tag LOCUS_7780 5667 5885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7780 7825 5915 gene locus_tag LOCUS_7790 7825 5915 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117868.1 protein_id gnl|my_center|LOCUS_7790 8600 8055 gene locus_tag LOCUS_7800 8600 8055 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815036.1 protein_id gnl|my_center|LOCUS_7800 9978 8587 gene locus_tag LOCUS_7810 9978 8587 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054593.1 protein_id gnl|my_center|LOCUS_7810 11169 10045 gene locus_tag LOCUS_7820 gene dnaN 11169 10045 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051765.1 protein_id gnl|my_center|LOCUS_7820 13257 11614 gene locus_tag LOCUS_7830 gene dnaA 13257 11614 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815928.1 protein_id gnl|my_center|LOCUS_7830 13641 13775 gene locus_tag LOCUS_7840 gene rpmH 13641 13775 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051768.1 protein_id gnl|my_center|LOCUS_7840 13831 14217 gene locus_tag LOCUS_7850 gene rnpA 13831 14217 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815924.1 protein_id gnl|my_center|LOCUS_7850 14219 14578 gene locus_tag LOCUS_7860 14219 14578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7860 14575 15558 gene locus_tag LOCUS_7870 gene yidC 14575 15558 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819388.1 protein_id gnl|my_center|LOCUS_7870 15661 17247 gene locus_tag LOCUS_7880 15661 17247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7880 17567 17358 gene locus_tag LOCUS_7890 17567 17358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7890 17635 19200 gene locus_tag LOCUS_7900 17635 19200 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389437.1 protein_id gnl|my_center|LOCUS_7900 19197 20369 gene locus_tag LOCUS_7910 19197 20369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7910 20366 21070 gene locus_tag LOCUS_7920 20366 21070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7920 21070 24156 gene locus_tag LOCUS_7930 21070 24156 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137656664.1 protein_id gnl|my_center|LOCUS_7930 24718 25503 gene locus_tag LOCUS_7940 24718 25503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7940 25500 26303 gene locus_tag LOCUS_7950 gene rsmG 25500 26303 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390391.1 protein_id gnl|my_center|LOCUS_7950 26438 27406 gene locus_tag LOCUS_7960 26438 27406 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051774.1 protein_id gnl|my_center|LOCUS_7960 27496 28854 gene locus_tag LOCUS_7970 27496 28854 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068597.1 protein_id gnl|my_center|LOCUS_7970 29398 31140 gene locus_tag LOCUS_7980 29398 31140 CDS product SpaA isopeptide-forming pilin-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814213.1 protein_id gnl|my_center|LOCUS_7980 31329 32411 gene locus_tag LOCUS_7990 31329 32411 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068518.1 protein_id gnl|my_center|LOCUS_7990 33562 33248 gene locus_tag LOCUS_8000 33562 33248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8000 34134 34319 gene locus_tag LOCUS_8010 34134 34319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8010 34654 35235 gene locus_tag LOCUS_8020 34654 35235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8020 36295 35324 gene locus_tag LOCUS_8030 gene trxB 36295 35324 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114045.1 protein_id gnl|my_center|LOCUS_8030 >Feature sequence12 415 489 gene locus_tag LOCUS_t0410 415 489 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 515 590 gene locus_tag LOCUS_t0420 515 590 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 752 1708 gene locus_tag LOCUS_8040 752 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8040 1699 2652 gene locus_tag LOCUS_8050 1699 2652 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966382.1 protein_id gnl|my_center|LOCUS_8050 2649 3452 gene locus_tag LOCUS_8060 2649 3452 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_8060 3501 4094 gene locus_tag LOCUS_8070 3501 4094 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 protein_id gnl|my_center|LOCUS_8070 4223 4888 gene locus_tag LOCUS_8080 4223 4888 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392954.1 protein_id gnl|my_center|LOCUS_8080 5595 5020 gene locus_tag LOCUS_8090 5595 5020 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_8090 7261 5729 gene locus_tag LOCUS_8100 gene glpK 7261 5729 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776956.1 protein_id gnl|my_center|LOCUS_8100 8722 7361 gene locus_tag LOCUS_8110 8722 7361 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379815.1 protein_id gnl|my_center|LOCUS_8110 11272 8939 gene locus_tag LOCUS_8120 11272 8939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8120 12949 11474 gene locus_tag LOCUS_8130 12949 11474 CDS product basic amino acid/polyamine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112459.1 protein_id gnl|my_center|LOCUS_8130 18627 13411 gene locus_tag LOCUS_8140 18627 13411 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015608.1 protein_id gnl|my_center|LOCUS_8140 18730 18539 gene locus_tag LOCUS_8150 18730 18539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8150 20261 18822 gene locus_tag LOCUS_8160 gene arcD 20261 18822 CDS product arginine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286721.1 protein_id gnl|my_center|LOCUS_8160 21493 20546 gene locus_tag LOCUS_8170 gene arcC 21493 20546 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288434.1 protein_id gnl|my_center|LOCUS_8170 22553 21504 gene locus_tag LOCUS_8180 gene argF 22553 21504 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254507.1 protein_id gnl|my_center|LOCUS_8180 23954 22725 gene locus_tag LOCUS_8190 gene arcA 23954 22725 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288439.1 protein_id gnl|my_center|LOCUS_8190 25286 24252 gene locus_tag LOCUS_8200 25286 24252 CDS product DUF2776 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202808.1 protein_id gnl|my_center|LOCUS_8200 26796 25306 gene locus_tag LOCUS_8210 26796 25306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8210 30240 27406 gene locus_tag LOCUS_8220 gene mgtA 30240 27406 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704210.1 protein_id gnl|my_center|LOCUS_8220 30488 31051 gene locus_tag LOCUS_8230 gene ahpC 30488 31051 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367212.1 protein_id gnl|my_center|LOCUS_8230 31816 31151 gene locus_tag LOCUS_8240 31816 31151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8240 31710 31958 gene locus_tag LOCUS_8250 31710 31958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8250 31991 33145 gene locus_tag LOCUS_8260 31991 33145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8260 33795 33211 gene locus_tag LOCUS_8270 33795 33211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8270 <34353 33774 gene locus_tag LOCUS_8280 <34353 33774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815936.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence13 1523 1981 gene locus_tag LOCUS_8290 1523 1981 CDS product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594864.1 protein_id gnl|my_center|LOCUS_8290 1978 4473 gene locus_tag LOCUS_8300 1978 4473 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714164.1 protein_id gnl|my_center|LOCUS_8300 4553 4753 gene locus_tag LOCUS_8310 4553 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8310 6447 5671 gene locus_tag LOCUS_8320 6447 5671 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582957.1 protein_id gnl|my_center|LOCUS_8320 7215 6541 gene locus_tag LOCUS_8330 7215 6541 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389501.1 protein_id gnl|my_center|LOCUS_8330 8645 7491 gene locus_tag LOCUS_8340 8645 7491 CDS product glutamate--tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414594.1 protein_id gnl|my_center|LOCUS_8340 10171 8666 gene locus_tag LOCUS_8350 10171 8666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8350 10343 11785 gene locus_tag LOCUS_8360 10343 11785 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 protein_id gnl|my_center|LOCUS_8360 11970 12671 gene locus_tag LOCUS_8370 11970 12671 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068566.1 protein_id gnl|my_center|LOCUS_8370 12707 13333 gene locus_tag LOCUS_8380 12707 13333 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811415.1 protein_id gnl|my_center|LOCUS_8380 13338 14954 gene locus_tag LOCUS_8390 13338 14954 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051709.1 protein_id gnl|my_center|LOCUS_8390 15168 14962 gene locus_tag LOCUS_8400 15168 14962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8400 15146 16660 gene locus_tag LOCUS_8410 15146 16660 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811411.1 protein_id gnl|my_center|LOCUS_8410 16660 18129 gene locus_tag LOCUS_8420 16660 18129 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389388.1 protein_id gnl|my_center|LOCUS_8420 18126 19118 gene locus_tag LOCUS_8430 18126 19118 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811405.1 protein_id gnl|my_center|LOCUS_8430 19115 21208 gene locus_tag LOCUS_8440 gene pknB 19115 21208 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116465.1 protein_id gnl|my_center|LOCUS_8440 22405 21269 gene locus_tag LOCUS_8450 22405 21269 CDS product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068569.1 protein_id gnl|my_center|LOCUS_8450 22656 23138 gene locus_tag LOCUS_8460 gene crgA 22656 23138 CDS product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389385.1 protein_id gnl|my_center|LOCUS_8460 23494 23282 gene locus_tag LOCUS_8470 23494 23282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8470 25077 23674 gene locus_tag LOCUS_8480 25077 23674 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068757.1 protein_id gnl|my_center|LOCUS_8480 25914 25270 gene locus_tag LOCUS_8490 25914 25270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_8490 26227 26472 gene locus_tag LOCUS_8500 26227 26472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811385.1 protein_id gnl|my_center|LOCUS_8500 27280 27669 gene locus_tag LOCUS_8510 27280 27669 CDS product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022527180.1 protein_id gnl|my_center|LOCUS_8510 27916 29643 gene locus_tag LOCUS_8520 27916 29643 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174157.1 protein_id gnl|my_center|LOCUS_8520 >Feature sequence14 28 197 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttctgcgcagccgcggcagc 3151 1718 gene locus_tag LOCUS_8530 3151 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8530 3468 3277 gene locus_tag LOCUS_8540 3468 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8540 3650 3468 gene locus_tag LOCUS_8550 3650 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8550 4609 4534 gene locus_tag LOCUS_t0430 4609 4534 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6425 4692 gene locus_tag LOCUS_8560 6425 4692 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014584.1 protein_id gnl|my_center|LOCUS_8560 7858 6440 gene locus_tag LOCUS_8570 7858 6440 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051791.1 protein_id gnl|my_center|LOCUS_8570 7984 8700 gene locus_tag LOCUS_8580 7984 8700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8580 8697 10892 gene locus_tag LOCUS_8590 8697 10892 CDS product DUF6049 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173361541.1 protein_id gnl|my_center|LOCUS_8590 10889 15205 gene locus_tag LOCUS_8600 10889 15205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8600 15431 16945 gene locus_tag LOCUS_8610 gene gadC 15431 16945 CDS product glutamate:gamma-aminobutyrate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989972.1 protein_id gnl|my_center|LOCUS_8610 17536 17399 gene locus_tag LOCUS_8620 17536 17399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8620 >Feature sequence15 2945 2872 gene locus_tag LOCUS_t0440 2945 2872 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3159 4592 gene locus_tag LOCUS_8630 3159 4592 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101592.1 protein_id gnl|my_center|LOCUS_8630 4825 4589 gene locus_tag LOCUS_8640 4825 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8640 4710 6101 gene locus_tag LOCUS_8650 4710 6101 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673958.1 protein_id gnl|my_center|LOCUS_8650 6229 6158 gene locus_tag LOCUS_t0450 6229 6158 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6378 8426 gene locus_tag LOCUS_8660 6378 8426 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390147.1 protein_id gnl|my_center|LOCUS_8660 9122 9197 gene locus_tag LOCUS_t0460 9122 9197 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 10192 9899 gene locus_tag LOCUS_8670 10192 9899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8670 10714 10385 gene locus_tag LOCUS_8680 10714 10385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8680 >Feature sequence16 3326 636 gene locus_tag LOCUS_8690 3326 636 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390266.1 protein_id gnl|my_center|LOCUS_8690 3727 3458 gene locus_tag LOCUS_8700 gene rpsO 3727 3458 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814361.1 protein_id gnl|my_center|LOCUS_8700 4524 3865 gene locus_tag LOCUS_8710 4524 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8710 4688 4482 gene locus_tag LOCUS_8720 4688 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8720 5806 5252 gene locus_tag LOCUS_8730 5806 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8730 7360 6008 gene locus_tag LOCUS_8740 gene pepC 7360 6008 CDS product aminopeptidase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549077.1 protein_id gnl|my_center|LOCUS_8740 >Feature sequence17 1685 303 gene locus_tag LOCUS_8750 1685 303 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815077.1 protein_id gnl|my_center|LOCUS_8750 1777 2361 gene locus_tag LOCUS_8760 1777 2361 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211251.1 protein_id gnl|my_center|LOCUS_8760 2880 2401 gene locus_tag LOCUS_8770 2880 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8770 3165 3082 gene locus_tag LOCUS_t0470 3165 3082 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3239 3166 gene locus_tag LOCUS_t0480 3239 3166 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3642 5495 gene locus_tag LOCUS_8780 3642 5495 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582988.1 protein_id gnl|my_center|LOCUS_8780 5495 7285 gene locus_tag LOCUS_8790 5495 7285 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052919.1 protein_id gnl|my_center|LOCUS_8790 >Feature sequence18 <1 1216 gene locus_tag LOCUS_8800 <1 1216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_173361534.1:DNA topoisomerase (ATP-hydrolyzing) subunit B 1243 3951 gene locus_tag LOCUS_8810 gene gyrA 1243 3951 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399363.1 protein_id gnl|my_center|LOCUS_8810 >Feature sequence19 1764 292 gene locus_tag LOCUS_8820 gene gadC 1764 292 CDS product glutamate:gamma-aminobutyrate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989972.1 protein_id gnl|my_center|LOCUS_8820 >Feature sequence20 300 863 gene locus_tag LOCUS_8830 gene efp 300 863 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813823.1 protein_id gnl|my_center|LOCUS_8830 914 1429 gene locus_tag LOCUS_8840 914 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8840