>Feature sequence01 142 333 gene locus_tag LOCUS_00010 gene rpmB 142 333 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813371.1 protein_id gnl|my_center|LOCUS_00010 897 427 gene locus_tag LOCUS_00020 gene ribE 897 427 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358088.1 protein_id gnl|my_center|LOCUS_00020 2113 911 gene locus_tag LOCUS_00030 2113 911 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392434.1 protein_id gnl|my_center|LOCUS_00030 2829 2179 gene locus_tag LOCUS_00040 2829 2179 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459819.1 protein_id gnl|my_center|LOCUS_00040 4061 2961 gene locus_tag LOCUS_00050 gene ribD 4061 2961 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_00050 5293 4316 gene locus_tag LOCUS_00060 gene moaA 5293 4316 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_00060 6236 5451 gene locus_tag LOCUS_00070 6236 5451 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258918.1 protein_id gnl|my_center|LOCUS_00070 7582 6260 gene locus_tag LOCUS_00080 7582 6260 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_00080 9309 7603 gene locus_tag LOCUS_00090 9309 7603 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392558.1 protein_id gnl|my_center|LOCUS_00090 10367 9324 gene locus_tag LOCUS_00100 gene ispG 10367 9324 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460411.1 protein_id gnl|my_center|LOCUS_00100 11411 10386 gene locus_tag LOCUS_00110 gene rseP 11411 10386 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392556.1 protein_id gnl|my_center|LOCUS_00110 12568 11411 gene locus_tag LOCUS_00120 12568 11411 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241803.1 protein_id gnl|my_center|LOCUS_00120 13651 12581 gene locus_tag LOCUS_00130 gene ytvI 13651 12581 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392554.1 protein_id gnl|my_center|LOCUS_00130 14444 13662 gene locus_tag LOCUS_00140 14444 13662 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392553.1 protein_id gnl|my_center|LOCUS_00140 15208 14432 gene locus_tag LOCUS_00150 15208 14432 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_00150 15630 15397 gene locus_tag LOCUS_00160 15630 15397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 16188 15634 gene locus_tag LOCUS_00170 gene frr 16188 15634 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810666.1 protein_id gnl|my_center|LOCUS_00170 16913 16152 gene locus_tag LOCUS_00180 gene pyrH 16913 16152 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810668.1 protein_id gnl|my_center|LOCUS_00180 17571 16969 gene locus_tag LOCUS_00190 gene tsf 17571 16969 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392547.1 protein_id gnl|my_center|LOCUS_00190 18390 17683 gene locus_tag LOCUS_00200 gene rpsB 18390 17683 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_00200 19336 18560 gene locus_tag LOCUS_00210 gene codY 19336 18560 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774472.1 protein_id gnl|my_center|LOCUS_00210 20753 19362 gene locus_tag LOCUS_00220 gene hslU 20753 19362 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245556.1 protein_id gnl|my_center|LOCUS_00220 21473 20928 gene locus_tag LOCUS_00230 gene hslV 21473 20928 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172636479.1 protein_id gnl|my_center|LOCUS_00230 22378 21479 gene locus_tag LOCUS_00240 gene xerC 22378 21479 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392542.1 protein_id gnl|my_center|LOCUS_00240 23694 22378 gene locus_tag LOCUS_00250 gene trmFO 23694 22378 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357486.1 protein_id gnl|my_center|LOCUS_00250 25782 23698 gene locus_tag LOCUS_00260 gene topA 25782 23698 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541498.1 protein_id gnl|my_center|LOCUS_00260 26912 25818 gene locus_tag LOCUS_00270 gene dprA 26912 25818 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392539.1 protein_id gnl|my_center|LOCUS_00270 28052 27156 gene locus_tag LOCUS_00280 gene ligD 28052 27156 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393573.1 protein_id gnl|my_center|LOCUS_00280 28205 28387 gene locus_tag LOCUS_00290 28205 28387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 28890 28531 gene locus_tag LOCUS_00300 28890 28531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 30002 29043 gene locus_tag LOCUS_00310 gene ligD 30002 29043 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392997.1 protein_id gnl|my_center|LOCUS_00310 30817 29999 gene locus_tag LOCUS_00320 30817 29999 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392998.1 protein_id gnl|my_center|LOCUS_00320 31146 31009 gene locus_tag LOCUS_00330 31146 31009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 32425 31160 gene locus_tag LOCUS_00340 32425 31160 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541187.1 protein_id gnl|my_center|LOCUS_00340 34145 32577 gene locus_tag LOCUS_00350 34145 32577 CDS product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330413.1 protein_id gnl|my_center|LOCUS_00350 35488 34361 gene locus_tag LOCUS_00360 gene yhbH 35488 34361 CDS product sporulation protein YhbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392048.1 protein_id gnl|my_center|LOCUS_00360 37405 35510 gene locus_tag LOCUS_00370 37405 35510 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392047.1 protein_id gnl|my_center|LOCUS_00370 38055 37933 gene locus_tag LOCUS_00380 38055 37933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 38715 38149 gene locus_tag LOCUS_00390 38715 38149 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817427.1 protein_id gnl|my_center|LOCUS_00390 40255 38852 gene locus_tag LOCUS_00400 40255 38852 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461524.1 protein_id gnl|my_center|LOCUS_00400 41206 40358 gene locus_tag LOCUS_00410 41206 40358 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392335.1 protein_id gnl|my_center|LOCUS_00410 42238 41207 gene locus_tag LOCUS_00420 42238 41207 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392334.1 protein_id gnl|my_center|LOCUS_00420 43239 42253 gene locus_tag LOCUS_00430 43239 42253 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392333.1 protein_id gnl|my_center|LOCUS_00430 43397 43236 gene locus_tag LOCUS_00440 43397 43236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 43670 43455 gene locus_tag LOCUS_00450 43670 43455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00450 45652 43661 gene locus_tag LOCUS_00460 45652 43661 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940767.1 protein_id gnl|my_center|LOCUS_00460 46531 45671 gene locus_tag LOCUS_00470 46531 45671 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_00470 47097 46528 gene locus_tag LOCUS_00480 47097 46528 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939676.1 protein_id gnl|my_center|LOCUS_00480 50161 47423 gene locus_tag LOCUS_00490 50161 47423 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392668.1 protein_id gnl|my_center|LOCUS_00490 50453 50172 gene locus_tag LOCUS_00500 50453 50172 CDS product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393184.1 protein_id gnl|my_center|LOCUS_00500 50576 50977 gene locus_tag LOCUS_00510 50576 50977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 51078 51911 gene locus_tag LOCUS_00520 51078 51911 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860835.1 protein_id gnl|my_center|LOCUS_00520 52956 52042 gene locus_tag LOCUS_00530 gene trxB 52956 52042 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_00530 54210 52969 gene locus_tag LOCUS_00540 54210 52969 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143008.1 protein_id gnl|my_center|LOCUS_00540 54517 54251 gene locus_tag LOCUS_00550 gene hfq 54517 54251 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811582.1 protein_id gnl|my_center|LOCUS_00550 55506 54541 gene locus_tag LOCUS_00560 gene miaA 55506 54541 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392629.1 protein_id gnl|my_center|LOCUS_00560 56300 55503 gene locus_tag LOCUS_00570 56300 55503 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230795.1 protein_id gnl|my_center|LOCUS_00570 58025 56307 gene locus_tag LOCUS_00580 gene mutL 58025 56307 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732291.1 protein_id gnl|my_center|LOCUS_00580 60716 58113 gene locus_tag LOCUS_00590 gene mutS 60716 58113 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541545.1 protein_id gnl|my_center|LOCUS_00590 61204 60854 gene locus_tag LOCUS_00600 61204 60854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 62615 61287 gene locus_tag LOCUS_00610 gene miaB 62615 61287 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392626.1 protein_id gnl|my_center|LOCUS_00610 63110 62721 gene locus_tag LOCUS_00620 63110 62721 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392635.1 protein_id gnl|my_center|LOCUS_00620 63303 64076 gene locus_tag LOCUS_00630 63303 64076 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274445.1 protein_id gnl|my_center|LOCUS_00630 65408 64257 gene locus_tag LOCUS_00640 65408 64257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 66505 65603 gene locus_tag LOCUS_00650 66505 65603 CDS product glycine/betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733788.1 protein_id gnl|my_center|LOCUS_00650 67464 66619 gene locus_tag LOCUS_00660 67464 66619 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022132.1 protein_id gnl|my_center|LOCUS_00660 68723 67464 gene locus_tag LOCUS_00670 68723 67464 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172728.1 protein_id gnl|my_center|LOCUS_00670 69559 69128 gene locus_tag LOCUS_00680 69559 69128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 70152 69757 gene locus_tag LOCUS_00690 70152 69757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 70344 71417 gene locus_tag LOCUS_00700 70344 71417 CDS product tetraprenyl-beta-curcumene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391704.1 protein_id gnl|my_center|LOCUS_00700 71494 71949 gene locus_tag LOCUS_00710 71494 71949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 72044 72598 gene locus_tag LOCUS_00720 gene sigW 72044 72598 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_00720 72606 73517 gene locus_tag LOCUS_00730 72606 73517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 73638 74237 gene locus_tag LOCUS_00740 73638 74237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 74767 74507 gene locus_tag LOCUS_00750 74767 74507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 74888 75337 gene locus_tag LOCUS_00760 74888 75337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 75421 76200 gene locus_tag LOCUS_00770 75421 76200 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544947.1 protein_id gnl|my_center|LOCUS_00770 77675 76263 gene locus_tag LOCUS_00780 77675 76263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 78173 79264 gene locus_tag LOCUS_00790 78173 79264 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545936.1 protein_id gnl|my_center|LOCUS_00790 79264 80595 gene locus_tag LOCUS_00800 79264 80595 CDS product bifunctional L-myo-inositol-1-phosphate cytidylyltransferase/CDP-L-myo-inositol myo-inositolphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868152.1 protein_id gnl|my_center|LOCUS_00800 81499 80600 gene locus_tag LOCUS_00810 81499 80600 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459478.1 protein_id gnl|my_center|LOCUS_00810 81755 82532 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttcagtcccctatttatcgggtcattagctgaaac 83777 82857 gene locus_tag LOCUS_00820 gene cas4a 83777 82857 CDS product type I-A CRISPR-associated protein Cas4/Csa1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879372.1 protein_id gnl|my_center|LOCUS_00820 84349 83780 gene locus_tag LOCUS_00830 gene cas4 84349 83780 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258805.1 protein_id gnl|my_center|LOCUS_00830 84672 84346 gene locus_tag LOCUS_00840 84672 84346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 85681 84674 gene locus_tag LOCUS_00850 gene cas1 85681 84674 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258803.1 protein_id gnl|my_center|LOCUS_00850 87557 85878 gene locus_tag LOCUS_00860 87557 85878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 88175 87570 gene locus_tag LOCUS_00870 88175 87570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 89022 88186 gene locus_tag LOCUS_00880 89022 88186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 91619 89019 gene locus_tag LOCUS_00890 91619 89019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 92624 91638 gene locus_tag LOCUS_00900 gene cas6 92624 91638 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545643.1 protein_id gnl|my_center|LOCUS_00900 92846 93052 gene locus_tag LOCUS_00910 92846 93052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 93093 93566 gene locus_tag LOCUS_00920 93093 93566 CDS product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701923.1 protein_id gnl|my_center|LOCUS_00920 93598 95238 gene locus_tag LOCUS_00930 93598 95238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 96708 95263 gene locus_tag LOCUS_00940 96708 95263 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222688.1 protein_id gnl|my_center|LOCUS_00940 97216 96821 gene locus_tag LOCUS_00950 97216 96821 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_00950 98073 97435 gene locus_tag LOCUS_00960 98073 97435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 100021 98093 gene locus_tag LOCUS_00970 100021 98093 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545360.1 protein_id gnl|my_center|LOCUS_00970 101996 100173 gene locus_tag LOCUS_00980 101996 100173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 102288 102091 gene locus_tag LOCUS_00990 102288 102091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 104393 102408 gene locus_tag LOCUS_01000 gene acs 104393 102408 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459120.1 protein_id gnl|my_center|LOCUS_01000 105488 104553 gene locus_tag LOCUS_01010 gene trxB 105488 104553 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583127.1 protein_id gnl|my_center|LOCUS_01010 105815 107116 gene locus_tag LOCUS_01020 105815 107116 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393761.1 protein_id gnl|my_center|LOCUS_01020 107143 108447 gene locus_tag LOCUS_01030 107143 108447 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162490120.1 protein_id gnl|my_center|LOCUS_01030 108481 108912 gene locus_tag LOCUS_01040 108481 108912 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_01040 109837 109010 gene locus_tag LOCUS_01050 109837 109010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 111132 109930 gene locus_tag LOCUS_01060 gene hybB 111132 109930 CDS product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815882.1 protein_id gnl|my_center|LOCUS_01060 111951 111172 gene locus_tag LOCUS_01070 111951 111172 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941442.1 protein_id gnl|my_center|LOCUS_01070 115036 111998 gene locus_tag LOCUS_01080 gene fdnG 115036 111998 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941441.1 transl_except (pos:complement(114428..114430),aa:Sec) note codon on position 203 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_01080 116569 115367 gene locus_tag LOCUS_01090 gene hybB 116569 115367 CDS product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815882.1 protein_id gnl|my_center|LOCUS_01090 117387 116608 gene locus_tag LOCUS_01100 117387 116608 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815883.1 protein_id gnl|my_center|LOCUS_01100 117935 117720 gene locus_tag LOCUS_01110 117935 117720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 118170 117979 gene locus_tag LOCUS_01120 118170 117979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 118675 118172 gene locus_tag LOCUS_01130 118675 118172 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_01130 119463 118816 gene locus_tag LOCUS_01140 119463 118816 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936275.1 protein_id gnl|my_center|LOCUS_01140 120251 119565 gene locus_tag LOCUS_01150 gene rpe 120251 119565 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589959.1 protein_id gnl|my_center|LOCUS_01150 121134 120244 gene locus_tag LOCUS_01160 gene rsgA 121134 120244 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392430.1 protein_id gnl|my_center|LOCUS_01160 122955 121138 gene locus_tag LOCUS_01170 gene pknB 122955 121138 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392429.1 protein_id gnl|my_center|LOCUS_01170 123680 122952 gene locus_tag LOCUS_01180 123680 122952 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_01180 124723 123680 gene locus_tag LOCUS_01190 gene rlmN 124723 123680 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965033.1 protein_id gnl|my_center|LOCUS_01190 126189 124741 gene locus_tag LOCUS_01200 gene rsmB 126189 124741 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_01200 127066 126131 gene locus_tag LOCUS_01210 gene fmt 127066 126131 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392417.1 protein_id gnl|my_center|LOCUS_01210 127533 127075 gene locus_tag LOCUS_01220 gene def 127533 127075 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392416.1 protein_id gnl|my_center|LOCUS_01220 129778 127559 gene locus_tag LOCUS_01230 gene priA 129778 127559 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_01230 130970 129771 gene locus_tag LOCUS_01240 gene coaBC 130970 129771 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392412.1 protein_id gnl|my_center|LOCUS_01240 131192 130983 gene locus_tag LOCUS_01250 gene rpoZ 131192 130983 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392411.1 protein_id gnl|my_center|LOCUS_01250 131820 131233 gene locus_tag LOCUS_01260 gene gmk 131820 131233 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460557.1 protein_id gnl|my_center|LOCUS_01260 132142 131873 gene locus_tag LOCUS_01270 132142 131873 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965024.1 protein_id gnl|my_center|LOCUS_01270 133040 132156 gene locus_tag LOCUS_01280 133040 132156 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811868.1 protein_id gnl|my_center|LOCUS_01280 134631 133438 gene locus_tag LOCUS_01290 134631 133438 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392999.1 protein_id gnl|my_center|LOCUS_01290 135927 134746 gene locus_tag LOCUS_01300 135927 134746 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_01300 135885 136064 gene locus_tag LOCUS_01310 135885 136064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 136945 136061 gene locus_tag LOCUS_01320 gene dapF 136945 136061 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_01320 138107 136977 gene locus_tag LOCUS_01330 138107 136977 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868783.1 protein_id gnl|my_center|LOCUS_01330 138666 138109 gene locus_tag LOCUS_01340 138666 138109 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420711.1 protein_id gnl|my_center|LOCUS_01340 139436 138660 gene locus_tag LOCUS_01350 139436 138660 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420710.1 protein_id gnl|my_center|LOCUS_01350 140499 139429 gene locus_tag LOCUS_01360 140499 139429 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432442.1 protein_id gnl|my_center|LOCUS_01360 140710 140492 gene locus_tag LOCUS_01370 140710 140492 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_01370 141552 140869 gene locus_tag LOCUS_01380 141552 140869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357453.1 protein_id gnl|my_center|LOCUS_01380 142404 141571 gene locus_tag LOCUS_01390 142404 141571 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419210.1 protein_id gnl|my_center|LOCUS_01390 143162 142503 gene locus_tag LOCUS_01400 143162 142503 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438150.1 protein_id gnl|my_center|LOCUS_01400 144045 143155 gene locus_tag LOCUS_01410 144045 143155 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861144.1 protein_id gnl|my_center|LOCUS_01410 145192 144056 gene locus_tag LOCUS_01420 gene steA 145192 144056 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428389.1 protein_id gnl|my_center|LOCUS_01420 146121 145351 gene locus_tag LOCUS_01430 gene spo0A 146121 145351 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393014.1 protein_id gnl|my_center|LOCUS_01430 147591 146242 gene locus_tag LOCUS_01440 gene spoIVB 147591 146242 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393015.1 protein_id gnl|my_center|LOCUS_01440 149694 147661 gene locus_tag LOCUS_01450 gene ligA 149694 147661 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393509.1 protein_id gnl|my_center|LOCUS_01450 150587 149712 gene locus_tag LOCUS_01460 150587 149712 CDS product lipid II flippase Amj family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528234.1 protein_id gnl|my_center|LOCUS_01460 152890 150743 gene locus_tag LOCUS_01470 gene pcrA 152890 150743 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542538.1 protein_id gnl|my_center|LOCUS_01470 153668 152913 gene locus_tag LOCUS_01480 gene hisIE 153668 152913 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243045.1 protein_id gnl|my_center|LOCUS_01480 154613 153855 gene locus_tag LOCUS_01490 gene hisF 154613 153855 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393527.1 protein_id gnl|my_center|LOCUS_01490 155344 154616 gene locus_tag LOCUS_01500 gene hisA 155344 154616 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393528.1 protein_id gnl|my_center|LOCUS_01500 155949 155338 gene locus_tag LOCUS_01510 gene hisH 155949 155338 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_01510 156803 156219 gene locus_tag LOCUS_01520 gene hisB 156803 156219 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393530.1 protein_id gnl|my_center|LOCUS_01520 157895 156825 gene locus_tag LOCUS_01530 gene hisC 157895 156825 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461462.1 protein_id gnl|my_center|LOCUS_01530 159184 157892 gene locus_tag LOCUS_01540 gene hisD 159184 157892 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461463.1 protein_id gnl|my_center|LOCUS_01540 159386 159559 gene locus_tag LOCUS_01550 159386 159559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 159611 159766 gene locus_tag LOCUS_01560 159611 159766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 161100 159826 gene locus_tag LOCUS_01570 gene purD 161100 159826 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393539.1 protein_id gnl|my_center|LOCUS_01570 162683 161139 gene locus_tag LOCUS_01580 gene purH 162683 161139 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393540.1 protein_id gnl|my_center|LOCUS_01580 163535 162927 gene locus_tag LOCUS_01590 gene purN 163535 162927 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_01590 164733 163678 gene locus_tag LOCUS_01600 gene purM 164733 163678 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_01600 166147 164711 gene locus_tag LOCUS_01610 gene purF 166147 164711 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785566.1 protein_id gnl|my_center|LOCUS_01610 166867 166163 gene locus_tag LOCUS_01620 gene purC 166867 166163 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170544.1 protein_id gnl|my_center|LOCUS_01620 168187 166895 gene locus_tag LOCUS_01630 gene purB 168187 166895 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393548.1 protein_id gnl|my_center|LOCUS_01630 168739 168215 gene locus_tag LOCUS_01640 gene purE 168739 168215 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393549.1 protein_id gnl|my_center|LOCUS_01640 170299 168755 gene locus_tag LOCUS_01650 gene guaA 170299 168755 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393595.1 protein_id gnl|my_center|LOCUS_01650 170850 170311 gene locus_tag LOCUS_01660 gene hpt 170850 170311 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_01660 171770 171054 gene locus_tag LOCUS_01670 171770 171054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 172274 171843 gene locus_tag LOCUS_01680 172274 171843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 172447 172770 gene locus_tag LOCUS_01690 172447 172770 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808431.1 protein_id gnl|my_center|LOCUS_01690 172911 174203 gene locus_tag LOCUS_01700 172911 174203 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921547.1 protein_id gnl|my_center|LOCUS_01700 175334 174312 gene locus_tag LOCUS_01710 gene hypE 175334 174312 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393663.1 protein_id gnl|my_center|LOCUS_01710 176747 175638 gene locus_tag LOCUS_01720 gene hypD 176747 175638 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393664.1 protein_id gnl|my_center|LOCUS_01720 176964 176725 gene locus_tag LOCUS_01730 176964 176725 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393665.1 protein_id gnl|my_center|LOCUS_01730 179258 176955 gene locus_tag LOCUS_01740 gene hypF 179258 176955 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393666.1 protein_id gnl|my_center|LOCUS_01740 179872 179210 gene locus_tag LOCUS_01750 gene hypB 179872 179210 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007234.1 protein_id gnl|my_center|LOCUS_01750 180293 179817 gene locus_tag LOCUS_01760 180293 179817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 180817 180323 gene locus_tag LOCUS_01770 180817 180323 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021168.1 protein_id gnl|my_center|LOCUS_01770 182435 180969 gene locus_tag LOCUS_01780 182435 180969 CDS product F420-non-reducing hydrogenase subunit A, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545782.1 transl_except (pos:complement(182241..182243),aa:Sec) note codon on position 65 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_01780 183391 182438 gene locus_tag LOCUS_01790 183391 182438 CDS product F420-non-reducing hydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545939.1 protein_id gnl|my_center|LOCUS_01790 183588 183397 gene locus_tag LOCUS_01800 183588 183397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01800 183837 183631 gene locus_tag LOCUS_01810 183837 183631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01810 185699 184131 gene locus_tag LOCUS_01820 gene murJ 185699 184131 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391760.1 protein_id gnl|my_center|LOCUS_01820 186634 185708 gene locus_tag LOCUS_01830 186634 185708 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541541.1 protein_id gnl|my_center|LOCUS_01830 186802 188505 gene locus_tag LOCUS_01840 186802 188505 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941459.1 protein_id gnl|my_center|LOCUS_01840 188996 188514 gene locus_tag LOCUS_01850 188996 188514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 189181 189564 gene locus_tag LOCUS_01860 189181 189564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 189644 190588 gene locus_tag LOCUS_01870 189644 190588 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813418.1 protein_id gnl|my_center|LOCUS_01870 191359 190706 gene locus_tag LOCUS_01880 191359 190706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 192747 191464 gene locus_tag LOCUS_01890 192747 191464 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869050.1 protein_id gnl|my_center|LOCUS_01890 192956 193555 gene locus_tag LOCUS_01900 192956 193555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 193724 193569 gene locus_tag LOCUS_01910 193724 193569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 >Feature sequence02 779 33 gene locus_tag LOCUS_01920 779 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 3532 779 gene locus_tag LOCUS_01930 3532 779 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546856.1 protein_id gnl|my_center|LOCUS_01930 4647 3826 gene locus_tag LOCUS_01940 4647 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 4921 4658 gene locus_tag LOCUS_01950 4921 4658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 6225 5035 gene locus_tag LOCUS_01960 gene folP 6225 5035 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391658.1 protein_id gnl|my_center|LOCUS_01960 7338 6373 gene locus_tag LOCUS_01970 7338 6373 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792911.1 protein_id gnl|my_center|LOCUS_01970 8711 7491 gene locus_tag LOCUS_01980 8711 7491 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392962.1 protein_id gnl|my_center|LOCUS_01980 11825 8781 gene locus_tag LOCUS_01990 11825 8781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 13035 12109 gene locus_tag LOCUS_02000 13035 12109 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393156.1 protein_id gnl|my_center|LOCUS_02000 13418 13056 gene locus_tag LOCUS_02010 13418 13056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 14296 13847 gene locus_tag LOCUS_02020 gene ndk 14296 13847 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056122.1 protein_id gnl|my_center|LOCUS_02020 16193 14319 gene locus_tag LOCUS_02030 gene ftsH 16193 14319 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391653.1 protein_id gnl|my_center|LOCUS_02030 17720 16272 gene locus_tag LOCUS_02040 gene tilS 17720 16272 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391652.1 protein_id gnl|my_center|LOCUS_02040 20223 17884 gene locus_tag LOCUS_02050 gene spoIIE 20223 17884 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243026.1 protein_id gnl|my_center|LOCUS_02050 21252 20347 gene locus_tag LOCUS_02060 21252 20347 CDS product Ppx/GppA phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391641.1 protein_id gnl|my_center|LOCUS_02060 21414 22283 gene locus_tag LOCUS_02070 gene hisG 21414 22283 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545705.1 protein_id gnl|my_center|LOCUS_02070 22482 22360 gene locus_tag LOCUS_02080 22482 22360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 22918 22580 gene locus_tag LOCUS_02090 22918 22580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 23144 22896 gene locus_tag LOCUS_02100 23144 22896 CDS product sigma-70 region 4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391638.1 protein_id gnl|my_center|LOCUS_02100 23602 23363 gene locus_tag LOCUS_02110 23602 23363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 24255 23794 gene locus_tag LOCUS_02120 24255 23794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 24549 24271 gene locus_tag LOCUS_02130 24549 24271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 24996 24751 gene locus_tag LOCUS_02140 24996 24751 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421412.1 protein_id gnl|my_center|LOCUS_02140 25281 25006 gene locus_tag LOCUS_02150 25281 25006 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391633.1 protein_id gnl|my_center|LOCUS_02150 26466 25363 gene locus_tag LOCUS_02160 26466 25363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 27130 26570 gene locus_tag LOCUS_02170 gene spoVT 27130 26570 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391631.1 protein_id gnl|my_center|LOCUS_02170 30786 27274 gene locus_tag LOCUS_02180 gene mfd 30786 27274 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391629.1 protein_id gnl|my_center|LOCUS_02180 31505 30930 gene locus_tag LOCUS_02190 gene pth 31505 30930 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257532.1 protein_id gnl|my_center|LOCUS_02190 32161 31508 gene locus_tag LOCUS_02200 32161 31508 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391626.1 protein_id gnl|my_center|LOCUS_02200 33389 32442 gene locus_tag LOCUS_02210 33389 32442 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814952.1 protein_id gnl|my_center|LOCUS_02210 34777 33389 gene locus_tag LOCUS_02220 gene glmU 34777 33389 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391623.1 protein_id gnl|my_center|LOCUS_02220 35181 34894 gene locus_tag LOCUS_02230 gene spoVG 35181 34894 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966499.1 protein_id gnl|my_center|LOCUS_02230 35409 36296 gene locus_tag LOCUS_02240 35409 36296 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393325.1 protein_id gnl|my_center|LOCUS_02240 36417 36511 gene locus_tag LOCUS_t00010 36417 36511 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 36748 37833 gene locus_tag LOCUS_02250 gene yedE 36748 37833 CDS product YedE family putative selenium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680420.1 protein_id gnl|my_center|LOCUS_02250 37814 38029 gene locus_tag LOCUS_02260 37814 38029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 38281 38108 gene locus_tag LOCUS_02270 38281 38108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02270 39331 38573 gene locus_tag LOCUS_02280 39331 38573 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391622.1 protein_id gnl|my_center|LOCUS_02280 40017 39328 gene locus_tag LOCUS_02290 40017 39328 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_02290 41104 40109 gene locus_tag LOCUS_02300 gene ispE 41104 40109 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391620.1 protein_id gnl|my_center|LOCUS_02300 41274 41978 gene locus_tag LOCUS_02310 41274 41978 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460948.1 protein_id gnl|my_center|LOCUS_02310 42416 41967 gene locus_tag LOCUS_02320 42416 41967 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206857.1 protein_id gnl|my_center|LOCUS_02320 42610 43584 gene locus_tag LOCUS_02330 42610 43584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391744.1 protein_id gnl|my_center|LOCUS_02330 45321 43690 gene locus_tag LOCUS_02340 45321 43690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 46331 45426 gene locus_tag LOCUS_02350 46331 45426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 46796 46449 gene locus_tag LOCUS_02360 46796 46449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 47001 49028 gene locus_tag LOCUS_02370 47001 49028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 48976 51336 gene locus_tag LOCUS_02380 48976 51336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 51501 52445 gene locus_tag LOCUS_02390 gene ykvP 51501 52445 CDS product spore protein YkvP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245384.1 protein_id gnl|my_center|LOCUS_02390 52465 53544 gene locus_tag LOCUS_02400 52465 53544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 53580 54737 gene locus_tag LOCUS_02410 53580 54737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 55359 54814 gene locus_tag LOCUS_02420 55359 54814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 56219 55449 gene locus_tag LOCUS_02430 56219 55449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 56345 58324 gene locus_tag LOCUS_02440 56345 58324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 58321 60096 gene locus_tag LOCUS_02450 58321 60096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 60093 61586 gene locus_tag LOCUS_02460 60093 61586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 61547 63178 gene locus_tag LOCUS_02470 61547 63178 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459169.1 protein_id gnl|my_center|LOCUS_02470 63693 63238 gene locus_tag LOCUS_02480 63693 63238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 64204 63821 gene locus_tag LOCUS_02490 64204 63821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 65224 64370 gene locus_tag LOCUS_02500 gene yabG 65224 64370 CDS product sporulation peptidase YabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458914.1 protein_id gnl|my_center|LOCUS_02500 65587 65309 gene locus_tag LOCUS_02510 65587 65309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 65797 66618 gene locus_tag LOCUS_02520 65797 66618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 67155 66682 gene locus_tag LOCUS_02530 67155 66682 CDS product ribonuclease H-like YkuK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773636.1 protein_id gnl|my_center|LOCUS_02530 68065 67187 gene locus_tag LOCUS_02540 gene rsmA 68065 67187 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892086.1 protein_id gnl|my_center|LOCUS_02540 69358 68276 gene locus_tag LOCUS_02550 69358 68276 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768275.1 protein_id gnl|my_center|LOCUS_02550 69969 69442 gene locus_tag LOCUS_02560 gene cobO 69969 69442 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812393.1 protein_id gnl|my_center|LOCUS_02560 70738 69950 gene locus_tag LOCUS_02570 70738 69950 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259435.1 protein_id gnl|my_center|LOCUS_02570 72349 70799 gene locus_tag LOCUS_02580 gene metG 72349 70799 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391596.1 protein_id gnl|my_center|LOCUS_02580 72565 72819 gene locus_tag LOCUS_02590 72565 72819 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815009.1 protein_id gnl|my_center|LOCUS_02590 73749 72913 gene locus_tag LOCUS_02600 gene rsmI 73749 72913 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530019.1 protein_id gnl|my_center|LOCUS_02600 74573 73755 gene locus_tag LOCUS_02610 74573 73755 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221433.1 protein_id gnl|my_center|LOCUS_02610 75733 74747 gene locus_tag LOCUS_02620 gene holB 75733 74747 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_02620 76349 75720 gene locus_tag LOCUS_02630 gene tmk 76349 75720 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391590.1 protein_id gnl|my_center|LOCUS_02630 77810 76374 gene locus_tag LOCUS_02640 77810 76374 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393748.1 protein_id gnl|my_center|LOCUS_02640 78218 77928 gene locus_tag LOCUS_02650 78218 77928 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391585.1 protein_id gnl|my_center|LOCUS_02650 78798 78223 gene locus_tag LOCUS_02660 78798 78223 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391584.1 protein_id gnl|my_center|LOCUS_02660 79549 78791 gene locus_tag LOCUS_02670 79549 78791 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391583.1 protein_id gnl|my_center|LOCUS_02670 80652 79564 gene locus_tag LOCUS_02680 80652 79564 CDS product pyruvate flavodoxin/ferredoxin oxidoreductase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391582.1 protein_id gnl|my_center|LOCUS_02680 81363 80677 gene locus_tag LOCUS_02690 81363 80677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 81731 81468 gene locus_tag LOCUS_02700 81731 81468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 82384 81788 gene locus_tag LOCUS_02710 gene recR 82384 81788 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_02710 82702 82394 gene locus_tag LOCUS_02720 82702 82394 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815036.1 protein_id gnl|my_center|LOCUS_02720 84137 82722 gene locus_tag LOCUS_02730 gene dnaX 84137 82722 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458896.1 protein_id gnl|my_center|LOCUS_02730 84849 84759 gene locus_tag LOCUS_t00020 84849 84759 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 85202 85107 gene locus_tag LOCUS_t00030 85202 85107 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 85701 85216 gene locus_tag LOCUS_02740 gene tadA 85701 85216 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 protein_id gnl|my_center|LOCUS_02740 85798 85722 gene locus_tag LOCUS_t00040 85798 85722 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 85956 85881 gene locus_tag LOCUS_t00050 85956 85881 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 86054 85960 gene locus_tag LOCUS_t00060 86054 85960 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 86188 86097 gene locus_tag LOCUS_t00070 86188 86097 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 89500 86474 gene locus_tag LOCUS_02750 89500 86474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 90374 89523 gene locus_tag LOCUS_02760 90374 89523 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_02760 90949 90371 gene locus_tag LOCUS_02770 90949 90371 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392710.1 protein_id gnl|my_center|LOCUS_02770 91445 91218 gene locus_tag LOCUS_02780 gene rpsR 91445 91218 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391678.1 protein_id gnl|my_center|LOCUS_02780 91893 91474 gene locus_tag LOCUS_02790 gene ssb 91893 91474 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391677.1 protein_id gnl|my_center|LOCUS_02790 92201 91914 gene locus_tag LOCUS_02800 gene rpsF 92201 91914 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048444.1 protein_id gnl|my_center|LOCUS_02800 93079 92408 gene locus_tag LOCUS_02810 93079 92408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 93198 94352 gene locus_tag LOCUS_02820 93198 94352 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393376.1 protein_id gnl|my_center|LOCUS_02820 94772 94422 gene locus_tag LOCUS_02830 94772 94422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 95253 95050 gene locus_tag LOCUS_02840 95253 95050 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_02840 96750 95344 gene locus_tag LOCUS_02850 96750 95344 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391671.1 protein_id gnl|my_center|LOCUS_02850 97615 96878 gene locus_tag LOCUS_02860 97615 96878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 98708 97641 gene locus_tag LOCUS_02870 98708 97641 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393376.1 protein_id gnl|my_center|LOCUS_02870 98843 99499 gene locus_tag LOCUS_02880 gene yyaC 98843 99499 CDS product spore protease YyaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393985.1 protein_id gnl|my_center|LOCUS_02880 99872 99627 gene locus_tag LOCUS_02890 99872 99627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 100559 99930 gene locus_tag LOCUS_02900 100559 99930 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542407.1 protein_id gnl|my_center|LOCUS_02900 101256 100717 gene locus_tag LOCUS_02910 101256 100717 CDS product DUF4446 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398925.1 protein_id gnl|my_center|LOCUS_02910 102589 102714 gene locus_tag LOCUS_02920 102589 102714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 104206 103349 gene locus_tag LOCUS_02930 104206 103349 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_02930 104963 104199 gene locus_tag LOCUS_02940 104963 104199 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_02940 105974 105258 gene locus_tag LOCUS_02950 gene rsmG 105974 105258 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355977.1 protein_id gnl|my_center|LOCUS_02950 107862 105937 gene locus_tag LOCUS_02960 gene mnmG 107862 105937 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226825.1 protein_id gnl|my_center|LOCUS_02960 109258 107873 gene locus_tag LOCUS_02970 gene mnmE 109258 107873 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393757.1 protein_id gnl|my_center|LOCUS_02970 109894 109268 gene locus_tag LOCUS_02980 109894 109268 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393997.1 protein_id gnl|my_center|LOCUS_02980 110579 109845 gene locus_tag LOCUS_02990 110579 109845 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393998.1 protein_id gnl|my_center|LOCUS_02990 111171 110818 gene locus_tag LOCUS_03000 gene rnpA 111171 110818 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429302.1 protein_id gnl|my_center|LOCUS_03000 111581 112915 gene locus_tag LOCUS_03010 gene dnaA 111581 112915 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391551.1 protein_id gnl|my_center|LOCUS_03010 113091 114149 gene locus_tag LOCUS_03020 gene dnaN 113091 114149 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012615304.1 protein_id gnl|my_center|LOCUS_03020 114161 115249 gene locus_tag LOCUS_03030 gene recF 114161 115249 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028050.1 protein_id gnl|my_center|LOCUS_03030 115252 115500 gene locus_tag LOCUS_03040 115252 115500 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815134.1 protein_id gnl|my_center|LOCUS_03040 115688 117592 gene locus_tag LOCUS_03050 gene gyrB 115688 117592 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391556.1 protein_id gnl|my_center|LOCUS_03050 118535 119266 gene locus_tag LOCUS_03060 118535 119266 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458906.1 protein_id gnl|my_center|LOCUS_03060 119543 121966 gene locus_tag LOCUS_03070 gene gyrA 119543 121966 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282864.1 protein_id gnl|my_center|LOCUS_03070 121986 122438 gene locus_tag LOCUS_03080 121986 122438 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277988.1 protein_id gnl|my_center|LOCUS_03080 122450 122884 gene locus_tag LOCUS_03090 122450 122884 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277988.1 protein_id gnl|my_center|LOCUS_03090 123261 124145 gene locus_tag LOCUS_03100 gene pdxS 123261 124145 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391558.1 protein_id gnl|my_center|LOCUS_03100 124149 124715 gene locus_tag LOCUS_03110 gene pdxT 124149 124715 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391559.1 protein_id gnl|my_center|LOCUS_03110 125069 126217 gene locus_tag LOCUS_03120 125069 126217 CDS product serine-pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081619.1 protein_id gnl|my_center|LOCUS_03120 126217 127803 gene locus_tag LOCUS_03130 gene serA 126217 127803 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391569.1 protein_id gnl|my_center|LOCUS_03130 127816 129093 gene locus_tag LOCUS_03140 gene serS 127816 129093 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391570.1 protein_id gnl|my_center|LOCUS_03140 129567 130463 gene locus_tag LOCUS_03150 129567 130463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 130460 130912 gene locus_tag LOCUS_03160 gene rplI 130460 130912 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391680.1 protein_id gnl|my_center|LOCUS_03160 130902 132236 gene locus_tag LOCUS_03170 gene dnaB 130902 132236 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391682.1 protein_id gnl|my_center|LOCUS_03170 132292 133683 gene locus_tag LOCUS_03180 132292 133683 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393793.1 protein_id gnl|my_center|LOCUS_03180 133799 135082 gene locus_tag LOCUS_03190 133799 135082 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462314.1 protein_id gnl|my_center|LOCUS_03190 135193 135270 gene locus_tag LOCUS_t00080 135193 135270 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 135337 135411 gene locus_tag LOCUS_t00090 135337 135411 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 135674 135838 gene locus_tag LOCUS_03200 gene scfA 135674 135838 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815210.1 protein_id gnl|my_center|LOCUS_03200 136048 137400 gene locus_tag LOCUS_03210 gene scfB 136048 137400 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462310.1 protein_id gnl|my_center|LOCUS_03210 137665 138855 gene locus_tag LOCUS_03220 137665 138855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 138949 139557 gene locus_tag LOCUS_03230 138949 139557 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392349.1 protein_id gnl|my_center|LOCUS_03230 139621 140514 gene locus_tag LOCUS_03240 139621 140514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393895.1 protein_id gnl|my_center|LOCUS_03240 140507 141814 gene locus_tag LOCUS_03250 gene murA 140507 141814 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393852.1 protein_id gnl|my_center|LOCUS_03250 141811 142293 gene locus_tag LOCUS_03260 gene rlmH 141811 142293 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773554.1 protein_id gnl|my_center|LOCUS_03260 142651 143832 gene locus_tag LOCUS_03270 gene dsrA 142651 143832 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810505.1 protein_id gnl|my_center|LOCUS_03270 143907 144965 gene locus_tag LOCUS_03280 gene dsrB 143907 144965 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810503.1 protein_id gnl|my_center|LOCUS_03280 145005 145196 gene locus_tag LOCUS_03290 145005 145196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 145318 145746 gene locus_tag LOCUS_03300 145318 145746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 146151 146336 gene locus_tag LOCUS_03310 146151 146336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 146461 147228 gene locus_tag LOCUS_03320 gene dsrM 146461 147228 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544992.1 protein_id gnl|my_center|LOCUS_03320 147254 148705 gene locus_tag LOCUS_03330 147254 148705 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461881.1 protein_id gnl|my_center|LOCUS_03330 148799 149119 gene locus_tag LOCUS_03340 148799 149119 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393134.1 protein_id gnl|my_center|LOCUS_03340 149197 150600 gene locus_tag LOCUS_03350 gene cobB 149197 150600 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393130.1 protein_id gnl|my_center|LOCUS_03350 150676 150993 gene locus_tag LOCUS_03360 150676 150993 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294592.1 protein_id gnl|my_center|LOCUS_03360 150996 151670 gene locus_tag LOCUS_03370 gene nfi 150996 151670 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172477.1 protein_id gnl|my_center|LOCUS_03370 152440 151667 gene locus_tag LOCUS_03380 gene otsB 152440 151667 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392881.1 protein_id gnl|my_center|LOCUS_03380 153866 152424 gene locus_tag LOCUS_03390 153866 152424 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392880.1 protein_id gnl|my_center|LOCUS_03390 154177 154878 gene locus_tag LOCUS_03400 gene sleB 154177 154878 CDS product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964005.1 protein_id gnl|my_center|LOCUS_03400 155962 154883 gene locus_tag LOCUS_03410 155962 154883 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256874.1 protein_id gnl|my_center|LOCUS_03410 156409 156897 gene locus_tag LOCUS_03420 156409 156897 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_03420 156894 158105 gene locus_tag LOCUS_03430 156894 158105 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_03430 158442 158864 gene locus_tag LOCUS_03440 158442 158864 CDS product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393888.1 protein_id gnl|my_center|LOCUS_03440 158866 160554 gene locus_tag LOCUS_03450 gene argS 158866 160554 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393887.1 protein_id gnl|my_center|LOCUS_03450 160566 162173 gene locus_tag LOCUS_03460 160566 162173 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393886.1 protein_id gnl|my_center|LOCUS_03460 162219 163151 gene locus_tag LOCUS_03470 162219 163151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 163209 163955 gene locus_tag LOCUS_03480 163209 163955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 164050 164421 gene locus_tag LOCUS_03490 164050 164421 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272792.1 protein_id gnl|my_center|LOCUS_03490 164481 165146 gene locus_tag LOCUS_03500 164481 165146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393882.1 protein_id gnl|my_center|LOCUS_03500 165157 166020 gene locus_tag LOCUS_03510 165157 166020 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393881.1 protein_id gnl|my_center|LOCUS_03510 166216 166878 gene locus_tag LOCUS_03520 gene fsa 166216 166878 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393880.1 protein_id gnl|my_center|LOCUS_03520 167300 168796 gene locus_tag LOCUS_03530 gene rho 167300 168796 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393879.1 protein_id gnl|my_center|LOCUS_03530 168896 169813 gene locus_tag LOCUS_03540 168896 169813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 169985 171238 gene locus_tag LOCUS_03550 169985 171238 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941550.1 protein_id gnl|my_center|LOCUS_03550 171331 171510 gene locus_tag LOCUS_03560 171331 171510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 172688 171543 gene locus_tag LOCUS_03570 gene dinB 172688 171543 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937382.1 protein_id gnl|my_center|LOCUS_03570 173030 173791 gene locus_tag LOCUS_03580 gene atpB 173030 173791 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462234.1 protein_id gnl|my_center|LOCUS_03580 173818 174051 gene locus_tag LOCUS_03590 173818 174051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 174252 174749 gene locus_tag LOCUS_03600 gene atpF 174252 174749 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906128.1 protein_id gnl|my_center|LOCUS_03600 174743 175264 gene locus_tag LOCUS_03610 gene atpH 174743 175264 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393858.1 protein_id gnl|my_center|LOCUS_03610 175383 176879 gene locus_tag LOCUS_03620 gene atpA 175383 176879 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_03620 176900 177739 gene locus_tag LOCUS_03630 gene atpG 176900 177739 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393856.1 protein_id gnl|my_center|LOCUS_03630 177752 179179 gene locus_tag LOCUS_03640 gene atpD 177752 179179 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_03640 179269 179694 gene locus_tag LOCUS_03650 179269 179694 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773532.1 protein_id gnl|my_center|LOCUS_03650 >Feature sequence03 197 1555 gene locus_tag LOCUS_03660 197 1555 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_03660 1573 2910 gene locus_tag LOCUS_03670 gene lysA 1573 2910 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392877.1 protein_id gnl|my_center|LOCUS_03670 2975 5617 gene locus_tag LOCUS_03680 2975 5617 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546426.1 protein_id gnl|my_center|LOCUS_03680 5610 6239 gene locus_tag LOCUS_03690 5610 6239 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_03690 6372 7274 gene locus_tag LOCUS_03700 gene trpS 6372 7274 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460225.1 protein_id gnl|my_center|LOCUS_03700 7300 7899 gene locus_tag LOCUS_03710 7300 7899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 7906 8313 gene locus_tag LOCUS_03720 gene ytfJ 7906 8313 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392871.1 protein_id gnl|my_center|LOCUS_03720 8413 9006 gene locus_tag LOCUS_03730 8413 9006 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774866.1 protein_id gnl|my_center|LOCUS_03730 9006 9542 gene locus_tag LOCUS_03740 9006 9542 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392868.1 protein_id gnl|my_center|LOCUS_03740 9564 10289 gene locus_tag LOCUS_03750 9564 10289 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392865.1 protein_id gnl|my_center|LOCUS_03750 10386 10847 gene locus_tag LOCUS_03760 10386 10847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811083.1 protein_id gnl|my_center|LOCUS_03760 11053 11253 gene locus_tag LOCUS_03770 11053 11253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 11284 11637 gene locus_tag LOCUS_03780 11284 11637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03780 11910 12995 gene locus_tag LOCUS_03790 gene hisC 11910 12995 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_03790 13015 14106 gene locus_tag LOCUS_03800 13015 14106 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392846.1 protein_id gnl|my_center|LOCUS_03800 14354 15640 gene locus_tag LOCUS_03810 gene aroA 14354 15640 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392845.1 protein_id gnl|my_center|LOCUS_03810 15705 16409 gene locus_tag LOCUS_03820 gene cmk 15705 16409 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361264.1 protein_id gnl|my_center|LOCUS_03820 16406 16990 gene locus_tag LOCUS_03830 16406 16990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 16998 18980 gene locus_tag LOCUS_03840 16998 18980 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811135.1 protein_id gnl|my_center|LOCUS_03840 19139 19852 gene locus_tag LOCUS_03850 19139 19852 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392840.1 protein_id gnl|my_center|LOCUS_03850 19842 20999 gene locus_tag LOCUS_03860 19842 20999 CDS product stage II sporulation protein P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392839.1 protein_id gnl|my_center|LOCUS_03860 21014 21469 gene locus_tag LOCUS_03870 21014 21469 CDS product DUF3189 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392838.1 protein_id gnl|my_center|LOCUS_03870 21466 21855 gene locus_tag LOCUS_03880 21466 21855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 21904 23208 gene locus_tag LOCUS_03890 21904 23208 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_03890 23220 24533 gene locus_tag LOCUS_03900 gene der 23220 24533 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_03900 24534 25124 gene locus_tag LOCUS_03910 gene plsY 24534 25124 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392834.1 protein_id gnl|my_center|LOCUS_03910 25175 28015 gene locus_tag LOCUS_03920 gene purL 25175 28015 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259203.1 protein_id gnl|my_center|LOCUS_03920 28012 28788 gene locus_tag LOCUS_03930 gene purQ 28012 28788 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256638.1 protein_id gnl|my_center|LOCUS_03930 28799 29851 gene locus_tag LOCUS_03940 28799 29851 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426955.1 protein_id gnl|my_center|LOCUS_03940 30186 30869 gene locus_tag LOCUS_03950 30186 30869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 30883 32088 gene locus_tag LOCUS_03960 30883 32088 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259630.1 protein_id gnl|my_center|LOCUS_03960 32116 33396 gene locus_tag LOCUS_03970 32116 33396 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_03970 33408 34364 gene locus_tag LOCUS_03980 33408 34364 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256415.1 protein_id gnl|my_center|LOCUS_03980 34374 35294 gene locus_tag LOCUS_03990 34374 35294 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256414.1 protein_id gnl|my_center|LOCUS_03990 35718 36236 gene locus_tag LOCUS_04000 35718 36236 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877737.1 protein_id gnl|my_center|LOCUS_04000 36255 37400 gene locus_tag LOCUS_04010 36255 37400 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583980.1 protein_id gnl|my_center|LOCUS_04010 38421 37408 gene locus_tag LOCUS_04020 38421 37408 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391684.1 protein_id gnl|my_center|LOCUS_04020 38830 39282 gene locus_tag LOCUS_04030 38830 39282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 39640 39323 gene locus_tag LOCUS_04040 39640 39323 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393435.1 protein_id gnl|my_center|LOCUS_04040 39927 40613 gene locus_tag LOCUS_04050 39927 40613 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462100.1 protein_id gnl|my_center|LOCUS_04050 40983 42014 gene locus_tag LOCUS_04060 40983 42014 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813561.1 protein_id gnl|my_center|LOCUS_04060 42093 42632 gene locus_tag LOCUS_04070 42093 42632 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813563.1 protein_id gnl|my_center|LOCUS_04070 42610 43893 gene locus_tag LOCUS_04080 42610 43893 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813565.1 protein_id gnl|my_center|LOCUS_04080 43921 44763 gene locus_tag LOCUS_04090 43921 44763 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393766.1 protein_id gnl|my_center|LOCUS_04090 44797 45354 gene locus_tag LOCUS_04100 44797 45354 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881093.1 protein_id gnl|my_center|LOCUS_04100 45517 46704 gene locus_tag LOCUS_04110 gene maeB 45517 46704 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229415.1 protein_id gnl|my_center|LOCUS_04110 48650 47127 gene locus_tag LOCUS_04120 48650 47127 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392258.1 protein_id gnl|my_center|LOCUS_04120 48807 49454 gene locus_tag LOCUS_04130 48807 49454 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082876.1 protein_id gnl|my_center|LOCUS_04130 49850 50131 gene locus_tag LOCUS_04140 49850 50131 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763032.1 protein_id gnl|my_center|LOCUS_04140 50222 51145 gene locus_tag LOCUS_04150 50222 51145 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941035.1 protein_id gnl|my_center|LOCUS_04150 51181 52236 gene locus_tag LOCUS_04160 51181 52236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173689.1 protein_id gnl|my_center|LOCUS_04160 52476 52258 gene locus_tag LOCUS_04170 52476 52258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 52574 54283 gene locus_tag LOCUS_04180 gene polX 52574 54283 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_04180 54356 54940 gene locus_tag LOCUS_04190 54356 54940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 54987 55586 gene locus_tag LOCUS_04200 54987 55586 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392134.1 protein_id gnl|my_center|LOCUS_04200 55659 56270 gene locus_tag LOCUS_04210 gene yedF 55659 56270 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943158.1 protein_id gnl|my_center|LOCUS_04210 57796 56267 gene locus_tag LOCUS_04220 57796 56267 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065752.1 protein_id gnl|my_center|LOCUS_04220 58817 58095 gene locus_tag LOCUS_04230 58817 58095 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774590.1 protein_id gnl|my_center|LOCUS_04230 59511 58804 gene locus_tag LOCUS_04240 59511 58804 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392641.1 protein_id gnl|my_center|LOCUS_04240 60430 59588 gene locus_tag LOCUS_04250 60430 59588 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392640.1 protein_id gnl|my_center|LOCUS_04250 60668 61612 gene locus_tag LOCUS_04260 60668 61612 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392639.1 protein_id gnl|my_center|LOCUS_04260 61719 62075 gene locus_tag LOCUS_04270 61719 62075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 62264 63211 gene locus_tag LOCUS_04280 62264 63211 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944001.1 protein_id gnl|my_center|LOCUS_04280 63434 64930 gene locus_tag LOCUS_04290 gene putP 63434 64930 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707325.1 protein_id gnl|my_center|LOCUS_04290 65269 64997 gene locus_tag LOCUS_04300 65269 64997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 65782 67260 gene locus_tag LOCUS_04310 gene istA 65782 67260 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974233.1 protein_id gnl|my_center|LOCUS_04310 67257 67985 gene locus_tag LOCUS_04320 67257 67985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 68034 68342 gene locus_tag LOCUS_04330 68034 68342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 68417 68629 gene locus_tag LOCUS_04340 68417 68629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 69703 68777 gene locus_tag LOCUS_04350 gene mdh 69703 68777 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_04350 70532 69759 gene locus_tag LOCUS_04360 gene tatC 70532 69759 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392793.1 protein_id gnl|my_center|LOCUS_04360 70872 70618 gene locus_tag LOCUS_04370 70872 70618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 72241 71012 gene locus_tag LOCUS_04380 72241 71012 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939204.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04380 72460 72266 gene locus_tag LOCUS_04390 72460 72266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04390 73409 72477 gene locus_tag LOCUS_04400 73409 72477 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545343.1 protein_id gnl|my_center|LOCUS_04400 74265 73723 gene locus_tag LOCUS_04410 74265 73723 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939205.1 protein_id gnl|my_center|LOCUS_04410 75459 74356 gene locus_tag LOCUS_04420 75459 74356 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393239.1 protein_id gnl|my_center|LOCUS_04420 78310 75569 gene locus_tag LOCUS_04430 78310 75569 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392653.1 protein_id gnl|my_center|LOCUS_04430 78534 78352 gene locus_tag LOCUS_04440 78534 78352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 78900 78625 gene locus_tag LOCUS_04450 78900 78625 CDS product late competence development ComFB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391619.1 protein_id gnl|my_center|LOCUS_04450 79270 78914 gene locus_tag LOCUS_04460 79270 78914 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392649.1 protein_id gnl|my_center|LOCUS_04460 80152 79511 gene locus_tag LOCUS_04470 80152 79511 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810125.1 protein_id gnl|my_center|LOCUS_04470 80296 80219 gene locus_tag LOCUS_t00100 80296 80219 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 80763 81707 gene locus_tag LOCUS_04480 80763 81707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 81770 83389 gene locus_tag LOCUS_04490 81770 83389 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454872.1 protein_id gnl|my_center|LOCUS_04490 83399 84265 gene locus_tag LOCUS_04500 83399 84265 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684725.1 protein_id gnl|my_center|LOCUS_04500 85289 84258 gene locus_tag LOCUS_04510 85289 84258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 85816 85361 gene locus_tag LOCUS_04520 85816 85361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 86316 85810 gene locus_tag LOCUS_04530 86316 85810 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939394.1 protein_id gnl|my_center|LOCUS_04530 86602 86420 gene locus_tag LOCUS_04540 86602 86420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 86850 86614 gene locus_tag LOCUS_04550 86850 86614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 87603 86947 gene locus_tag LOCUS_04560 87603 86947 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392490.1 protein_id gnl|my_center|LOCUS_04560 88761 87616 gene locus_tag LOCUS_04570 88761 87616 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392489.1 protein_id gnl|my_center|LOCUS_04570 89945 88794 gene locus_tag LOCUS_04580 89945 88794 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392647.1 protein_id gnl|my_center|LOCUS_04580 90693 90109 gene locus_tag LOCUS_04590 90693 90109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 91450 90854 gene locus_tag LOCUS_04600 91450 90854 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392977.1 protein_id gnl|my_center|LOCUS_04600 93012 91936 gene locus_tag LOCUS_04610 93012 91936 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937737.1 protein_id gnl|my_center|LOCUS_04610 93375 93034 gene locus_tag LOCUS_04620 93375 93034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 93817 93380 gene locus_tag LOCUS_04630 93817 93380 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937739.1 protein_id gnl|my_center|LOCUS_04630 94704 93832 gene locus_tag LOCUS_04640 94704 93832 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937740.1 protein_id gnl|my_center|LOCUS_04640 96629 94701 gene locus_tag LOCUS_04650 96629 94701 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937741.1 protein_id gnl|my_center|LOCUS_04650 96969 97202 gene locus_tag LOCUS_04660 96969 97202 CDS product DUF1657 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393288.1 protein_id gnl|my_center|LOCUS_04660 99159 97240 gene locus_tag LOCUS_04670 gene selB 99159 97240 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393980.1 protein_id gnl|my_center|LOCUS_04670 100583 99147 gene locus_tag LOCUS_04680 gene selA 100583 99147 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897684.1 protein_id gnl|my_center|LOCUS_04680 101297 100623 gene locus_tag LOCUS_04690 101297 100623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 102121 101402 gene locus_tag LOCUS_04700 gene ubiE 102121 101402 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392794.1 protein_id gnl|my_center|LOCUS_04700 102869 102126 gene locus_tag LOCUS_04710 102869 102126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 103465 103073 gene locus_tag LOCUS_04720 gene speD 103465 103073 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392796.1 protein_id gnl|my_center|LOCUS_04720 106049 103884 gene locus_tag LOCUS_04730 106049 103884 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861168.1 protein_id gnl|my_center|LOCUS_04730 106545 106357 gene locus_tag LOCUS_04740 106545 106357 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393332.1 protein_id gnl|my_center|LOCUS_04740 107947 106826 gene locus_tag LOCUS_04750 107947 106826 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675870.1 protein_id gnl|my_center|LOCUS_04750 108177 107995 gene locus_tag LOCUS_04760 108177 107995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 110515 108443 gene locus_tag LOCUS_04770 110515 108443 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391908.1 protein_id gnl|my_center|LOCUS_04770 111407 110508 gene locus_tag LOCUS_04780 111407 110508 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391904.1 protein_id gnl|my_center|LOCUS_04780 111831 111400 gene locus_tag LOCUS_04790 111831 111400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 112973 112536 gene locus_tag LOCUS_04800 112973 112536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 113982 113101 gene locus_tag LOCUS_04810 113982 113101 CDS product ArdC-like ssDNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785691.1 protein_id gnl|my_center|LOCUS_04810 114600 114028 gene locus_tag LOCUS_04820 114600 114028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 115034 114888 gene locus_tag LOCUS_04830 115034 114888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 115399 115103 gene locus_tag LOCUS_04840 115399 115103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 115508 115386 gene locus_tag LOCUS_04850 115508 115386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 116260 115562 gene locus_tag LOCUS_04860 116260 115562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 116707 116444 gene locus_tag LOCUS_04870 116707 116444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 117097 116747 gene locus_tag LOCUS_04880 117097 116747 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393300.1 protein_id gnl|my_center|LOCUS_04880 >Feature sequence04 634 560 gene locus_tag LOCUS_t00110 634 560 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1619 690 gene locus_tag LOCUS_04890 1619 690 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393326.1 protein_id gnl|my_center|LOCUS_04890 1718 1876 gene locus_tag LOCUS_04900 1718 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 1948 2076 gene locus_tag LOCUS_04910 1948 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 2620 2270 gene locus_tag LOCUS_04920 2620 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 2788 3072 gene locus_tag LOCUS_04930 2788 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 3963 3304 gene locus_tag LOCUS_04940 3963 3304 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393512.1 protein_id gnl|my_center|LOCUS_04940 4119 4250 gene locus_tag LOCUS_04950 4119 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 4457 4296 gene locus_tag LOCUS_04960 4457 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 4593 4462 gene locus_tag LOCUS_04970 4593 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 4806 4985 gene locus_tag LOCUS_04980 4806 4985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04980 5019 5165 gene locus_tag LOCUS_04990 5019 5165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 5685 5610 gene locus_tag LOCUS_t00120 5685 5610 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5769 5696 gene locus_tag LOCUS_t00130 5769 5696 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7284 5800 gene locus_tag LOCUS_05000 gene gltX 7284 5800 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_05000 7895 7452 gene locus_tag LOCUS_05010 7895 7452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05010 9291 7918 gene locus_tag LOCUS_05020 9291 7918 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392880.1 protein_id gnl|my_center|LOCUS_05020 11477 9309 gene locus_tag LOCUS_05030 11477 9309 CDS product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392879.1 protein_id gnl|my_center|LOCUS_05030 12685 11486 gene locus_tag LOCUS_05040 12685 11486 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392878.1 protein_id gnl|my_center|LOCUS_05040 12999 13958 gene locus_tag LOCUS_05050 gene selD 12999 13958 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_05050 15620 14037 gene locus_tag LOCUS_05060 15620 14037 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877458.1 protein_id gnl|my_center|LOCUS_05060 16066 16497 gene locus_tag LOCUS_05070 16066 16497 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392448.1 protein_id gnl|my_center|LOCUS_05070 16436 17302 gene locus_tag LOCUS_05080 16436 17302 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876244.1 protein_id gnl|my_center|LOCUS_05080 17315 18136 gene locus_tag LOCUS_05090 17315 18136 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392445.1 protein_id gnl|my_center|LOCUS_05090 18626 19258 gene locus_tag LOCUS_05100 18626 19258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 19296 20408 gene locus_tag LOCUS_05110 19296 20408 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975879.1 protein_id gnl|my_center|LOCUS_05110 20398 21120 gene locus_tag LOCUS_05120 20398 21120 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969991.1 protein_id gnl|my_center|LOCUS_05120 21171 22160 gene locus_tag LOCUS_05130 21171 22160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 22262 22041 gene locus_tag LOCUS_05140 22262 22041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 22855 22289 gene locus_tag LOCUS_05150 22855 22289 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813649.1 protein_id gnl|my_center|LOCUS_05150 23988 22855 gene locus_tag LOCUS_05160 23988 22855 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393399.1 protein_id gnl|my_center|LOCUS_05160 24721 23975 gene locus_tag LOCUS_05170 24721 23975 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966543.1 protein_id gnl|my_center|LOCUS_05170 25745 24738 gene locus_tag LOCUS_05180 25745 24738 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393402.1 protein_id gnl|my_center|LOCUS_05180 25915 26475 gene locus_tag LOCUS_05190 25915 26475 CDS product GerMN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392053.1 protein_id gnl|my_center|LOCUS_05190 28222 26489 gene locus_tag LOCUS_05200 28222 26489 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948117.1 protein_id gnl|my_center|LOCUS_05200 28414 28280 gene locus_tag LOCUS_05210 28414 28280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 29065 28442 gene locus_tag LOCUS_05220 29065 28442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 29548 29081 gene locus_tag LOCUS_05230 29548 29081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072774911.1 protein_id gnl|my_center|LOCUS_05230 29843 30322 gene locus_tag LOCUS_05240 29843 30322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 30346 32280 gene locus_tag LOCUS_05250 30346 32280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 32743 32252 gene locus_tag LOCUS_05260 32743 32252 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249062.1 protein_id gnl|my_center|LOCUS_05260 34912 32942 gene locus_tag LOCUS_05270 gene feoB 34912 32942 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541602.1 protein_id gnl|my_center|LOCUS_05270 35185 34964 gene locus_tag LOCUS_05280 35185 34964 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392697.1 protein_id gnl|my_center|LOCUS_05280 35375 35716 gene locus_tag LOCUS_05290 35375 35716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 35766 36044 gene locus_tag LOCUS_05300 35766 36044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 36155 37894 gene locus_tag LOCUS_05310 36155 37894 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546166.1 protein_id gnl|my_center|LOCUS_05310 37983 38222 gene locus_tag LOCUS_05320 37983 38222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 38226 38951 gene locus_tag LOCUS_05330 gene moeB 38226 38951 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393468.1 protein_id gnl|my_center|LOCUS_05330 39354 39037 gene locus_tag LOCUS_05340 39354 39037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 39812 39390 gene locus_tag LOCUS_05350 39812 39390 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964982.1 protein_id gnl|my_center|LOCUS_05350 40128 39943 gene locus_tag LOCUS_05360 40128 39943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 42484 40520 gene locus_tag LOCUS_05370 42484 40520 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_05370 43032 42499 gene locus_tag LOCUS_05380 43032 42499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 44028 43036 gene locus_tag LOCUS_05390 44028 43036 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_05390 44488 44198 gene locus_tag LOCUS_05400 44488 44198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 44809 44516 gene locus_tag LOCUS_05410 44809 44516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 45681 44824 gene locus_tag LOCUS_05420 45681 44824 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861239.1 protein_id gnl|my_center|LOCUS_05420 45821 45681 gene locus_tag LOCUS_05430 45821 45681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 46406 45909 gene locus_tag LOCUS_05440 46406 45909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 46645 46866 gene locus_tag LOCUS_05450 46645 46866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 47163 50525 gene locus_tag LOCUS_05460 47163 50525 CDS product ribonucleotide reductase N-terminal alpha domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459011.1 protein_id gnl|my_center|LOCUS_05460 50715 50894 gene locus_tag LOCUS_05470 50715 50894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 51327 50932 gene locus_tag LOCUS_05480 51327 50932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 52012 51335 gene locus_tag LOCUS_05490 52012 51335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 52186 52950 gene locus_tag LOCUS_05500 52186 52950 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837964.1 protein_id gnl|my_center|LOCUS_05500 53013 53606 gene locus_tag LOCUS_05510 53013 53606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 53807 53977 gene locus_tag LOCUS_05520 53807 53977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 54717 54043 gene locus_tag LOCUS_05530 54717 54043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 55050 54832 gene locus_tag LOCUS_05540 55050 54832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 55218 55568 gene locus_tag LOCUS_05550 55218 55568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 55587 55970 gene locus_tag LOCUS_05560 55587 55970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 55985 56119 gene locus_tag LOCUS_05570 55985 56119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 56494 56625 gene locus_tag LOCUS_05580 56494 56625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 57294 56677 gene locus_tag LOCUS_05590 57294 56677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 57773 57312 gene locus_tag LOCUS_05600 57773 57312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 59038 57866 gene locus_tag LOCUS_05610 59038 57866 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937434.1 protein_id gnl|my_center|LOCUS_05610 59251 59075 gene locus_tag LOCUS_05620 59251 59075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 59600 60223 gene locus_tag LOCUS_05630 59600 60223 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053690.1 protein_id gnl|my_center|LOCUS_05630 60249 61241 gene locus_tag LOCUS_05640 60249 61241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 61325 62236 gene locus_tag LOCUS_05650 61325 62236 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582467.1 protein_id gnl|my_center|LOCUS_05650 62268 62690 gene locus_tag LOCUS_05660 62268 62690 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582466.1 protein_id gnl|my_center|LOCUS_05660 63736 63071 gene locus_tag LOCUS_05670 63736 63071 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941391.1 protein_id gnl|my_center|LOCUS_05670 67745 63921 gene locus_tag LOCUS_05680 gene addA 67745 63921 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572274.1 protein_id gnl|my_center|LOCUS_05680 71214 67738 gene locus_tag LOCUS_05690 gene addB 71214 67738 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392018.1 protein_id gnl|my_center|LOCUS_05690 71494 73203 gene locus_tag LOCUS_05700 71494 73203 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393317.1 protein_id gnl|my_center|LOCUS_05700 73440 73279 gene locus_tag LOCUS_05710 73440 73279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 74158 73589 gene locus_tag LOCUS_05720 74158 73589 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_05720 74931 74209 gene locus_tag LOCUS_05730 74931 74209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 75470 75141 gene locus_tag LOCUS_05740 75470 75141 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293844.1 protein_id gnl|my_center|LOCUS_05740 78841 75683 gene locus_tag LOCUS_05750 78841 75683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 80133 78841 gene locus_tag LOCUS_05760 80133 78841 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065381.1 protein_id gnl|my_center|LOCUS_05760 80367 81395 gene locus_tag LOCUS_05770 80367 81395 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392390.1 protein_id gnl|my_center|LOCUS_05770 82476 81355 gene locus_tag LOCUS_05780 gene hpnI 82476 81355 CDS product bacteriohopanetetrol glucosamine biosynthesis glycosyltransferase HpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941358.1 protein_id gnl|my_center|LOCUS_05780 82854 82564 gene locus_tag LOCUS_05790 82854 82564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 83728 83189 gene locus_tag LOCUS_05800 83728 83189 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933341.1 protein_id gnl|my_center|LOCUS_05800 83787 84026 gene locus_tag LOCUS_05810 83787 84026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 84783 84016 gene locus_tag LOCUS_05820 84783 84016 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392718.1 protein_id gnl|my_center|LOCUS_05820 84972 85451 gene locus_tag LOCUS_05830 84972 85451 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461828.1 protein_id gnl|my_center|LOCUS_05830 85487 87349 gene locus_tag LOCUS_05840 gene cooS 85487 87349 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066467.1 protein_id gnl|my_center|LOCUS_05840 88755 87535 gene locus_tag LOCUS_05850 88755 87535 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392245.1 protein_id gnl|my_center|LOCUS_05850 89258 88752 gene locus_tag LOCUS_05860 89258 88752 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461828.1 protein_id gnl|my_center|LOCUS_05860 89654 89436 gene locus_tag LOCUS_05870 89654 89436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 91135 90551 gene locus_tag LOCUS_05880 91135 90551 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021922.1 protein_id gnl|my_center|LOCUS_05880 91624 91187 gene locus_tag LOCUS_05890 91624 91187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 92202 91762 gene locus_tag LOCUS_05900 92202 91762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 92483 92199 gene locus_tag LOCUS_05910 92483 92199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 93266 92703 gene locus_tag LOCUS_05920 93266 92703 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_05920 94882 93422 gene locus_tag LOCUS_05930 94882 93422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 96324 95008 gene locus_tag LOCUS_05940 96324 95008 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878898.1 protein_id gnl|my_center|LOCUS_05940 97429 96377 gene locus_tag LOCUS_05950 97429 96377 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460055.1 protein_id gnl|my_center|LOCUS_05950 98411 97449 gene locus_tag LOCUS_05960 98411 97449 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867634.1 protein_id gnl|my_center|LOCUS_05960 98668 100638 gene locus_tag LOCUS_05970 gene acs 98668 100638 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228545.1 protein_id gnl|my_center|LOCUS_05970 101208 100834 gene locus_tag LOCUS_05980 101208 100834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 102005 101238 gene locus_tag LOCUS_05990 102005 101238 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261938.1 protein_id gnl|my_center|LOCUS_05990 102161 103306 gene locus_tag LOCUS_06000 102161 103306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 103631 104755 gene locus_tag LOCUS_06010 gene ald 103631 104755 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219405.1 protein_id gnl|my_center|LOCUS_06010 105860 104886 gene locus_tag LOCUS_06020 105860 104886 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815232.1 protein_id gnl|my_center|LOCUS_06020 106066 107787 gene locus_tag LOCUS_06030 106066 107787 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082593.1 protein_id gnl|my_center|LOCUS_06030 109321 107876 gene locus_tag LOCUS_06040 109321 107876 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459002.1 protein_id gnl|my_center|LOCUS_06040 109600 109346 gene locus_tag LOCUS_06050 109600 109346 CDS product DUF5395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879113.1 protein_id gnl|my_center|LOCUS_06050 109836 109651 gene locus_tag LOCUS_06060 109836 109651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 110557 111855 gene locus_tag LOCUS_06070 110557 111855 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459114.1 protein_id gnl|my_center|LOCUS_06070 111862 112437 gene locus_tag LOCUS_06080 111862 112437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 >Feature sequence05 1729 344 gene locus_tag LOCUS_06090 1729 344 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393286.1 protein_id gnl|my_center|LOCUS_06090 1901 2269 gene locus_tag LOCUS_06100 1901 2269 CDS product YlxM family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392480.1 protein_id gnl|my_center|LOCUS_06100 2281 3633 gene locus_tag LOCUS_06110 gene ffh 2281 3633 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_06110 3662 3919 gene locus_tag LOCUS_06120 gene rpsP 3662 3919 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_06120 3943 4170 gene locus_tag LOCUS_06130 3943 4170 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460446.1 protein_id gnl|my_center|LOCUS_06130 4216 4617 gene locus_tag LOCUS_06140 4216 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 4623 5138 gene locus_tag LOCUS_06150 gene rimM 4623 5138 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392484.1 protein_id gnl|my_center|LOCUS_06150 5135 5887 gene locus_tag LOCUS_06160 gene trmD 5135 5887 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_06160 5986 6330 gene locus_tag LOCUS_06170 gene rplS 5986 6330 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813207.1 protein_id gnl|my_center|LOCUS_06170 6396 6926 gene locus_tag LOCUS_06180 gene lepB 6396 6926 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392487.1 protein_id gnl|my_center|LOCUS_06180 6941 7789 gene locus_tag LOCUS_06190 gene ylqF 6941 7789 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460442.1 protein_id gnl|my_center|LOCUS_06190 7878 8615 gene locus_tag LOCUS_06200 7878 8615 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_06200 8635 8997 gene locus_tag LOCUS_06210 8635 8997 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392503.1 protein_id gnl|my_center|LOCUS_06210 9274 9011 gene locus_tag LOCUS_06220 9274 9011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 9897 9394 gene locus_tag LOCUS_06230 9897 9394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06230 10428 9946 gene locus_tag LOCUS_06240 10428 9946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06240 10557 12092 gene locus_tag LOCUS_06250 10557 12092 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546463.1 protein_id gnl|my_center|LOCUS_06250 12117 12521 gene locus_tag LOCUS_06260 12117 12521 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545896.1 protein_id gnl|my_center|LOCUS_06260 14522 12819 gene locus_tag LOCUS_06270 14522 12819 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868859.1 protein_id gnl|my_center|LOCUS_06270 14685 14927 gene locus_tag LOCUS_06280 14685 14927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 15237 14974 gene locus_tag LOCUS_06290 15237 14974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 15520 16614 gene locus_tag LOCUS_06300 15520 16614 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393885.1 protein_id gnl|my_center|LOCUS_06300 16618 17799 gene locus_tag LOCUS_06310 gene alr 16618 17799 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393884.1 protein_id gnl|my_center|LOCUS_06310 18112 17867 gene locus_tag LOCUS_06320 18112 17867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 18765 18178 gene locus_tag LOCUS_06330 18765 18178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 18900 19703 gene locus_tag LOCUS_06340 gene tepA 18900 19703 CDS product translocation-enhancing protein TepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245712.1 protein_id gnl|my_center|LOCUS_06340 19700 19966 gene locus_tag LOCUS_06350 19700 19966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 20103 20315 gene locus_tag LOCUS_06360 20103 20315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 20607 21548 gene locus_tag LOCUS_06370 20607 21548 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_06370 21624 21908 gene locus_tag LOCUS_06380 21624 21908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 22030 22815 gene locus_tag LOCUS_06390 gene uppP 22030 22815 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392108.1 protein_id gnl|my_center|LOCUS_06390 23324 22845 gene locus_tag LOCUS_06400 23324 22845 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392625.1 protein_id gnl|my_center|LOCUS_06400 23544 25730 gene locus_tag LOCUS_06410 23544 25730 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392586.1 protein_id gnl|my_center|LOCUS_06410 25852 26586 gene locus_tag LOCUS_06420 25852 26586 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392587.1 protein_id gnl|my_center|LOCUS_06420 26564 27910 gene locus_tag LOCUS_06430 gene rimO 26564 27910 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_06430 28002 28568 gene locus_tag LOCUS_06440 28002 28568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 28552 30030 gene locus_tag LOCUS_06450 28552 30030 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392591.1 protein_id gnl|my_center|LOCUS_06450 30234 31466 gene locus_tag LOCUS_06460 30234 31466 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812916.1 protein_id gnl|my_center|LOCUS_06460 32042 33088 gene locus_tag LOCUS_06470 gene recA 32042 33088 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392593.1 protein_id gnl|my_center|LOCUS_06470 33270 34148 gene locus_tag LOCUS_06480 gene hslO 33270 34148 CDS product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226695.1 protein_id gnl|my_center|LOCUS_06480 34530 34715 gene locus_tag LOCUS_06490 34530 34715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 34778 35434 gene locus_tag LOCUS_06500 34778 35434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 36049 35351 gene locus_tag LOCUS_06510 36049 35351 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462325.1 protein_id gnl|my_center|LOCUS_06510 36363 36142 gene locus_tag LOCUS_06520 36363 36142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 36803 37039 gene locus_tag LOCUS_06530 36803 37039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 37108 37833 gene locus_tag LOCUS_06540 37108 37833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 37846 39069 gene locus_tag LOCUS_06550 37846 39069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 39069 40757 gene locus_tag LOCUS_06560 39069 40757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 40738 41385 gene locus_tag LOCUS_06570 40738 41385 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695789.1 protein_id gnl|my_center|LOCUS_06570 41424 42530 gene locus_tag LOCUS_06580 41424 42530 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868600.1 protein_id gnl|my_center|LOCUS_06580 43456 44019 gene locus_tag LOCUS_06590 43456 44019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 44176 44769 gene locus_tag LOCUS_06600 44176 44769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 45661 47229 gene locus_tag LOCUS_06610 45661 47229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 47801 48532 gene locus_tag LOCUS_06620 47801 48532 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879896.1 protein_id gnl|my_center|LOCUS_06620 48577 48900 gene locus_tag LOCUS_06630 48577 48900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 48971 49261 gene locus_tag LOCUS_06640 48971 49261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 49791 49462 gene locus_tag LOCUS_06650 49791 49462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 50012 49863 gene locus_tag LOCUS_06660 50012 49863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 50334 50648 gene locus_tag LOCUS_06670 50334 50648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 51042 51668 gene locus_tag LOCUS_06680 51042 51668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 51710 51940 gene locus_tag LOCUS_06690 51710 51940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 52043 52393 gene locus_tag LOCUS_06700 52043 52393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 52420 54087 gene locus_tag LOCUS_06710 52420 54087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 54102 54434 gene locus_tag LOCUS_06720 54102 54434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 54497 54880 gene locus_tag LOCUS_06730 54497 54880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 54906 56177 gene locus_tag LOCUS_06740 54906 56177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 56289 56645 gene locus_tag LOCUS_06750 56289 56645 CDS product type II toxin-antitoxin system MqsR family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461871.1 protein_id gnl|my_center|LOCUS_06750 56689 57660 gene locus_tag LOCUS_06760 56689 57660 CDS product DUF4065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461870.1 protein_id gnl|my_center|LOCUS_06760 57894 58487 gene locus_tag LOCUS_06770 57894 58487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 58593 61286 gene locus_tag LOCUS_06780 58593 61286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 61391 61768 gene locus_tag LOCUS_06790 61391 61768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 62006 62602 gene locus_tag LOCUS_06800 62006 62602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391865.1 protein_id gnl|my_center|LOCUS_06800 62610 63941 gene locus_tag LOCUS_06810 62610 63941 CDS product CpaF/VirB11 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391867.1 protein_id gnl|my_center|LOCUS_06810 63941 64750 gene locus_tag LOCUS_06820 63941 64750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391868.1 protein_id gnl|my_center|LOCUS_06820 64763 65599 gene locus_tag LOCUS_06830 64763 65599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391869.1 protein_id gnl|my_center|LOCUS_06830 65770 65955 gene locus_tag LOCUS_06840 65770 65955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 65968 66381 gene locus_tag LOCUS_06850 65968 66381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391870.1 protein_id gnl|my_center|LOCUS_06850 67003 67671 gene locus_tag LOCUS_06860 67003 67671 CDS product SAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391872.1 protein_id gnl|my_center|LOCUS_06860 67674 68291 gene locus_tag LOCUS_06870 67674 68291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 68288 69769 gene locus_tag LOCUS_06880 68288 69769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 69773 70828 gene locus_tag LOCUS_06890 69773 70828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 70941 71444 gene locus_tag LOCUS_06900 70941 71444 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391876.1 protein_id gnl|my_center|LOCUS_06900 71444 72322 gene locus_tag LOCUS_06910 71444 72322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 72324 73166 gene locus_tag LOCUS_06920 72324 73166 CDS product RcpC/CpaB family pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391877.1 protein_id gnl|my_center|LOCUS_06920 73066 74451 gene locus_tag LOCUS_06930 73066 74451 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391878.1 protein_id gnl|my_center|LOCUS_06930 74451 75362 gene locus_tag LOCUS_06940 74451 75362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 75368 76165 gene locus_tag LOCUS_06950 75368 76165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 76315 76506 gene locus_tag LOCUS_06960 76315 76506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 76571 76750 gene locus_tag LOCUS_06970 76571 76750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 77052 76798 gene locus_tag LOCUS_06980 77052 76798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 77159 77797 gene locus_tag LOCUS_06990 77159 77797 CDS product pilus assembly protein TadG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391884.1 protein_id gnl|my_center|LOCUS_06990 77803 78570 gene locus_tag LOCUS_07000 77803 78570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 78539 78763 gene locus_tag LOCUS_07010 78539 78763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 78844 81051 gene locus_tag LOCUS_07020 78844 81051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274769.1 protein_id gnl|my_center|LOCUS_07020 81075 81212 gene locus_tag LOCUS_07030 81075 81212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 81241 82215 gene locus_tag LOCUS_07040 81241 82215 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122014502.1 protein_id gnl|my_center|LOCUS_07040 82233 82529 gene locus_tag LOCUS_07050 82233 82529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 82730 84676 gene locus_tag LOCUS_07060 82730 84676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 84692 86038 gene locus_tag LOCUS_07070 84692 86038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 >Feature sequence06 481 143 gene locus_tag LOCUS_07080 481 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 826 1074 gene locus_tag LOCUS_07090 826 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 1172 1900 gene locus_tag LOCUS_07100 1172 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 2018 3667 gene locus_tag LOCUS_07110 gene tlpC 2018 3667 CDS product methyl-accepting chemotaxis protein TlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246498.1 protein_id gnl|my_center|LOCUS_07110 4203 3742 gene locus_tag LOCUS_07120 4203 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 5592 4456 gene locus_tag LOCUS_07130 5592 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 5781 5602 gene locus_tag LOCUS_07140 5781 5602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 5823 6068 gene locus_tag LOCUS_07150 5823 6068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 6292 7398 gene locus_tag LOCUS_07160 gene fbp 6292 7398 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393749.1 protein_id gnl|my_center|LOCUS_07160 8160 7735 gene locus_tag LOCUS_07170 8160 7735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 8451 8161 gene locus_tag LOCUS_07180 8451 8161 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870093.1 protein_id gnl|my_center|LOCUS_07180 9435 8470 gene locus_tag LOCUS_07190 9435 8470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 9612 10079 gene locus_tag LOCUS_07200 9612 10079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 10842 10210 gene locus_tag LOCUS_07210 10842 10210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 11750 10854 gene locus_tag LOCUS_07220 gene menA 11750 10854 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081897.1 protein_id gnl|my_center|LOCUS_07220 12044 11969 gene locus_tag LOCUS_t00140 12044 11969 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 12465 12184 gene locus_tag LOCUS_07230 12465 12184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 13107 12496 gene locus_tag LOCUS_07240 13107 12496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 15973 13499 gene locus_tag LOCUS_07250 gene leuS 15973 13499 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_07250 16132 16058 gene locus_tag LOCUS_t00150 16132 16058 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 16538 16182 gene locus_tag LOCUS_07260 gene rsfS 16538 16182 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229971.1 protein_id gnl|my_center|LOCUS_07260 16910 16596 gene locus_tag LOCUS_07270 16910 16596 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392102.1 protein_id gnl|my_center|LOCUS_07270 17527 16925 gene locus_tag LOCUS_07280 gene nadD 17527 16925 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392101.1 protein_id gnl|my_center|LOCUS_07280 18256 17600 gene locus_tag LOCUS_07290 18256 17600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 19622 18360 gene locus_tag LOCUS_07300 19622 18360 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_07300 20357 19848 gene locus_tag LOCUS_07310 20357 19848 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_07310 21530 20400 gene locus_tag LOCUS_07320 gene proB 21530 20400 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392099.1 protein_id gnl|my_center|LOCUS_07320 23081 21798 gene locus_tag LOCUS_07330 gene obgE 23081 21798 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392098.1 protein_id gnl|my_center|LOCUS_07330 23657 23085 gene locus_tag LOCUS_07340 23657 23085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 25076 23877 gene locus_tag LOCUS_07350 25076 23877 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541694.1 protein_id gnl|my_center|LOCUS_07350 26414 25320 gene locus_tag LOCUS_07360 26414 25320 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392257.1 protein_id gnl|my_center|LOCUS_07360 27872 26748 gene locus_tag LOCUS_07370 27872 26748 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156271991.1 protein_id gnl|my_center|LOCUS_07370 28901 28077 gene locus_tag LOCUS_07380 28901 28077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 29839 28901 gene locus_tag LOCUS_07390 29839 28901 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389853.1 protein_id gnl|my_center|LOCUS_07390 31524 30229 gene locus_tag LOCUS_07400 gene rpoN 31524 30229 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391805.1 protein_id gnl|my_center|LOCUS_07400 31792 33123 gene locus_tag LOCUS_07410 31792 33123 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_07410 33633 35111 gene locus_tag LOCUS_07420 33633 35111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 35262 35441 gene locus_tag LOCUS_07430 35262 35441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 35522 36436 gene locus_tag LOCUS_07440 35522 36436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 36520 37959 gene locus_tag LOCUS_07450 36520 37959 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002431748.1 protein_id gnl|my_center|LOCUS_07450 38063 38581 gene locus_tag LOCUS_07460 38063 38581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 38697 40136 gene locus_tag LOCUS_07470 38697 40136 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986138.1 protein_id gnl|my_center|LOCUS_07470 40276 41811 gene locus_tag LOCUS_07480 40276 41811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 41786 43132 gene locus_tag LOCUS_07490 41786 43132 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_07490 43883 43395 gene locus_tag LOCUS_07500 43883 43395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 44718 43921 gene locus_tag LOCUS_07510 44718 43921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 45593 44697 gene locus_tag LOCUS_07520 45593 44697 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245643.1 protein_id gnl|my_center|LOCUS_07520 46490 46014 gene locus_tag LOCUS_07530 46490 46014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 46906 46505 gene locus_tag LOCUS_07540 46906 46505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 47647 46940 gene locus_tag LOCUS_07550 47647 46940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937444.1 protein_id gnl|my_center|LOCUS_07550 48916 47651 gene locus_tag LOCUS_07560 48916 47651 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793113.1 protein_id gnl|my_center|LOCUS_07560 49375 49154 gene locus_tag LOCUS_07570 49375 49154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 49595 49392 gene locus_tag LOCUS_07580 49595 49392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 50179 49727 gene locus_tag LOCUS_07590 50179 49727 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227162.1 protein_id gnl|my_center|LOCUS_07590 50549 50316 gene locus_tag LOCUS_07600 50549 50316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 51295 50918 gene locus_tag LOCUS_07610 51295 50918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 52802 51297 gene locus_tag LOCUS_07620 52802 51297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 53868 52987 gene locus_tag LOCUS_07630 53868 52987 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940768.1 protein_id gnl|my_center|LOCUS_07630 54439 53870 gene locus_tag LOCUS_07640 54439 53870 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392330.1 protein_id gnl|my_center|LOCUS_07640 56833 54611 gene locus_tag LOCUS_07650 56833 54611 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545086.1 protein_id gnl|my_center|LOCUS_07650 58058 56826 gene locus_tag LOCUS_07660 58058 56826 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546111.1 protein_id gnl|my_center|LOCUS_07660 60109 58232 gene locus_tag LOCUS_07670 gene aprA 60109 58232 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879166.1 protein_id gnl|my_center|LOCUS_07670 60566 60129 gene locus_tag LOCUS_07680 gene aprB 60566 60129 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879165.1 protein_id gnl|my_center|LOCUS_07680 61519 61848 gene locus_tag LOCUS_07690 61519 61848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 62650 61895 gene locus_tag LOCUS_07700 gene lgt 62650 61895 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583316.1 protein_id gnl|my_center|LOCUS_07700 63595 62651 gene locus_tag LOCUS_07710 63595 62651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 64083 63577 gene locus_tag LOCUS_07720 gene moaC 64083 63577 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393624.1 protein_id gnl|my_center|LOCUS_07720 66099 64153 gene locus_tag LOCUS_07730 66099 64153 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545932.1 protein_id gnl|my_center|LOCUS_07730 67337 66126 gene locus_tag LOCUS_07740 67337 66126 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542268.1 protein_id gnl|my_center|LOCUS_07740 67500 68027 gene locus_tag LOCUS_07750 67500 68027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 68382 69068 gene locus_tag LOCUS_07760 68382 69068 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938388.1 protein_id gnl|my_center|LOCUS_07760 69065 70468 gene locus_tag LOCUS_07770 69065 70468 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015261871.1 protein_id gnl|my_center|LOCUS_07770 70575 71282 gene locus_tag LOCUS_07780 70575 71282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 72013 71471 gene locus_tag LOCUS_07790 72013 71471 CDS product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395815.1 protein_id gnl|my_center|LOCUS_07790 72217 72486 gene locus_tag LOCUS_07800 72217 72486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 72506 73354 gene locus_tag LOCUS_07810 72506 73354 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868068.1 protein_id gnl|my_center|LOCUS_07810 73356 74747 gene locus_tag LOCUS_07820 gene gltA 73356 74747 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393026.1 protein_id gnl|my_center|LOCUS_07820 75196 74762 gene locus_tag LOCUS_07830 75196 74762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 76721 75291 gene locus_tag LOCUS_07840 76721 75291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 77107 79182 gene locus_tag LOCUS_07850 77107 79182 CDS product beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271984.1 protein_id gnl|my_center|LOCUS_07850 79990 79232 gene locus_tag LOCUS_07860 79990 79232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 80463 80014 gene locus_tag LOCUS_07870 80463 80014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 81026 80835 gene locus_tag LOCUS_07880 81026 80835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 >Feature sequence07 877 95 gene locus_tag LOCUS_07890 877 95 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877312.1 protein_id gnl|my_center|LOCUS_07890 1653 883 gene locus_tag LOCUS_07900 1653 883 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920686.1 protein_id gnl|my_center|LOCUS_07900 2293 1637 gene locus_tag LOCUS_07910 gene cbiM 2293 1637 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920867.1 protein_id gnl|my_center|LOCUS_07910 2736 2293 gene locus_tag LOCUS_07920 2736 2293 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057259.1 protein_id gnl|my_center|LOCUS_07920 3696 2833 gene locus_tag LOCUS_07930 3696 2833 CDS product DUF4382 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920868.1 protein_id gnl|my_center|LOCUS_07930 4135 4368 gene locus_tag LOCUS_07940 4135 4368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 4665 4432 gene locus_tag LOCUS_07950 4665 4432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 7522 5057 gene locus_tag LOCUS_07960 7522 5057 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003185.1 protein_id gnl|my_center|LOCUS_07960 8303 7707 gene locus_tag LOCUS_07970 8303 7707 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022152.1 protein_id gnl|my_center|LOCUS_07970 8859 9896 gene locus_tag LOCUS_07980 8859 9896 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970141.1 protein_id gnl|my_center|LOCUS_07980 10229 10855 gene locus_tag LOCUS_07990 10229 10855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 11579 10926 gene locus_tag LOCUS_08000 11579 10926 CDS product DtxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582916.1 protein_id gnl|my_center|LOCUS_08000 13839 11821 gene locus_tag LOCUS_08010 gene feoB 13839 11821 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249665.1 protein_id gnl|my_center|LOCUS_08010 14138 13899 gene locus_tag LOCUS_08020 14138 13899 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392945.1 protein_id gnl|my_center|LOCUS_08020 14383 14141 gene locus_tag LOCUS_08030 14383 14141 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392946.1 protein_id gnl|my_center|LOCUS_08030 15632 14508 gene locus_tag LOCUS_08040 15632 14508 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965731.1 protein_id gnl|my_center|LOCUS_08040 16710 15667 gene locus_tag LOCUS_08050 16710 15667 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020082.1 protein_id gnl|my_center|LOCUS_08050 18102 16825 gene locus_tag LOCUS_08060 18102 16825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 18456 19208 gene locus_tag LOCUS_08070 18456 19208 CDS product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948933.1 protein_id gnl|my_center|LOCUS_08070 19340 19681 gene locus_tag LOCUS_08080 19340 19681 CDS product DUF5320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392926.1 protein_id gnl|my_center|LOCUS_08080 19874 22648 gene locus_tag LOCUS_08090 19874 22648 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392212.1 protein_id gnl|my_center|LOCUS_08090 23556 22735 gene locus_tag LOCUS_08100 23556 22735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 23719 24078 gene locus_tag LOCUS_08110 23719 24078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 25424 24093 gene locus_tag LOCUS_08120 25424 24093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 25683 26477 gene locus_tag LOCUS_08130 25683 26477 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938184.1 protein_id gnl|my_center|LOCUS_08130 26589 27281 gene locus_tag LOCUS_08140 26589 27281 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440228.1 protein_id gnl|my_center|LOCUS_08140 27967 27359 gene locus_tag LOCUS_08150 27967 27359 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392954.1 protein_id gnl|my_center|LOCUS_08150 28802 27960 gene locus_tag LOCUS_08160 28802 27960 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007204.1 protein_id gnl|my_center|LOCUS_08160 29596 28802 gene locus_tag LOCUS_08170 29596 28802 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081428946.1 protein_id gnl|my_center|LOCUS_08170 30567 29689 gene locus_tag LOCUS_08180 30567 29689 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937413.1 protein_id gnl|my_center|LOCUS_08180 30875 32020 gene locus_tag LOCUS_08190 30875 32020 CDS product stage II sporulation protein P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392839.1 protein_id gnl|my_center|LOCUS_08190 32745 32017 gene locus_tag LOCUS_08200 32745 32017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 33072 32878 gene locus_tag LOCUS_08210 33072 32878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 33454 34110 gene locus_tag LOCUS_08220 33454 34110 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940552.1 protein_id gnl|my_center|LOCUS_08220 34129 34506 gene locus_tag LOCUS_08230 34129 34506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 35575 34568 gene locus_tag LOCUS_08240 35575 34568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 36645 35596 gene locus_tag LOCUS_08250 36645 35596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 37499 36645 gene locus_tag LOCUS_08260 37499 36645 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258883.1 protein_id gnl|my_center|LOCUS_08260 38194 37550 gene locus_tag LOCUS_08270 38194 37550 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258572.1 protein_id gnl|my_center|LOCUS_08270 38398 38769 gene locus_tag LOCUS_08280 38398 38769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 38784 39329 gene locus_tag LOCUS_08290 38784 39329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 39375 39569 gene locus_tag LOCUS_08300 39375 39569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 39753 39980 gene locus_tag LOCUS_08310 39753 39980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 40220 40447 gene locus_tag LOCUS_08320 40220 40447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 40867 41400 gene locus_tag LOCUS_08330 40867 41400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 41394 41618 gene locus_tag LOCUS_08340 41394 41618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 41717 41875 gene locus_tag LOCUS_08350 41717 41875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 42008 42166 gene locus_tag LOCUS_08360 42008 42166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 43467 42301 gene locus_tag LOCUS_08370 43467 42301 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272338.1 protein_id gnl|my_center|LOCUS_08370 44777 43647 gene locus_tag LOCUS_08380 44777 43647 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_08380 45561 44917 gene locus_tag LOCUS_08390 45561 44917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 46919 45558 gene locus_tag LOCUS_08400 46919 45558 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016770.1 protein_id gnl|my_center|LOCUS_08400 47516 46929 gene locus_tag LOCUS_08410 47516 46929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 48575 47670 gene locus_tag LOCUS_08420 48575 47670 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453817.1 protein_id gnl|my_center|LOCUS_08420 49592 48588 gene locus_tag LOCUS_08430 49592 48588 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583224.1 protein_id gnl|my_center|LOCUS_08430 51295 49676 gene locus_tag LOCUS_08440 51295 49676 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583223.1 protein_id gnl|my_center|LOCUS_08440 52353 51382 gene locus_tag LOCUS_08450 52353 51382 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_08450 53348 52377 gene locus_tag LOCUS_08460 53348 52377 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_08460 53540 53977 gene locus_tag LOCUS_08470 53540 53977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 54120 55463 gene locus_tag LOCUS_08480 54120 55463 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392943.1 protein_id gnl|my_center|LOCUS_08480 56557 55547 gene locus_tag LOCUS_08490 56557 55547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 56827 57399 gene locus_tag LOCUS_08500 56827 57399 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393271.1 protein_id gnl|my_center|LOCUS_08500 58516 57536 gene locus_tag LOCUS_08510 58516 57536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 58948 58571 gene locus_tag LOCUS_08520 58948 58571 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382363.1 protein_id gnl|my_center|LOCUS_08520 61033 59144 gene locus_tag LOCUS_08530 61033 59144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 62318 61608 gene locus_tag LOCUS_08540 62318 61608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 63797 62643 gene locus_tag LOCUS_08550 63797 62643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 64868 63870 gene locus_tag LOCUS_08560 64868 63870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 69532 64889 gene locus_tag LOCUS_08570 69532 64889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 69791 69465 gene locus_tag LOCUS_08580 69791 69465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 69993 70664 gene locus_tag LOCUS_08590 69993 70664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529371.1 protein_id gnl|my_center|LOCUS_08590 71676 70855 gene locus_tag LOCUS_08600 71676 70855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 71853 71704 gene locus_tag LOCUS_08610 71853 71704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 >Feature sequence08 78 1 gene locus_tag LOCUS_t00160 78 1 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1719 514 gene locus_tag LOCUS_08620 1719 514 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_08620 3105 1861 gene locus_tag LOCUS_08630 gene sat 3105 1861 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_08630 4644 3409 gene locus_tag LOCUS_08640 4644 3409 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_08640 5555 4659 gene locus_tag LOCUS_08650 gene thrB 5555 4659 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392818.1 protein_id gnl|my_center|LOCUS_08650 6886 5585 gene locus_tag LOCUS_08660 6886 5585 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_08660 8536 7154 gene locus_tag LOCUS_08670 8536 7154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 10145 8688 gene locus_tag LOCUS_08680 gene guaB 10145 8688 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541542.1 protein_id gnl|my_center|LOCUS_08680 10467 10240 gene locus_tag LOCUS_08690 10467 10240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392620.1 protein_id gnl|my_center|LOCUS_08690 10993 10514 gene locus_tag LOCUS_08700 10993 10514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 11316 10990 gene locus_tag LOCUS_08710 11316 10990 CDS product YtrH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393373.1 protein_id gnl|my_center|LOCUS_08710 12708 11446 gene locus_tag LOCUS_08720 gene eam 12708 11446 CDS product glutamate 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094599.1 protein_id gnl|my_center|LOCUS_08720 13702 13079 gene locus_tag LOCUS_08730 gene cobC 13702 13079 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_08730 14196 13783 gene locus_tag LOCUS_08740 14196 13783 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935469.1 protein_id gnl|my_center|LOCUS_08740 14565 14296 gene locus_tag LOCUS_08750 14565 14296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 15619 14630 gene locus_tag LOCUS_08760 15619 14630 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812947.1 protein_id gnl|my_center|LOCUS_08760 15898 15638 gene locus_tag LOCUS_08770 15898 15638 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965123.1 protein_id gnl|my_center|LOCUS_08770 16797 16006 gene locus_tag LOCUS_08780 16797 16006 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_08780 18360 16822 gene locus_tag LOCUS_08790 gene rny 18360 16822 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_08790 18877 18656 gene locus_tag LOCUS_08800 18877 18656 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_08800 19116 19031 gene locus_tag LOCUS_t00170 19116 19031 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 19762 19163 gene locus_tag LOCUS_08810 19762 19163 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007140.1 protein_id gnl|my_center|LOCUS_08810 21584 19836 gene locus_tag LOCUS_08820 gene pyk 21584 19836 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393367.1 protein_id gnl|my_center|LOCUS_08820 22560 21598 gene locus_tag LOCUS_08830 gene pfkA 22560 21598 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393368.1 protein_id gnl|my_center|LOCUS_08830 23523 22576 gene locus_tag LOCUS_08840 23523 22576 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931204.1 protein_id gnl|my_center|LOCUS_08840 24370 23528 gene locus_tag LOCUS_08850 gene accD 24370 23528 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966832.1 protein_id gnl|my_center|LOCUS_08850 24716 24465 gene locus_tag LOCUS_08860 gene mtrB 24716 24465 CDS product trp RNA-binding attenuation protein MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869580.1 protein_id gnl|my_center|LOCUS_08860 28204 24803 gene locus_tag LOCUS_08870 28204 24803 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_08870 28394 28233 gene locus_tag LOCUS_08880 28394 28233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 28894 28436 gene locus_tag LOCUS_08890 28894 28436 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814644.1 protein_id gnl|my_center|LOCUS_08890 29310 28885 gene locus_tag LOCUS_08900 29310 28885 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248960.1 protein_id gnl|my_center|LOCUS_08900 31328 29346 gene locus_tag LOCUS_08910 31328 29346 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980092.1 protein_id gnl|my_center|LOCUS_08910 31473 32210 gene locus_tag LOCUS_08920 31473 32210 CDS product DUF4912 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393414.1 protein_id gnl|my_center|LOCUS_08920 32214 33788 gene locus_tag LOCUS_08930 32214 33788 CDS product DUF1957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393415.1 protein_id gnl|my_center|LOCUS_08930 36324 33862 gene locus_tag LOCUS_08940 36324 33862 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393425.1 protein_id gnl|my_center|LOCUS_08940 37600 36353 gene locus_tag LOCUS_08950 37600 36353 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393432.1 protein_id gnl|my_center|LOCUS_08950 38102 37722 gene locus_tag LOCUS_08960 38102 37722 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393435.1 protein_id gnl|my_center|LOCUS_08960 39173 38172 gene locus_tag LOCUS_08970 39173 38172 CDS product isocitrate dehydrogenase (NAD(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964290.1 protein_id gnl|my_center|LOCUS_08970 39697 39194 gene locus_tag LOCUS_08980 39697 39194 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583979.1 protein_id gnl|my_center|LOCUS_08980 40965 39706 gene locus_tag LOCUS_08990 40965 39706 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583978.1 protein_id gnl|my_center|LOCUS_08990 42103 40967 gene locus_tag LOCUS_09000 gene nifV 42103 40967 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461443.1 protein_id gnl|my_center|LOCUS_09000 43656 42217 gene locus_tag LOCUS_09010 gene gatB 43656 42217 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393504.1 protein_id gnl|my_center|LOCUS_09010 45129 43657 gene locus_tag LOCUS_09020 gene gatA 45129 43657 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_09020 45425 45144 gene locus_tag LOCUS_09030 gene gatC 45425 45144 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461445.1 protein_id gnl|my_center|LOCUS_09030 47169 45472 gene locus_tag LOCUS_09040 gene recN 47169 45472 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393016.1 protein_id gnl|my_center|LOCUS_09040 47606 47175 gene locus_tag LOCUS_09050 gene argR 47606 47175 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810957.1 protein_id gnl|my_center|LOCUS_09050 48207 47572 gene locus_tag LOCUS_09060 48207 47572 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225444.1 protein_id gnl|my_center|LOCUS_09060 49057 48197 gene locus_tag LOCUS_09070 49057 48197 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_09070 49872 49054 gene locus_tag LOCUS_09080 49872 49054 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965376.1 protein_id gnl|my_center|LOCUS_09080 51777 49876 gene locus_tag LOCUS_09090 gene dxs 51777 49876 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393020.1 protein_id gnl|my_center|LOCUS_09090 52389 51796 gene locus_tag LOCUS_09100 52389 51796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965378.1 protein_id gnl|my_center|LOCUS_09100 53984 53094 gene locus_tag LOCUS_09110 53984 53094 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_09110 54179 53988 gene locus_tag LOCUS_09120 54179 53988 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721552.1 protein_id gnl|my_center|LOCUS_09120 54757 54203 gene locus_tag LOCUS_09130 54757 54203 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810935.1 protein_id gnl|my_center|LOCUS_09130 55706 54855 gene locus_tag LOCUS_09140 55706 54855 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460266.1 protein_id gnl|my_center|LOCUS_09140 56944 55703 gene locus_tag LOCUS_09150 gene xseA 56944 55703 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393024.1 protein_id gnl|my_center|LOCUS_09150 57416 56982 gene locus_tag LOCUS_09160 gene nusB 57416 56982 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460271.1 protein_id gnl|my_center|LOCUS_09160 57617 57423 gene locus_tag LOCUS_09170 57617 57423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 58190 57654 gene locus_tag LOCUS_09180 58190 57654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 58613 58224 gene locus_tag LOCUS_09190 58613 58224 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_09190 60025 58688 gene locus_tag LOCUS_09200 gene accC 60025 58688 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393033.1 protein_id gnl|my_center|LOCUS_09200 61929 60052 gene locus_tag LOCUS_09210 gene accB 61929 60052 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272421.1 protein_id gnl|my_center|LOCUS_09210 62663 62061 gene locus_tag LOCUS_09220 62663 62061 CDS product SpoIIIAH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393038.1 protein_id gnl|my_center|LOCUS_09220 63295 62681 gene locus_tag LOCUS_09230 63295 62681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 63883 63308 gene locus_tag LOCUS_09240 63883 63308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 65071 63896 gene locus_tag LOCUS_09250 gene spoIIIAE 65071 63896 CDS product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393041.1 protein_id gnl|my_center|LOCUS_09250 65468 65082 gene locus_tag LOCUS_09260 gene spoIIIAD 65468 65082 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393042.1 protein_id gnl|my_center|LOCUS_09260 65681 65484 gene locus_tag LOCUS_09270 gene spoIIIAC 65681 65484 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020914.1 protein_id gnl|my_center|LOCUS_09270 66214 65696 gene locus_tag LOCUS_09280 66214 65696 CDS product stage III sporulation protein AB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460278.1 protein_id gnl|my_center|LOCUS_09280 67218 66217 gene locus_tag LOCUS_09290 gene spoIIIAA 67218 66217 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272423.1 protein_id gnl|my_center|LOCUS_09290 67821 67378 gene locus_tag LOCUS_09300 67821 67378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393046.1 protein_id gnl|my_center|LOCUS_09300 68484 67927 gene locus_tag LOCUS_09310 gene efp 68484 67927 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_09310 69601 68525 gene locus_tag LOCUS_09320 gene pepQ 69601 68525 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411056.1 protein_id gnl|my_center|LOCUS_09320 70055 69606 gene locus_tag LOCUS_09330 gene aroQ 70055 69606 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393049.1 protein_id gnl|my_center|LOCUS_09330 71421 70057 gene locus_tag LOCUS_09340 71421 70057 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393050.1 protein_id gnl|my_center|LOCUS_09340 >Feature sequence09 587 204 gene locus_tag LOCUS_09350 587 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 794 1711 gene locus_tag LOCUS_09360 gene metA 794 1711 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462040.1 protein_id gnl|my_center|LOCUS_09360 1751 3040 gene locus_tag LOCUS_09370 1751 3040 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272631.1 protein_id gnl|my_center|LOCUS_09370 3062 3265 gene locus_tag LOCUS_09380 3062 3265 CDS product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198960.1 protein_id gnl|my_center|LOCUS_09380 3299 4099 gene locus_tag LOCUS_09390 gene thiM 3299 4099 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056115.1 protein_id gnl|my_center|LOCUS_09390 5298 4120 gene locus_tag LOCUS_09400 gene mnmA 5298 4120 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393152.1 protein_id gnl|my_center|LOCUS_09400 5715 5320 gene locus_tag LOCUS_09410 gene nifU 5715 5320 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_09410 6745 5717 gene locus_tag LOCUS_09420 gene nifS 6745 5717 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_09420 9257 7134 gene locus_tag LOCUS_09430 9257 7134 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393690.1 protein_id gnl|my_center|LOCUS_09430 9682 9323 gene locus_tag LOCUS_09440 9682 9323 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918378.1 protein_id gnl|my_center|LOCUS_09440 10737 9973 gene locus_tag LOCUS_09450 gene fdhD 10737 9973 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393662.1 protein_id gnl|my_center|LOCUS_09450 11922 10768 gene locus_tag LOCUS_09460 11922 10768 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938320.1 protein_id gnl|my_center|LOCUS_09460 12697 11948 gene locus_tag LOCUS_09470 12697 11948 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938321.1 protein_id gnl|my_center|LOCUS_09470 13558 12836 gene locus_tag LOCUS_09480 13558 12836 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082427.1 protein_id gnl|my_center|LOCUS_09480 13876 13676 gene locus_tag LOCUS_09490 13876 13676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 14497 13877 gene locus_tag LOCUS_09500 14497 13877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09500 14904 14527 gene locus_tag LOCUS_09510 14904 14527 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393696.1 protein_id gnl|my_center|LOCUS_09510 15186 16250 gene locus_tag LOCUS_09520 15186 16250 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496549.1 protein_id gnl|my_center|LOCUS_09520 16414 16653 gene locus_tag LOCUS_09530 16414 16653 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255927.1 protein_id gnl|my_center|LOCUS_09530 16735 16998 gene locus_tag LOCUS_09540 16735 16998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 17140 18213 gene locus_tag LOCUS_09550 gene arsB 17140 18213 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826560.1 protein_id gnl|my_center|LOCUS_09550 18383 19066 gene locus_tag LOCUS_09560 18383 19066 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392343.1 protein_id gnl|my_center|LOCUS_09560 20996 19116 gene locus_tag LOCUS_09570 gene cooS 20996 19116 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879343.1 protein_id gnl|my_center|LOCUS_09570 21860 21420 gene locus_tag LOCUS_09580 21860 21420 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392624.1 protein_id gnl|my_center|LOCUS_09580 22247 21963 gene locus_tag LOCUS_09590 22247 21963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 23338 22280 gene locus_tag LOCUS_09600 23338 22280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 23747 23388 gene locus_tag LOCUS_09610 23747 23388 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392117.1 protein_id gnl|my_center|LOCUS_09610 24041 25087 gene locus_tag LOCUS_09620 24041 25087 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459323.1 protein_id gnl|my_center|LOCUS_09620 25101 26510 gene locus_tag LOCUS_09630 25101 26510 CDS product periplasmic [NiFeSe] hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:P13065 protein_id gnl|my_center|LOCUS_09630 26619 27152 gene locus_tag LOCUS_09640 gene cybH 26619 27152 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811610.1 protein_id gnl|my_center|LOCUS_09640 27206 27700 gene locus_tag LOCUS_09650 27206 27700 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225641.1 protein_id gnl|my_center|LOCUS_09650 27887 28066 gene locus_tag LOCUS_09660 27887 28066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 28246 28512 gene locus_tag LOCUS_09670 gene rpsT 28246 28512 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774009.1 protein_id gnl|my_center|LOCUS_09670 29608 28574 gene locus_tag LOCUS_09680 gene holA 29608 28574 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392113.1 protein_id gnl|my_center|LOCUS_09680 30134 32383 gene locus_tag LOCUS_09690 30134 32383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 32665 33036 gene locus_tag LOCUS_09700 gene crcB 32665 33036 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867782.1 protein_id gnl|my_center|LOCUS_09700 33052 33405 gene locus_tag LOCUS_09710 33052 33405 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 protein_id gnl|my_center|LOCUS_09710 33987 34166 gene locus_tag LOCUS_09720 33987 34166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 34854 34231 gene locus_tag LOCUS_09730 34854 34231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 35075 35533 gene locus_tag LOCUS_09740 35075 35533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 37233 35530 gene locus_tag LOCUS_09750 37233 35530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 37793 37233 gene locus_tag LOCUS_09760 37793 37233 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948397.1 protein_id gnl|my_center|LOCUS_09760 38032 38550 gene locus_tag LOCUS_09770 38032 38550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 38591 39547 gene locus_tag LOCUS_09780 38591 39547 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108052.1 protein_id gnl|my_center|LOCUS_09780 39947 41758 gene locus_tag LOCUS_09790 gene lepA 39947 41758 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392118.1 protein_id gnl|my_center|LOCUS_09790 41755 42891 gene locus_tag LOCUS_09800 gene hemW 41755 42891 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_09800 42990 44036 gene locus_tag LOCUS_09810 gene hrcA 42990 44036 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392120.1 protein_id gnl|my_center|LOCUS_09810 44051 45619 gene locus_tag LOCUS_09820 44051 45619 CDS product TCP-1/cpn60 chaperonin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143737.1 protein_id gnl|my_center|LOCUS_09820 45612 46316 gene locus_tag LOCUS_09830 45612 46316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 46309 48138 gene locus_tag LOCUS_09840 gene dnaK 46309 48138 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_09840 48190 49317 gene locus_tag LOCUS_09850 gene dnaJ 48190 49317 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_09850 49310 50194 gene locus_tag LOCUS_09860 gene prmA 49310 50194 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398884.1 protein_id gnl|my_center|LOCUS_09860 50191 50937 gene locus_tag LOCUS_09870 50191 50937 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392124.1 protein_id gnl|my_center|LOCUS_09870 51027 52346 gene locus_tag LOCUS_09880 gene mtaB 51027 52346 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392125.1 protein_id gnl|my_center|LOCUS_09880 52394 52738 gene locus_tag LOCUS_09890 52394 52738 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964599.1 protein_id gnl|my_center|LOCUS_09890 52820 53017 gene locus_tag LOCUS_09900 52820 53017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 53309 53088 gene locus_tag LOCUS_09910 53309 53088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 53701 53342 gene locus_tag LOCUS_09920 gene spoVAE 53701 53342 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575919.1 protein_id gnl|my_center|LOCUS_09920 54735 53722 gene locus_tag LOCUS_09930 gene spoVAD 54735 53722 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_09930 55221 54751 gene locus_tag LOCUS_09940 gene spoVAC 55221 54751 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147736.1 protein_id gnl|my_center|LOCUS_09940 55395 55676 gene locus_tag LOCUS_09950 gene yqfC 55395 55676 CDS product sporulation protein YqfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392128.1 protein_id gnl|my_center|LOCUS_09950 55958 57190 gene locus_tag LOCUS_09960 gene yqfD 55958 57190 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392129.1 protein_id gnl|my_center|LOCUS_09960 57206 58177 gene locus_tag LOCUS_09970 57206 58177 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816443.1 protein_id gnl|my_center|LOCUS_09970 58183 60330 gene locus_tag LOCUS_09980 58183 60330 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392131.1 protein_id gnl|my_center|LOCUS_09980 60311 60775 gene locus_tag LOCUS_09990 gene ybeY 60311 60775 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392132.1 protein_id gnl|my_center|LOCUS_09990 60967 61359 gene locus_tag LOCUS_10000 gene cdd 60967 61359 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080780.1 protein_id gnl|my_center|LOCUS_10000 61911 61585 gene locus_tag LOCUS_10010 61911 61585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 62281 63189 gene locus_tag LOCUS_10020 gene era 62281 63189 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288753.1 protein_id gnl|my_center|LOCUS_10020 65183 63672 gene locus_tag LOCUS_10030 65183 63672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10030 66355 65258 gene locus_tag LOCUS_10040 66355 65258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10040 66771 67463 gene locus_tag LOCUS_10050 66771 67463 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211429.1 protein_id gnl|my_center|LOCUS_10050 >Feature sequence10 170 246 gene locus_tag LOCUS_t00180 170 246 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 260 335 gene locus_tag LOCUS_t00190 260 335 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 379 456 gene locus_tag LOCUS_t00200 379 456 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 555 639 gene locus_tag LOCUS_t00210 555 639 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1052 1240 gene locus_tag LOCUS_10060 1052 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 1153 1962 gene locus_tag LOCUS_10070 1153 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 2062 3117 gene locus_tag LOCUS_10080 2062 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 3430 4122 gene locus_tag LOCUS_10090 3430 4122 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211429.1 protein_id gnl|my_center|LOCUS_10090 4155 4823 gene locus_tag LOCUS_10100 4155 4823 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948381.1 protein_id gnl|my_center|LOCUS_10100 5988 5203 gene locus_tag LOCUS_10110 5988 5203 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256753.1 protein_id gnl|my_center|LOCUS_10110 6772 5975 gene locus_tag LOCUS_10120 6772 5975 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583949.1 protein_id gnl|my_center|LOCUS_10120 7059 8396 gene locus_tag LOCUS_10130 gene tig 7059 8396 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392064.1 protein_id gnl|my_center|LOCUS_10130 8463 9059 gene locus_tag LOCUS_10140 gene clpP 8463 9059 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545892.1 protein_id gnl|my_center|LOCUS_10140 9073 10329 gene locus_tag LOCUS_10150 gene clpX 9073 10329 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816893.1 protein_id gnl|my_center|LOCUS_10150 10454 12145 gene locus_tag LOCUS_10160 gene lonB 10454 12145 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392067.1 protein_id gnl|my_center|LOCUS_10160 12312 14711 gene locus_tag LOCUS_10170 gene lon 12312 14711 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_10170 15784 14801 gene locus_tag LOCUS_10180 15784 14801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 15953 18601 gene locus_tag LOCUS_10190 15953 18601 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460907.1 protein_id gnl|my_center|LOCUS_10190 18684 19994 gene locus_tag LOCUS_10200 18684 19994 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_10200 20124 20363 gene locus_tag LOCUS_10210 20124 20363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 20421 21419 gene locus_tag LOCUS_10220 20421 21419 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392337.1 protein_id gnl|my_center|LOCUS_10220 21493 22500 gene locus_tag LOCUS_10230 21493 22500 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392337.1 protein_id gnl|my_center|LOCUS_10230 22567 23022 gene locus_tag LOCUS_10240 22567 23022 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897586.1 protein_id gnl|my_center|LOCUS_10240 23095 23343 gene locus_tag LOCUS_10250 23095 23343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 23396 23950 gene locus_tag LOCUS_10260 23396 23950 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583757.1 protein_id gnl|my_center|LOCUS_10260 23970 24665 gene locus_tag LOCUS_10270 gene radC 23970 24665 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816793.1 protein_id gnl|my_center|LOCUS_10270 24689 25714 gene locus_tag LOCUS_10280 24689 25714 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392074.1 protein_id gnl|my_center|LOCUS_10280 25715 26545 gene locus_tag LOCUS_10290 gene mreC 25715 26545 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392075.1 protein_id gnl|my_center|LOCUS_10290 26550 27047 gene locus_tag LOCUS_10300 gene mreD 26550 27047 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392076.1 protein_id gnl|my_center|LOCUS_10300 27062 29056 gene locus_tag LOCUS_10310 gene mrdA 27062 29056 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392077.1 protein_id gnl|my_center|LOCUS_10310 29151 29528 gene locus_tag LOCUS_10320 gene minC 29151 29528 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392078.1 protein_id gnl|my_center|LOCUS_10320 29566 30366 gene locus_tag LOCUS_10330 gene minD 29566 30366 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816779.1 protein_id gnl|my_center|LOCUS_10330 30389 30658 gene locus_tag LOCUS_10340 gene minE 30389 30658 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816777.1 protein_id gnl|my_center|LOCUS_10340 30763 31899 gene locus_tag LOCUS_10350 gene rodA 30763 31899 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392081.1 protein_id gnl|my_center|LOCUS_10350 31911 32675 gene locus_tag LOCUS_10360 31911 32675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 33026 33712 gene locus_tag LOCUS_10370 33026 33712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 33727 34614 gene locus_tag LOCUS_10380 33727 34614 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816555.1 protein_id gnl|my_center|LOCUS_10380 34724 36583 gene locus_tag LOCUS_10390 34724 36583 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542452.1 protein_id gnl|my_center|LOCUS_10390 36570 37250 gene locus_tag LOCUS_10400 36570 37250 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460898.1 protein_id gnl|my_center|LOCUS_10400 37264 38505 gene locus_tag LOCUS_10410 37264 38505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 38674 38985 gene locus_tag LOCUS_10420 gene rplU 38674 38985 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460896.1 protein_id gnl|my_center|LOCUS_10420 39005 39271 gene locus_tag LOCUS_10430 gene rpmA 39005 39271 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816541.1 protein_id gnl|my_center|LOCUS_10430 39496 40401 gene locus_tag LOCUS_10440 39496 40401 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814543.1 protein_id gnl|my_center|LOCUS_10440 40446 41261 gene locus_tag LOCUS_10450 40446 41261 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_10450 41562 42044 gene locus_tag LOCUS_10460 gene mraZ 41562 42044 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_10460 42170 43150 gene locus_tag LOCUS_10470 gene rsmH 42170 43150 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861627.1 protein_id gnl|my_center|LOCUS_10470 43153 43686 gene locus_tag LOCUS_10480 43153 43686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 43705 45843 gene locus_tag LOCUS_10490 43705 45843 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_10490 45933 47411 gene locus_tag LOCUS_10500 45933 47411 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_10500 47408 48802 gene locus_tag LOCUS_10510 47408 48802 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392358.1 protein_id gnl|my_center|LOCUS_10510 48799 49812 gene locus_tag LOCUS_10520 gene mraY 48799 49812 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460699.1 protein_id gnl|my_center|LOCUS_10520 49817 51178 gene locus_tag LOCUS_10530 gene murD 49817 51178 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_10530 51178 52281 gene locus_tag LOCUS_10540 gene spoVE 51178 52281 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_10540 52295 53422 gene locus_tag LOCUS_10550 gene murG 52295 53422 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392362.1 protein_id gnl|my_center|LOCUS_10550 53566 54951 gene locus_tag LOCUS_10560 gene murC 53566 54951 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392363.1 protein_id gnl|my_center|LOCUS_10560 54938 55840 gene locus_tag LOCUS_10570 gene murB 54938 55840 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392364.1 protein_id gnl|my_center|LOCUS_10570 55853 57106 gene locus_tag LOCUS_10580 gene murA 55853 57106 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460694.1 protein_id gnl|my_center|LOCUS_10580 57184 57891 gene locus_tag LOCUS_10590 57184 57891 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272487.1 protein_id gnl|my_center|LOCUS_10590 57881 58606 gene locus_tag LOCUS_10600 57881 58606 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393732.1 protein_id gnl|my_center|LOCUS_10600 58617 59315 gene locus_tag LOCUS_10610 58617 59315 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861623.1 protein_id gnl|my_center|LOCUS_10610 59322 59663 gene locus_tag LOCUS_10620 59322 59663 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392367.1 protein_id gnl|my_center|LOCUS_10620 59760 60806 gene locus_tag LOCUS_10630 gene ftsZ 59760 60806 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069588917.1 protein_id gnl|my_center|LOCUS_10630 60957 61877 gene locus_tag LOCUS_10640 gene spoIIGA 60957 61877 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170291042.1 protein_id gnl|my_center|LOCUS_10640 61890 62618 gene locus_tag LOCUS_10650 gene sigE 61890 62618 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811355.1 protein_id gnl|my_center|LOCUS_10650 63015 63785 gene locus_tag LOCUS_10660 gene sigG 63015 63785 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774282.1 protein_id gnl|my_center|LOCUS_10660 63823 64437 gene locus_tag LOCUS_10670 63823 64437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 64502 64756 gene locus_tag LOCUS_10680 64502 64756 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392374.1 protein_id gnl|my_center|LOCUS_10680 64909 65721 gene locus_tag LOCUS_10690 64909 65721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 >Feature sequence11 251 409 gene locus_tag LOCUS_10700 251 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 391 2034 gene locus_tag LOCUS_10710 391 2034 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913630.1 protein_id gnl|my_center|LOCUS_10710 2158 3087 gene locus_tag LOCUS_10720 2158 3087 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966906.1 protein_id gnl|my_center|LOCUS_10720 3092 4009 gene locus_tag LOCUS_10730 gene dppC 3092 4009 CDS product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245702.1 protein_id gnl|my_center|LOCUS_10730 4026 5063 gene locus_tag LOCUS_10740 4026 5063 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966904.1 protein_id gnl|my_center|LOCUS_10740 5068 6048 gene locus_tag LOCUS_10750 5068 6048 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519085.1 protein_id gnl|my_center|LOCUS_10750 6566 6045 gene locus_tag LOCUS_10760 6566 6045 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469482.1 protein_id gnl|my_center|LOCUS_10760 7366 6698 gene locus_tag LOCUS_10770 7366 6698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 9561 7381 gene locus_tag LOCUS_10780 9561 7381 CDS product DUF3160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177619.1 protein_id gnl|my_center|LOCUS_10780 11174 9915 gene locus_tag LOCUS_10790 11174 9915 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799743.1 protein_id gnl|my_center|LOCUS_10790 12934 11510 gene locus_tag LOCUS_10800 12934 11510 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940879.1 protein_id gnl|my_center|LOCUS_10800 13495 13208 gene locus_tag LOCUS_10810 13495 13208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 13596 13913 gene locus_tag LOCUS_10820 13596 13913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 14297 15055 gene locus_tag LOCUS_10830 14297 15055 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258316.1 protein_id gnl|my_center|LOCUS_10830 15139 15324 gene locus_tag LOCUS_10840 15139 15324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 15755 15414 gene locus_tag LOCUS_10850 15755 15414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 16038 16574 gene locus_tag LOCUS_10860 16038 16574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 16586 16795 gene locus_tag LOCUS_10870 16586 16795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 18150 17506 gene locus_tag LOCUS_10880 gene ppaX 18150 17506 CDS product pyrophosphatase PpaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222403.1 protein_id gnl|my_center|LOCUS_10880 18705 18247 gene locus_tag LOCUS_10890 18705 18247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 19571 18780 gene locus_tag LOCUS_10900 19571 18780 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047988.1 protein_id gnl|my_center|LOCUS_10900 20251 19562 gene locus_tag LOCUS_10910 20251 19562 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221393.1 protein_id gnl|my_center|LOCUS_10910 20447 20373 gene locus_tag LOCUS_t00220 20447 20373 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 20535 20458 gene locus_tag LOCUS_t00230 20535 20458 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 21663 20584 gene locus_tag LOCUS_10920 gene rpoD 21663 20584 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_10920 23444 21660 gene locus_tag LOCUS_10930 gene dnaG 23444 21660 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816339.1 protein_id gnl|my_center|LOCUS_10930 24539 23538 gene locus_tag LOCUS_10940 24539 23538 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_10940 25224 24607 gene locus_tag LOCUS_10950 25224 24607 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392158.1 protein_id gnl|my_center|LOCUS_10950 25823 25257 gene locus_tag LOCUS_10960 gene thpR 25823 25257 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583814.1 protein_id gnl|my_center|LOCUS_10960 28375 26042 gene locus_tag LOCUS_10970 gene ppsA 28375 26042 CDS product pyruvate, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846514.1 protein_id gnl|my_center|LOCUS_10970 29301 28447 gene locus_tag LOCUS_10980 29301 28447 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392143.1 protein_id gnl|my_center|LOCUS_10980 29948 29310 gene locus_tag LOCUS_10990 29948 29310 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392142.1 protein_id gnl|my_center|LOCUS_10990 32142 30064 gene locus_tag LOCUS_11000 gene glyS 32142 30064 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392141.1 protein_id gnl|my_center|LOCUS_11000 32920 32135 gene locus_tag LOCUS_11010 gene glyQ 32920 32135 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392140.1 protein_id gnl|my_center|LOCUS_11010 33508 33125 gene locus_tag LOCUS_11020 33508 33125 CDS product DUF4342 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392139.1 protein_id gnl|my_center|LOCUS_11020 34288 33539 gene locus_tag LOCUS_11030 gene recO 34288 33539 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909322.1 protein_id gnl|my_center|LOCUS_11030 35665 34310 gene locus_tag LOCUS_11040 gene mgtE 35665 34310 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232543.1 protein_id gnl|my_center|LOCUS_11040 35772 35620 gene locus_tag LOCUS_11050 35772 35620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 37392 35974 gene locus_tag LOCUS_11060 37392 35974 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986767.1 protein_id gnl|my_center|LOCUS_11060 38818 37397 gene locus_tag LOCUS_11070 gene rtcB 38818 37397 CDS product RNA ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228915.1 protein_id gnl|my_center|LOCUS_11070 39741 38842 gene locus_tag LOCUS_11080 39741 38842 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143624.1 protein_id gnl|my_center|LOCUS_11080 40642 40016 gene locus_tag LOCUS_11090 40642 40016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 41208 40648 gene locus_tag LOCUS_11100 41208 40648 CDS product GbsR/MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313806.1 protein_id gnl|my_center|LOCUS_11100 41353 42369 gene locus_tag LOCUS_11110 41353 42369 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582485.1 protein_id gnl|my_center|LOCUS_11110 42366 43151 gene locus_tag LOCUS_11120 42366 43151 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582486.1 protein_id gnl|my_center|LOCUS_11120 43268 43654 gene locus_tag LOCUS_11130 43268 43654 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393656.1 protein_id gnl|my_center|LOCUS_11130 43651 45204 gene locus_tag LOCUS_11140 43651 45204 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_11140 45252 46388 gene locus_tag LOCUS_11150 gene alr 45252 46388 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_11150 47225 46473 gene locus_tag LOCUS_11160 47225 46473 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393659.1 protein_id gnl|my_center|LOCUS_11160 48463 47228 gene locus_tag LOCUS_11170 48463 47228 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393658.1 protein_id gnl|my_center|LOCUS_11170 48787 49335 gene locus_tag LOCUS_11180 48787 49335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 49332 49817 gene locus_tag LOCUS_11190 49332 49817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 50939 49899 gene locus_tag LOCUS_11200 gene ltaE 50939 49899 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_11200 51570 51076 gene locus_tag LOCUS_11210 51570 51076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 51850 52170 gene locus_tag LOCUS_11220 51850 52170 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393575.1 protein_id gnl|my_center|LOCUS_11220 52197 52883 gene locus_tag LOCUS_11230 52197 52883 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393576.1 protein_id gnl|my_center|LOCUS_11230 52969 54033 gene locus_tag LOCUS_11240 52969 54033 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942278.1 protein_id gnl|my_center|LOCUS_11240 54197 54039 gene locus_tag LOCUS_11250 54197 54039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 54465 55070 gene locus_tag LOCUS_11260 54465 55070 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392977.1 protein_id gnl|my_center|LOCUS_11260 55125 55565 gene locus_tag LOCUS_11270 55125 55565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 56619 55606 gene locus_tag LOCUS_11280 gene aroF 56619 55606 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460211.1 protein_id gnl|my_center|LOCUS_11280 57482 56688 gene locus_tag LOCUS_11290 gene trpA 57482 56688 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392849.1 protein_id gnl|my_center|LOCUS_11290 58668 57469 gene locus_tag LOCUS_11300 gene trpB 58668 57469 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392850.1 protein_id gnl|my_center|LOCUS_11300 59278 58592 gene locus_tag LOCUS_11310 59278 58592 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392851.1 protein_id gnl|my_center|LOCUS_11310 60059 59262 gene locus_tag LOCUS_11320 gene trpC 60059 59262 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392852.1 protein_id gnl|my_center|LOCUS_11320 61072 60053 gene locus_tag LOCUS_11330 gene trpD 61072 60053 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_11330 61647 61084 gene locus_tag LOCUS_11340 gene pabA 61647 61084 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392854.1 protein_id gnl|my_center|LOCUS_11340 63107 61644 gene locus_tag LOCUS_11350 gene trpE 63107 61644 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392855.1 protein_id gnl|my_center|LOCUS_11350 >Feature sequence12 205 933 gene locus_tag LOCUS_11360 gene nadE 205 933 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808614.1 protein_id gnl|my_center|LOCUS_11360 951 1730 gene locus_tag LOCUS_11370 951 1730 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583963.1 protein_id gnl|my_center|LOCUS_11370 1827 2303 gene locus_tag LOCUS_11380 gene ruvC 1827 2303 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_11380 2308 2895 gene locus_tag LOCUS_11390 gene ruvA 2308 2895 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406125.1 protein_id gnl|my_center|LOCUS_11390 2916 3935 gene locus_tag LOCUS_11400 gene ruvB 2916 3935 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_11400 3965 4516 gene locus_tag LOCUS_11410 3965 4516 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_11410 4519 4743 gene locus_tag LOCUS_11420 4519 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 5243 5491 gene locus_tag LOCUS_11430 5243 5491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 5509 6531 gene locus_tag LOCUS_11440 gene queA 5509 6531 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 protein_id gnl|my_center|LOCUS_11440 7218 8234 gene locus_tag LOCUS_11450 gene tgt 7218 8234 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_11450 8316 8591 gene locus_tag LOCUS_11460 8316 8591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 8615 9277 gene locus_tag LOCUS_11470 8615 9277 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_11470 9290 10519 gene locus_tag LOCUS_11480 9290 10519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 10532 11422 gene locus_tag LOCUS_11490 gene secF 10532 11422 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393192.1 protein_id gnl|my_center|LOCUS_11490 11511 11792 gene locus_tag LOCUS_11500 11511 11792 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871082.1 protein_id gnl|my_center|LOCUS_11500 11844 13202 gene locus_tag LOCUS_11510 11844 13202 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392890.1 protein_id gnl|my_center|LOCUS_11510 13590 14624 gene locus_tag LOCUS_11520 13590 14624 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_11520 14641 15009 gene locus_tag LOCUS_11530 14641 15009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 15053 15661 gene locus_tag LOCUS_11540 15053 15661 CDS product yteA family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957397.1 protein_id gnl|my_center|LOCUS_11540 15759 16715 gene locus_tag LOCUS_11550 15759 16715 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392766.1 protein_id gnl|my_center|LOCUS_11550 16734 17402 gene locus_tag LOCUS_11560 16734 17402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 17350 18663 gene locus_tag LOCUS_11570 gene hemA 17350 18663 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392764.1 protein_id gnl|my_center|LOCUS_11570 18670 19614 gene locus_tag LOCUS_11580 gene hemC 18670 19614 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392763.1 protein_id gnl|my_center|LOCUS_11580 19607 21136 gene locus_tag LOCUS_11590 gene cobA 19607 21136 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_11590 21136 22284 gene locus_tag LOCUS_11600 gene nirJ1 21136 22284 CDS product putative heme d1 biosynthesis radical SAM protein NirJ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460179.1 protein_id gnl|my_center|LOCUS_11600 22300 23283 gene locus_tag LOCUS_11610 gene hemB 22300 23283 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_11610 23285 24292 gene locus_tag LOCUS_11620 gene nirJ2 23285 24292 CDS product putative heme d1 biosynthesis radical SAM protein NirJ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392759.1 protein_id gnl|my_center|LOCUS_11620 24279 24752 gene locus_tag LOCUS_11630 gene ahbA 24279 24752 CDS product siroheme decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938154.1 protein_id gnl|my_center|LOCUS_11630 24742 25245 gene locus_tag LOCUS_11640 24742 25245 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393684.1 protein_id gnl|my_center|LOCUS_11640 25238 26530 gene locus_tag LOCUS_11650 gene hemL 25238 26530 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_11650 27131 26700 gene locus_tag LOCUS_11660 27131 26700 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393982.1 protein_id gnl|my_center|LOCUS_11660 27300 27839 gene locus_tag LOCUS_11670 27300 27839 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_11670 28416 27832 gene locus_tag LOCUS_11680 gene minC 28416 27832 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393365.1 protein_id gnl|my_center|LOCUS_11680 28580 29626 gene locus_tag LOCUS_11690 gene galT 28580 29626 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080684.1 protein_id gnl|my_center|LOCUS_11690 29619 31121 gene locus_tag LOCUS_11700 gene glgA 29619 31121 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393434.1 protein_id gnl|my_center|LOCUS_11700 31899 31501 gene locus_tag LOCUS_11710 31899 31501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 32454 31972 gene locus_tag LOCUS_11720 32454 31972 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925080.1 protein_id gnl|my_center|LOCUS_11720 32887 32468 gene locus_tag LOCUS_11730 32887 32468 CDS product nucleoside recognition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868940.1 protein_id gnl|my_center|LOCUS_11730 33036 33995 gene locus_tag LOCUS_11740 33036 33995 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545174.1 protein_id gnl|my_center|LOCUS_11740 34102 34713 gene locus_tag LOCUS_11750 34102 34713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 34815 35501 gene locus_tag LOCUS_11760 34815 35501 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026871.1 protein_id gnl|my_center|LOCUS_11760 35869 35498 gene locus_tag LOCUS_11770 35869 35498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 37421 35841 gene locus_tag LOCUS_11780 gene spoIVCA 37421 35841 CDS product site-specific DNA recombinase SpoIVCA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886573.1 protein_id gnl|my_center|LOCUS_11780 37836 39335 gene locus_tag LOCUS_11790 37836 39335 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818003.1 protein_id gnl|my_center|LOCUS_11790 39851 39717 gene locus_tag LOCUS_11800 39851 39717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 40263 39910 gene locus_tag LOCUS_11810 40263 39910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 41899 40334 gene locus_tag LOCUS_11820 gene spoIVCA 41899 40334 CDS product site-specific DNA recombinase SpoIVCA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886573.1 protein_id gnl|my_center|LOCUS_11820 42314 43813 gene locus_tag LOCUS_11830 42314 43813 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818003.1 protein_id gnl|my_center|LOCUS_11830 44329 44195 gene locus_tag LOCUS_11840 44329 44195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 44741 44388 gene locus_tag LOCUS_11850 44741 44388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 45176 44802 gene locus_tag LOCUS_11860 45176 44802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 45368 46429 gene locus_tag LOCUS_11870 45368 46429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 46444 46968 gene locus_tag LOCUS_11880 46444 46968 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393068.1 protein_id gnl|my_center|LOCUS_11880 46961 47875 gene locus_tag LOCUS_11890 46961 47875 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_11890 47906 49096 gene locus_tag LOCUS_11900 gene aroC 47906 49096 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_11900 49127 49615 gene locus_tag LOCUS_11910 49127 49615 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272425.1 protein_id gnl|my_center|LOCUS_11910 49608 50687 gene locus_tag LOCUS_11920 gene aroB 49608 50687 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393064.1 protein_id gnl|my_center|LOCUS_11920 50700 52409 gene locus_tag LOCUS_11930 50700 52409 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_11930 52424 53512 gene locus_tag LOCUS_11940 52424 53512 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393062.1 protein_id gnl|my_center|LOCUS_11940 53632 54852 gene locus_tag LOCUS_11950 53632 54852 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393061.1 protein_id gnl|my_center|LOCUS_11950 54981 55436 gene locus_tag LOCUS_11960 54981 55436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 55754 56407 gene locus_tag LOCUS_11970 55754 56407 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393059.1 protein_id gnl|my_center|LOCUS_11970 56426 56914 gene locus_tag LOCUS_11980 56426 56914 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541852.1 protein_id gnl|my_center|LOCUS_11980 56918 57295 gene locus_tag LOCUS_11990 56918 57295 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393057.1 protein_id gnl|my_center|LOCUS_11990 57289 57846 gene locus_tag LOCUS_12000 57289 57846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 57876 59084 gene locus_tag LOCUS_12010 57876 59084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 59133 60815 gene locus_tag LOCUS_12020 59133 60815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 60819 61544 gene locus_tag LOCUS_12030 60819 61544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 >Feature sequence13 2944 74 gene locus_tag LOCUS_12040 gene treY 2944 74 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393311.1 protein_id gnl|my_center|LOCUS_12040 5378 2946 gene locus_tag LOCUS_12050 5378 2946 CDS product DUF3536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393310.1 protein_id gnl|my_center|LOCUS_12050 7237 5384 gene locus_tag LOCUS_12060 gene treZ 7237 5384 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393309.1 protein_id gnl|my_center|LOCUS_12060 9297 7234 gene locus_tag LOCUS_12070 gene malQ 9297 7234 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542051.1 protein_id gnl|my_center|LOCUS_12070 9439 9514 gene locus_tag LOCUS_t00240 9439 9514 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 9710 10315 gene locus_tag LOCUS_12080 9710 10315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 10424 11569 gene locus_tag LOCUS_12090 10424 11569 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392213.1 protein_id gnl|my_center|LOCUS_12090 11559 13757 gene locus_tag LOCUS_12100 11559 13757 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949077.1 protein_id gnl|my_center|LOCUS_12100 15259 13790 gene locus_tag LOCUS_12110 15259 13790 CDS product S-layer homology domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392269.1 protein_id gnl|my_center|LOCUS_12110 15782 16099 gene locus_tag LOCUS_12120 15782 16099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 16527 16153 gene locus_tag LOCUS_12130 16527 16153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 16772 16524 gene locus_tag LOCUS_12140 16772 16524 CDS product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774132.1 protein_id gnl|my_center|LOCUS_12140 17263 17087 gene locus_tag LOCUS_12150 17263 17087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 18533 17268 gene locus_tag LOCUS_12160 18533 17268 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392972.1 protein_id gnl|my_center|LOCUS_12160 19623 18517 gene locus_tag LOCUS_12170 19623 18517 CDS product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943959.1 protein_id gnl|my_center|LOCUS_12170 21437 19623 gene locus_tag LOCUS_12180 21437 19623 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393538.1 protein_id gnl|my_center|LOCUS_12180 21722 22129 gene locus_tag LOCUS_12190 21722 22129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 23130 22213 gene locus_tag LOCUS_12200 gene cysK 23130 22213 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393469.1 protein_id gnl|my_center|LOCUS_12200 24132 23230 gene locus_tag LOCUS_12210 24132 23230 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393185.1 protein_id gnl|my_center|LOCUS_12210 24286 24495 gene locus_tag LOCUS_12220 24286 24495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 24508 24789 gene locus_tag LOCUS_12230 24508 24789 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392904.1 protein_id gnl|my_center|LOCUS_12230 24792 25397 gene locus_tag LOCUS_12240 24792 25397 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948863.1 protein_id gnl|my_center|LOCUS_12240 27080 25452 gene locus_tag LOCUS_12250 gene groL 27080 25452 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817317.1 protein_id gnl|my_center|LOCUS_12250 27397 27113 gene locus_tag LOCUS_12260 gene groES 27397 27113 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583322.1 protein_id gnl|my_center|LOCUS_12260 28095 27895 gene locus_tag LOCUS_12270 28095 27895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 28220 28984 gene locus_tag LOCUS_12280 gene fdhD 28220 28984 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529224.1 protein_id gnl|my_center|LOCUS_12280 29540 28968 gene locus_tag LOCUS_12290 29540 28968 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_12290 30890 29547 gene locus_tag LOCUS_12300 30890 29547 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392749.1 protein_id gnl|my_center|LOCUS_12300 32096 31050 gene locus_tag LOCUS_12310 gene tsaD 32096 31050 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393644.1 protein_id gnl|my_center|LOCUS_12310 32452 32745 gene locus_tag LOCUS_12320 32452 32745 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459031.1 protein_id gnl|my_center|LOCUS_12320 32880 33317 gene locus_tag LOCUS_12330 32880 33317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 33685 34266 gene locus_tag LOCUS_12340 33685 34266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 35415 34957 gene locus_tag LOCUS_12350 gene rimI 35415 34957 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393645.1 protein_id gnl|my_center|LOCUS_12350 36124 35417 gene locus_tag LOCUS_12360 gene tsaB 36124 35417 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_12360 36599 36105 gene locus_tag LOCUS_12370 gene tsaE 36599 36105 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044854.1 protein_id gnl|my_center|LOCUS_12370 37714 36653 gene locus_tag LOCUS_12380 gene thiL 37714 36653 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_12380 39220 37931 gene locus_tag LOCUS_12390 gene thiC 39220 37931 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392914.1 protein_id gnl|my_center|LOCUS_12390 40188 39217 gene locus_tag LOCUS_12400 40188 39217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 41709 40552 gene locus_tag LOCUS_12410 41709 40552 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817351.1 protein_id gnl|my_center|LOCUS_12410 42614 41916 gene locus_tag LOCUS_12420 42614 41916 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256366.1 protein_id gnl|my_center|LOCUS_12420 44390 43059 gene locus_tag LOCUS_12430 gene glnA 44390 43059 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392811.1 protein_id gnl|my_center|LOCUS_12430 45844 44471 gene locus_tag LOCUS_12440 gene lpdA 45844 44471 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393264.1 protein_id gnl|my_center|LOCUS_12440 46640 45864 gene locus_tag LOCUS_12450 46640 45864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083223.1 protein_id gnl|my_center|LOCUS_12450 48254 46659 gene locus_tag LOCUS_12460 48254 46659 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392806.1 protein_id gnl|my_center|LOCUS_12460 49351 48251 gene locus_tag LOCUS_12470 49351 48251 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392807.1 protein_id gnl|my_center|LOCUS_12470 49546 49373 gene locus_tag LOCUS_12480 49546 49373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 50852 49524 gene locus_tag LOCUS_12490 gene glnA 50852 49524 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392811.1 protein_id gnl|my_center|LOCUS_12490 51591 51010 gene locus_tag LOCUS_12500 51591 51010 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257866.1 protein_id gnl|my_center|LOCUS_12500 53399 51822 gene locus_tag LOCUS_12510 53399 51822 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582712.1 protein_id gnl|my_center|LOCUS_12510 54933 53566 gene locus_tag LOCUS_12520 gene glnA 54933 53566 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392811.1 protein_id gnl|my_center|LOCUS_12520 55638 55060 gene locus_tag LOCUS_12530 55638 55060 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583472.1 protein_id gnl|my_center|LOCUS_12530 55756 57048 gene locus_tag LOCUS_12540 55756 57048 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871084.1 protein_id gnl|my_center|LOCUS_12540 57640 57248 gene locus_tag LOCUS_12550 57640 57248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 57866 58558 gene locus_tag LOCUS_12560 57866 58558 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_12560 59563 58631 gene locus_tag LOCUS_12570 59563 58631 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584019.1 protein_id gnl|my_center|LOCUS_12570 59804 59610 gene locus_tag LOCUS_12580 59804 59610 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584018.1 protein_id gnl|my_center|LOCUS_12580 >Feature sequence14 202 663 gene locus_tag LOCUS_12590 202 663 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392560.1 protein_id gnl|my_center|LOCUS_12590 700 1809 gene locus_tag LOCUS_12600 gene nusA 700 1809 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_12600 2087 2395 gene locus_tag LOCUS_12610 2087 2395 CDS product ribosomal L7Ae/L30e/S12e/Gadd45 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419470.1 protein_id gnl|my_center|LOCUS_12610 2435 5155 gene locus_tag LOCUS_12620 gene infB 2435 5155 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541506.1 protein_id gnl|my_center|LOCUS_12620 5182 5532 gene locus_tag LOCUS_12630 gene rbfA 5182 5532 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460392.1 protein_id gnl|my_center|LOCUS_12630 5489 6514 gene locus_tag LOCUS_12640 5489 6514 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_12640 6498 7424 gene locus_tag LOCUS_12650 gene truB 6498 7424 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392567.1 protein_id gnl|my_center|LOCUS_12650 7427 8392 gene locus_tag LOCUS_12660 7427 8392 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546739.1 protein_id gnl|my_center|LOCUS_12660 8452 8667 gene locus_tag LOCUS_12670 8452 8667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 8686 8907 gene locus_tag LOCUS_12680 8686 8907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 8984 9253 gene locus_tag LOCUS_12690 gene rpsO 8984 9253 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546801.1 protein_id gnl|my_center|LOCUS_12690 9315 11534 gene locus_tag LOCUS_12700 9315 11534 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541509.1 protein_id gnl|my_center|LOCUS_12700 11562 12296 gene locus_tag LOCUS_12710 11562 12296 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392571.1 protein_id gnl|my_center|LOCUS_12710 12359 13624 gene locus_tag LOCUS_12720 12359 13624 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_12720 13657 14118 gene locus_tag LOCUS_12730 gene dut 13657 14118 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808844.1 protein_id gnl|my_center|LOCUS_12730 14193 14531 gene locus_tag LOCUS_12740 14193 14531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392575.1 protein_id gnl|my_center|LOCUS_12740 14549 14818 gene locus_tag LOCUS_12750 14549 14818 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774520.1 protein_id gnl|my_center|LOCUS_12750 14923 15909 gene locus_tag LOCUS_12760 14923 15909 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183783.1 protein_id gnl|my_center|LOCUS_12760 15923 16090 gene locus_tag LOCUS_12770 15923 16090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 16218 17018 gene locus_tag LOCUS_12780 gene dapB 16218 17018 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808837.1 protein_id gnl|my_center|LOCUS_12780 17082 18014 gene locus_tag LOCUS_12790 gene dpsA 17082 18014 CDS product dipicolinate synthase subunit DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460385.1 protein_id gnl|my_center|LOCUS_12790 17995 18582 gene locus_tag LOCUS_12800 17995 18582 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392579.1 protein_id gnl|my_center|LOCUS_12800 18600 19610 gene locus_tag LOCUS_12810 18600 19610 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460383.1 protein_id gnl|my_center|LOCUS_12810 19641 20858 gene locus_tag LOCUS_12820 gene dapG 19641 20858 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808827.1 protein_id gnl|my_center|LOCUS_12820 20882 21772 gene locus_tag LOCUS_12830 gene dapA 20882 21772 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392582.1 protein_id gnl|my_center|LOCUS_12830 21917 23581 gene locus_tag LOCUS_12840 21917 23581 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_12840 23738 23645 gene locus_tag LOCUS_t00250 23738 23645 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 23885 24346 gene locus_tag LOCUS_12850 gene lspA 23885 24346 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392387.1 protein_id gnl|my_center|LOCUS_12850 24333 25262 gene locus_tag LOCUS_12860 24333 25262 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245307.1 protein_id gnl|my_center|LOCUS_12860 25686 25234 gene locus_tag LOCUS_12870 25686 25234 CDS product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391668.1 protein_id gnl|my_center|LOCUS_12870 26522 25746 gene locus_tag LOCUS_12880 26522 25746 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391666.1 protein_id gnl|my_center|LOCUS_12880 27858 26641 gene locus_tag LOCUS_12890 27858 26641 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245414.1 protein_id gnl|my_center|LOCUS_12890 27957 28220 gene locus_tag LOCUS_12900 27957 28220 CDS product YqhV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391665.1 protein_id gnl|my_center|LOCUS_12900 28380 28931 gene locus_tag LOCUS_12910 gene pyrR 28380 28931 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583925.1 protein_id gnl|my_center|LOCUS_12910 29048 29977 gene locus_tag LOCUS_12920 29048 29977 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 protein_id gnl|my_center|LOCUS_12920 29961 31259 gene locus_tag LOCUS_12930 29961 31259 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_12930 31276 32358 gene locus_tag LOCUS_12940 gene carA 31276 32358 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104362.1 protein_id gnl|my_center|LOCUS_12940 32358 35582 gene locus_tag LOCUS_12950 gene carB 32358 35582 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392401.1 protein_id gnl|my_center|LOCUS_12950 35587 36384 gene locus_tag LOCUS_12960 35587 36384 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_12960 36362 37288 gene locus_tag LOCUS_12970 36362 37288 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_12970 37291 38016 gene locus_tag LOCUS_12980 gene pyrF 37291 38016 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_12980 38043 38621 gene locus_tag LOCUS_12990 gene pyrE 38043 38621 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083096.1 protein_id gnl|my_center|LOCUS_12990 40357 38618 gene locus_tag LOCUS_13000 40357 38618 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392405.1 protein_id gnl|my_center|LOCUS_13000 40501 41577 gene locus_tag LOCUS_13010 40501 41577 CDS product DUF3866 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896132.1 protein_id gnl|my_center|LOCUS_13010 42070 41795 gene locus_tag LOCUS_13020 42070 41795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 42635 43510 gene locus_tag LOCUS_13030 gene xerD 42635 43510 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_13030 43531 44721 gene locus_tag LOCUS_13040 43531 44721 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393009.1 protein_id gnl|my_center|LOCUS_13040 44724 46049 gene locus_tag LOCUS_13050 44724 46049 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393758.1 protein_id gnl|my_center|LOCUS_13050 46076 46807 gene locus_tag LOCUS_13060 46076 46807 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881445.1 protein_id gnl|my_center|LOCUS_13060 47053 46811 gene locus_tag LOCUS_13070 47053 46811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391944.1 protein_id gnl|my_center|LOCUS_13070 47197 48246 gene locus_tag LOCUS_13080 47197 48246 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_13080 48346 48855 gene locus_tag LOCUS_13090 48346 48855 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391738.1 protein_id gnl|my_center|LOCUS_13090 49008 49979 gene locus_tag LOCUS_13100 49008 49979 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670942.1 protein_id gnl|my_center|LOCUS_13100 49976 51196 gene locus_tag LOCUS_13110 49976 51196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 51315 51464 gene locus_tag LOCUS_13120 51315 51464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 51690 52610 gene locus_tag LOCUS_13130 51690 52610 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_13130 52956 53177 gene locus_tag LOCUS_13140 52956 53177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 54178 53174 gene locus_tag LOCUS_13150 gene gap 54178 53174 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459734.1 protein_id gnl|my_center|LOCUS_13150 54362 55306 gene locus_tag LOCUS_13160 54362 55306 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391635.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence15 2190 4217 gene locus_tag LOCUS_13170 2190 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 4476 4294 gene locus_tag LOCUS_13180 4476 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 5906 4698 gene locus_tag LOCUS_13190 5906 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 6190 6053 gene locus_tag LOCUS_13200 6190 6053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 7636 6221 gene locus_tag LOCUS_13210 7636 6221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 9051 7648 gene locus_tag LOCUS_13220 9051 7648 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004068250.1 protein_id gnl|my_center|LOCUS_13220 9423 9055 gene locus_tag LOCUS_13230 9423 9055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 9786 10907 gene locus_tag LOCUS_13240 9786 10907 CDS product PRK06851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392810.1 protein_id gnl|my_center|LOCUS_13240 11697 10912 gene locus_tag LOCUS_13250 11697 10912 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811476.1 protein_id gnl|my_center|LOCUS_13250 12449 11682 gene locus_tag LOCUS_13260 12449 11682 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391646.1 protein_id gnl|my_center|LOCUS_13260 13446 12466 gene locus_tag LOCUS_13270 13446 12466 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391645.1 protein_id gnl|my_center|LOCUS_13270 14089 13532 gene locus_tag LOCUS_13280 14089 13532 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391642.1 protein_id gnl|my_center|LOCUS_13280 14299 15744 gene locus_tag LOCUS_13290 14299 15744 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545977.1 protein_id gnl|my_center|LOCUS_13290 15734 16603 gene locus_tag LOCUS_13300 gene ubiA 15734 16603 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391644.1 protein_id gnl|my_center|LOCUS_13300 16685 17080 gene locus_tag LOCUS_13310 16685 17080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391648.1 protein_id gnl|my_center|LOCUS_13310 17175 19199 gene locus_tag LOCUS_13320 17175 19199 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878757.1 protein_id gnl|my_center|LOCUS_13320 19661 19425 gene locus_tag LOCUS_13330 19661 19425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 20948 19719 gene locus_tag LOCUS_13340 20948 19719 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461855.1 protein_id gnl|my_center|LOCUS_13340 22644 21001 gene locus_tag LOCUS_13350 22644 21001 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393538.1 protein_id gnl|my_center|LOCUS_13350 23777 22671 gene locus_tag LOCUS_13360 23777 22671 CDS product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393537.1 protein_id gnl|my_center|LOCUS_13360 24063 24779 gene locus_tag LOCUS_13370 24063 24779 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939585.1 protein_id gnl|my_center|LOCUS_13370 24940 26532 gene locus_tag LOCUS_13380 24940 26532 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437634.1 protein_id gnl|my_center|LOCUS_13380 26943 27941 gene locus_tag LOCUS_13390 26943 27941 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439336.1 protein_id gnl|my_center|LOCUS_13390 27994 28980 gene locus_tag LOCUS_13400 27994 28980 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856992.1 protein_id gnl|my_center|LOCUS_13400 28977 29780 gene locus_tag LOCUS_13410 28977 29780 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856990.1 protein_id gnl|my_center|LOCUS_13410 29958 30140 gene locus_tag LOCUS_13420 29958 30140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 30231 30665 gene locus_tag LOCUS_13430 30231 30665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 30670 31770 gene locus_tag LOCUS_13440 30670 31770 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393523.1 protein_id gnl|my_center|LOCUS_13440 32086 31835 gene locus_tag LOCUS_13450 32086 31835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 32224 32745 gene locus_tag LOCUS_13460 32224 32745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 33308 32823 gene locus_tag LOCUS_13470 33308 32823 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583986.1 protein_id gnl|my_center|LOCUS_13470 33826 33419 gene locus_tag LOCUS_13480 33826 33419 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_13480 34942 34010 gene locus_tag LOCUS_13490 34942 34010 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_13490 36042 34939 gene locus_tag LOCUS_13500 36042 34939 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_13500 37568 36039 gene locus_tag LOCUS_13510 37568 36039 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_13510 38828 37725 gene locus_tag LOCUS_13520 38828 37725 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276126.1 protein_id gnl|my_center|LOCUS_13520 40211 39225 gene locus_tag LOCUS_13530 40211 39225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 41435 40398 gene locus_tag LOCUS_13540 41435 40398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 42840 41608 gene locus_tag LOCUS_13550 gene rsgI 42840 41608 CDS product anti-sigma-I factor RsgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981244.1 protein_id gnl|my_center|LOCUS_13550 43543 42830 gene locus_tag LOCUS_13560 gene sigI 43543 42830 CDS product RNA polymerase sigma factor SigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245855.1 protein_id gnl|my_center|LOCUS_13560 44622 43657 gene locus_tag LOCUS_13570 44622 43657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 44929 45306 gene locus_tag LOCUS_13580 44929 45306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 45559 46701 gene locus_tag LOCUS_13590 45559 46701 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392522.1 protein_id gnl|my_center|LOCUS_13590 46801 48084 gene locus_tag LOCUS_13600 46801 48084 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392521.1 protein_id gnl|my_center|LOCUS_13600 48265 49563 gene locus_tag LOCUS_13610 48265 49563 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272434.1 protein_id gnl|my_center|LOCUS_13610 50846 49716 gene locus_tag LOCUS_13620 50846 49716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 51117 50959 gene locus_tag LOCUS_13630 51117 50959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 >Feature sequence16 665 42 gene locus_tag LOCUS_13640 665 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 1493 681 gene locus_tag LOCUS_13650 1493 681 CDS product RNA-binding S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391895.1 protein_id gnl|my_center|LOCUS_13650 3613 1508 gene locus_tag LOCUS_13660 3613 1508 CDS product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201786535.1 protein_id gnl|my_center|LOCUS_13660 4170 3616 gene locus_tag LOCUS_13670 4170 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391890.1 protein_id gnl|my_center|LOCUS_13670 4746 4447 gene locus_tag LOCUS_13680 4746 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 5927 4953 gene locus_tag LOCUS_13690 5927 4953 CDS product ParM/StbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391888.1 protein_id gnl|my_center|LOCUS_13690 6701 6141 gene locus_tag LOCUS_13700 6701 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 7669 7106 gene locus_tag LOCUS_13710 7669 7106 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546058.1 protein_id gnl|my_center|LOCUS_13710 8315 7749 gene locus_tag LOCUS_13720 8315 7749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 9602 8379 gene locus_tag LOCUS_13730 9602 8379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 11329 9677 gene locus_tag LOCUS_13740 11329 9677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 12090 11332 gene locus_tag LOCUS_13750 12090 11332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 14327 12204 gene locus_tag LOCUS_13760 14327 12204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 14772 14389 gene locus_tag LOCUS_13770 14772 14389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 15290 14769 gene locus_tag LOCUS_13780 15290 14769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 15534 15328 gene locus_tag LOCUS_13790 15534 15328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 15701 15549 gene locus_tag LOCUS_13800 15701 15549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 16589 15714 gene locus_tag LOCUS_13810 16589 15714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 17499 16603 gene locus_tag LOCUS_13820 17499 16603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 18836 17487 gene locus_tag LOCUS_13830 18836 17487 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_13830 20083 18833 gene locus_tag LOCUS_13840 20083 18833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 20856 20080 gene locus_tag LOCUS_13850 20856 20080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 21601 20858 gene locus_tag LOCUS_13860 21601 20858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 22383 21634 gene locus_tag LOCUS_13870 22383 21634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 22764 22384 gene locus_tag LOCUS_13880 22764 22384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 23257 22784 gene locus_tag LOCUS_13890 23257 22784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 25838 23310 gene locus_tag LOCUS_13900 25838 23310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 26497 25910 gene locus_tag LOCUS_13910 26497 25910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 27235 26675 gene locus_tag LOCUS_13920 27235 26675 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880077.1 protein_id gnl|my_center|LOCUS_13920 28175 27444 gene locus_tag LOCUS_13930 28175 27444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 30195 28894 gene locus_tag LOCUS_13940 30195 28894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 30504 30286 gene locus_tag LOCUS_13950 30504 30286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 32548 30818 gene locus_tag LOCUS_13960 32548 30818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 34682 32598 gene locus_tag LOCUS_13970 34682 32598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 35062 34679 gene locus_tag LOCUS_13980 35062 34679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 36930 35059 gene locus_tag LOCUS_13990 36930 35059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 37486 36917 gene locus_tag LOCUS_14000 37486 36917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 37973 37668 gene locus_tag LOCUS_14010 37973 37668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 38317 37973 gene locus_tag LOCUS_14020 38317 37973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 38708 38343 gene locus_tag LOCUS_14030 38708 38343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 38932 38726 gene locus_tag LOCUS_14040 38932 38726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 39658 39521 gene locus_tag LOCUS_14050 39658 39521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 39734 42850 gene locus_tag LOCUS_14060 39734 42850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 43047 42916 gene locus_tag LOCUS_14070 43047 42916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 43898 43038 gene locus_tag LOCUS_14080 gene xerA 43898 43038 CDS product tyrosine recombinase XerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249728.1 protein_id gnl|my_center|LOCUS_14080 44385 45047 gene locus_tag LOCUS_14090 44385 45047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 45824 45360 gene locus_tag LOCUS_14100 45824 45360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 46289 45897 gene locus_tag LOCUS_14110 46289 45897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14110 46985 46707 gene locus_tag LOCUS_14120 46985 46707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 48127 47186 gene locus_tag LOCUS_14130 48127 47186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 48562 48224 gene locus_tag LOCUS_14140 48562 48224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 48629 48814 gene locus_tag LOCUS_14150 48629 48814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 48726 49118 gene locus_tag LOCUS_14160 48726 49118 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393217.1 protein_id gnl|my_center|LOCUS_14160 49226 49693 gene locus_tag LOCUS_14170 49226 49693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 49718 50308 gene locus_tag LOCUS_14180 49718 50308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 >Feature sequence17 121 1086 gene locus_tag LOCUS_14190 121 1086 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454499.1 protein_id gnl|my_center|LOCUS_14190 1369 1031 gene locus_tag LOCUS_14200 1369 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 2328 1423 gene locus_tag LOCUS_14210 gene nadA 2328 1423 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583121.1 protein_id gnl|my_center|LOCUS_14210 3966 2590 gene locus_tag LOCUS_14220 3966 2590 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156272834.1 protein_id gnl|my_center|LOCUS_14220 5819 4542 gene locus_tag LOCUS_14230 5819 4542 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048213.1 protein_id gnl|my_center|LOCUS_14230 5991 6134 gene locus_tag LOCUS_14240 5991 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 6431 7789 gene locus_tag LOCUS_14250 gene trkA 6431 7789 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459869.1 protein_id gnl|my_center|LOCUS_14250 7939 9222 gene locus_tag LOCUS_14260 7939 9222 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_14260 9451 10809 gene locus_tag LOCUS_14270 9451 10809 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012843245.1 protein_id gnl|my_center|LOCUS_14270 13226 10698 gene locus_tag LOCUS_14280 13226 10698 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392112.1 protein_id gnl|my_center|LOCUS_14280 13879 13250 gene locus_tag LOCUS_14290 13879 13250 CDS product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392107.1 protein_id gnl|my_center|LOCUS_14290 14588 13911 gene locus_tag LOCUS_14300 14588 13911 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455123.1 protein_id gnl|my_center|LOCUS_14300 15303 16130 gene locus_tag LOCUS_14310 15303 16130 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_14310 16172 17275 gene locus_tag LOCUS_14320 gene mqnE 16172 17275 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393346.1 protein_id gnl|my_center|LOCUS_14320 17276 18115 gene locus_tag LOCUS_14330 17276 18115 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393345.1 protein_id gnl|my_center|LOCUS_14330 18118 19185 gene locus_tag LOCUS_14340 gene mqnC 18118 19185 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044953.1 protein_id gnl|my_center|LOCUS_14340 19587 19219 gene locus_tag LOCUS_14350 19587 19219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 19963 19574 gene locus_tag LOCUS_14360 19963 19574 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986456.1 protein_id gnl|my_center|LOCUS_14360 20854 20210 gene locus_tag LOCUS_14370 20854 20210 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392812.1 protein_id gnl|my_center|LOCUS_14370 21106 21399 gene locus_tag LOCUS_14380 21106 21399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 21608 22534 gene locus_tag LOCUS_14390 21608 22534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 22837 22655 gene locus_tag LOCUS_14400 22837 22655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 24081 23332 gene locus_tag LOCUS_14410 gene fetB 24081 23332 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392685.1 protein_id gnl|my_center|LOCUS_14410 24833 24078 gene locus_tag LOCUS_14420 24833 24078 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232774.1 protein_id gnl|my_center|LOCUS_14420 25128 24811 gene locus_tag LOCUS_14430 25128 24811 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389622.1 protein_id gnl|my_center|LOCUS_14430 25256 26248 gene locus_tag LOCUS_14440 25256 26248 CDS product potassium channel protein MjK1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869633.1 protein_id gnl|my_center|LOCUS_14440 26666 26241 gene locus_tag LOCUS_14450 26666 26241 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095222.1 protein_id gnl|my_center|LOCUS_14450 27110 26682 gene locus_tag LOCUS_14460 27110 26682 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021476.1 protein_id gnl|my_center|LOCUS_14460 27533 27144 gene locus_tag LOCUS_14470 27533 27144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 28066 27881 gene locus_tag LOCUS_14480 28066 27881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 28001 28225 gene locus_tag LOCUS_14490 28001 28225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 28586 28227 gene locus_tag LOCUS_14500 28586 28227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 29302 28730 gene locus_tag LOCUS_14510 29302 28730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 29534 30385 gene locus_tag LOCUS_14520 gene focA 29534 30385 CDS product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097310.1 protein_id gnl|my_center|LOCUS_14520 30407 30877 gene locus_tag LOCUS_14530 gene nuoE 30407 30877 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_14530 30874 32754 gene locus_tag LOCUS_14540 gene nuoF 30874 32754 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393387.1 protein_id gnl|my_center|LOCUS_14540 32663 35401 gene locus_tag LOCUS_14550 gene fdhF 32663 35401 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 transl_except (pos:33716..33718,aa:Sec) note codon on position 352 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_14550 35474 36985 gene locus_tag LOCUS_14560 gene thrC 35474 36985 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_14560 37631 36975 gene locus_tag LOCUS_14570 37631 36975 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105281.1 protein_id gnl|my_center|LOCUS_14570 38766 37684 gene locus_tag LOCUS_14580 gene ychF 38766 37684 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393954.1 protein_id gnl|my_center|LOCUS_14580 39171 38785 gene locus_tag LOCUS_14590 39171 38785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 39680 40507 gene locus_tag LOCUS_14600 39680 40507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 42664 40562 gene locus_tag LOCUS_14610 42664 40562 CDS product DUF3160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990923.1 protein_id gnl|my_center|LOCUS_14610 42918 43925 gene locus_tag LOCUS_14620 42918 43925 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811776.1 protein_id gnl|my_center|LOCUS_14620 43956 44870 gene locus_tag LOCUS_14630 43956 44870 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811777.1 protein_id gnl|my_center|LOCUS_14630 44854 45651 gene locus_tag LOCUS_14640 44854 45651 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_14640 47717 45699 gene locus_tag LOCUS_14650 47717 45699 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964331.1 protein_id gnl|my_center|LOCUS_14650 48619 47828 gene locus_tag LOCUS_14660 48619 47828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 >Feature sequence18 246 55 gene locus_tag LOCUS_14670 246 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 416 670 gene locus_tag LOCUS_14680 416 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 716 1258 gene locus_tag LOCUS_14690 716 1258 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_14690 2466 1285 gene locus_tag LOCUS_14700 2466 1285 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918814.1 protein_id gnl|my_center|LOCUS_14700 4856 2496 gene locus_tag LOCUS_14710 4856 2496 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018307275.1 protein_id gnl|my_center|LOCUS_14710 5571 4861 gene locus_tag LOCUS_14720 5571 4861 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879314.1 protein_id gnl|my_center|LOCUS_14720 5893 6327 gene locus_tag LOCUS_14730 5893 6327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 6634 6546 gene locus_tag LOCUS_t00260 6634 6546 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6983 6699 gene locus_tag LOCUS_14740 6983 6699 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355819.1 protein_id gnl|my_center|LOCUS_14740 7455 7000 gene locus_tag LOCUS_14750 7455 7000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 7751 7632 gene locus_tag LOCUS_14760 7751 7632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 7955 8818 gene locus_tag LOCUS_14770 7955 8818 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460068.1 protein_id gnl|my_center|LOCUS_14770 9364 9014 gene locus_tag LOCUS_14780 9364 9014 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146466.1 protein_id gnl|my_center|LOCUS_14780 10296 9415 gene locus_tag LOCUS_14790 10296 9415 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391630.1 protein_id gnl|my_center|LOCUS_14790 11585 10767 gene locus_tag LOCUS_14800 11585 10767 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937416.1 protein_id gnl|my_center|LOCUS_14800 12263 11598 gene locus_tag LOCUS_14810 12263 11598 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461612.1 protein_id gnl|my_center|LOCUS_14810 13160 12408 gene locus_tag LOCUS_14820 13160 12408 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823741.1 protein_id gnl|my_center|LOCUS_14820 15521 13878 gene locus_tag LOCUS_14830 15521 13878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 15791 17152 gene locus_tag LOCUS_14840 15791 17152 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205893.1 protein_id gnl|my_center|LOCUS_14840 17172 18518 gene locus_tag LOCUS_14850 gene gabT 17172 18518 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093009.1 protein_id gnl|my_center|LOCUS_14850 18615 20372 gene locus_tag LOCUS_14860 18615 20372 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392243.1 protein_id gnl|my_center|LOCUS_14860 20404 21129 gene locus_tag LOCUS_14870 gene atoD 20404 21129 CDS product acetate CoA-transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208097.1 protein_id gnl|my_center|LOCUS_14870 21096 21755 gene locus_tag LOCUS_14880 21096 21755 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525271.1 protein_id gnl|my_center|LOCUS_14880 21778 22974 gene locus_tag LOCUS_14890 21778 22974 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966157.1 protein_id gnl|my_center|LOCUS_14890 22977 24251 gene locus_tag LOCUS_14900 22977 24251 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436675.1 protein_id gnl|my_center|LOCUS_14900 24441 25295 gene locus_tag LOCUS_14910 gene ablB 24441 25295 CDS product putative beta-lysine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878594.1 protein_id gnl|my_center|LOCUS_14910 25645 26097 gene locus_tag LOCUS_14920 25645 26097 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_14920 29418 26101 gene locus_tag LOCUS_14930 29418 26101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 29591 29666 gene locus_tag LOCUS_t00270 29591 29666 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 30033 30845 gene locus_tag LOCUS_14940 gene cdaA 30033 30845 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_14940 31493 31957 gene locus_tag LOCUS_14950 31493 31957 CDS product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391746.1 protein_id gnl|my_center|LOCUS_14950 31970 33340 gene locus_tag LOCUS_14960 gene ypeB 31970 33340 CDS product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391745.1 protein_id gnl|my_center|LOCUS_14960 34457 34876 gene locus_tag LOCUS_14970 34457 34876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 34973 35167 gene locus_tag LOCUS_14980 34973 35167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 35692 35264 gene locus_tag LOCUS_14990 35692 35264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 35984 35784 gene locus_tag LOCUS_15000 35984 35784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 36162 37073 gene locus_tag LOCUS_15010 36162 37073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 37136 38137 gene locus_tag LOCUS_15020 37136 38137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 38686 38462 gene locus_tag LOCUS_15030 38686 38462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 40343 39522 gene locus_tag LOCUS_15040 40343 39522 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877333.1 protein_id gnl|my_center|LOCUS_15040 41226 40375 gene locus_tag LOCUS_15050 gene pstA 41226 40375 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877336.1 protein_id gnl|my_center|LOCUS_15050 42077 41223 gene locus_tag LOCUS_15060 gene pstC 42077 41223 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877335.1 protein_id gnl|my_center|LOCUS_15060 42451 42251 gene locus_tag LOCUS_15070 42451 42251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 43261 42545 gene locus_tag LOCUS_15080 43261 42545 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence19 126 371 gene locus_tag LOCUS_15090 126 371 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391797.1 protein_id gnl|my_center|LOCUS_15090 362 814 gene locus_tag LOCUS_15100 362 814 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391796.1 protein_id gnl|my_center|LOCUS_15100 945 1406 gene locus_tag LOCUS_15110 945 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1458 2549 gene locus_tag LOCUS_15120 1458 2549 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214669.1 protein_id gnl|my_center|LOCUS_15120 2552 5680 gene locus_tag LOCUS_15130 2552 5680 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_15130 6438 5677 gene locus_tag LOCUS_15140 6438 5677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 6601 7803 gene locus_tag LOCUS_15150 6601 7803 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525130.1 protein_id gnl|my_center|LOCUS_15150 7790 9346 gene locus_tag LOCUS_15160 gene murJ 7790 9346 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460880.1 protein_id gnl|my_center|LOCUS_15160 9372 10598 gene locus_tag LOCUS_15170 9372 10598 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048107.1 protein_id gnl|my_center|LOCUS_15170 10595 11740 gene locus_tag LOCUS_15180 10595 11740 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462207.1 protein_id gnl|my_center|LOCUS_15180 11737 12855 gene locus_tag LOCUS_15190 gene csaB 11737 12855 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391759.1 protein_id gnl|my_center|LOCUS_15190 12883 14193 gene locus_tag LOCUS_15200 12883 14193 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062390429.1 protein_id gnl|my_center|LOCUS_15200 14207 14938 gene locus_tag LOCUS_15210 14207 14938 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920693.1 protein_id gnl|my_center|LOCUS_15210 14973 17078 gene locus_tag LOCUS_15220 14973 17078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 17145 18494 gene locus_tag LOCUS_15230 17145 18494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 18773 19201 gene locus_tag LOCUS_15240 gene fabZ 18773 19201 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931959.1 protein_id gnl|my_center|LOCUS_15240 19386 20456 gene locus_tag LOCUS_15250 19386 20456 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391762.1 protein_id gnl|my_center|LOCUS_15250 20562 21431 gene locus_tag LOCUS_15260 gene galU 20562 21431 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048121.1 protein_id gnl|my_center|LOCUS_15260 21432 22352 gene locus_tag LOCUS_15270 21432 22352 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965631.1 protein_id gnl|my_center|LOCUS_15270 22739 23680 gene locus_tag LOCUS_15280 22739 23680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 24172 25596 gene locus_tag LOCUS_15290 24172 25596 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391765.1 protein_id gnl|my_center|LOCUS_15290 25709 27262 gene locus_tag LOCUS_15300 gene murJ 25709 27262 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391760.1 protein_id gnl|my_center|LOCUS_15300 27389 27655 gene locus_tag LOCUS_15310 27389 27655 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392374.1 protein_id gnl|my_center|LOCUS_15310 27746 28360 gene locus_tag LOCUS_15320 27746 28360 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024220.1 protein_id gnl|my_center|LOCUS_15320 28636 29457 gene locus_tag LOCUS_15330 28636 29457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 29577 30767 gene locus_tag LOCUS_15340 gene metK 29577 30767 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432462.1 protein_id gnl|my_center|LOCUS_15340 30837 32567 gene locus_tag LOCUS_15350 30837 32567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 32560 33300 gene locus_tag LOCUS_15360 32560 33300 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529448.1 protein_id gnl|my_center|LOCUS_15360 33541 34062 gene locus_tag LOCUS_15370 gene raiA 33541 34062 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773749.1 protein_id gnl|my_center|LOCUS_15370 34241 36922 gene locus_tag LOCUS_15380 gene secA 34241 36922 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_15380 37502 38509 gene locus_tag LOCUS_15390 gene prfB 37502 38509 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018379.1 protein_id gnl|my_center|LOCUS_15390 38673 39533 gene locus_tag LOCUS_15400 38673 39533 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391779.1 protein_id gnl|my_center|LOCUS_15400 39563 40378 gene locus_tag LOCUS_15410 39563 40378 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_15410 40391 41332 gene locus_tag LOCUS_15420 40391 41332 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462197.1 protein_id gnl|my_center|LOCUS_15420 41477 42163 gene locus_tag LOCUS_15430 gene ftsE 41477 42163 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815584.1 protein_id gnl|my_center|LOCUS_15430 42153 43046 gene locus_tag LOCUS_15440 gene ftsX 42153 43046 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198720.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence20 139 465 gene locus_tag LOCUS_15450 139 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 558 1700 gene locus_tag LOCUS_15460 558 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 1947 3284 gene locus_tag LOCUS_15470 gene acsC 1947 3284 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392715.1 protein_id gnl|my_center|LOCUS_15470 3761 5485 gene locus_tag LOCUS_15480 3761 5485 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811724.1 protein_id gnl|my_center|LOCUS_15480 5516 6460 gene locus_tag LOCUS_15490 gene cdhD 5516 6460 CDS product CO dehydrogenase/acetyl-CoA synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392712.1 protein_id gnl|my_center|LOCUS_15490 6511 7305 gene locus_tag LOCUS_15500 6511 7305 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392711.1 protein_id gnl|my_center|LOCUS_15500 7327 10311 gene locus_tag LOCUS_15510 7327 10311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 10311 10745 gene locus_tag LOCUS_15520 10311 10745 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392707.1 protein_id gnl|my_center|LOCUS_15520 10742 11410 gene locus_tag LOCUS_15530 10742 11410 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392706.1 protein_id gnl|my_center|LOCUS_15530 11407 12324 gene locus_tag LOCUS_15540 11407 12324 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392705.1 protein_id gnl|my_center|LOCUS_15540 13407 12349 gene locus_tag LOCUS_15550 gene gap 13407 12349 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_15550 13570 14295 gene locus_tag LOCUS_15560 13570 14295 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947991.1 protein_id gnl|my_center|LOCUS_15560 15481 14264 gene locus_tag LOCUS_15570 15481 14264 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808454.1 protein_id gnl|my_center|LOCUS_15570 15618 16400 gene locus_tag LOCUS_15580 15618 16400 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_15580 16863 16384 gene locus_tag LOCUS_15590 16863 16384 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398518.1 protein_id gnl|my_center|LOCUS_15590 16945 17226 gene locus_tag LOCUS_15600 16945 17226 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393381.1 protein_id gnl|my_center|LOCUS_15600 17342 18133 gene locus_tag LOCUS_15610 17342 18133 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392699.1 protein_id gnl|my_center|LOCUS_15610 18169 18906 gene locus_tag LOCUS_15620 18169 18906 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392698.1 protein_id gnl|my_center|LOCUS_15620 19050 19673 gene locus_tag LOCUS_15630 19050 19673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 19798 21903 gene locus_tag LOCUS_15640 19798 21903 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_15640 21914 22969 gene locus_tag LOCUS_15650 21914 22969 CDS product phosphotransacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259751.1 protein_id gnl|my_center|LOCUS_15650 23199 24677 gene locus_tag LOCUS_15660 gene spoIVA 23199 24677 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944577.1 protein_id gnl|my_center|LOCUS_15660 25316 25621 gene locus_tag LOCUS_15670 25316 25621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 25710 28355 gene locus_tag LOCUS_15680 25710 28355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 28345 30480 gene locus_tag LOCUS_15690 28345 30480 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_15690 30503 30931 gene locus_tag LOCUS_15700 gene dtd 30503 30931 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080996.1 protein_id gnl|my_center|LOCUS_15700 30947 31576 gene locus_tag LOCUS_15710 30947 31576 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460349.1 protein_id gnl|my_center|LOCUS_15710 31691 32947 gene locus_tag LOCUS_15720 gene hisS 31691 32947 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460333.1 protein_id gnl|my_center|LOCUS_15720 32975 34753 gene locus_tag LOCUS_15730 gene aspS 32975 34753 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393178.1 protein_id gnl|my_center|LOCUS_15730 35430 36572 gene locus_tag LOCUS_15740 gene nifS 35430 36572 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583089.1 protein_id gnl|my_center|LOCUS_15740 36685 36858 gene locus_tag LOCUS_15750 36685 36858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810836.1 protein_id gnl|my_center|LOCUS_15750 37623 36877 gene locus_tag LOCUS_15760 37623 36877 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583102.1 protein_id gnl|my_center|LOCUS_15760 38023 37625 gene locus_tag LOCUS_15770 38023 37625 CDS product NIL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939217.1 protein_id gnl|my_center|LOCUS_15770 39240 38029 gene locus_tag LOCUS_15780 39240 38029 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583100.1 protein_id gnl|my_center|LOCUS_15780 >Feature sequence21 80 1129 gene locus_tag LOCUS_15790 gene cobT 80 1129 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943639.1 protein_id gnl|my_center|LOCUS_15790 1132 1866 gene locus_tag LOCUS_15800 1132 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 2199 1879 gene locus_tag LOCUS_15810 2199 1879 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392756.1 protein_id gnl|my_center|LOCUS_15810 2924 2178 gene locus_tag LOCUS_15820 2924 2178 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392755.1 protein_id gnl|my_center|LOCUS_15820 3448 4335 gene locus_tag LOCUS_15830 gene ilvE 3448 4335 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_15830 4438 6096 gene locus_tag LOCUS_15840 gene ilvD 4438 6096 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_15840 6138 7793 gene locus_tag LOCUS_15850 6138 7793 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_15850 7807 8313 gene locus_tag LOCUS_15860 gene ilvN 7807 8313 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_15860 8318 9316 gene locus_tag LOCUS_15870 gene ilvC 8318 9316 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816729.1 protein_id gnl|my_center|LOCUS_15870 9318 10835 gene locus_tag LOCUS_15880 9318 10835 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393738.1 protein_id gnl|my_center|LOCUS_15880 10846 12108 gene locus_tag LOCUS_15890 gene leuC 10846 12108 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393737.1 protein_id gnl|my_center|LOCUS_15890 12109 12603 gene locus_tag LOCUS_15900 gene leuD 12109 12603 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_15900 12600 14216 gene locus_tag LOCUS_15910 gene cimA 12600 14216 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393734.1 protein_id gnl|my_center|LOCUS_15910 14350 15699 gene locus_tag LOCUS_15920 gene glmM 14350 15699 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461863.1 protein_id gnl|my_center|LOCUS_15920 16186 18018 gene locus_tag LOCUS_15930 gene glmS 16186 18018 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393728.1 protein_id gnl|my_center|LOCUS_15930 19603 18317 gene locus_tag LOCUS_15940 19603 18317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 19949 19740 gene locus_tag LOCUS_15950 19949 19740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 20232 19909 gene locus_tag LOCUS_15960 20232 19909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15960 20905 21807 gene locus_tag LOCUS_15970 20905 21807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15970 21773 22132 gene locus_tag LOCUS_15980 21773 22132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15980 23217 23381 gene locus_tag LOCUS_15990 23217 23381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 23398 26298 gene locus_tag LOCUS_16000 23398 26298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 26298 29117 gene locus_tag LOCUS_16010 26298 29117 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933392.1 protein_id gnl|my_center|LOCUS_16010 29180 29662 gene locus_tag LOCUS_16020 29180 29662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 30109 29705 gene locus_tag LOCUS_16030 30109 29705 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_16030 30393 30106 gene locus_tag LOCUS_16040 30393 30106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 30895 30659 gene locus_tag LOCUS_16050 30895 30659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 31027 31374 gene locus_tag LOCUS_16060 31027 31374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007001.1 protein_id gnl|my_center|LOCUS_16060 31352 31735 gene locus_tag LOCUS_16070 31352 31735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392187.1 protein_id gnl|my_center|LOCUS_16070 32646 32840 gene locus_tag LOCUS_16080 32646 32840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 32857 33735 gene locus_tag LOCUS_16090 32857 33735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812228.1 protein_id gnl|my_center|LOCUS_16090 34318 33899 gene locus_tag LOCUS_16100 34318 33899 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_16100 34565 34329 gene locus_tag LOCUS_16110 34565 34329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 >Feature sequence22 798 502 gene locus_tag LOCUS_16120 798 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 691 930 gene locus_tag LOCUS_16130 691 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 945 1424 gene locus_tag LOCUS_16140 945 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 1492 1890 gene locus_tag LOCUS_16150 1492 1890 CDS product TIGR02530 family flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941086.1 protein_id gnl|my_center|LOCUS_16150 1969 2862 gene locus_tag LOCUS_16160 1969 2862 CDS product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392300.1 protein_id gnl|my_center|LOCUS_16160 2912 3373 gene locus_tag LOCUS_16170 2912 3373 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881216.1 protein_id gnl|my_center|LOCUS_16170 3385 3765 gene locus_tag LOCUS_16180 gene fliN 3385 3765 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156273871.1 protein_id gnl|my_center|LOCUS_16180 3765 4139 gene locus_tag LOCUS_16190 3765 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 4159 4878 gene locus_tag LOCUS_16200 gene fliP 4159 4878 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359303.1 protein_id gnl|my_center|LOCUS_16200 5174 5443 gene locus_tag LOCUS_16210 gene fliQ 5174 5443 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816214.1 protein_id gnl|my_center|LOCUS_16210 5459 6229 gene locus_tag LOCUS_16220 gene fliR 5459 6229 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392309.1 protein_id gnl|my_center|LOCUS_16220 6229 7311 gene locus_tag LOCUS_16230 gene flhB 6229 7311 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392310.1 protein_id gnl|my_center|LOCUS_16230 7394 9472 gene locus_tag LOCUS_16240 gene flhA 7394 9472 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392311.1 protein_id gnl|my_center|LOCUS_16240 9462 10823 gene locus_tag LOCUS_16250 gene flhF 9462 10823 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460748.1 protein_id gnl|my_center|LOCUS_16250 10804 11685 gene locus_tag LOCUS_16260 10804 11685 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392313.1 protein_id gnl|my_center|LOCUS_16260 11696 12373 gene locus_tag LOCUS_16270 11696 12373 CDS product flagellar brake domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986947.1 protein_id gnl|my_center|LOCUS_16270 12361 13137 gene locus_tag LOCUS_16280 12361 13137 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392315.1 protein_id gnl|my_center|LOCUS_16280 13134 13586 gene locus_tag LOCUS_16290 13134 13586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 13662 14414 gene locus_tag LOCUS_16300 gene flgF 13662 14414 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943677.1 protein_id gnl|my_center|LOCUS_16300 14430 15191 gene locus_tag LOCUS_16310 14430 15191 CDS product flagellar hook-basal body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392319.1 protein_id gnl|my_center|LOCUS_16310 15201 15713 gene locus_tag LOCUS_16320 15201 15713 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541375.1 protein_id gnl|my_center|LOCUS_16320 15714 16505 gene locus_tag LOCUS_16330 15714 16505 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392322.1 protein_id gnl|my_center|LOCUS_16330 16516 17127 gene locus_tag LOCUS_16340 16516 17127 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774235.1 protein_id gnl|my_center|LOCUS_16340 17159 17530 gene locus_tag LOCUS_16350 gene cheY 17159 17530 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244957.1 protein_id gnl|my_center|LOCUS_16350 17546 18553 gene locus_tag LOCUS_16360 gene fliM 17546 18553 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392325.1 protein_id gnl|my_center|LOCUS_16360 18546 19679 gene locus_tag LOCUS_16370 gene fliY 18546 19679 CDS product flagellar motor switch phosphatase FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231962.1 protein_id gnl|my_center|LOCUS_16370 19971 21002 gene locus_tag LOCUS_16380 19971 21002 CDS product bis-aminopropyl spermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064426.1 protein_id gnl|my_center|LOCUS_16380 21764 21195 gene locus_tag LOCUS_16390 21764 21195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459317.1 protein_id gnl|my_center|LOCUS_16390 21953 24193 gene locus_tag LOCUS_16400 21953 24193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 24362 26728 gene locus_tag LOCUS_16410 24362 26728 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392767.1 protein_id gnl|my_center|LOCUS_16410 27478 27110 gene locus_tag LOCUS_16420 27478 27110 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_16420 27830 28045 gene locus_tag LOCUS_16430 27830 28045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945230.1 protein_id gnl|my_center|LOCUS_16430 28980 28354 gene locus_tag LOCUS_16440 28980 28354 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890562.1 protein_id gnl|my_center|LOCUS_16440 29237 28929 gene locus_tag LOCUS_16450 29237 28929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 29696 30058 gene locus_tag LOCUS_16460 29696 30058 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081150.1 protein_id gnl|my_center|LOCUS_16460 30266 31396 gene locus_tag LOCUS_16470 30266 31396 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_16470 31542 31919 gene locus_tag LOCUS_16480 31542 31919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 >Feature sequence23 408 776 gene locus_tag LOCUS_16490 408 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 782 2602 gene locus_tag LOCUS_16500 782 2602 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392283.1 protein_id gnl|my_center|LOCUS_16500 2710 3078 gene locus_tag LOCUS_16510 2710 3078 CDS product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392285.1 protein_id gnl|my_center|LOCUS_16510 3098 4627 gene locus_tag LOCUS_16520 gene fliD 3098 4627 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460770.1 protein_id gnl|my_center|LOCUS_16520 5036 5419 gene locus_tag LOCUS_16530 gene fliS 5036 5419 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243747.1 protein_id gnl|my_center|LOCUS_16530 5742 6113 gene locus_tag LOCUS_16540 5742 6113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 6569 6177 gene locus_tag LOCUS_16550 6569 6177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 7735 6854 gene locus_tag LOCUS_16560 gene flgL 7735 6854 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 protein_id gnl|my_center|LOCUS_16560 9313 7934 gene locus_tag LOCUS_16570 gene flgK 9313 7934 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392267.1 protein_id gnl|my_center|LOCUS_16570 9983 9495 gene locus_tag LOCUS_16580 9983 9495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 10307 10017 gene locus_tag LOCUS_16590 10307 10017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 11428 10370 gene locus_tag LOCUS_16600 11428 10370 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870053.1 protein_id gnl|my_center|LOCUS_16600 13517 11418 gene locus_tag LOCUS_16610 13517 11418 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392263.1 protein_id gnl|my_center|LOCUS_16610 14125 13631 gene locus_tag LOCUS_16620 14125 13631 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392262.1 protein_id gnl|my_center|LOCUS_16620 14369 16030 gene locus_tag LOCUS_16630 14369 16030 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391777.1 protein_id gnl|my_center|LOCUS_16630 16142 16945 gene locus_tag LOCUS_16640 16142 16945 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460801.1 protein_id gnl|my_center|LOCUS_16640 16932 17717 gene locus_tag LOCUS_16650 16932 17717 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391996.1 protein_id gnl|my_center|LOCUS_16650 17774 17848 gene locus_tag LOCUS_t00280 17774 17848 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 18119 17982 gene locus_tag LOCUS_16660 18119 17982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 18249 18097 gene locus_tag LOCUS_16670 18249 18097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 20981 18882 gene locus_tag LOCUS_16680 20981 18882 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392263.1 protein_id gnl|my_center|LOCUS_16680 21360 20995 gene locus_tag LOCUS_16690 gene cheY 21360 20995 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244957.1 protein_id gnl|my_center|LOCUS_16690 21866 21393 gene locus_tag LOCUS_16700 21866 21393 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937609.1 protein_id gnl|my_center|LOCUS_16700 22577 22158 gene locus_tag LOCUS_16710 22577 22158 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392262.1 protein_id gnl|my_center|LOCUS_16710 24297 22630 gene locus_tag LOCUS_16720 gene tlpC 24297 22630 CDS product methyl-accepting chemotaxis protein TlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246498.1 protein_id gnl|my_center|LOCUS_16720 24586 24365 gene locus_tag LOCUS_16730 24586 24365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 25541 25227 gene locus_tag LOCUS_16740 25541 25227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 26493 25564 gene locus_tag LOCUS_16750 26493 25564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 26796 26524 gene locus_tag LOCUS_16760 26796 26524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 29227 26786 gene locus_tag LOCUS_16770 29227 26786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 29600 29214 gene locus_tag LOCUS_16780 29600 29214 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757478.1 protein_id gnl|my_center|LOCUS_16780 30441 29611 gene locus_tag LOCUS_16790 30441 29611 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002908.1 protein_id gnl|my_center|LOCUS_16790 31029 30460 gene locus_tag LOCUS_16800 31029 30460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 32126 31053 gene locus_tag LOCUS_16810 gene cheB 32126 31053 CDS product chemotaxis-specific protein-glutamate methyltransferase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390076.1 protein_id gnl|my_center|LOCUS_16810 >Feature sequence24 <1 1969 gene locus_tag LOCUS_16820 <1 1969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927078.1:DUF559 domain-containing protein 1969 4701 gene locus_tag LOCUS_16830 1969 4701 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933392.1 protein_id gnl|my_center|LOCUS_16830 5170 5604 gene locus_tag LOCUS_16840 5170 5604 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081070.1 protein_id gnl|my_center|LOCUS_16840 5950 5726 gene locus_tag LOCUS_16850 5950 5726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 6080 5901 gene locus_tag LOCUS_16860 6080 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 7080 6112 gene locus_tag LOCUS_16870 7080 6112 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546038.1 protein_id gnl|my_center|LOCUS_16870 7253 7714 gene locus_tag LOCUS_16880 7253 7714 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869814.1 protein_id gnl|my_center|LOCUS_16880 8153 7722 gene locus_tag LOCUS_16890 8153 7722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 9099 8173 gene locus_tag LOCUS_16900 9099 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 10299 9388 gene locus_tag LOCUS_16910 10299 9388 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_16910 10743 11714 gene locus_tag LOCUS_16920 10743 11714 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462207.1 protein_id gnl|my_center|LOCUS_16920 12570 11761 gene locus_tag LOCUS_16930 12570 11761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 12909 13961 gene locus_tag LOCUS_16940 12909 13961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 14180 14815 gene locus_tag LOCUS_16950 14180 14815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 15292 16509 gene locus_tag LOCUS_16960 15292 16509 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503245.1 protein_id gnl|my_center|LOCUS_16960 16706 16954 gene locus_tag LOCUS_16970 16706 16954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 18587 16935 gene locus_tag LOCUS_16980 18587 16935 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838626.1 protein_id gnl|my_center|LOCUS_16980 19197 18739 gene locus_tag LOCUS_16990 19197 18739 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963997.1 protein_id gnl|my_center|LOCUS_16990 19771 19451 gene locus_tag LOCUS_17000 19771 19451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 19927 20793 gene locus_tag LOCUS_17010 gene dat 19927 20793 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233305.1 protein_id gnl|my_center|LOCUS_17010 20860 21018 gene locus_tag LOCUS_17020 20860 21018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 21067 21309 gene locus_tag LOCUS_17030 21067 21309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 21758 22441 gene locus_tag LOCUS_17040 21758 22441 CDS product DUF2225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393240.1 protein_id gnl|my_center|LOCUS_17040 23634 22438 gene locus_tag LOCUS_17050 gene lnrN 23634 22438 CDS product linearmycin resistance permease LnrN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243650.1 protein_id gnl|my_center|LOCUS_17050 25096 23822 gene locus_tag LOCUS_17060 gene lnrM 25096 23822 CDS product linearmycin resistance permease LnrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242483.1 protein_id gnl|my_center|LOCUS_17060 26054 25101 gene locus_tag LOCUS_17070 26054 25101 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963494.1 protein_id gnl|my_center|LOCUS_17070 27129 26059 gene locus_tag LOCUS_17080 27129 26059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 27936 27277 gene locus_tag LOCUS_17090 27936 27277 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705044.1 protein_id gnl|my_center|LOCUS_17090 29179 27971 gene locus_tag LOCUS_17100 29179 27971 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948977.1 protein_id gnl|my_center|LOCUS_17100 29457 29933 gene locus_tag LOCUS_17110 29457 29933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 30029 30361 gene locus_tag LOCUS_17120 30029 30361 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355771.1 protein_id gnl|my_center|LOCUS_17120 30446 32008 gene locus_tag LOCUS_17130 30446 32008 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272339.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence25 568 882 gene locus_tag LOCUS_17140 568 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 885 1013 gene locus_tag LOCUS_17150 885 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 1153 1455 gene locus_tag LOCUS_17160 1153 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 1439 1849 gene locus_tag LOCUS_17170 1439 1849 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259070.1 protein_id gnl|my_center|LOCUS_17170 1915 2784 gene locus_tag LOCUS_17180 1915 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 2906 9130 gene locus_tag LOCUS_17190 2906 9130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 9291 9698 gene locus_tag LOCUS_17200 9291 9698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 9711 10256 gene locus_tag LOCUS_17210 9711 10256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 10288 11298 gene locus_tag LOCUS_17220 10288 11298 CDS product ParM/StbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391888.1 protein_id gnl|my_center|LOCUS_17220 11573 11821 gene locus_tag LOCUS_17230 11573 11821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393080.1 protein_id gnl|my_center|LOCUS_17230 11818 12462 gene locus_tag LOCUS_17240 11818 12462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 12769 13149 gene locus_tag LOCUS_17250 12769 13149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 13155 14402 gene locus_tag LOCUS_17260 13155 14402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 14940 16622 gene locus_tag LOCUS_17270 14940 16622 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965270.1 protein_id gnl|my_center|LOCUS_17270 16650 16997 gene locus_tag LOCUS_17280 16650 16997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 17026 17352 gene locus_tag LOCUS_17290 17026 17352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 17407 18252 gene locus_tag LOCUS_17300 17407 18252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 18259 18558 gene locus_tag LOCUS_17310 18259 18558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 18558 19226 gene locus_tag LOCUS_17320 18558 19226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 19250 21088 gene locus_tag LOCUS_17330 19250 21088 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484404.1 protein_id gnl|my_center|LOCUS_17330 21088 22026 gene locus_tag LOCUS_17340 21088 22026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 22055 23224 gene locus_tag LOCUS_17350 22055 23224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276639.1 protein_id gnl|my_center|LOCUS_17350 23593 23913 gene locus_tag LOCUS_17360 23593 23913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 23985 24167 gene locus_tag LOCUS_17370 23985 24167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 24222 25334 gene locus_tag LOCUS_17380 24222 25334 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675870.1 protein_id gnl|my_center|LOCUS_17380 27000 26587 gene locus_tag LOCUS_17390 27000 26587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 27222 27091 gene locus_tag LOCUS_17400 27222 27091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 27903 27475 gene locus_tag LOCUS_17410 27903 27475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 28742 28482 gene locus_tag LOCUS_17420 28742 28482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17420 29423 28746 gene locus_tag LOCUS_17430 29423 28746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17430 29721 29891 gene locus_tag LOCUS_17440 29721 29891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 >Feature sequence26 1571 105 gene locus_tag LOCUS_17450 gene lysS 1571 105 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_17450 2094 1600 gene locus_tag LOCUS_17460 gene greA 2094 1600 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809765.1 protein_id gnl|my_center|LOCUS_17460 2263 2072 gene locus_tag LOCUS_17470 2263 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 3390 2323 gene locus_tag LOCUS_17480 3390 2323 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391697.1 protein_id gnl|my_center|LOCUS_17480 4497 3538 gene locus_tag LOCUS_17490 gene dusB 4497 3538 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_17490 4865 4698 gene locus_tag LOCUS_17500 4865 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 5710 4931 gene locus_tag LOCUS_17510 5710 4931 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_17510 6904 5933 gene locus_tag LOCUS_17520 6904 5933 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768282.1 protein_id gnl|my_center|LOCUS_17520 7778 6948 gene locus_tag LOCUS_17530 gene nadC 7778 6948 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_17530 9370 7781 gene locus_tag LOCUS_17540 gene nadB 9370 7781 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545397.1 protein_id gnl|my_center|LOCUS_17540 10295 9384 gene locus_tag LOCUS_17550 gene nadA 10295 9384 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020997.1 protein_id gnl|my_center|LOCUS_17550 10703 10464 gene locus_tag LOCUS_17560 10703 10464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 11277 10918 gene locus_tag LOCUS_17570 11277 10918 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167581.1 protein_id gnl|my_center|LOCUS_17570 12138 11278 gene locus_tag LOCUS_17580 gene panC 12138 11278 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_17580 13033 12188 gene locus_tag LOCUS_17590 gene panB 13033 12188 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_17590 13926 13033 gene locus_tag LOCUS_17600 13926 13033 CDS product Rossmann-like and DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391687.1 protein_id gnl|my_center|LOCUS_17600 14171 13977 gene locus_tag LOCUS_17610 14171 13977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 15174 14359 gene locus_tag LOCUS_17620 15174 14359 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393437.1 protein_id gnl|my_center|LOCUS_17620 16230 15274 gene locus_tag LOCUS_17630 16230 15274 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860937.1 protein_id gnl|my_center|LOCUS_17630 17096 16224 gene locus_tag LOCUS_17640 17096 16224 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436928.1 protein_id gnl|my_center|LOCUS_17640 18662 17205 gene locus_tag LOCUS_17650 gene gcvPB 18662 17205 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460674.1 protein_id gnl|my_center|LOCUS_17650 20002 18659 gene locus_tag LOCUS_17660 gene gcvPA 20002 18659 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393441.1 protein_id gnl|my_center|LOCUS_17660 20398 20003 gene locus_tag LOCUS_17670 gene gcvH 20398 20003 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393442.1 protein_id gnl|my_center|LOCUS_17670 21519 20416 gene locus_tag LOCUS_17680 gene gcvT 21519 20416 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_17680 22946 21552 gene locus_tag LOCUS_17690 gene lpdA 22946 21552 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809814.1 protein_id gnl|my_center|LOCUS_17690 24606 23218 gene locus_tag LOCUS_17700 24606 23218 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974991.1 protein_id gnl|my_center|LOCUS_17700 25783 25025 gene locus_tag LOCUS_17710 gene cobB 25783 25025 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240270.1 protein_id gnl|my_center|LOCUS_17710 26525 25920 gene locus_tag LOCUS_17720 26525 25920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 26918 27595 gene locus_tag LOCUS_17730 26918 27595 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460066.1 protein_id gnl|my_center|LOCUS_17730 27621 28004 gene locus_tag LOCUS_17740 27621 28004 CDS product DUF4363 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812777.1 protein_id gnl|my_center|LOCUS_17740 28900 28445 gene locus_tag LOCUS_17750 28900 28445 CDS product DUF188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460027.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence27 126 201 gene locus_tag LOCUS_t00290 126 201 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 605 432 gene locus_tag LOCUS_17760 605 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 621 980 gene locus_tag LOCUS_17770 621 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 1077 1916 gene locus_tag LOCUS_17780 1077 1916 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890830.1 protein_id gnl|my_center|LOCUS_17780 3909 1918 gene locus_tag LOCUS_17790 3909 1918 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272796.1 protein_id gnl|my_center|LOCUS_17790 4563 4138 gene locus_tag LOCUS_17800 4563 4138 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880818.1 protein_id gnl|my_center|LOCUS_17800 4882 5430 gene locus_tag LOCUS_17810 4882 5430 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391683.1 protein_id gnl|my_center|LOCUS_17810 5518 6183 gene locus_tag LOCUS_17820 5518 6183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 6379 6846 gene locus_tag LOCUS_17830 6379 6846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 6862 7173 gene locus_tag LOCUS_17840 6862 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 7311 7625 gene locus_tag LOCUS_17850 7311 7625 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637521.1 protein_id gnl|my_center|LOCUS_17850 7909 7709 gene locus_tag LOCUS_17860 7909 7709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 8299 8150 gene locus_tag LOCUS_17870 8299 8150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 8417 9814 gene locus_tag LOCUS_17880 gene rlmD 8417 9814 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105059.1 protein_id gnl|my_center|LOCUS_17880 9933 11180 gene locus_tag LOCUS_17890 9933 11180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 11510 11983 gene locus_tag LOCUS_17900 gene ctsR 11510 11983 CDS product transcriptional regulator CtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244563.1 protein_id gnl|my_center|LOCUS_17900 11989 12504 gene locus_tag LOCUS_17910 11989 12504 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391707.1 protein_id gnl|my_center|LOCUS_17910 12506 13582 gene locus_tag LOCUS_17920 12506 13582 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391708.1 protein_id gnl|my_center|LOCUS_17920 13597 16026 gene locus_tag LOCUS_17930 13597 16026 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391709.1 protein_id gnl|my_center|LOCUS_17930 16339 17586 gene locus_tag LOCUS_17940 gene radA 16339 17586 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085202.1 protein_id gnl|my_center|LOCUS_17940 17601 18677 gene locus_tag LOCUS_17950 gene disA 17601 18677 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393302.1 protein_id gnl|my_center|LOCUS_17950 18772 19251 gene locus_tag LOCUS_17960 18772 19251 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_17960 19356 20474 gene locus_tag LOCUS_17970 19356 20474 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393965.1 protein_id gnl|my_center|LOCUS_17970 20464 21657 gene locus_tag LOCUS_17980 gene ispD 20464 21657 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546162.1 protein_id gnl|my_center|LOCUS_17980 21714 22388 gene locus_tag LOCUS_17990 gene cysE 21714 22388 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069591551.1 protein_id gnl|my_center|LOCUS_17990 22375 23814 gene locus_tag LOCUS_18000 gene cysS 22375 23814 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393961.1 protein_id gnl|my_center|LOCUS_18000 23926 24675 gene locus_tag LOCUS_18010 gene thyX 23926 24675 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546288.1 protein_id gnl|my_center|LOCUS_18010 24792 25559 gene locus_tag LOCUS_18020 gene rlmB 24792 25559 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393958.1 protein_id gnl|my_center|LOCUS_18020 25525 26034 gene locus_tag LOCUS_18030 25525 26034 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393957.1 protein_id gnl|my_center|LOCUS_18030 26136 26783 gene locus_tag LOCUS_18040 gene sigH 26136 26783 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393956.1 protein_id gnl|my_center|LOCUS_18040 26962 27036 gene locus_tag LOCUS_t00300 26962 27036 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 27418 27299 gene locus_tag LOCUS_18050 27418 27299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 >Feature sequence28 419 1993 gene locus_tag LOCUS_18060 419 1993 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392701.1 protein_id gnl|my_center|LOCUS_18060 1983 2822 gene locus_tag LOCUS_18070 gene pgeF 1983 2822 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_18070 2911 4257 gene locus_tag LOCUS_18080 2911 4257 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393971.1 protein_id gnl|my_center|LOCUS_18080 4388 5146 gene locus_tag LOCUS_18090 gene pstB 4388 5146 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391662.1 protein_id gnl|my_center|LOCUS_18090 5232 5888 gene locus_tag LOCUS_18100 gene phoU 5232 5888 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_18100 6079 6777 gene locus_tag LOCUS_18110 6079 6777 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_18110 6778 7224 gene locus_tag LOCUS_18120 6778 7224 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213920.1 protein_id gnl|my_center|LOCUS_18120 7229 8053 gene locus_tag LOCUS_18130 gene proC 7229 8053 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_18130 8057 8323 gene locus_tag LOCUS_18140 8057 8323 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392380.1 protein_id gnl|my_center|LOCUS_18140 8351 8662 gene locus_tag LOCUS_18150 gene yggU 8351 8662 CDS product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215612.1 protein_id gnl|my_center|LOCUS_18150 8967 11759 gene locus_tag LOCUS_18160 gene ileS 8967 11759 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_18160 12347 11805 gene locus_tag LOCUS_18170 12347 11805 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964415.1 protein_id gnl|my_center|LOCUS_18170 13053 12448 gene locus_tag LOCUS_18180 gene coaE 13053 12448 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393338.1 protein_id gnl|my_center|LOCUS_18180 13697 13074 gene locus_tag LOCUS_18190 gene ytaF 13697 13074 CDS product sporulation membrane protein YtaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281740.1 protein_id gnl|my_center|LOCUS_18190 14596 13760 gene locus_tag LOCUS_18200 gene mutM 14596 13760 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355756.1 protein_id gnl|my_center|LOCUS_18200 17198 14607 gene locus_tag LOCUS_18210 gene polA 17198 14607 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393341.1 protein_id gnl|my_center|LOCUS_18210 17422 18708 gene locus_tag LOCUS_18220 17422 18708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 18836 19438 gene locus_tag LOCUS_18230 18836 19438 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007140.1 protein_id gnl|my_center|LOCUS_18230 19535 19954 gene locus_tag LOCUS_18240 19535 19954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 20040 20531 gene locus_tag LOCUS_18250 20040 20531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 21330 20578 gene locus_tag LOCUS_18260 21330 20578 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812013.1 protein_id gnl|my_center|LOCUS_18260 21474 22592 gene locus_tag LOCUS_18270 21474 22592 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_18270 22654 22728 gene locus_tag LOCUS_t00310 22654 22728 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 23204 24043 gene locus_tag LOCUS_18280 gene ytxC 23204 24043 CDS product putative sporulation protein YtxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393262.1 protein_id gnl|my_center|LOCUS_18280 24124 24726 gene locus_tag LOCUS_18290 24124 24726 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439009.1 protein_id gnl|my_center|LOCUS_18290 25080 26990 gene locus_tag LOCUS_18300 gene thrS 25080 26990 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393260.1 protein_id gnl|my_center|LOCUS_18300 >Feature sequence29 90 1925 gene locus_tag LOCUS_18310 gene uvrC 90 1925 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_18310 2000 2791 gene locus_tag LOCUS_18320 2000 2791 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391801.1 protein_id gnl|my_center|LOCUS_18320 2804 3778 gene locus_tag LOCUS_18330 2804 3778 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532940.1 protein_id gnl|my_center|LOCUS_18330 3926 5920 gene locus_tag LOCUS_18340 3926 5920 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064995.1 protein_id gnl|my_center|LOCUS_18340 5956 7020 gene locus_tag LOCUS_18350 5956 7020 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392147.1 protein_id gnl|my_center|LOCUS_18350 7282 8142 gene locus_tag LOCUS_18360 gene rapZ 7282 8142 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391802.1 protein_id gnl|my_center|LOCUS_18360 8274 9239 gene locus_tag LOCUS_18370 gene whiA 8274 9239 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462177.1 protein_id gnl|my_center|LOCUS_18370 9249 9446 gene locus_tag LOCUS_18380 9249 9446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 9578 10609 gene locus_tag LOCUS_18390 gene gap 9578 10609 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_18390 10672 11853 gene locus_tag LOCUS_18400 10672 11853 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272149.1 protein_id gnl|my_center|LOCUS_18400 12041 12811 gene locus_tag LOCUS_18410 gene tpiA 12041 12811 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259656.1 protein_id gnl|my_center|LOCUS_18410 12808 14346 gene locus_tag LOCUS_18420 gene gpmI 12808 14346 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541097.1 protein_id gnl|my_center|LOCUS_18420 14397 15680 gene locus_tag LOCUS_18430 gene eno 14397 15680 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_18430 15790 16017 gene locus_tag LOCUS_18440 gene secG 15790 16017 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936141.1 protein_id gnl|my_center|LOCUS_18440 16150 18147 gene locus_tag LOCUS_18450 16150 18147 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943902.1 protein_id gnl|my_center|LOCUS_18450 18306 18686 gene locus_tag LOCUS_18460 18306 18686 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392925.1 protein_id gnl|my_center|LOCUS_18460 18689 19066 gene locus_tag LOCUS_18470 18689 19066 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392924.1 protein_id gnl|my_center|LOCUS_18470 19130 19993 gene locus_tag LOCUS_18480 19130 19993 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_18480 19965 20807 gene locus_tag LOCUS_18490 19965 20807 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_18490 20864 21337 gene locus_tag LOCUS_18500 20864 21337 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648186.1 protein_id gnl|my_center|LOCUS_18500 21363 21917 gene locus_tag LOCUS_18510 21363 21917 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768286.1 protein_id gnl|my_center|LOCUS_18510 22101 24248 gene locus_tag LOCUS_18520 gene rnr 22101 24248 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964034.1 protein_id gnl|my_center|LOCUS_18520 24399 25082 gene locus_tag LOCUS_18530 24399 25082 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460218.1 protein_id gnl|my_center|LOCUS_18530 25224 25433 gene locus_tag LOCUS_18540 25224 25433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 25467 25712 gene locus_tag LOCUS_18550 25467 25712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 25748 26176 gene locus_tag LOCUS_18560 25748 26176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 26255 26746 gene locus_tag LOCUS_18570 26255 26746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 >Feature sequence30 95 295 gene locus_tag LOCUS_18580 gene rpmE 95 295 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_18580 363 1241 gene locus_tag LOCUS_18590 363 1241 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393875.1 protein_id gnl|my_center|LOCUS_18590 1234 2304 gene locus_tag LOCUS_18600 gene prfA 1234 2304 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_18600 2488 3345 gene locus_tag LOCUS_18610 gene prmC 2488 3345 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393873.1 protein_id gnl|my_center|LOCUS_18610 3379 4659 gene locus_tag LOCUS_18620 3379 4659 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986138.1 protein_id gnl|my_center|LOCUS_18620 4767 5810 gene locus_tag LOCUS_18630 4767 5810 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393872.1 protein_id gnl|my_center|LOCUS_18630 5988 6530 gene locus_tag LOCUS_18640 5988 6530 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945496.1 protein_id gnl|my_center|LOCUS_18640 6664 7149 gene locus_tag LOCUS_18650 6664 7149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 7201 7656 gene locus_tag LOCUS_18660 gene rpiB 7201 7656 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952859.1 protein_id gnl|my_center|LOCUS_18660 7659 8903 gene locus_tag LOCUS_18670 7659 8903 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583175.1 protein_id gnl|my_center|LOCUS_18670 8934 10079 gene locus_tag LOCUS_18680 gene wecB 8934 10079 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393864.1 protein_id gnl|my_center|LOCUS_18680 10506 10736 gene locus_tag LOCUS_18690 10506 10736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 10756 11202 gene locus_tag LOCUS_18700 10756 11202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 11224 11991 gene locus_tag LOCUS_18710 gene atpB 11224 11991 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462234.1 protein_id gnl|my_center|LOCUS_18710 12077 12310 gene locus_tag LOCUS_18720 12077 12310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 12450 12935 gene locus_tag LOCUS_18730 gene atpF 12450 12935 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393859.1 protein_id gnl|my_center|LOCUS_18730 12932 13480 gene locus_tag LOCUS_18740 12932 13480 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815471.1 protein_id gnl|my_center|LOCUS_18740 13496 15019 gene locus_tag LOCUS_18750 gene atpA 13496 15019 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_18750 15039 15917 gene locus_tag LOCUS_18760 gene atpG 15039 15917 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272788.1 protein_id gnl|my_center|LOCUS_18760 15944 17362 gene locus_tag LOCUS_18770 gene atpD 15944 17362 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_18770 17378 17785 gene locus_tag LOCUS_18780 17378 17785 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227688.1 protein_id gnl|my_center|LOCUS_18780 18166 19134 gene locus_tag LOCUS_18790 gene spoIID 18166 19134 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393851.1 protein_id gnl|my_center|LOCUS_18790 19222 19473 gene locus_tag LOCUS_18800 gene spoIIID 19222 19473 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393849.1 protein_id gnl|my_center|LOCUS_18800 19658 20692 gene locus_tag LOCUS_18810 19658 20692 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393848.1 protein_id gnl|my_center|LOCUS_18810 20736 21281 gene locus_tag LOCUS_18820 20736 21281 CDS product pyruvate kinase alpha/beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393991.1 protein_id gnl|my_center|LOCUS_18820 21503 21318 gene locus_tag LOCUS_18830 21503 21318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 21865 21500 gene locus_tag LOCUS_18840 21865 21500 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081150.1 protein_id gnl|my_center|LOCUS_18840 22042 26220 gene locus_tag LOCUS_18850 22042 26220 CDS product S-layer homology domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393841.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence31 1478 183 gene locus_tag LOCUS_18860 1478 183 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_18860 2152 1475 gene locus_tag LOCUS_18870 2152 1475 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460450.1 protein_id gnl|my_center|LOCUS_18870 3634 2384 gene locus_tag LOCUS_18880 3634 2384 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345604.1 protein_id gnl|my_center|LOCUS_18880 4677 3637 gene locus_tag LOCUS_18890 gene mtnA 4677 3637 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460451.1 protein_id gnl|my_center|LOCUS_18890 5480 4683 gene locus_tag LOCUS_18900 gene mtnP 5480 4683 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392226.1 protein_id gnl|my_center|LOCUS_18900 6836 5916 gene locus_tag LOCUS_18910 gene ftsY 6836 5916 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249530.1 protein_id gnl|my_center|LOCUS_18910 7545 6850 gene locus_tag LOCUS_18920 gene rnc 7545 6850 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460498.1 protein_id gnl|my_center|LOCUS_18920 8795 7548 gene locus_tag LOCUS_18930 gene fabF 8795 7548 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_18930 9075 8842 gene locus_tag LOCUS_18940 gene acpP 9075 8842 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771263.1 protein_id gnl|my_center|LOCUS_18940 9840 9097 gene locus_tag LOCUS_18950 gene fabG 9840 9097 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 protein_id gnl|my_center|LOCUS_18950 10786 9842 gene locus_tag LOCUS_18960 gene fabD 10786 9842 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392463.1 protein_id gnl|my_center|LOCUS_18960 11736 10777 gene locus_tag LOCUS_18970 gene fabK 11736 10777 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460502.1 protein_id gnl|my_center|LOCUS_18970 12777 11779 gene locus_tag LOCUS_18980 12777 11779 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_18980 13775 12777 gene locus_tag LOCUS_18990 gene plsX 13775 12777 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_18990 14057 13881 gene locus_tag LOCUS_19000 gene rpmF 14057 13881 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813398.1 protein_id gnl|my_center|LOCUS_19000 14577 14059 gene locus_tag LOCUS_19010 14577 14059 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094714.1 protein_id gnl|my_center|LOCUS_19010 14704 15885 gene locus_tag LOCUS_19020 gene ylbJ 14704 15885 CDS product sporulation integral membrane protein YlbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392455.1 protein_id gnl|my_center|LOCUS_19020 16317 15868 gene locus_tag LOCUS_19030 16317 15868 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460509.1 protein_id gnl|my_center|LOCUS_19030 16835 16332 gene locus_tag LOCUS_19040 gene coaD 16835 16332 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583503.1 protein_id gnl|my_center|LOCUS_19040 17403 16840 gene locus_tag LOCUS_19050 gene rsmD 17403 16840 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017073.1 protein_id gnl|my_center|LOCUS_19050 17582 18526 gene locus_tag LOCUS_19060 gene gpr 17582 18526 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460511.1 protein_id gnl|my_center|LOCUS_19060 18881 18618 gene locus_tag LOCUS_19070 18881 18618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 21118 19049 gene locus_tag LOCUS_19080 gene recG 21118 19049 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392440.1 protein_id gnl|my_center|LOCUS_19080 21329 23491 gene locus_tag LOCUS_19090 21329 23491 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393243.1 protein_id gnl|my_center|LOCUS_19090 23503 24546 gene locus_tag LOCUS_19100 23503 24546 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393244.1 protein_id gnl|my_center|LOCUS_19100 >Feature sequence32 326 790 gene locus_tag LOCUS_19110 gene infC 326 790 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498574.1 protein_id gnl|my_center|LOCUS_19110 794 991 gene locus_tag LOCUS_19120 gene rpmI 794 991 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808207.1 protein_id gnl|my_center|LOCUS_19120 1019 1378 gene locus_tag LOCUS_19130 gene rplT 1019 1378 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393257.1 protein_id gnl|my_center|LOCUS_19130 1513 2865 gene locus_tag LOCUS_19140 1513 2865 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062283476.1 protein_id gnl|my_center|LOCUS_19140 2875 3522 gene locus_tag LOCUS_19150 2875 3522 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773049.1 protein_id gnl|my_center|LOCUS_19150 3525 4337 gene locus_tag LOCUS_19160 3525 4337 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256575.1 protein_id gnl|my_center|LOCUS_19160 4673 5695 gene locus_tag LOCUS_19170 gene pheS 4673 5695 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_19170 5740 8142 gene locus_tag LOCUS_19180 gene pheT 5740 8142 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_19180 8139 8405 gene locus_tag LOCUS_19190 8139 8405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 8475 9425 gene locus_tag LOCUS_19200 8475 9425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584075.1 protein_id gnl|my_center|LOCUS_19200 9503 12037 gene locus_tag LOCUS_19210 9503 12037 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458989.1 protein_id gnl|my_center|LOCUS_19210 12038 14383 gene locus_tag LOCUS_19220 12038 14383 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542519.1 protein_id gnl|my_center|LOCUS_19220 14397 15236 gene locus_tag LOCUS_19230 14397 15236 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877350.1 protein_id gnl|my_center|LOCUS_19230 15251 16006 gene locus_tag LOCUS_19240 15251 16006 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938321.1 protein_id gnl|my_center|LOCUS_19240 16027 17193 gene locus_tag LOCUS_19250 16027 17193 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938320.1 protein_id gnl|my_center|LOCUS_19250 19707 17311 gene locus_tag LOCUS_19260 19707 17311 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393212.1 protein_id gnl|my_center|LOCUS_19260 19850 21067 gene locus_tag LOCUS_19270 gene tyrS 19850 21067 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_19270 21682 22365 gene locus_tag LOCUS_19280 gene yunB 21682 22365 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418439.1 protein_id gnl|my_center|LOCUS_19280 >Feature sequence33 75 362 gene locus_tag LOCUS_19290 75 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 1078 1950 gene locus_tag LOCUS_19300 1078 1950 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 protein_id gnl|my_center|LOCUS_19300 2228 2854 gene locus_tag LOCUS_19310 2228 2854 CDS product fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070757.1 protein_id gnl|my_center|LOCUS_19310 2854 4698 gene locus_tag LOCUS_19320 2854 4698 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940520.1 protein_id gnl|my_center|LOCUS_19320 4691 5419 gene locus_tag LOCUS_19330 4691 5419 CDS product fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940521.1 protein_id gnl|my_center|LOCUS_19330 6268 5528 gene locus_tag LOCUS_19340 gene murI 6268 5528 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099300.1 protein_id gnl|my_center|LOCUS_19340 7000 6482 gene locus_tag LOCUS_19350 7000 6482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 7792 7295 gene locus_tag LOCUS_19360 7792 7295 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582742.1 protein_id gnl|my_center|LOCUS_19360 7923 8384 gene locus_tag LOCUS_19370 7923 8384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 8402 8560 gene locus_tag LOCUS_19380 8402 8560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 8966 8622 gene locus_tag LOCUS_19390 8966 8622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 9268 9828 gene locus_tag LOCUS_19400 9268 9828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 11146 9860 gene locus_tag LOCUS_19410 11146 9860 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392450.1 protein_id gnl|my_center|LOCUS_19410 11764 11171 gene locus_tag LOCUS_19420 11764 11171 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392451.1 protein_id gnl|my_center|LOCUS_19420 13569 11761 gene locus_tag LOCUS_19430 gene iorA 13569 11761 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392452.1 protein_id gnl|my_center|LOCUS_19430 13843 14619 gene locus_tag LOCUS_19440 13843 14619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 14699 15112 gene locus_tag LOCUS_19450 14699 15112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 16869 15178 gene locus_tag LOCUS_19460 16869 15178 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810509.1 protein_id gnl|my_center|LOCUS_19460 17276 17037 gene locus_tag LOCUS_19470 17276 17037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 18406 17396 gene locus_tag LOCUS_19480 18406 17396 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380282.1 protein_id gnl|my_center|LOCUS_19480 19066 18422 gene locus_tag LOCUS_19490 19066 18422 CDS product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231442.1 protein_id gnl|my_center|LOCUS_19490 19235 19639 gene locus_tag LOCUS_19500 19235 19639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 19639 20685 gene locus_tag LOCUS_19510 19639 20685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 >Feature sequence34 38 739 gene locus_tag LOCUS_19520 38 739 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272841.1 protein_id gnl|my_center|LOCUS_19520 2613 736 gene locus_tag LOCUS_19530 2613 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 3260 3126 gene locus_tag LOCUS_19540 3260 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 3916 3293 gene locus_tag LOCUS_19550 3916 3293 CDS product accessory gene regulator B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393086.1 protein_id gnl|my_center|LOCUS_19550 4090 4419 gene locus_tag LOCUS_19560 4090 4419 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785422.1 protein_id gnl|my_center|LOCUS_19560 4433 4960 gene locus_tag LOCUS_19570 4433 4960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 5367 8729 gene locus_tag LOCUS_19580 5367 8729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 8944 9615 gene locus_tag LOCUS_19590 8944 9615 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_19590 9805 11214 gene locus_tag LOCUS_19600 gene amrA 9805 11214 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393778.1 protein_id gnl|my_center|LOCUS_19600 11457 12479 gene locus_tag LOCUS_19610 gene amrS 11457 12479 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393777.1 protein_id gnl|my_center|LOCUS_19610 12694 13734 gene locus_tag LOCUS_19620 gene argC 12694 13734 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_19620 13751 14953 gene locus_tag LOCUS_19630 gene argJ 13751 14953 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_19630 15571 16461 gene locus_tag LOCUS_19640 gene argB 15571 16461 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_19640 16484 17692 gene locus_tag LOCUS_19650 16484 17692 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_19650 17696 18616 gene locus_tag LOCUS_19660 gene argF 17696 18616 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868438.1 protein_id gnl|my_center|LOCUS_19660 18791 19987 gene locus_tag LOCUS_19670 18791 19987 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_19670 >Feature sequence35 2299 374 gene locus_tag LOCUS_19680 2299 374 CDS product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201786535.1 protein_id gnl|my_center|LOCUS_19680 4577 2559 gene locus_tag LOCUS_19690 4577 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 4985 4710 gene locus_tag LOCUS_19700 4985 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 5268 5005 gene locus_tag LOCUS_19710 5268 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 5967 5284 gene locus_tag LOCUS_19720 5967 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 6227 5982 gene locus_tag LOCUS_19730 6227 5982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 7955 6483 gene locus_tag LOCUS_19740 7955 6483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 9876 7945 gene locus_tag LOCUS_19750 9876 7945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 11437 9821 gene locus_tag LOCUS_19760 11437 9821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 13151 12063 gene locus_tag LOCUS_19770 13151 12063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 14106 13222 gene locus_tag LOCUS_19780 14106 13222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 14479 14162 gene locus_tag LOCUS_19790 14479 14162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 16438 15287 gene locus_tag LOCUS_19800 16438 15287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 16937 16815 gene locus_tag LOCUS_19810 16937 16815 CDS product cyclic lactone autoinducer peptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170066312.1 protein_id gnl|my_center|LOCUS_19810 17579 16956 gene locus_tag LOCUS_19820 17579 16956 CDS product accessory gene regulator B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393122.1 protein_id gnl|my_center|LOCUS_19820 18298 17576 gene locus_tag LOCUS_19830 18298 17576 CDS product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393124.1 protein_id gnl|my_center|LOCUS_19830 18899 18405 gene locus_tag LOCUS_19840 18899 18405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393125.1 protein_id gnl|my_center|LOCUS_19840 >Feature sequence36 1104 451 gene locus_tag LOCUS_19850 gene ribB 1104 451 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070545.1 protein_id gnl|my_center|LOCUS_19850 2184 3104 gene locus_tag LOCUS_19860 2184 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391696.1 protein_id gnl|my_center|LOCUS_19860 4049 3108 gene locus_tag LOCUS_19870 4049 3108 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768278.1 protein_id gnl|my_center|LOCUS_19870 4186 4716 gene locus_tag LOCUS_19880 4186 4716 CDS product GerMN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392053.1 protein_id gnl|my_center|LOCUS_19880 4862 7411 gene locus_tag LOCUS_19890 4862 7411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 7623 8603 gene locus_tag LOCUS_19900 7623 8603 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460939.1 protein_id gnl|my_center|LOCUS_19900 8628 9389 gene locus_tag LOCUS_19910 8628 9389 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989617.1 protein_id gnl|my_center|LOCUS_19910 9429 10178 gene locus_tag LOCUS_19920 gene rph 9429 10178 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392056.1 protein_id gnl|my_center|LOCUS_19920 10181 10780 gene locus_tag LOCUS_19930 10181 10780 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_19930 10857 10930 gene locus_tag LOCUS_t00320 10857 10930 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 10941 11017 gene locus_tag LOCUS_t00330 10941 11017 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11240 12124 gene locus_tag LOCUS_19940 11240 12124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 12367 12732 gene locus_tag LOCUS_19950 12367 12732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 13423 13085 gene locus_tag LOCUS_19960 13423 13085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 13696 13929 gene locus_tag LOCUS_19970 13696 13929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 14874 13975 gene locus_tag LOCUS_19980 14874 13975 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023177.1 protein_id gnl|my_center|LOCUS_19980 15212 17269 gene locus_tag LOCUS_19990 15212 17269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 17895 17266 gene locus_tag LOCUS_20000 17895 17266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 >Feature sequence37 112 420 gene locus_tag LOCUS_20010 gene rpsJ 112 420 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810163.1 protein_id gnl|my_center|LOCUS_20010 446 1075 gene locus_tag LOCUS_20020 gene rplC 446 1075 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393937.1 protein_id gnl|my_center|LOCUS_20020 1092 1739 gene locus_tag LOCUS_20030 gene rplD 1092 1739 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393936.1 protein_id gnl|my_center|LOCUS_20030 1714 2001 gene locus_tag LOCUS_20040 gene rplW 1714 2001 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393935.1 protein_id gnl|my_center|LOCUS_20040 2020 2847 gene locus_tag LOCUS_20050 gene rplB 2020 2847 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459099.1 protein_id gnl|my_center|LOCUS_20050 2863 3147 gene locus_tag LOCUS_20060 gene rpsS 2863 3147 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393933.1 protein_id gnl|my_center|LOCUS_20060 3160 3501 gene locus_tag LOCUS_20070 gene rplV 3160 3501 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810154.1 protein_id gnl|my_center|LOCUS_20070 3505 4164 gene locus_tag LOCUS_20080 gene rpsC 3505 4164 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393931.1 protein_id gnl|my_center|LOCUS_20080 4167 4598 gene locus_tag LOCUS_20090 gene rplP 4167 4598 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829782.1 protein_id gnl|my_center|LOCUS_20090 4588 4791 gene locus_tag LOCUS_20100 gene rpmC 4588 4791 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393929.1 protein_id gnl|my_center|LOCUS_20100 4804 5061 gene locus_tag LOCUS_20110 gene rpsQ 4804 5061 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_20110 5075 5443 gene locus_tag LOCUS_20120 gene rplN 5075 5443 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459101.1 protein_id gnl|my_center|LOCUS_20120 5482 5799 gene locus_tag LOCUS_20130 gene rplX 5482 5799 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187422288.1 protein_id gnl|my_center|LOCUS_20130 5856 6398 gene locus_tag LOCUS_20140 gene rplE 5856 6398 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393925.1 protein_id gnl|my_center|LOCUS_20140 6412 6597 gene locus_tag LOCUS_20150 6412 6597 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583358.1 protein_id gnl|my_center|LOCUS_20150 6614 7009 gene locus_tag LOCUS_20160 gene rpsH 6614 7009 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036371522.1 protein_id gnl|my_center|LOCUS_20160 7031 7573 gene locus_tag LOCUS_20170 gene rplF 7031 7573 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393922.1 protein_id gnl|my_center|LOCUS_20170 7592 7960 gene locus_tag LOCUS_20180 gene rplR 7592 7960 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_20180 7978 8490 gene locus_tag LOCUS_20190 gene rpsE 7978 8490 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_20190 8494 8673 gene locus_tag LOCUS_20200 gene rpmD 8494 8673 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258249.1 protein_id gnl|my_center|LOCUS_20200 8686 9129 gene locus_tag LOCUS_20210 gene rplO 8686 9129 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357513.1 protein_id gnl|my_center|LOCUS_20210 9130 10395 gene locus_tag LOCUS_20220 gene secY 9130 10395 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_20220 10410 11156 gene locus_tag LOCUS_20230 gene map 10410 11156 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393915.1 protein_id gnl|my_center|LOCUS_20230 11171 11452 gene locus_tag LOCUS_20240 11171 11452 CDS product KOW domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869906.1 protein_id gnl|my_center|LOCUS_20240 11449 11664 gene locus_tag LOCUS_20250 gene infA 11449 11664 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393913.1 protein_id gnl|my_center|LOCUS_20250 11816 12187 gene locus_tag LOCUS_20260 gene rpsM 11816 12187 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_20260 12200 12586 gene locus_tag LOCUS_20270 gene rpsK 12200 12586 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810114.1 protein_id gnl|my_center|LOCUS_20270 12598 13224 gene locus_tag LOCUS_20280 gene rpsD 12598 13224 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_20280 13253 14200 gene locus_tag LOCUS_20290 13253 14200 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_20290 14251 14589 gene locus_tag LOCUS_20300 gene rplQ 14251 14589 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357477.1 protein_id gnl|my_center|LOCUS_20300 14602 15345 gene locus_tag LOCUS_20310 gene truA 14602 15345 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393903.1 protein_id gnl|my_center|LOCUS_20310 15447 15899 gene locus_tag LOCUS_20320 gene smpB 15447 15899 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391819.1 protein_id gnl|my_center|LOCUS_20320 15926 16285 gene locus_tag LOCUS_tm00010 15926 16285 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 16634 16810 gene locus_tag LOCUS_20330 16634 16810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 >Feature sequence38 208 861 gene locus_tag LOCUS_20340 208 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20340 1006 1090 gene locus_tag LOCUS_t00340 1006 1090 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1349 1669 gene locus_tag LOCUS_20350 1349 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 1919 2548 gene locus_tag LOCUS_20360 1919 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 2800 2600 gene locus_tag LOCUS_20370 2800 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 4402 2927 gene locus_tag LOCUS_20380 4402 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 4676 4434 gene locus_tag LOCUS_20390 4676 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 4588 6309 gene locus_tag LOCUS_20400 4588 6309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 6401 7342 gene locus_tag LOCUS_20410 6401 7342 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392654.1 protein_id gnl|my_center|LOCUS_20410 7382 8029 gene locus_tag LOCUS_20420 gene deoC 7382 8029 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289206.1 protein_id gnl|my_center|LOCUS_20420 8175 9308 gene locus_tag LOCUS_20430 8175 9308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 9508 10068 gene locus_tag LOCUS_20440 gene folE 9508 10068 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014794265.1 protein_id gnl|my_center|LOCUS_20440 10088 10267 gene locus_tag LOCUS_20450 10088 10267 CDS product YpmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459899.1 protein_id gnl|my_center|LOCUS_20450 10285 11046 gene locus_tag LOCUS_20460 gene surE 10285 11046 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392658.1 protein_id gnl|my_center|LOCUS_20460 12609 11053 gene locus_tag LOCUS_20470 gene spoVB 12609 11053 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812078.1 protein_id gnl|my_center|LOCUS_20470 12807 14828 gene locus_tag LOCUS_20480 gene fusA 12807 14828 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_20480 15483 15408 gene locus_tag LOCUS_t00350 15483 15408 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence39 133 218 gene locus_tag LOCUS_t00360 133 218 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 349 1362 gene locus_tag LOCUS_20490 gene xerD 349 1362 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071230.1 protein_id gnl|my_center|LOCUS_20490 2404 1319 gene locus_tag LOCUS_20500 gene xerC 2404 1319 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002079116.1 protein_id gnl|my_center|LOCUS_20500 2692 2435 gene locus_tag LOCUS_20510 2692 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 3261 2785 gene locus_tag LOCUS_20520 3261 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 4032 3595 gene locus_tag LOCUS_20530 4032 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 5658 4057 gene locus_tag LOCUS_20540 5658 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 6832 6662 gene locus_tag LOCUS_20550 6832 6662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 7155 6985 gene locus_tag LOCUS_20560 7155 6985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 10041 7330 gene locus_tag LOCUS_20570 10041 7330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 10704 10132 gene locus_tag LOCUS_20580 10704 10132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 11396 10917 gene locus_tag LOCUS_20590 11396 10917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 11963 12613 gene locus_tag LOCUS_20600 11963 12613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 12756 12595 gene locus_tag LOCUS_20610 12756 12595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 >Feature sequence40 920 417 gene locus_tag LOCUS_20620 920 417 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459789.1 protein_id gnl|my_center|LOCUS_20620 2589 1018 gene locus_tag LOCUS_20630 2589 1018 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811612.1 protein_id gnl|my_center|LOCUS_20630 3559 2636 gene locus_tag LOCUS_20640 3559 2636 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811615.1 protein_id gnl|my_center|LOCUS_20640 3974 3579 gene locus_tag LOCUS_20650 3974 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 5198 5611 gene locus_tag LOCUS_20660 5198 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 6076 5840 gene locus_tag LOCUS_20670 6076 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 6216 7256 gene locus_tag LOCUS_20680 6216 7256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 7962 7360 gene locus_tag LOCUS_20690 7962 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 8182 7931 gene locus_tag LOCUS_20700 8182 7931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 8335 9543 gene locus_tag LOCUS_20710 8335 9543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 9798 9607 gene locus_tag LOCUS_20720 9798 9607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 10896 10114 gene locus_tag LOCUS_20730 10896 10114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074291.1 protein_id gnl|my_center|LOCUS_20730 12786 11515 gene locus_tag LOCUS_20740 12786 11515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 >Feature sequence41 471 52 gene locus_tag LOCUS_20750 471 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 1192 491 gene locus_tag LOCUS_20760 1192 491 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584037.1 protein_id gnl|my_center|LOCUS_20760 1363 2103 gene locus_tag LOCUS_20770 1363 2103 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810311.1 protein_id gnl|my_center|LOCUS_20770 2198 3505 gene locus_tag LOCUS_20780 2198 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 4459 4731 gene locus_tag LOCUS_20790 4459 4731 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356943.1 protein_id gnl|my_center|LOCUS_20790 4762 5562 gene locus_tag LOCUS_20800 4762 5562 CDS product FeoB small GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392919.1 protein_id gnl|my_center|LOCUS_20800 5537 6940 gene locus_tag LOCUS_20810 5537 6940 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392918.1 protein_id gnl|my_center|LOCUS_20810 7432 6968 gene locus_tag LOCUS_20820 7432 6968 CDS product iron dependent repressor, metal binding and dimerization domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460462.1 protein_id gnl|my_center|LOCUS_20820 7568 8299 gene locus_tag LOCUS_20830 7568 8299 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545667.1 protein_id gnl|my_center|LOCUS_20830 8436 10049 gene locus_tag LOCUS_20840 8436 10049 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861896.1 protein_id gnl|my_center|LOCUS_20840 10225 10425 gene locus_tag LOCUS_20850 10225 10425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 11221 10442 gene locus_tag LOCUS_20860 11221 10442 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 protein_id gnl|my_center|LOCUS_20860 11953 11264 gene locus_tag LOCUS_20870 11953 11264 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393101.1 protein_id gnl|my_center|LOCUS_20870 12255 12422 gene locus_tag LOCUS_20880 12255 12422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 >Feature sequence42 592 1611 gene locus_tag LOCUS_20890 gene aroF 592 1611 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460211.1 protein_id gnl|my_center|LOCUS_20890 1626 2747 gene locus_tag LOCUS_20900 1626 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 2869 3762 gene locus_tag LOCUS_20910 2869 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 4401 3883 gene locus_tag LOCUS_20920 4401 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 4760 4548 gene locus_tag LOCUS_20930 4760 4548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 5802 6752 gene locus_tag LOCUS_20940 5802 6752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 6739 7899 gene locus_tag LOCUS_20950 6739 7899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 7892 8131 gene locus_tag LOCUS_20960 7892 8131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 8195 10192 gene locus_tag LOCUS_20970 8195 10192 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392996.1 protein_id gnl|my_center|LOCUS_20970 10185 10619 gene locus_tag LOCUS_20980 10185 10619 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392262.1 protein_id gnl|my_center|LOCUS_20980 10893 11120 gene locus_tag LOCUS_20990 10893 11120 CDS product DUF1659 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393294.1 protein_id gnl|my_center|LOCUS_20990 11181 11405 gene locus_tag LOCUS_21000 11181 11405 CDS product DUF2922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437662.1 protein_id gnl|my_center|LOCUS_21000 >Feature sequence43 117 1247 gene locus_tag LOCUS_21010 117 1247 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_21010 1365 2504 gene locus_tag LOCUS_21020 1365 2504 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391791.1 protein_id gnl|my_center|LOCUS_21020 2515 3738 gene locus_tag LOCUS_21030 2515 3738 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963822.1 protein_id gnl|my_center|LOCUS_21030 3861 4049 gene locus_tag LOCUS_21040 3861 4049 CDS product CooT family nickel-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943365.1 protein_id gnl|my_center|LOCUS_21040 4255 4899 gene locus_tag LOCUS_21050 4255 4899 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947937.1 protein_id gnl|my_center|LOCUS_21050 4964 5131 gene locus_tag LOCUS_21060 4964 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 5674 5363 gene locus_tag LOCUS_21070 5674 5363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 5779 7032 gene locus_tag LOCUS_21080 5779 7032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 7134 9167 gene locus_tag LOCUS_21090 gene uvrB 7134 9167 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_21090 9225 12065 gene locus_tag LOCUS_21100 gene uvrA 9225 12065 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_21100 >Feature sequence44 37 219 gene locus_tag LOCUS_21110 37 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 918 190 gene locus_tag LOCUS_21120 918 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 1325 903 gene locus_tag LOCUS_21130 1325 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 2044 1526 gene locus_tag LOCUS_21140 2044 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 2456 2034 gene locus_tag LOCUS_21150 2456 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 2787 2545 gene locus_tag LOCUS_21160 2787 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 3652 2807 gene locus_tag LOCUS_21170 3652 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 4585 3656 gene locus_tag LOCUS_21180 4585 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 5891 4560 gene locus_tag LOCUS_21190 5891 4560 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921386.1 protein_id gnl|my_center|LOCUS_21190 6657 5836 gene locus_tag LOCUS_21200 6657 5836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 7353 6670 gene locus_tag LOCUS_21210 7353 6670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 7782 7450 gene locus_tag LOCUS_21220 7782 7450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 8033 7836 gene locus_tag LOCUS_21230 8033 7836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 9412 9053 gene locus_tag LOCUS_21240 9412 9053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 10368 9427 gene locus_tag LOCUS_21250 10368 9427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 10752 10471 gene locus_tag LOCUS_21260 10752 10471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 10937 11254 gene locus_tag LOCUS_21270 10937 11254 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391827.1 protein_id gnl|my_center|LOCUS_21270 11309 11524 gene locus_tag LOCUS_21280 11309 11524 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392020.1 protein_id gnl|my_center|LOCUS_21280 11521 11757 gene locus_tag LOCUS_21290 11521 11757 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392021.1 protein_id gnl|my_center|LOCUS_21290 11998 11813 gene locus_tag LOCUS_21300 11998 11813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 >Feature sequence45 493 170 gene locus_tag LOCUS_21310 gene trxA 493 170 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759608.1 protein_id gnl|my_center|LOCUS_21310 1626 859 gene locus_tag LOCUS_21320 1626 859 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393327.1 protein_id gnl|my_center|LOCUS_21320 3416 1713 gene locus_tag LOCUS_21330 3416 1713 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_21330 4516 3482 gene locus_tag LOCUS_21340 gene mltG 4516 3482 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 protein_id gnl|my_center|LOCUS_21340 5329 4598 gene locus_tag LOCUS_21350 5329 4598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 6842 5406 gene locus_tag LOCUS_21360 6842 5406 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896350.1 protein_id gnl|my_center|LOCUS_21360 7116 6856 gene locus_tag LOCUS_21370 7116 6856 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810865.1 protein_id gnl|my_center|LOCUS_21370 7585 7172 gene locus_tag LOCUS_21380 gene ruvX 7585 7172 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964987.1 protein_id gnl|my_center|LOCUS_21380 8534 7587 gene locus_tag LOCUS_21390 8534 7587 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393143.1 protein_id gnl|my_center|LOCUS_21390 8858 8586 gene locus_tag LOCUS_21400 8858 8586 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964986.1 protein_id gnl|my_center|LOCUS_21400 11594 8952 gene locus_tag LOCUS_21410 gene alaS 11594 8952 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_21410 >Feature sequence46 109 3528 gene locus_tag LOCUS_21420 109 3528 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065207.1 protein_id gnl|my_center|LOCUS_21420 3534 5234 gene locus_tag LOCUS_21430 3534 5234 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051765.1 protein_id gnl|my_center|LOCUS_21430 5266 8139 gene locus_tag LOCUS_21440 5266 8139 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020506622.1 protein_id gnl|my_center|LOCUS_21440 8170 11124 gene locus_tag LOCUS_21450 8170 11124 CDS product DUF499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148590534.1 protein_id gnl|my_center|LOCUS_21450 >Feature sequence47 180 608 gene locus_tag LOCUS_21460 gene rplM 180 608 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393902.1 protein_id gnl|my_center|LOCUS_21460 625 1017 gene locus_tag LOCUS_21470 gene rpsI 625 1017 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393901.1 protein_id gnl|my_center|LOCUS_21470 1093 1884 gene locus_tag LOCUS_21480 1093 1884 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069591230.1 protein_id gnl|my_center|LOCUS_21480 2020 2310 gene locus_tag LOCUS_21490 2020 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 4082 2307 gene locus_tag LOCUS_21500 4082 2307 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768290.1 protein_id gnl|my_center|LOCUS_21500 5004 4159 gene locus_tag LOCUS_21510 5004 4159 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393282.1 protein_id gnl|my_center|LOCUS_21510 5168 5908 gene locus_tag LOCUS_21520 5168 5908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 6119 6802 gene locus_tag LOCUS_21530 6119 6802 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392339.1 protein_id gnl|my_center|LOCUS_21530 7337 6837 gene locus_tag LOCUS_21540 7337 6837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 7610 7738 gene locus_tag LOCUS_21550 7610 7738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 8358 7750 gene locus_tag LOCUS_21560 8358 7750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 8940 9818 gene locus_tag LOCUS_21570 8940 9818 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545230.1 protein_id gnl|my_center|LOCUS_21570 9966 10664 gene locus_tag LOCUS_21580 9966 10664 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546597.1 protein_id gnl|my_center|LOCUS_21580 10774 11406 gene locus_tag LOCUS_21590 10774 11406 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392686.1 protein_id gnl|my_center|LOCUS_21590 >Feature sequence48 1571 252 gene locus_tag LOCUS_21600 1571 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 1762 1601 gene locus_tag LOCUS_21610 1762 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 2747 1791 gene locus_tag LOCUS_21620 2747 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 4325 2925 gene locus_tag LOCUS_21630 4325 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 5395 5598 gene locus_tag LOCUS_21640 5395 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21640 5671 6423 gene locus_tag LOCUS_21650 5671 6423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 6404 8545 gene locus_tag LOCUS_21660 6404 8545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 8545 9927 gene locus_tag LOCUS_21670 8545 9927 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_21670 >Feature sequence49 1260 217 gene locus_tag LOCUS_21680 1260 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 1874 1260 gene locus_tag LOCUS_21690 1874 1260 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393839.1 protein_id gnl|my_center|LOCUS_21690 2278 2517 gene locus_tag LOCUS_21700 2278 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 2492 2938 gene locus_tag LOCUS_21710 2492 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 3322 3008 gene locus_tag LOCUS_21720 3322 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 3592 3323 gene locus_tag LOCUS_21730 3592 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 4299 3928 gene locus_tag LOCUS_21740 4299 3928 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808288.1 protein_id gnl|my_center|LOCUS_21740 4538 4296 gene locus_tag LOCUS_21750 4538 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 5550 7685 gene locus_tag LOCUS_21760 5550 7685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 7852 8091 gene locus_tag LOCUS_21770 7852 8091 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021610.1 protein_id gnl|my_center|LOCUS_21770 8085 8324 gene locus_tag LOCUS_21780 8085 8324 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228303.1 protein_id gnl|my_center|LOCUS_21780 8658 9761 gene locus_tag LOCUS_21790 8658 9761 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276205.1 protein_id gnl|my_center|LOCUS_21790 >Feature sequence50 270 536 gene locus_tag LOCUS_21800 270 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 536 958 gene locus_tag LOCUS_21810 536 958 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393269.1 protein_id gnl|my_center|LOCUS_21810 1063 2292 gene locus_tag LOCUS_21820 gene pseC 1063 2292 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869432.1 protein_id gnl|my_center|LOCUS_21820 2676 3086 gene locus_tag LOCUS_21830 gene flgB 2676 3086 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392289.1 protein_id gnl|my_center|LOCUS_21830 3087 3509 gene locus_tag LOCUS_21840 gene flgC 3087 3509 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_21840 3529 3702 gene locus_tag LOCUS_21850 3529 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 3753 4052 gene locus_tag LOCUS_21860 gene fliE 3753 4052 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986961.1 protein_id gnl|my_center|LOCUS_21860 4068 5624 gene locus_tag LOCUS_21870 gene fliF 4068 5624 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392292.1 protein_id gnl|my_center|LOCUS_21870 5628 6644 gene locus_tag LOCUS_21880 gene fliG 5628 6644 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392293.1 protein_id gnl|my_center|LOCUS_21880 6637 7314 gene locus_tag LOCUS_21890 6637 7314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 7475 8803 gene locus_tag LOCUS_21900 gene fliI 7475 8803 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392295.1 protein_id gnl|my_center|LOCUS_21900 8807 9241 gene locus_tag LOCUS_21910 8807 9241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 >Feature sequence51 664 62 gene locus_tag LOCUS_21920 664 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 1010 1387 gene locus_tag LOCUS_21930 1010 1387 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392689.1 protein_id gnl|my_center|LOCUS_21930 1384 2082 gene locus_tag LOCUS_21940 1384 2082 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392688.1 protein_id gnl|my_center|LOCUS_21940 2079 2834 gene locus_tag LOCUS_21950 2079 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 3195 2902 gene locus_tag LOCUS_21960 3195 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 4014 3334 gene locus_tag LOCUS_21970 4014 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 5624 4083 gene locus_tag LOCUS_21980 5624 4083 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583223.1 protein_id gnl|my_center|LOCUS_21980 5799 6659 gene locus_tag LOCUS_21990 5799 6659 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060947.1 protein_id gnl|my_center|LOCUS_21990 6739 7197 gene locus_tag LOCUS_22000 6739 7197 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869814.1 protein_id gnl|my_center|LOCUS_22000 7218 8057 gene locus_tag LOCUS_22010 gene speE 7218 8057 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393316.1 protein_id gnl|my_center|LOCUS_22010 8061 8969 gene locus_tag LOCUS_22020 gene speB 8061 8969 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393315.1 protein_id gnl|my_center|LOCUS_22020 9009 9087 gene locus_tag LOCUS_t00370 9009 9087 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence52 434 186 gene locus_tag LOCUS_22030 434 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 632 1069 gene locus_tag LOCUS_22040 632 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 1542 1345 gene locus_tag LOCUS_22050 1542 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 2224 1535 gene locus_tag LOCUS_22060 2224 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 2491 2264 gene locus_tag LOCUS_22070 2491 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 2871 3137 gene locus_tag LOCUS_22080 2871 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 3236 3634 gene locus_tag LOCUS_22090 3236 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 3876 4361 gene locus_tag LOCUS_22100 3876 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 4556 4900 gene locus_tag LOCUS_22110 4556 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 5122 6114 gene locus_tag LOCUS_22120 5122 6114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 6196 7842 gene locus_tag LOCUS_22130 6196 7842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 8132 8392 gene locus_tag LOCUS_22140 8132 8392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 >Feature sequence53 218 865 gene locus_tag LOCUS_22150 218 865 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260949.1 protein_id gnl|my_center|LOCUS_22150 963 1529 gene locus_tag LOCUS_22160 963 1529 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948566.1 protein_id gnl|my_center|LOCUS_22160 1529 1696 gene locus_tag LOCUS_22170 1529 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 1723 1875 gene locus_tag LOCUS_22180 1723 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 2506 1928 gene locus_tag LOCUS_22190 2506 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 3138 2602 gene locus_tag LOCUS_22200 3138 2602 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964725.1 protein_id gnl|my_center|LOCUS_22200 3361 3942 gene locus_tag LOCUS_22210 3361 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 5186 4002 gene locus_tag LOCUS_22220 5186 4002 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812525.1 protein_id gnl|my_center|LOCUS_22220 5920 5183 gene locus_tag LOCUS_22230 5920 5183 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812523.1 protein_id gnl|my_center|LOCUS_22230 7238 5913 gene locus_tag LOCUS_22240 7238 5913 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214102.1 protein_id gnl|my_center|LOCUS_22240 8003 7275 gene locus_tag LOCUS_22250 8003 7275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 8300 8151 gene locus_tag LOCUS_22260 8300 8151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 8503 8324 gene locus_tag LOCUS_22270 8503 8324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 8804 8880 gene locus_tag LOCUS_t00380 8804 8880 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence54 496 269 gene locus_tag LOCUS_22280 496 269 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_22280 1534 668 gene locus_tag LOCUS_22290 1534 668 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941065.1 protein_id gnl|my_center|LOCUS_22290 1794 1531 gene locus_tag LOCUS_22300 1794 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 2195 2920 gene locus_tag LOCUS_22310 2195 2920 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_22310 2958 4232 gene locus_tag LOCUS_22320 gene hacA 2958 4232 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876998.1 protein_id gnl|my_center|LOCUS_22320 4234 4752 gene locus_tag LOCUS_22330 4234 4752 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083008.1 protein_id gnl|my_center|LOCUS_22330 4852 5856 gene locus_tag LOCUS_22340 4852 5856 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816965.1 protein_id gnl|my_center|LOCUS_22340 5926 6423 gene locus_tag LOCUS_22350 5926 6423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 6470 7966 gene locus_tag LOCUS_22360 6470 7966 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582707.1 protein_id gnl|my_center|LOCUS_22360 >Feature sequence55 914 1882 gene locus_tag LOCUS_22370 gene pseB 914 1882 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869431.1 protein_id gnl|my_center|LOCUS_22370 1936 2985 gene locus_tag LOCUS_22380 1936 2985 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870578.1 protein_id gnl|my_center|LOCUS_22380 2997 4013 gene locus_tag LOCUS_22390 2997 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 4019 5233 gene locus_tag LOCUS_22400 4019 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 5247 5999 gene locus_tag LOCUS_22410 5247 5999 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 protein_id gnl|my_center|LOCUS_22410 6036 6770 gene locus_tag LOCUS_22420 6036 6770 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965489.1 protein_id gnl|my_center|LOCUS_22420 6935 7054 gene locus_tag LOCUS_22430 6935 7054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 7472 7606 gene locus_tag LOCUS_22440 7472 7606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 >Feature sequence56 530 234 gene locus_tag LOCUS_22450 530 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 1652 1122 gene locus_tag LOCUS_22460 1652 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 4573 1952 gene locus_tag LOCUS_22470 4573 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 6455 4593 gene locus_tag LOCUS_22480 6455 4593 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211204934.1 protein_id gnl|my_center|LOCUS_22480 7311 6754 gene locus_tag LOCUS_22490 7311 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 >Feature sequence57 3522 43 gene locus_tag LOCUS_22500 gene rpoC 3522 43 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345594.1 protein_id gnl|my_center|LOCUS_22500 7059 3577 gene locus_tag LOCUS_22510 gene rpoB 7059 3577 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393945.1 protein_id gnl|my_center|LOCUS_22510 >Feature sequence58 577 158 gene locus_tag LOCUS_22520 577 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 1128 2168 gene locus_tag LOCUS_22530 gene cobD 1128 2168 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392618.1 protein_id gnl|my_center|LOCUS_22530 2412 3902 gene locus_tag LOCUS_22540 2412 3902 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392612.1 protein_id gnl|my_center|LOCUS_22540 3916 4848 gene locus_tag LOCUS_22550 gene cbiB 3916 4848 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943620.1 protein_id gnl|my_center|LOCUS_22550 4963 5520 gene locus_tag LOCUS_22560 gene cobU 4963 5520 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932625.1 protein_id gnl|my_center|LOCUS_22560 >Feature sequence59 1624 800 gene locus_tag LOCUS_22570 1624 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 2675 1794 gene locus_tag LOCUS_22580 2675 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 4063 2741 gene locus_tag LOCUS_22590 4063 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 4640 4452 gene locus_tag LOCUS_22600 4640 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 5330 4824 gene locus_tag LOCUS_22610 5330 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 >Feature sequence60 416 255 gene locus_tag LOCUS_22620 416 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 827 438 gene locus_tag LOCUS_22630 827 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 1398 949 gene locus_tag LOCUS_22640 1398 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22640 1858 1451 gene locus_tag LOCUS_22650 1858 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 2820 2203 gene locus_tag LOCUS_22660 2820 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 3658 2774 gene locus_tag LOCUS_22670 3658 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 4521 4694 gene locus_tag LOCUS_22680 4521 4694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 4691 5041 gene locus_tag LOCUS_22690 4691 5041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 >Feature sequence61 523 1308 gene locus_tag LOCUS_22700 523 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 2384 2728 gene locus_tag LOCUS_22710 2384 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 2924 2679 gene locus_tag LOCUS_22720 2924 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 3580 3149 gene locus_tag LOCUS_22730 3580 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210986.1 protein_id gnl|my_center|LOCUS_22730 4385 3645 gene locus_tag LOCUS_22740 4385 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 4935 4387 gene locus_tag LOCUS_22750 4935 4387 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343928.1 protein_id gnl|my_center|LOCUS_22750 >Feature sequence62 86 2515 gene locus_tag LOCUS_22760 86 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 2604 3527 gene locus_tag LOCUS_22770 2604 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 3768 4685 gene locus_tag LOCUS_22780 3768 4685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 >Feature sequence63 1507 398 gene locus_tag LOCUS_22790 1507 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 4123 1802 gene locus_tag LOCUS_22800 4123 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 >Feature sequence64 231 34 gene locus_tag LOCUS_22810 231 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 736 371 gene locus_tag LOCUS_22820 736 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 950 810 gene locus_tag LOCUS_22830 950 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 1888 1034 gene locus_tag LOCUS_22840 1888 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 2394 3476 gene locus_tag LOCUS_22850 2394 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 3744 4151 gene locus_tag LOCUS_22860 3744 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 >Feature sequence65 620 447 gene locus_tag LOCUS_22870 620 447 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023347.1 protein_id gnl|my_center|LOCUS_22870 1140 808 gene locus_tag LOCUS_22880 1140 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 1316 1558 gene locus_tag LOCUS_22890 1316 1558 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083476658.1 protein_id gnl|my_center|LOCUS_22890 1614 2414 gene locus_tag LOCUS_22900 1614 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 2950 2621 gene locus_tag LOCUS_22910 2950 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 2997 3341 gene locus_tag LOCUS_22920 2997 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 3544 4071 gene locus_tag LOCUS_22930 3544 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 >Feature sequence66 2167 482 gene locus_tag LOCUS_22940 2167 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816571.1 protein_id gnl|my_center|LOCUS_22940 2943 2164 gene locus_tag LOCUS_22950 2943 2164 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_22950 3196 3002 gene locus_tag LOCUS_22960 3196 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 >Feature sequence67 273 422 gene locus_tag LOCUS_22970 gene rpmG 273 422 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393952.1 protein_id gnl|my_center|LOCUS_22970 434 712 gene locus_tag LOCUS_22980 434 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 752 1300 gene locus_tag LOCUS_22990 gene nusG 752 1300 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393950.1 protein_id gnl|my_center|LOCUS_22990 1313 1741 gene locus_tag LOCUS_23000 gene rplK 1313 1741 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393949.1 protein_id gnl|my_center|LOCUS_23000 1786 2481 gene locus_tag LOCUS_23010 gene rplA 1786 2481 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_23010 2659 3195 gene locus_tag LOCUS_23020 gene rplJ 2659 3195 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393947.1 protein_id gnl|my_center|LOCUS_23020 3262 3648 gene locus_tag LOCUS_23030 gene rplL 3262 3648 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393946.1 protein_id gnl|my_center|LOCUS_23030 >Feature sequence68 2152 83 gene locus_tag LOCUS_23040 gene fusA 2152 83 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_23040 2636 2166 gene locus_tag LOCUS_23050 gene rpsG 2636 2166 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393941.1 protein_id gnl|my_center|LOCUS_23050 3023 2649 gene locus_tag LOCUS_23060 gene rpsL 3023 2649 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393942.1 protein_id gnl|my_center|LOCUS_23060 >Feature sequence69 169 1353 gene locus_tag LOCUS_23070 169 1353 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811039.1 protein_id gnl|my_center|LOCUS_23070 1468 1833 gene locus_tag LOCUS_23080 1468 1833 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393007.1 protein_id gnl|my_center|LOCUS_23080 1823 2275 gene locus_tag LOCUS_23090 gene spoIIAB 1823 2275 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393006.1 protein_id gnl|my_center|LOCUS_23090 2259 3032 gene locus_tag LOCUS_23100 gene sigF 2259 3032 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460233.1 protein_id gnl|my_center|LOCUS_23100 >Feature sequence70 615 85 gene locus_tag LOCUS_23110 615 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 2211 802 gene locus_tag LOCUS_23120 2211 802 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965627.1 protein_id gnl|my_center|LOCUS_23120 2687 2313 gene locus_tag LOCUS_23130 2687 2313 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_23130 >Feature sequence71 696 43 gene locus_tag LOCUS_23140 696 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 1231 719 gene locus_tag LOCUS_23150 1231 719 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256008.1 protein_id gnl|my_center|LOCUS_23150 2039 1257 gene locus_tag LOCUS_23160 2039 1257 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061316.1 protein_id gnl|my_center|LOCUS_23160 2304 2228 gene locus_tag LOCUS_t00390 2304 2228 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2412 2326 gene locus_tag LOCUS_t00400 2412 2326 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2518 2441 gene locus_tag LOCUS_t00410 2518 2441 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence72 651 1910 gene locus_tag LOCUS_23170 651 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 >Feature sequence73 97 555 gene locus_tag LOCUS_23180 97 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 1081 2082 gene locus_tag LOCUS_23190 1081 2082 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393640.1 protein_id gnl|my_center|LOCUS_23190 2300 2467 gene locus_tag LOCUS_23200 2300 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 >Feature sequence74 1881 373 gene locus_tag LOCUS_23210 gene istA 1881 373 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974233.1 protein_id gnl|my_center|LOCUS_23210 >Feature sequence75 43 324 gene locus_tag LOCUS_23220 43 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 478 1857 gene locus_tag LOCUS_23230 gene ltrA 478 1857 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966780.1 protein_id gnl|my_center|LOCUS_23230 >Feature sequence76 117 1796 gene locus_tag LOCUS_23240 117 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 >Feature sequence77 1627 20 gene locus_tag LOCUS_23250 1627 20 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459240.1 protein_id gnl|my_center|LOCUS_23250 >Feature sequence78 1492 119 gene locus_tag LOCUS_23260 gene argH 1492 119 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_23260 >Feature sequence79 321 1175 gene locus_tag LOCUS_23270 321 1175 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459951.1 protein_id gnl|my_center|LOCUS_23270 >Feature sequence80 >Feature sequence81 28 420 gene locus_tag LOCUS_23280 28 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 539 796 gene locus_tag LOCUS_23290 539 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 >Feature sequence82 <1 1011 gene locus_tag LOCUS_23300 <1 1011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_173518222.1:tyrosine-type recombinase/integrase