>Feature sequence001 1888 1010 gene locus_tag LOCUS_00010 1888 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2049 2975 gene locus_tag LOCUS_00020 2049 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2982 4691 gene locus_tag LOCUS_00030 gene ctaD 2982 4691 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098822.1 protein_id gnl|my_center|LOCUS_00030 4718 5626 gene locus_tag LOCUS_00040 4718 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5751 6062 gene locus_tag LOCUS_00050 5751 6062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6183 6632 gene locus_tag LOCUS_00060 6183 6632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6821 7894 gene locus_tag LOCUS_00070 gene coxB 6821 7894 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227850.1 protein_id gnl|my_center|LOCUS_00070 7908 9845 gene locus_tag LOCUS_00080 gene ctaD 7908 9845 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142160.1 protein_id gnl|my_center|LOCUS_00080 9887 10741 gene locus_tag LOCUS_00090 9887 10741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 10756 11415 gene locus_tag LOCUS_00100 10756 11415 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057844.1 protein_id gnl|my_center|LOCUS_00100 11605 12420 gene locus_tag LOCUS_00110 11605 12420 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533219.1 protein_id gnl|my_center|LOCUS_00110 12981 12556 gene locus_tag LOCUS_00120 12981 12556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13880 12996 gene locus_tag LOCUS_00130 13880 12996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 15005 14244 gene locus_tag LOCUS_00140 15005 14244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 16753 15137 gene locus_tag LOCUS_00150 16753 15137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 16733 17116 gene locus_tag LOCUS_00160 16733 17116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 17133 17558 gene locus_tag LOCUS_00170 17133 17558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 18212 17580 gene locus_tag LOCUS_00180 18212 17580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 18727 18311 gene locus_tag LOCUS_00190 18727 18311 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114401.1 protein_id gnl|my_center|LOCUS_00190 19781 18771 gene locus_tag LOCUS_00200 19781 18771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 19665 20195 gene locus_tag LOCUS_00210 19665 20195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 20911 20165 gene locus_tag LOCUS_00220 20911 20165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 20918 21053 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21825 21358 gene locus_tag LOCUS_00230 21825 21358 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065746.1 protein_id gnl|my_center|LOCUS_00230 23412 21838 gene locus_tag LOCUS_00240 23412 21838 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_00240 23827 23444 gene locus_tag LOCUS_00250 23827 23444 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817437.1 protein_id gnl|my_center|LOCUS_00250 25736 23868 gene locus_tag LOCUS_00260 gene glmS 25736 23868 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808420.1 protein_id gnl|my_center|LOCUS_00260 27181 25838 gene locus_tag LOCUS_00270 gene glmM 27181 25838 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393729.1 protein_id gnl|my_center|LOCUS_00270 28040 27240 gene locus_tag LOCUS_00280 28040 27240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 28509 28069 gene locus_tag LOCUS_00290 gene rplM 28509 28069 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881226.1 protein_id gnl|my_center|LOCUS_00290 28828 29883 gene locus_tag LOCUS_00300 28828 29883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 29929 30339 gene locus_tag LOCUS_00310 29929 30339 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_00310 32119 30374 gene locus_tag LOCUS_00320 gene guaA 32119 30374 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393595.1 protein_id gnl|my_center|LOCUS_00320 33327 32122 gene locus_tag LOCUS_00330 33327 32122 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_00330 34587 33619 gene locus_tag LOCUS_00340 gene pfkB 34587 33619 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391561.1 protein_id gnl|my_center|LOCUS_00340 35903 34584 gene locus_tag LOCUS_00350 35903 34584 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_00350 36250 35900 gene locus_tag LOCUS_00360 36250 35900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 37420 36383 gene locus_tag LOCUS_00370 gene pyrF 37420 36383 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922551.1 protein_id gnl|my_center|LOCUS_00370 37707 37435 gene locus_tag LOCUS_00380 37707 37435 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357604.1 protein_id gnl|my_center|LOCUS_00380 38395 37868 gene locus_tag LOCUS_00390 38395 37868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 39534 38410 gene locus_tag LOCUS_00400 39534 38410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 40100 39519 gene locus_tag LOCUS_00410 gene rdgB 40100 39519 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776021.1 protein_id gnl|my_center|LOCUS_00410 40819 40100 gene locus_tag LOCUS_00420 gene rph 40819 40100 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918041.1 protein_id gnl|my_center|LOCUS_00420 41685 40816 gene locus_tag LOCUS_00430 gene murI 41685 40816 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467674.1 protein_id gnl|my_center|LOCUS_00430 41975 41745 gene locus_tag LOCUS_00440 41975 41745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 42118 43209 gene locus_tag LOCUS_00450 42118 43209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 43206 44168 gene locus_tag LOCUS_00460 43206 44168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 44342 44827 gene locus_tag LOCUS_00470 44342 44827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 44880 44919 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 46025 44955 gene locus_tag LOCUS_00480 46025 44955 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902051.1 protein_id gnl|my_center|LOCUS_00480 46039 46926 gene locus_tag LOCUS_00490 46039 46926 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 protein_id gnl|my_center|LOCUS_00490 47137 47769 gene locus_tag LOCUS_00500 47137 47769 CDS product DUF1802 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143201.1 protein_id gnl|my_center|LOCUS_00500 48096 47824 gene locus_tag LOCUS_00510 48096 47824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00510 48779 48093 gene locus_tag LOCUS_00520 48779 48093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00520 48923 49411 gene locus_tag LOCUS_00530 48923 49411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 49842 49510 gene locus_tag LOCUS_00540 49842 49510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 50297 49899 gene locus_tag LOCUS_00550 50297 49899 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896304.1 protein_id gnl|my_center|LOCUS_00550 50611 50306 gene locus_tag LOCUS_00560 50611 50306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 51655 50684 gene locus_tag LOCUS_00570 51655 50684 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084687.1 protein_id gnl|my_center|LOCUS_00570 51973 51698 gene locus_tag LOCUS_00580 51973 51698 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559268.1 protein_id gnl|my_center|LOCUS_00580 53178 51985 gene locus_tag LOCUS_00590 gene moeB 53178 51985 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057412.1 protein_id gnl|my_center|LOCUS_00590 53366 54355 gene locus_tag LOCUS_00600 53366 54355 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327630.1 protein_id gnl|my_center|LOCUS_00600 54352 54984 gene locus_tag LOCUS_00610 54352 54984 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030451.1 protein_id gnl|my_center|LOCUS_00610 55035 55649 gene locus_tag LOCUS_00620 55035 55649 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918138.1 protein_id gnl|my_center|LOCUS_00620 55960 55697 gene locus_tag LOCUS_00630 55960 55697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 56203 56015 gene locus_tag LOCUS_00640 56203 56015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 57732 56200 gene locus_tag LOCUS_00650 57732 56200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731325.1 protein_id gnl|my_center|LOCUS_00650 57653 58429 gene locus_tag LOCUS_00660 57653 58429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 59489 58374 gene locus_tag LOCUS_00670 59489 58374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 59479 59673 gene locus_tag LOCUS_00680 59479 59673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 60741 59752 gene locus_tag LOCUS_00690 60741 59752 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467730.1 protein_id gnl|my_center|LOCUS_00690 61712 60786 gene locus_tag LOCUS_00700 61712 60786 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_00700 61969 63471 gene locus_tag LOCUS_00710 61969 63471 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229720.1 protein_id gnl|my_center|LOCUS_00710 63832 63536 gene locus_tag LOCUS_00720 63832 63536 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258652.1 protein_id gnl|my_center|LOCUS_00720 >Feature sequence002 1798 143 gene locus_tag LOCUS_00730 1798 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 2164 1982 gene locus_tag LOCUS_00740 2164 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 2599 2261 gene locus_tag LOCUS_00750 2599 2261 CDS product DUF3140 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339310.1 protein_id gnl|my_center|LOCUS_00750 2860 3240 gene locus_tag LOCUS_00760 2860 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 3730 3377 gene locus_tag LOCUS_00770 3730 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 4944 3727 gene locus_tag LOCUS_00780 4944 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 6222 5605 gene locus_tag LOCUS_00790 6222 5605 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486466.1 protein_id gnl|my_center|LOCUS_00790 6380 7492 gene locus_tag LOCUS_00800 6380 7492 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886737.1 protein_id gnl|my_center|LOCUS_00800 7495 8262 gene locus_tag LOCUS_00810 7495 8262 CDS product serine esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013614293.1 protein_id gnl|my_center|LOCUS_00810 9059 8274 gene locus_tag LOCUS_00820 9059 8274 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064968.1 protein_id gnl|my_center|LOCUS_00820 10591 9125 gene locus_tag LOCUS_00830 10591 9125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 10209 10276 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10691 11266 gene locus_tag LOCUS_00840 10691 11266 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223801.1 protein_id gnl|my_center|LOCUS_00840 11384 13231 gene locus_tag LOCUS_00850 11384 13231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 13434 13228 gene locus_tag LOCUS_00860 13434 13228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 13515 16133 gene locus_tag LOCUS_00870 13515 16133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 13916 13999 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16394 17863 gene locus_tag LOCUS_00880 gene amt 16394 17863 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056043.1 protein_id gnl|my_center|LOCUS_00880 17860 18234 gene locus_tag LOCUS_00890 17860 18234 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461711.1 protein_id gnl|my_center|LOCUS_00890 18660 18415 gene locus_tag LOCUS_00900 18660 18415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 18655 18861 gene locus_tag LOCUS_00910 18655 18861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 19164 18955 gene locus_tag LOCUS_00920 19164 18955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 19877 19674 gene locus_tag LOCUS_00930 19877 19674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 20120 21322 gene locus_tag LOCUS_00940 20120 21322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 21661 22680 gene locus_tag LOCUS_00950 21661 22680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 23262 22753 gene locus_tag LOCUS_00960 23262 22753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 23363 24187 gene locus_tag LOCUS_00970 23363 24187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 24195 25136 gene locus_tag LOCUS_00980 24195 25136 CDS product homogentisate phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140287.1 protein_id gnl|my_center|LOCUS_00980 26354 25212 gene locus_tag LOCUS_00990 gene rnd 26354 25212 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919573.1 protein_id gnl|my_center|LOCUS_00990 26479 27291 gene locus_tag LOCUS_01000 26479 27291 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407737.1 protein_id gnl|my_center|LOCUS_01000 27729 27442 gene locus_tag LOCUS_01010 27729 27442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 28021 28992 gene locus_tag LOCUS_01020 28021 28992 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_01020 29055 30095 gene locus_tag LOCUS_01030 29055 30095 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057240.1 protein_id gnl|my_center|LOCUS_01030 30096 31172 gene locus_tag LOCUS_01040 gene egtD 30096 31172 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226791.1 protein_id gnl|my_center|LOCUS_01040 31547 31134 gene locus_tag LOCUS_01050 31547 31134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 31732 33810 gene locus_tag LOCUS_01060 31732 33810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 33838 34914 gene locus_tag LOCUS_01070 33838 34914 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_01070 35834 34971 gene locus_tag LOCUS_01080 35834 34971 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027879.1 protein_id gnl|my_center|LOCUS_01080 35997 37202 gene locus_tag LOCUS_01090 35997 37202 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229362.1 protein_id gnl|my_center|LOCUS_01090 37287 38147 gene locus_tag LOCUS_01100 gene rfbD 37287 38147 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943001.1 protein_id gnl|my_center|LOCUS_01100 38144 39142 gene locus_tag LOCUS_01110 gene rfbB 38144 39142 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_01110 39597 39175 gene locus_tag LOCUS_01120 39597 39175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 39622 40437 gene locus_tag LOCUS_01130 39622 40437 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730268.1 protein_id gnl|my_center|LOCUS_01130 41418 40474 gene locus_tag LOCUS_01140 41418 40474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01140 41300 41536 gene locus_tag LOCUS_01150 41300 41536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 42663 41779 gene locus_tag LOCUS_01160 42663 41779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 43257 42895 gene locus_tag LOCUS_01170 43257 42895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 43272 44828 gene locus_tag LOCUS_01180 43272 44828 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036061.1 protein_id gnl|my_center|LOCUS_01180 44956 45684 gene locus_tag LOCUS_01190 44956 45684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 45820 46644 gene locus_tag LOCUS_01200 45820 46644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 >Feature sequence003 1616 366 gene locus_tag LOCUS_01210 1616 366 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592994.1 protein_id gnl|my_center|LOCUS_01210 1708 2574 gene locus_tag LOCUS_01220 gene ftsE 1708 2574 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_01220 2571 3464 gene locus_tag LOCUS_01230 gene ftsX 2571 3464 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357632.1 protein_id gnl|my_center|LOCUS_01230 3587 3985 gene locus_tag LOCUS_01240 3587 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 4154 5233 gene locus_tag LOCUS_01250 4154 5233 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057246.1 protein_id gnl|my_center|LOCUS_01250 5536 7182 gene locus_tag LOCUS_01260 5536 7182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 7193 7663 gene locus_tag LOCUS_01270 gene smpB 7193 7663 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925141.1 protein_id gnl|my_center|LOCUS_01270 8841 7741 gene locus_tag LOCUS_01280 8841 7741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 8978 9342 gene locus_tag LOCUS_tm00010 8978 9342 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 10106 9558 gene locus_tag LOCUS_01290 10106 9558 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029338.1 protein_id gnl|my_center|LOCUS_01290 10201 10419 gene locus_tag LOCUS_01300 10201 10419 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855276.1 protein_id gnl|my_center|LOCUS_01300 10416 12698 gene locus_tag LOCUS_01310 10416 12698 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730259.1 protein_id gnl|my_center|LOCUS_01310 12717 13937 gene locus_tag LOCUS_01320 12717 13937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 14448 14275 gene locus_tag LOCUS_01330 14448 14275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 14431 15054 gene locus_tag LOCUS_01340 14431 15054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 16977 15154 gene locus_tag LOCUS_01350 16977 15154 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404064.1 protein_id gnl|my_center|LOCUS_01350 17631 17023 gene locus_tag LOCUS_01360 17631 17023 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222994.1 protein_id gnl|my_center|LOCUS_01360 18124 17717 gene locus_tag LOCUS_01370 gene msrB 18124 17717 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943090.1 protein_id gnl|my_center|LOCUS_01370 18337 18528 gene locus_tag LOCUS_01380 18337 18528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 18631 20661 gene locus_tag LOCUS_01390 gene tkt 18631 20661 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142294.1 protein_id gnl|my_center|LOCUS_01390 20684 23383 gene locus_tag LOCUS_01400 20684 23383 CDS product bifunctional transaldolase/phosoglucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402866.1 protein_id gnl|my_center|LOCUS_01400 23434 24339 gene locus_tag LOCUS_01410 gene gnd 23434 24339 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402865.1 protein_id gnl|my_center|LOCUS_01410 24339 25877 gene locus_tag LOCUS_01420 gene zwf 24339 25877 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805125.1 protein_id gnl|my_center|LOCUS_01420 25877 26932 gene locus_tag LOCUS_01430 25877 26932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 26929 27606 gene locus_tag LOCUS_01440 gene pgl 26929 27606 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000607048.1 protein_id gnl|my_center|LOCUS_01440 27606 28565 gene locus_tag LOCUS_01450 27606 28565 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174053.1 protein_id gnl|my_center|LOCUS_01450 28562 29014 gene locus_tag LOCUS_01460 gene rpiB 28562 29014 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525805.1 protein_id gnl|my_center|LOCUS_01460 29042 30019 gene locus_tag LOCUS_01470 29042 30019 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_01470 31089 30106 gene locus_tag LOCUS_01480 31089 30106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 31142 32026 gene locus_tag LOCUS_01490 31142 32026 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181584.1 protein_id gnl|my_center|LOCUS_01490 32960 32148 gene locus_tag LOCUS_01500 32960 32148 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230182.1 protein_id gnl|my_center|LOCUS_01500 33864 32986 gene locus_tag LOCUS_01510 33864 32986 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230181.1 protein_id gnl|my_center|LOCUS_01510 33886 34758 gene locus_tag LOCUS_01520 33886 34758 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804959.1 protein_id gnl|my_center|LOCUS_01520 34915 35397 gene locus_tag LOCUS_01530 34915 35397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 35998 36169 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36256 38430 gene locus_tag LOCUS_01540 gene ppk1 36256 38430 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141500.1 protein_id gnl|my_center|LOCUS_01540 38499 39341 gene locus_tag LOCUS_01550 38499 39341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 41403 39343 gene locus_tag LOCUS_01560 41403 39343 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229847.1 protein_id gnl|my_center|LOCUS_01560 >Feature sequence004 1163 21 gene locus_tag LOCUS_01570 1163 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 3045 1462 gene locus_tag LOCUS_01580 3045 1462 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013584.1 protein_id gnl|my_center|LOCUS_01580 2951 3256 gene locus_tag LOCUS_01590 2951 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 3739 3257 gene locus_tag LOCUS_01600 3739 3257 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578443.1 protein_id gnl|my_center|LOCUS_01600 4053 3736 gene locus_tag LOCUS_01610 4053 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 3940 4491 gene locus_tag LOCUS_01620 3940 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 5857 4550 gene locus_tag LOCUS_01630 5857 4550 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037175.1 protein_id gnl|my_center|LOCUS_01630 6405 5854 gene locus_tag LOCUS_01640 gene rfbC 6405 5854 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257099.1 protein_id gnl|my_center|LOCUS_01640 7229 6408 gene locus_tag LOCUS_01650 gene rfbF 7229 6408 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937383.1 protein_id gnl|my_center|LOCUS_01650 8277 7237 gene locus_tag LOCUS_01660 8277 7237 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613588.1 protein_id gnl|my_center|LOCUS_01660 9441 8281 gene locus_tag LOCUS_01670 gene lhgO 9441 8281 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839995.1 protein_id gnl|my_center|LOCUS_01670 9373 9615 gene locus_tag LOCUS_01680 9373 9615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 10131 9946 gene locus_tag LOCUS_01690 10131 9946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 10177 10410 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10672 12627 gene locus_tag LOCUS_01700 10672 12627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 13539 12832 gene locus_tag LOCUS_01710 13539 12832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 13601 14083 gene locus_tag LOCUS_01720 13601 14083 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532679.1 protein_id gnl|my_center|LOCUS_01720 14525 14145 gene locus_tag LOCUS_01730 gene rplL 14525 14145 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393946.1 protein_id gnl|my_center|LOCUS_01730 15268 14555 gene locus_tag LOCUS_01740 15268 14555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 16067 15342 gene locus_tag LOCUS_01750 gene rplA 16067 15342 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_01750 16492 16067 gene locus_tag LOCUS_01760 gene rplK 16492 16067 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081512.1 protein_id gnl|my_center|LOCUS_01760 17034 16513 gene locus_tag LOCUS_01770 gene nusG 17034 16513 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393950.1 protein_id gnl|my_center|LOCUS_01770 17636 17046 gene locus_tag LOCUS_01780 17636 17046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 18059 17739 gene locus_tag LOCUS_01790 18059 17739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 18187 18056 gene locus_tag LOCUS_01800 18187 18056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 20008 18500 gene locus_tag LOCUS_01810 20008 18500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 21345 20290 gene locus_tag LOCUS_01820 21345 20290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 22178 21342 gene locus_tag LOCUS_01830 gene fabI 22178 21342 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977009.1 protein_id gnl|my_center|LOCUS_01830 22690 22175 gene locus_tag LOCUS_01840 22690 22175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 24174 22687 gene locus_tag LOCUS_01850 24174 22687 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392670.1 protein_id gnl|my_center|LOCUS_01850 25367 24171 gene locus_tag LOCUS_01860 gene fabF 25367 24171 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227920.1 protein_id gnl|my_center|LOCUS_01860 25633 25367 gene locus_tag LOCUS_01870 25633 25367 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259257.1 protein_id gnl|my_center|LOCUS_01870 26354 25635 gene locus_tag LOCUS_01880 gene fabG 26354 25635 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_01880 27360 26356 gene locus_tag LOCUS_01890 27360 26356 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222216.1 protein_id gnl|my_center|LOCUS_01890 28249 27353 gene locus_tag LOCUS_01900 gene fabD 28249 27353 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142142.1 protein_id gnl|my_center|LOCUS_01900 28958 28314 gene locus_tag LOCUS_01910 28958 28314 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228375.1 protein_id gnl|my_center|LOCUS_01910 30099 28945 gene locus_tag LOCUS_01920 30099 28945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 30495 30250 gene locus_tag LOCUS_01930 30495 30250 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222201.1 protein_id gnl|my_center|LOCUS_01930 31013 30492 gene locus_tag LOCUS_01940 31013 30492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 32919 31276 gene locus_tag LOCUS_01950 32919 31276 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389949.1 protein_id gnl|my_center|LOCUS_01950 34714 33032 gene locus_tag LOCUS_01960 34714 33032 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731142.1 protein_id gnl|my_center|LOCUS_01960 36944 34785 gene locus_tag LOCUS_01970 36944 34785 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_01970 37807 36941 gene locus_tag LOCUS_01980 37807 36941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 >Feature sequence005 450 82 gene locus_tag LOCUS_01990 450 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 337 711 gene locus_tag LOCUS_02000 337 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 699 1361 gene locus_tag LOCUS_02010 699 1361 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_02010 1411 1971 gene locus_tag LOCUS_02020 1411 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 1968 2723 gene locus_tag LOCUS_02030 gene proC 1968 2723 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140706.1 protein_id gnl|my_center|LOCUS_02030 2728 3021 gene locus_tag LOCUS_02040 2728 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 3018 3527 gene locus_tag LOCUS_02050 gene lspA 3018 3527 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392387.1 protein_id gnl|my_center|LOCUS_02050 3524 4423 gene locus_tag LOCUS_02060 3524 4423 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256790.1 protein_id gnl|my_center|LOCUS_02060 4617 5894 gene locus_tag LOCUS_02070 4617 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 5891 6499 gene locus_tag LOCUS_02080 gene tsf 5891 6499 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942565.1 protein_id gnl|my_center|LOCUS_02080 6512 7237 gene locus_tag LOCUS_02090 gene pyrH 6512 7237 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056115.1 protein_id gnl|my_center|LOCUS_02090 7234 7791 gene locus_tag LOCUS_02100 gene frr 7234 7791 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 protein_id gnl|my_center|LOCUS_02100 7788 8480 gene locus_tag LOCUS_02110 7788 8480 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081614.1 protein_id gnl|my_center|LOCUS_02110 8630 9412 gene locus_tag LOCUS_02120 8630 9412 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583559.1 protein_id gnl|my_center|LOCUS_02120 9426 9782 gene locus_tag LOCUS_02130 9426 9782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 9832 9990 gene locus_tag LOCUS_02140 9832 9990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 10013 11167 gene locus_tag LOCUS_02150 10013 11167 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142249.1 protein_id gnl|my_center|LOCUS_02150 11164 12255 gene locus_tag LOCUS_02160 gene rseP 11164 12255 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938164.1 protein_id gnl|my_center|LOCUS_02160 12376 14160 gene locus_tag LOCUS_02170 12376 14160 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014001171.1 protein_id gnl|my_center|LOCUS_02170 14244 15524 gene locus_tag LOCUS_02180 gene ispG 14244 15524 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541503.1 protein_id gnl|my_center|LOCUS_02180 15595 17277 gene locus_tag LOCUS_02190 15595 17277 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545094.1 protein_id gnl|my_center|LOCUS_02190 17259 17918 gene locus_tag LOCUS_02200 17259 17918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 17971 18234 gene locus_tag LOCUS_02210 17971 18234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 18260 18739 gene locus_tag LOCUS_02220 18260 18739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 18752 19666 gene locus_tag LOCUS_02230 18752 19666 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066949941.1 protein_id gnl|my_center|LOCUS_02230 19746 20156 gene locus_tag LOCUS_02240 19746 20156 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005618719.1 protein_id gnl|my_center|LOCUS_02240 21892 20141 gene locus_tag LOCUS_02250 21892 20141 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080010.1 protein_id gnl|my_center|LOCUS_02250 22448 21897 gene locus_tag LOCUS_02260 22448 21897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 22592 23131 gene locus_tag LOCUS_02270 22592 23131 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026917.1 protein_id gnl|my_center|LOCUS_02270 23175 24089 gene locus_tag LOCUS_02280 23175 24089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 24418 25530 gene locus_tag LOCUS_02290 gene dinB 24418 25530 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810865.1 protein_id gnl|my_center|LOCUS_02290 26335 25595 gene locus_tag LOCUS_02300 26335 25595 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223501.1 protein_id gnl|my_center|LOCUS_02300 26373 27188 gene locus_tag LOCUS_02310 26373 27188 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776214.1 protein_id gnl|my_center|LOCUS_02310 28980 27280 gene locus_tag LOCUS_02320 28980 27280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 29107 29778 gene locus_tag LOCUS_02330 29107 29778 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230121.1 protein_id gnl|my_center|LOCUS_02330 29779 30432 gene locus_tag LOCUS_02340 29779 30432 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257775.1 protein_id gnl|my_center|LOCUS_02340 30707 30429 gene locus_tag LOCUS_02350 30707 30429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 30744 34529 gene locus_tag LOCUS_02360 30744 34529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 34956 34636 gene locus_tag LOCUS_02370 34956 34636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 34903 35199 gene locus_tag LOCUS_02380 34903 35199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 35276 35716 gene locus_tag LOCUS_02390 35276 35716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 35732 36211 gene locus_tag LOCUS_02400 35732 36211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 >Feature sequence006 954 499 gene locus_tag LOCUS_02410 954 499 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222175.1 protein_id gnl|my_center|LOCUS_02410 1238 1020 gene locus_tag LOCUS_02420 1238 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 1334 2191 gene locus_tag LOCUS_02430 1334 2191 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525079.1 protein_id gnl|my_center|LOCUS_02430 3823 2273 gene locus_tag LOCUS_02440 gene ftsH 3823 2273 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583233.1 protein_id gnl|my_center|LOCUS_02440 4097 3969 gene locus_tag LOCUS_02450 4097 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 5491 4094 gene locus_tag LOCUS_02460 5491 4094 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228504.1 protein_id gnl|my_center|LOCUS_02460 6617 5799 gene locus_tag LOCUS_02470 6617 5799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 7918 6614 gene locus_tag LOCUS_02480 7918 6614 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226490.1 protein_id gnl|my_center|LOCUS_02480 8008 8211 gene locus_tag LOCUS_02490 8008 8211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 8357 9703 gene locus_tag LOCUS_02500 8357 9703 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977320.1 protein_id gnl|my_center|LOCUS_02500 9700 10536 gene locus_tag LOCUS_02510 9700 10536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 10629 10937 gene locus_tag LOCUS_02520 10629 10937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 12065 11265 gene locus_tag LOCUS_02530 12065 11265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 12108 12851 gene locus_tag LOCUS_02540 12108 12851 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_02540 12940 15111 gene locus_tag LOCUS_02550 12940 15111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 15343 15732 gene locus_tag LOCUS_02560 15343 15732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 15710 16408 gene locus_tag LOCUS_02570 15710 16408 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_02570 16485 17144 gene locus_tag LOCUS_02580 16485 17144 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887052.1 protein_id gnl|my_center|LOCUS_02580 17232 17975 gene locus_tag LOCUS_02590 17232 17975 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065117.1 protein_id gnl|my_center|LOCUS_02590 17975 18193 gene locus_tag LOCUS_02600 17975 18193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 18190 19521 gene locus_tag LOCUS_02610 gene hemA 18190 19521 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_02610 19518 20399 gene locus_tag LOCUS_02620 gene hemC 19518 20399 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258453.1 protein_id gnl|my_center|LOCUS_02620 20396 21877 gene locus_tag LOCUS_02630 gene cobA 20396 21877 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938035.1 protein_id gnl|my_center|LOCUS_02630 22705 21902 gene locus_tag LOCUS_02640 22705 21902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 23679 22747 gene locus_tag LOCUS_02650 23679 22747 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229774.1 protein_id gnl|my_center|LOCUS_02650 24392 23676 gene locus_tag LOCUS_02660 24392 23676 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870372.1 protein_id gnl|my_center|LOCUS_02660 24622 25578 gene locus_tag LOCUS_02670 24622 25578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 26340 25588 gene locus_tag LOCUS_02680 26340 25588 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228675.1 protein_id gnl|my_center|LOCUS_02680 26409 27227 gene locus_tag LOCUS_02690 26409 27227 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230769.1 protein_id gnl|my_center|LOCUS_02690 27260 27943 gene locus_tag LOCUS_02700 27260 27943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 31777 27968 gene locus_tag LOCUS_02710 31777 27968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 28623 28774 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31664 32005 gene locus_tag LOCUS_02720 31664 32005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 32261 32887 gene locus_tag LOCUS_02730 32261 32887 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194069.1 protein_id gnl|my_center|LOCUS_02730 33025 34005 gene locus_tag LOCUS_02740 gene galT 33025 34005 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080684.1 protein_id gnl|my_center|LOCUS_02740 34098 34922 gene locus_tag LOCUS_02750 34098 34922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 35007 35429 gene locus_tag LOCUS_02760 gene dtd 35007 35429 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393181.1 protein_id gnl|my_center|LOCUS_02760 >Feature sequence007 673 1851 gene locus_tag LOCUS_02770 673 1851 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461034.1 protein_id gnl|my_center|LOCUS_02770 1848 2972 gene locus_tag LOCUS_02780 1848 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 2871 2892 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2990 3583 gene locus_tag LOCUS_02790 2990 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 3591 5756 gene locus_tag LOCUS_02800 3591 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 6416 5775 gene locus_tag LOCUS_02810 6416 5775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 7626 6478 gene locus_tag LOCUS_02820 7626 6478 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030441.1 protein_id gnl|my_center|LOCUS_02820 9205 7667 gene locus_tag LOCUS_02830 9205 7667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 10233 9292 gene locus_tag LOCUS_02840 10233 9292 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403373.1 protein_id gnl|my_center|LOCUS_02840 10577 10383 gene locus_tag LOCUS_02850 10577 10383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 10633 11163 gene locus_tag LOCUS_02860 10633 11163 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062850.1 protein_id gnl|my_center|LOCUS_02860 11160 11816 gene locus_tag LOCUS_02870 gene tenA 11160 11816 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666827.1 protein_id gnl|my_center|LOCUS_02870 11916 12644 gene locus_tag LOCUS_02880 11916 12644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 12651 13115 gene locus_tag LOCUS_02890 12651 13115 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727128.1 protein_id gnl|my_center|LOCUS_02890 13079 13762 gene locus_tag LOCUS_02900 13079 13762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 14086 14445 gene locus_tag LOCUS_02910 14086 14445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 14551 15933 gene locus_tag LOCUS_02920 14551 15933 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870741.1 protein_id gnl|my_center|LOCUS_02920 15982 16233 gene locus_tag LOCUS_02930 15982 16233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 17321 16281 gene locus_tag LOCUS_02940 17321 16281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 18180 17395 gene locus_tag LOCUS_02950 18180 17395 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223617.1 protein_id gnl|my_center|LOCUS_02950 18864 18184 gene locus_tag LOCUS_02960 18864 18184 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404012.1 protein_id gnl|my_center|LOCUS_02960 18877 19995 gene locus_tag LOCUS_02970 18877 19995 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211249054.1 protein_id gnl|my_center|LOCUS_02970 20725 20000 gene locus_tag LOCUS_02980 20725 20000 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257014.1 protein_id gnl|my_center|LOCUS_02980 21698 20757 gene locus_tag LOCUS_02990 21698 20757 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730689.1 protein_id gnl|my_center|LOCUS_02990 21692 22927 gene locus_tag LOCUS_03000 21692 22927 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031122.1 protein_id gnl|my_center|LOCUS_03000 23088 25325 gene locus_tag LOCUS_03010 23088 25325 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941142.1 protein_id gnl|my_center|LOCUS_03010 25458 26459 gene locus_tag LOCUS_03020 25458 26459 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554710.1 protein_id gnl|my_center|LOCUS_03020 26503 27597 gene locus_tag LOCUS_03030 26503 27597 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889245.1 protein_id gnl|my_center|LOCUS_03030 27671 28741 gene locus_tag LOCUS_03040 gene pepD 27671 28741 CDS product serine protease PepD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901059.1 protein_id gnl|my_center|LOCUS_03040 29625 28774 gene locus_tag LOCUS_03050 29625 28774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 29624 31963 gene locus_tag LOCUS_03060 29624 31963 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485160.1 protein_id gnl|my_center|LOCUS_03060 32168 32680 gene locus_tag LOCUS_03070 32168 32680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 32741 33247 gene locus_tag LOCUS_03080 32741 33247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 33313 33385 gene locus_tag LOCUS_t00010 33313 33385 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 <34183 33519 gene locus_tag LOCUS_03090 <34183 33519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228032.1:PQQ-dependent sugar dehydrogenase >Feature sequence008 1042 275 gene locus_tag LOCUS_03100 1042 275 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701079.1 protein_id gnl|my_center|LOCUS_03100 1133 2275 gene locus_tag LOCUS_03110 1133 2275 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_03110 3558 2311 gene locus_tag LOCUS_03120 3558 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 4092 3709 gene locus_tag LOCUS_03130 4092 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 5013 4309 gene locus_tag LOCUS_03140 5013 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 6495 5161 gene locus_tag LOCUS_03150 6495 5161 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_03150 8006 6921 gene locus_tag LOCUS_03160 gene rpoD 8006 6921 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226225.1 protein_id gnl|my_center|LOCUS_03160 9121 8282 gene locus_tag LOCUS_03170 9121 8282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 8694 8711 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9295 10050 gene locus_tag LOCUS_03180 9295 10050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 10080 10086 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11120 10128 gene locus_tag LOCUS_03190 gene glpX 11120 10128 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973930.1 protein_id gnl|my_center|LOCUS_03190 11224 12000 gene locus_tag LOCUS_03200 11224 12000 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229388.1 protein_id gnl|my_center|LOCUS_03200 12122 14449 gene locus_tag LOCUS_03210 gene lon 12122 14449 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222513.1 protein_id gnl|my_center|LOCUS_03210 14487 16313 gene locus_tag LOCUS_03220 14487 16313 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223844.1 protein_id gnl|my_center|LOCUS_03220 17101 16376 gene locus_tag LOCUS_03230 17101 16376 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225866.1 protein_id gnl|my_center|LOCUS_03230 18257 17106 gene locus_tag LOCUS_03240 18257 17106 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066508.1 protein_id gnl|my_center|LOCUS_03240 18831 18271 gene locus_tag LOCUS_03250 18831 18271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 19094 19306 gene locus_tag LOCUS_03260 19094 19306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 20215 19454 gene locus_tag LOCUS_03270 20215 19454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 20532 20852 gene locus_tag LOCUS_03280 20532 20852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 21542 20880 gene locus_tag LOCUS_03290 21542 20880 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976991.1 protein_id gnl|my_center|LOCUS_03290 23223 21679 gene locus_tag LOCUS_03300 23223 21679 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141135.1 protein_id gnl|my_center|LOCUS_03300 24785 23268 gene locus_tag LOCUS_03310 24785 23268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 26253 24844 gene locus_tag LOCUS_03320 26253 24844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 26992 26258 gene locus_tag LOCUS_03330 26992 26258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 27613 27239 gene locus_tag LOCUS_03340 27613 27239 CDS product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227790.1 protein_id gnl|my_center|LOCUS_03340 28230 27739 gene locus_tag LOCUS_03350 28230 27739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 28284 28505 gene locus_tag LOCUS_03360 28284 28505 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227652.1 protein_id gnl|my_center|LOCUS_03360 28854 28603 gene locus_tag LOCUS_03370 28854 28603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 29918 29274 gene locus_tag LOCUS_03380 29918 29274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 29983 30369 gene locus_tag LOCUS_03390 29983 30369 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087886.1 protein_id gnl|my_center|LOCUS_03390 31260 30403 gene locus_tag LOCUS_03400 31260 30403 CDS product PhzF family phenazine biosynthesis isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668695.1 protein_id gnl|my_center|LOCUS_03400 31385 32299 gene locus_tag LOCUS_03410 31385 32299 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230161.1 protein_id gnl|my_center|LOCUS_03410 32775 32395 gene locus_tag LOCUS_03420 32775 32395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 >Feature sequence009 1167 1871 gene locus_tag LOCUS_03430 1167 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03430 2839 1838 gene locus_tag LOCUS_03440 2839 1838 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729219.1 protein_id gnl|my_center|LOCUS_03440 2310 2381 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2970 3998 gene locus_tag LOCUS_03450 2970 3998 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096289.1 protein_id gnl|my_center|LOCUS_03450 3989 5701 gene locus_tag LOCUS_03460 3989 5701 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256231.1 protein_id gnl|my_center|LOCUS_03460 6276 5698 gene locus_tag LOCUS_03470 6276 5698 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444959.1 protein_id gnl|my_center|LOCUS_03470 6975 6304 gene locus_tag LOCUS_03480 6975 6304 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226141.1 protein_id gnl|my_center|LOCUS_03480 7127 8194 gene locus_tag LOCUS_03490 7127 8194 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853704.1 protein_id gnl|my_center|LOCUS_03490 8205 9197 gene locus_tag LOCUS_03500 8205 9197 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027336.1 protein_id gnl|my_center|LOCUS_03500 13537 9668 gene locus_tag LOCUS_03510 gene hrpA 13537 9668 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228749.1 protein_id gnl|my_center|LOCUS_03510 14485 13664 gene locus_tag LOCUS_03520 14485 13664 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037155.1 protein_id gnl|my_center|LOCUS_03520 14737 17400 gene locus_tag LOCUS_03530 14737 17400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 17582 17376 gene locus_tag LOCUS_03540 17582 17376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 17977 17537 gene locus_tag LOCUS_03550 17977 17537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 18139 18561 gene locus_tag LOCUS_03560 18139 18561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 19332 18595 gene locus_tag LOCUS_03570 19332 18595 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908207.1 protein_id gnl|my_center|LOCUS_03570 19485 20492 gene locus_tag LOCUS_03580 gene nadA 19485 20492 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257284.1 protein_id gnl|my_center|LOCUS_03580 20525 22006 gene locus_tag LOCUS_03590 gene nadB 20525 22006 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257285.1 protein_id gnl|my_center|LOCUS_03590 22011 22850 gene locus_tag LOCUS_03600 gene nadC 22011 22850 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228350.1 protein_id gnl|my_center|LOCUS_03600 23697 22900 gene locus_tag LOCUS_03610 23697 22900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 24385 23702 gene locus_tag LOCUS_03620 24385 23702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 25557 24634 gene locus_tag LOCUS_03630 25557 24634 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_03630 26442 25831 gene locus_tag LOCUS_03640 26442 25831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 26747 26457 gene locus_tag LOCUS_03650 26747 26457 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729587.1 protein_id gnl|my_center|LOCUS_03650 27089 26799 gene locus_tag LOCUS_03660 27089 26799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 27243 27172 gene locus_tag LOCUS_t00020 27243 27172 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 28595 27336 gene locus_tag LOCUS_03670 28595 27336 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226226.1 protein_id gnl|my_center|LOCUS_03670 29288 28608 gene locus_tag LOCUS_03680 29288 28608 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393295.1 protein_id gnl|my_center|LOCUS_03680 29713 29285 gene locus_tag LOCUS_03690 29713 29285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 31973 29724 gene locus_tag LOCUS_03700 31973 29724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 30177 30210 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32143 31970 gene locus_tag LOCUS_03710 32143 31970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 <33485 32144 gene locus_tag LOCUS_03720 <33485 32144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392858.1:amino acid permease >Feature sequence010 328 1752 gene locus_tag LOCUS_03730 328 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 2494 1799 gene locus_tag LOCUS_03740 2494 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 2919 4508 gene locus_tag LOCUS_03750 2919 4508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 5998 4412 gene locus_tag LOCUS_03760 5998 4412 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227966.1 protein_id gnl|my_center|LOCUS_03760 6985 6008 gene locus_tag LOCUS_03770 6985 6008 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969887.1 protein_id gnl|my_center|LOCUS_03770 7896 6964 gene locus_tag LOCUS_03780 7896 6964 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220209699.1 protein_id gnl|my_center|LOCUS_03780 8176 8721 gene locus_tag LOCUS_03790 8176 8721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 9258 9518 gene locus_tag LOCUS_03800 9258 9518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 9519 11552 gene locus_tag LOCUS_03810 gene rmdB 9519 11552 CDS product cyclic Di-GMP phosphodiesterase RmdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030279.1 protein_id gnl|my_center|LOCUS_03810 13408 11603 gene locus_tag LOCUS_03820 13408 11603 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029115.1 protein_id gnl|my_center|LOCUS_03820 13891 13430 gene locus_tag LOCUS_03830 13891 13430 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228136.1 protein_id gnl|my_center|LOCUS_03830 14020 15708 gene locus_tag LOCUS_03840 14020 15708 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073255020.1 protein_id gnl|my_center|LOCUS_03840 15705 17339 gene locus_tag LOCUS_03850 15705 17339 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776426.1 protein_id gnl|my_center|LOCUS_03850 16901 16968 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17649 18194 gene locus_tag LOCUS_03860 17649 18194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 20025 18406 gene locus_tag LOCUS_03870 20025 18406 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031630.1 protein_id gnl|my_center|LOCUS_03870 20468 20049 gene locus_tag LOCUS_03880 20468 20049 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027424.1 protein_id gnl|my_center|LOCUS_03880 20578 22044 gene locus_tag LOCUS_03890 20578 22044 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728966.1 protein_id gnl|my_center|LOCUS_03890 22081 22689 gene locus_tag LOCUS_03900 22081 22689 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256875.1 protein_id gnl|my_center|LOCUS_03900 22784 23260 gene locus_tag LOCUS_03910 22784 23260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 23250 23741 gene locus_tag LOCUS_03920 23250 23741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 23826 25016 gene locus_tag LOCUS_03930 23826 25016 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138052126.1 protein_id gnl|my_center|LOCUS_03930 25839 25063 gene locus_tag LOCUS_03940 25839 25063 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224644.1 protein_id gnl|my_center|LOCUS_03940 25947 26420 gene locus_tag LOCUS_03950 25947 26420 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479949.1 protein_id gnl|my_center|LOCUS_03950 26445 27212 gene locus_tag LOCUS_03960 gene sufC 26445 27212 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259318.1 protein_id gnl|my_center|LOCUS_03960 27209 28420 gene locus_tag LOCUS_03970 27209 28420 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259320.1 protein_id gnl|my_center|LOCUS_03970 28440 28913 gene locus_tag LOCUS_03980 28440 28913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 28916 29203 gene locus_tag LOCUS_03990 28916 29203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 30920 29262 gene locus_tag LOCUS_04000 30920 29262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 30155 30215 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32120 31032 gene locus_tag LOCUS_04010 32120 31032 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228500.1 protein_id gnl|my_center|LOCUS_04010 >Feature sequence011 2991 880 gene locus_tag LOCUS_04020 gene flhA 2991 880 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870057.1 protein_id gnl|my_center|LOCUS_04020 4049 2988 gene locus_tag LOCUS_04030 gene flhB 4049 2988 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_04030 4843 4049 gene locus_tag LOCUS_04040 gene fliR 4843 4049 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392309.1 protein_id gnl|my_center|LOCUS_04040 5115 4843 gene locus_tag LOCUS_04050 gene fliQ 5115 4843 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160414.1 protein_id gnl|my_center|LOCUS_04050 5750 5112 gene locus_tag LOCUS_04060 gene fliP 5750 5112 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272500.1 protein_id gnl|my_center|LOCUS_04060 6379 5747 gene locus_tag LOCUS_04070 6379 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 6926 6549 gene locus_tag LOCUS_04080 6926 6549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 7387 6923 gene locus_tag LOCUS_04090 7387 6923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 8264 7416 gene locus_tag LOCUS_04100 8264 7416 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943655.1 protein_id gnl|my_center|LOCUS_04100 9070 8270 gene locus_tag LOCUS_04110 9070 8270 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460801.1 protein_id gnl|my_center|LOCUS_04110 9360 9067 gene locus_tag LOCUS_04120 9360 9067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 9496 10560 gene locus_tag LOCUS_04130 9496 10560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 11407 10562 gene locus_tag LOCUS_04140 11407 10562 CDS product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392300.1 protein_id gnl|my_center|LOCUS_04140 11867 11448 gene locus_tag LOCUS_04150 gene flgD 11867 11448 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870071.1 protein_id gnl|my_center|LOCUS_04150 13727 11889 gene locus_tag LOCUS_04160 13727 11889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 14500 13727 gene locus_tag LOCUS_04170 14500 13727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 14955 14497 gene locus_tag LOCUS_04180 14955 14497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 16538 15099 gene locus_tag LOCUS_04190 gene fliI 16538 15099 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392295.1 protein_id gnl|my_center|LOCUS_04190 17182 16535 gene locus_tag LOCUS_04200 17182 16535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 17095 17130 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18246 17185 gene locus_tag LOCUS_04210 gene fliG 18246 17185 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082903.1 protein_id gnl|my_center|LOCUS_04210 19790 18243 gene locus_tag LOCUS_04220 gene fliF 19790 18243 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941078.1 protein_id gnl|my_center|LOCUS_04220 18942 19051 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20131 19805 gene locus_tag LOCUS_04230 20131 19805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 20577 20131 gene locus_tag LOCUS_04240 gene flgC 20577 20131 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941076.1 protein_id gnl|my_center|LOCUS_04240 20932 20579 gene locus_tag LOCUS_04250 gene flgB 20932 20579 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097783.1 protein_id gnl|my_center|LOCUS_04250 21376 21086 gene locus_tag LOCUS_04260 21376 21086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 21870 21421 gene locus_tag LOCUS_04270 21870 21421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 23337 21979 gene locus_tag LOCUS_04280 23337 21979 CDS product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242960.1 protein_id gnl|my_center|LOCUS_04280 23735 23340 gene locus_tag LOCUS_04290 23735 23340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 24610 23798 gene locus_tag LOCUS_04300 gene whiG 24610 23798 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973389.1 protein_id gnl|my_center|LOCUS_04300 24966 24688 gene locus_tag LOCUS_04310 24966 24688 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392518.1 protein_id gnl|my_center|LOCUS_04310 25054 25107 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25534 25319 gene locus_tag LOCUS_04320 25534 25319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 25579 26262 gene locus_tag LOCUS_04330 gene flgF 25579 26262 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392318.1 protein_id gnl|my_center|LOCUS_04330 26348 27088 gene locus_tag LOCUS_04340 gene flgG 26348 27088 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869894.1 protein_id gnl|my_center|LOCUS_04340 27085 27363 gene locus_tag LOCUS_04350 27085 27363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 27360 27878 gene locus_tag LOCUS_04360 27360 27878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 27882 29252 gene locus_tag LOCUS_04370 gene flgK 27882 29252 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392267.1 protein_id gnl|my_center|LOCUS_04370 29293 30201 gene locus_tag LOCUS_04380 gene flgL 29293 30201 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 protein_id gnl|my_center|LOCUS_04380 >Feature sequence012 355 119 gene locus_tag LOCUS_04390 355 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 1316 444 gene locus_tag LOCUS_04400 gene thiD 1316 444 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002035802.1 protein_id gnl|my_center|LOCUS_04400 2485 1364 gene locus_tag LOCUS_04410 gene dprA 2485 1364 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392539.1 protein_id gnl|my_center|LOCUS_04410 4005 2482 gene locus_tag LOCUS_04420 4005 2482 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174141.1 protein_id gnl|my_center|LOCUS_04420 4373 4005 gene locus_tag LOCUS_04430 4373 4005 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813644.1 protein_id gnl|my_center|LOCUS_04430 5314 4607 gene locus_tag LOCUS_04440 5314 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 5996 5373 gene locus_tag LOCUS_04450 gene lepB 5996 5373 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583882.1 protein_id gnl|my_center|LOCUS_04450 6572 6000 gene locus_tag LOCUS_04460 6572 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 7207 6518 gene locus_tag LOCUS_04470 gene trmD 7207 6518 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686903.1 protein_id gnl|my_center|LOCUS_04470 7676 7212 gene locus_tag LOCUS_04480 7676 7212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 7932 7699 gene locus_tag LOCUS_04490 7932 7699 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965063.1 protein_id gnl|my_center|LOCUS_04490 8193 7948 gene locus_tag LOCUS_04500 gene rpsP 8193 7948 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699989.1 protein_id gnl|my_center|LOCUS_04500 9550 8216 gene locus_tag LOCUS_04510 gene ffh 9550 8216 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863461.1 protein_id gnl|my_center|LOCUS_04510 10828 9566 gene locus_tag LOCUS_04520 10828 9566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 11273 10848 gene locus_tag LOCUS_04530 11273 10848 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728853.1 protein_id gnl|my_center|LOCUS_04530 12321 11320 gene locus_tag LOCUS_04540 gene ftsY 12321 11320 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081293.1 protein_id gnl|my_center|LOCUS_04540 15675 12421 gene locus_tag LOCUS_04550 gene smc 15675 12421 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899542.1 protein_id gnl|my_center|LOCUS_04550 16234 15689 gene locus_tag LOCUS_04560 16234 15689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 16623 16363 gene locus_tag LOCUS_04570 16623 16363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 17753 16665 gene locus_tag LOCUS_04580 gene plsX 17753 16665 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_04580 17978 17769 gene locus_tag LOCUS_04590 gene rpmF 17978 17769 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830121.1 protein_id gnl|my_center|LOCUS_04590 18521 18000 gene locus_tag LOCUS_04600 18521 18000 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973424.1 protein_id gnl|my_center|LOCUS_04600 19097 20395 gene locus_tag LOCUS_04610 19097 20395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 21039 20422 gene locus_tag LOCUS_04620 21039 20422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 21625 21161 gene locus_tag LOCUS_04630 21625 21161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 22140 21643 gene locus_tag LOCUS_04640 gene coaD 22140 21643 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173005.1 protein_id gnl|my_center|LOCUS_04640 22663 22127 gene locus_tag LOCUS_04650 gene rsmD 22663 22127 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_04650 24786 22660 gene locus_tag LOCUS_04660 gene recG 24786 22660 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056582.1 protein_id gnl|my_center|LOCUS_04660 26473 24842 gene locus_tag LOCUS_04670 26473 24842 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245033.1 protein_id gnl|my_center|LOCUS_04670 26750 26490 gene locus_tag LOCUS_04680 26750 26490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 26725 28323 gene locus_tag LOCUS_04690 26725 28323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 28891 28466 gene locus_tag LOCUS_04700 gene ribE 28891 28466 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869754.1 protein_id gnl|my_center|LOCUS_04700 <29711 28888 gene locus_tag LOCUS_04710 <29711 28888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392434.1:bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II >Feature sequence013 531 76 gene locus_tag LOCUS_04720 531 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 1705 587 gene locus_tag LOCUS_04730 1705 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 1855 4089 gene locus_tag LOCUS_04740 gene pnp 1855 4089 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076750.1 protein_id gnl|my_center|LOCUS_04740 4102 5385 gene locus_tag LOCUS_04750 4102 5385 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392573.1 protein_id gnl|my_center|LOCUS_04750 5404 6075 gene locus_tag LOCUS_04760 gene dapB 5404 6075 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414099.1 protein_id gnl|my_center|LOCUS_04760 6115 6981 gene locus_tag LOCUS_04770 gene dapA 6115 6981 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422063.1 protein_id gnl|my_center|LOCUS_04770 6978 8645 gene locus_tag LOCUS_04780 6978 8645 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_04780 9119 8760 gene locus_tag LOCUS_04790 9119 8760 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870063.1 protein_id gnl|my_center|LOCUS_04790 10018 9149 gene locus_tag LOCUS_04800 10018 9149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 10999 10025 gene locus_tag LOCUS_04810 gene fliM 10999 10025 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987033.1 protein_id gnl|my_center|LOCUS_04810 11499 10996 gene locus_tag LOCUS_04820 11499 10996 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080666.1 protein_id gnl|my_center|LOCUS_04820 12098 11505 gene locus_tag LOCUS_04830 12098 11505 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006874833.1 protein_id gnl|my_center|LOCUS_04830 14079 12127 gene locus_tag LOCUS_04840 gene cheA 14079 12127 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245734.1 protein_id gnl|my_center|LOCUS_04840 14957 14079 gene locus_tag LOCUS_04850 14957 14079 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359187.1 protein_id gnl|my_center|LOCUS_04850 16000 14954 gene locus_tag LOCUS_04860 16000 14954 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083251.1 protein_id gnl|my_center|LOCUS_04860 16477 16025 gene locus_tag LOCUS_04870 16477 16025 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_04870 17841 16561 gene locus_tag LOCUS_04880 17841 16561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 17735 18061 gene locus_tag LOCUS_04890 17735 18061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 18634 17945 gene locus_tag LOCUS_04900 18634 17945 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230061.1 protein_id gnl|my_center|LOCUS_04900 18709 21483 gene locus_tag LOCUS_04910 18709 21483 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052638.1 protein_id gnl|my_center|LOCUS_04910 21499 22242 gene locus_tag LOCUS_04920 21499 22242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 22239 23531 gene locus_tag LOCUS_04930 22239 23531 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104544.1 protein_id gnl|my_center|LOCUS_04930 23528 24055 gene locus_tag LOCUS_04940 gene thpR 23528 24055 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337456.1 protein_id gnl|my_center|LOCUS_04940 24754 24062 gene locus_tag LOCUS_04950 24754 24062 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973635.1 protein_id gnl|my_center|LOCUS_04950 24908 25996 gene locus_tag LOCUS_04960 gene recA 24908 25996 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057169.1 protein_id gnl|my_center|LOCUS_04960 26010 26570 gene locus_tag LOCUS_04970 26010 26570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 26917 28437 gene locus_tag LOCUS_04980 gene rny 26917 28437 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986783.1 protein_id gnl|my_center|LOCUS_04980 >Feature sequence014 461 646 gene locus_tag LOCUS_04990 gene rpmD 461 646 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222615.1 protein_id gnl|my_center|LOCUS_04990 643 1200 gene locus_tag LOCUS_05000 gene rplO 643 1200 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869910.1 protein_id gnl|my_center|LOCUS_05000 1215 2480 gene locus_tag LOCUS_05010 gene secY 1215 2480 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_05010 2480 3148 gene locus_tag LOCUS_05020 2480 3148 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869908.1 protein_id gnl|my_center|LOCUS_05020 3165 3938 gene locus_tag LOCUS_05030 gene map 3165 3938 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_05030 4215 4598 gene locus_tag LOCUS_05040 gene rpsM 4215 4598 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_05040 4602 4997 gene locus_tag LOCUS_05050 gene rpsK 4602 4997 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908645.1 protein_id gnl|my_center|LOCUS_05050 5000 5620 gene locus_tag LOCUS_05060 gene rpsD 5000 5620 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_05060 5710 6699 gene locus_tag LOCUS_05070 5710 6699 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_05070 6737 7093 gene locus_tag LOCUS_05080 gene rplQ 6737 7093 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722538.1 protein_id gnl|my_center|LOCUS_05080 7135 7851 gene locus_tag LOCUS_05090 gene truA 7135 7851 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_05090 7942 8766 gene locus_tag LOCUS_05100 gene surE 7942 8766 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258539.1 protein_id gnl|my_center|LOCUS_05100 8789 10834 gene locus_tag LOCUS_05110 gene ligA 8789 10834 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256150.1 protein_id gnl|my_center|LOCUS_05110 12155 10893 gene locus_tag LOCUS_05120 12155 10893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 12293 13567 gene locus_tag LOCUS_05130 12293 13567 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259127.1 protein_id gnl|my_center|LOCUS_05130 13832 13647 gene locus_tag LOCUS_05140 13832 13647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 14776 14015 gene locus_tag LOCUS_05150 14776 14015 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377592.1 protein_id gnl|my_center|LOCUS_05150 14883 14958 gene locus_tag LOCUS_t00030 14883 14958 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 15138 15440 gene locus_tag LOCUS_05160 15138 15440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 16316 15657 gene locus_tag LOCUS_05170 16316 15657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 16315 17496 gene locus_tag LOCUS_05180 16315 17496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 17478 17873 gene locus_tag LOCUS_05190 17478 17873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 18351 17893 gene locus_tag LOCUS_05200 18351 17893 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021289.1 protein_id gnl|my_center|LOCUS_05200 19313 18348 gene locus_tag LOCUS_05210 19313 18348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 19463 20353 gene locus_tag LOCUS_05220 19463 20353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 20359 21501 gene locus_tag LOCUS_05230 20359 21501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 21663 23789 gene locus_tag LOCUS_05240 21663 23789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 23888 24640 gene locus_tag LOCUS_05250 23888 24640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256421.1 protein_id gnl|my_center|LOCUS_05250 24637 25062 gene locus_tag LOCUS_05260 24637 25062 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027736.1 protein_id gnl|my_center|LOCUS_05260 25268 25059 gene locus_tag LOCUS_05270 25268 25059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 25445 26689 gene locus_tag LOCUS_05280 25445 26689 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_05280 26698 27453 gene locus_tag LOCUS_05290 26698 27453 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_05290 >Feature sequence015 1091 603 gene locus_tag LOCUS_05300 1091 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05300 1157 1888 gene locus_tag LOCUS_05310 1157 1888 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201153.1 protein_id gnl|my_center|LOCUS_05310 2550 1801 gene locus_tag LOCUS_05320 2550 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 2747 3085 gene locus_tag LOCUS_05330 2747 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 3151 3831 gene locus_tag LOCUS_05340 3151 3831 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545169.1 protein_id gnl|my_center|LOCUS_05340 4839 3877 gene locus_tag LOCUS_05350 4839 3877 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976978.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05350 4849 5049 gene locus_tag LOCUS_05360 4849 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 6988 5075 gene locus_tag LOCUS_05370 6988 5075 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975669.1 protein_id gnl|my_center|LOCUS_05370 7468 8202 gene locus_tag LOCUS_05380 7468 8202 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976414.1 protein_id gnl|my_center|LOCUS_05380 8957 8382 gene locus_tag LOCUS_05390 gene frnE 8957 8382 CDS product protein disulfide isomerase FrnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887304.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05390 9532 8966 gene locus_tag LOCUS_05400 9532 8966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 9649 10110 gene locus_tag LOCUS_05410 9649 10110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 11217 10192 gene locus_tag LOCUS_05420 11217 10192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 11356 12129 gene locus_tag LOCUS_05430 11356 12129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 12126 12893 gene locus_tag LOCUS_05440 12126 12893 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284384.1 protein_id gnl|my_center|LOCUS_05440 13352 13017 gene locus_tag LOCUS_05450 13352 13017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 13864 13349 gene locus_tag LOCUS_05460 13864 13349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 13948 15069 gene locus_tag LOCUS_05470 13948 15069 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_05470 15430 15038 gene locus_tag LOCUS_05480 15430 15038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 15338 15700 gene locus_tag LOCUS_05490 15338 15700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 15751 16644 gene locus_tag LOCUS_05500 15751 16644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 16757 17905 gene locus_tag LOCUS_05510 16757 17905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 18767 17943 gene locus_tag LOCUS_05520 18767 17943 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706576.1 protein_id gnl|my_center|LOCUS_05520 19467 18898 gene locus_tag LOCUS_05530 19467 18898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 19605 21821 gene locus_tag LOCUS_05540 19605 21821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 23019 21874 gene locus_tag LOCUS_05550 23019 21874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 23369 23151 gene locus_tag LOCUS_05560 23369 23151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 23768 23532 gene locus_tag LOCUS_05570 23768 23532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 23685 24146 gene locus_tag LOCUS_05580 23685 24146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05580 24882 24391 gene locus_tag LOCUS_05590 24882 24391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 24784 25002 gene locus_tag LOCUS_05600 24784 25002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 25090 25557 gene locus_tag LOCUS_05610 25090 25557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 <27223 25616 gene locus_tag LOCUS_05620 <27223 25616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030524.1:MMPL family transporter >Feature sequence016 2 1303 gene locus_tag LOCUS_05630 2 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 1363 2040 gene locus_tag LOCUS_05640 1363 2040 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927102.1 protein_id gnl|my_center|LOCUS_05640 3786 2083 gene locus_tag LOCUS_05650 3786 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 3879 5696 gene locus_tag LOCUS_05660 3879 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 6864 5767 gene locus_tag LOCUS_05670 6864 5767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 8286 6952 gene locus_tag LOCUS_05680 8286 6952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 8703 9827 gene locus_tag LOCUS_05690 8703 9827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05690 10803 9871 gene locus_tag LOCUS_05700 10803 9871 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973040.1 protein_id gnl|my_center|LOCUS_05700 10882 13167 gene locus_tag LOCUS_05710 10882 13167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05710 13209 15665 gene locus_tag LOCUS_05720 13209 15665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 15662 16393 gene locus_tag LOCUS_05730 15662 16393 CDS product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031156.1 protein_id gnl|my_center|LOCUS_05730 16381 17505 gene locus_tag LOCUS_05740 16381 17505 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976203.1 protein_id gnl|my_center|LOCUS_05740 17561 18439 gene locus_tag LOCUS_05750 17561 18439 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930031.1 protein_id gnl|my_center|LOCUS_05750 18423 19316 gene locus_tag LOCUS_05760 18423 19316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 21008 19503 gene locus_tag LOCUS_05770 21008 19503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 21051 21848 gene locus_tag LOCUS_05780 21051 21848 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270333.1 protein_id gnl|my_center|LOCUS_05780 21845 22150 gene locus_tag LOCUS_05790 21845 22150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 22399 22785 gene locus_tag LOCUS_05800 22399 22785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 22823 23551 gene locus_tag LOCUS_05810 22823 23551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 23562 24500 gene locus_tag LOCUS_05820 23562 24500 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230821.1 protein_id gnl|my_center|LOCUS_05820 24511 25713 gene locus_tag LOCUS_05830 24511 25713 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886882.1 protein_id gnl|my_center|LOCUS_05830 25762 26886 gene locus_tag LOCUS_05840 25762 26886 CDS product spore photoproduct lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971741.1 protein_id gnl|my_center|LOCUS_05840 >Feature sequence017 1281 907 gene locus_tag LOCUS_05850 1281 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 1391 2143 gene locus_tag LOCUS_05860 1391 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 3408 2188 gene locus_tag LOCUS_05870 gene ilvA 3408 2188 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029975.1 protein_id gnl|my_center|LOCUS_05870 3835 3443 gene locus_tag LOCUS_05880 3835 3443 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168302153.1 protein_id gnl|my_center|LOCUS_05880 3860 5824 gene locus_tag LOCUS_05890 3860 5824 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119948893.1 protein_id gnl|my_center|LOCUS_05890 5917 6387 gene locus_tag LOCUS_05900 5917 6387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 7773 6487 gene locus_tag LOCUS_05910 gene glnA 7773 6487 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545065.1 protein_id gnl|my_center|LOCUS_05910 8298 7897 gene locus_tag LOCUS_05920 8298 7897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 8827 8267 gene locus_tag LOCUS_05930 8827 8267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 9578 9030 gene locus_tag LOCUS_05940 9578 9030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 10344 9850 gene locus_tag LOCUS_05950 10344 9850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 13808 10461 gene locus_tag LOCUS_05960 gene dnaE2 13808 10461 CDS product error-prone DNA polymerase DnaE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003908228.1 protein_id gnl|my_center|LOCUS_05960 15243 14053 gene locus_tag LOCUS_05970 15243 14053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 15957 16154 gene locus_tag LOCUS_05980 15957 16154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 17067 16438 gene locus_tag LOCUS_05990 gene lexA 17067 16438 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930693.1 protein_id gnl|my_center|LOCUS_05990 17203 17287 gene locus_tag LOCUS_t00040 17203 17287 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17351 18361 gene locus_tag LOCUS_06000 17351 18361 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867671.1 protein_id gnl|my_center|LOCUS_06000 18358 19059 gene locus_tag LOCUS_06010 18358 19059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 19059 20954 gene locus_tag LOCUS_06020 gene asnB 19059 20954 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_06020 22052 21105 gene locus_tag LOCUS_06030 22052 21105 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528461.1 protein_id gnl|my_center|LOCUS_06030 24164 22077 gene locus_tag LOCUS_06040 24164 22077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 24410 25207 gene locus_tag LOCUS_06050 24410 25207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 >Feature sequence018 328 510 gene locus_tag LOCUS_06060 328 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 507 758 gene locus_tag LOCUS_06070 507 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 773 2515 gene locus_tag LOCUS_06080 773 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 2571 3350 gene locus_tag LOCUS_06090 2571 3350 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226107.1 protein_id gnl|my_center|LOCUS_06090 3886 5709 gene locus_tag LOCUS_06100 3886 5709 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027999.1 protein_id gnl|my_center|LOCUS_06100 7125 5791 gene locus_tag LOCUS_06110 7125 5791 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460069.1 protein_id gnl|my_center|LOCUS_06110 7326 8216 gene locus_tag LOCUS_06120 7326 8216 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403630.1 protein_id gnl|my_center|LOCUS_06120 8213 8638 gene locus_tag LOCUS_06130 8213 8638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 9481 8696 gene locus_tag LOCUS_06140 9481 8696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 10365 9598 gene locus_tag LOCUS_06150 10365 9598 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086847270.1 protein_id gnl|my_center|LOCUS_06150 10952 10362 gene locus_tag LOCUS_06160 10952 10362 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 protein_id gnl|my_center|LOCUS_06160 11373 11011 gene locus_tag LOCUS_06170 11373 11011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 12158 11376 gene locus_tag LOCUS_06180 12158 11376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 12206 12763 gene locus_tag LOCUS_06190 12206 12763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 12773 13687 gene locus_tag LOCUS_06200 12773 13687 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_06200 13684 14073 gene locus_tag LOCUS_06210 13684 14073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 14138 14212 gene locus_tag LOCUS_t00050 14138 14212 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 14728 14396 gene locus_tag LOCUS_06220 14728 14396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 14964 15386 gene locus_tag LOCUS_06230 14964 15386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 15425 15615 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16141 16311 gene locus_tag LOCUS_06240 16141 16311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06240 16308 17021 gene locus_tag LOCUS_06250 16308 17021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 18140 18619 gene locus_tag LOCUS_06260 18140 18619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06260 18806 19519 gene locus_tag LOCUS_06270 18806 19519 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222950.1 protein_id gnl|my_center|LOCUS_06270 20364 19717 gene locus_tag LOCUS_06280 20364 19717 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387193.1 protein_id gnl|my_center|LOCUS_06280 21195 20509 gene locus_tag LOCUS_06290 gene rlmB 21195 20509 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459087.1 protein_id gnl|my_center|LOCUS_06290 22957 21515 gene locus_tag LOCUS_06300 gene cysS 22957 21515 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913180.1 protein_id gnl|my_center|LOCUS_06300 23039 23404 gene locus_tag LOCUS_06310 23039 23404 CDS product DUF6157 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090582.1 protein_id gnl|my_center|LOCUS_06310 23932 23453 gene locus_tag LOCUS_06320 gene ispF 23932 23453 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404396.1 protein_id gnl|my_center|LOCUS_06320 24771 23938 gene locus_tag LOCUS_06330 24771 23938 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582599.1 protein_id gnl|my_center|LOCUS_06330 25421 24765 gene locus_tag LOCUS_06340 gene ispD 25421 24765 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731019.1 protein_id gnl|my_center|LOCUS_06340 >Feature sequence019 778 3102 gene locus_tag LOCUS_06350 778 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 3418 3608 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3689 5248 gene locus_tag LOCUS_06360 gene dnaK 3689 5248 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_06360 5245 6021 gene locus_tag LOCUS_06370 5245 6021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 6035 7165 gene locus_tag LOCUS_06380 gene dnaJ 6035 7165 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230010.1 protein_id gnl|my_center|LOCUS_06380 7165 7647 gene locus_tag LOCUS_06390 7165 7647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 8838 7684 gene locus_tag LOCUS_06400 8838 7684 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104262.1 protein_id gnl|my_center|LOCUS_06400 10241 8835 gene locus_tag LOCUS_06410 10241 8835 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142001.1 protein_id gnl|my_center|LOCUS_06410 10491 13082 gene locus_tag LOCUS_06420 gene clpB 10491 13082 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258977.1 protein_id gnl|my_center|LOCUS_06420 15065 13194 gene locus_tag LOCUS_06430 15065 13194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 15944 15276 gene locus_tag LOCUS_06440 15944 15276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 16061 17329 gene locus_tag LOCUS_06450 gene purD 16061 17329 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393539.1 protein_id gnl|my_center|LOCUS_06450 17313 17855 gene locus_tag LOCUS_06460 17313 17855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 17852 19129 gene locus_tag LOCUS_06470 gene purB 17852 19129 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393548.1 protein_id gnl|my_center|LOCUS_06470 19191 20063 gene locus_tag LOCUS_06480 19191 20063 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224066.1 protein_id gnl|my_center|LOCUS_06480 20060 20302 gene locus_tag LOCUS_06490 gene purS 20060 20302 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880575.1 protein_id gnl|my_center|LOCUS_06490 20299 20964 gene locus_tag LOCUS_06500 gene purQ 20299 20964 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403995.1 protein_id gnl|my_center|LOCUS_06500 20961 23174 gene locus_tag LOCUS_06510 gene purL 20961 23174 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_06510 23283 24758 gene locus_tag LOCUS_06520 gene purF 23283 24758 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257473.1 protein_id gnl|my_center|LOCUS_06520 >Feature sequence020 721 1024 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1688 1305 gene locus_tag LOCUS_06530 1688 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 2385 1864 gene locus_tag LOCUS_06540 2385 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 2677 2602 gene locus_tag LOCUS_t00060 2677 2602 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4000 2753 gene locus_tag LOCUS_06550 4000 2753 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776106.1 protein_id gnl|my_center|LOCUS_06550 5031 3997 gene locus_tag LOCUS_06560 5031 3997 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776118.1 protein_id gnl|my_center|LOCUS_06560 5266 6246 gene locus_tag LOCUS_06570 5266 6246 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084065.1 protein_id gnl|my_center|LOCUS_06570 7104 6346 gene locus_tag LOCUS_06580 7104 6346 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027942.1 protein_id gnl|my_center|LOCUS_06580 7187 8059 gene locus_tag LOCUS_06590 7187 8059 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_06590 8470 8979 gene locus_tag LOCUS_06600 8470 8979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 9095 9182 gene locus_tag LOCUS_t00070 9095 9182 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9191 9742 gene locus_tag LOCUS_06610 9191 9742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 9899 11596 gene locus_tag LOCUS_06620 9899 11596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 11669 11998 gene locus_tag LOCUS_06630 11669 11998 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537521.1 protein_id gnl|my_center|LOCUS_06630 12527 12024 gene locus_tag LOCUS_06640 12527 12024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 13249 12572 gene locus_tag LOCUS_06650 13249 12572 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173343.1 protein_id gnl|my_center|LOCUS_06650 13554 13258 gene locus_tag LOCUS_06660 13554 13258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 14484 13669 gene locus_tag LOCUS_06670 14484 13669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 15709 14660 gene locus_tag LOCUS_06680 15709 14660 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142291.1 protein_id gnl|my_center|LOCUS_06680 15835 16764 gene locus_tag LOCUS_06690 15835 16764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 16859 17092 gene locus_tag LOCUS_06700 16859 17092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 17393 17160 gene locus_tag LOCUS_06710 17393 17160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 17539 18186 gene locus_tag LOCUS_06720 17539 18186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 18500 18183 gene locus_tag LOCUS_06730 18500 18183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 18849 18544 gene locus_tag LOCUS_06740 18849 18544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 20209 18935 gene locus_tag LOCUS_06750 gene eno 20209 18935 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_06750 21147 20206 gene locus_tag LOCUS_06760 21147 20206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 22270 21161 gene locus_tag LOCUS_06770 22270 21161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 <25426 22307 gene locus_tag LOCUS_06780 <25426 22307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010907633.1:transcription-repair coupling factor >Feature sequence021 540 361 gene locus_tag LOCUS_06790 540 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 1088 843 gene locus_tag LOCUS_06800 1088 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 2434 1232 gene locus_tag LOCUS_06810 2434 1232 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971802.1 protein_id gnl|my_center|LOCUS_06810 3444 2452 gene locus_tag LOCUS_06820 gene moaA 3444 2452 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230243.1 protein_id gnl|my_center|LOCUS_06820 3917 3441 gene locus_tag LOCUS_06830 gene moaC 3917 3441 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093030.1 protein_id gnl|my_center|LOCUS_06830 3960 4643 gene locus_tag LOCUS_06840 3960 4643 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227680.1 protein_id gnl|my_center|LOCUS_06840 4799 5692 gene locus_tag LOCUS_06850 4799 5692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 5403 5409 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5668 6690 gene locus_tag LOCUS_06860 5668 6690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 6614 6973 gene locus_tag LOCUS_06870 6614 6973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06870 6998 7933 gene locus_tag LOCUS_06880 6998 7933 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125309.1 protein_id gnl|my_center|LOCUS_06880 8396 7977 gene locus_tag LOCUS_06890 8396 7977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 10021 8456 gene locus_tag LOCUS_06900 10021 8456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 11392 10178 gene locus_tag LOCUS_06910 11392 10178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 11346 12455 gene locus_tag LOCUS_06920 11346 12455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 12836 12486 gene locus_tag LOCUS_06930 12836 12486 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429306.1 protein_id gnl|my_center|LOCUS_06930 13026 13379 gene locus_tag LOCUS_06940 13026 13379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 13603 13424 gene locus_tag LOCUS_06950 13603 13424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 13569 14786 gene locus_tag LOCUS_06960 13569 14786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 15192 14821 gene locus_tag LOCUS_06970 15192 14821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 15241 16209 gene locus_tag LOCUS_06980 15241 16209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970274.1 protein_id gnl|my_center|LOCUS_06980 16310 16723 gene locus_tag LOCUS_06990 16310 16723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 18018 16843 gene locus_tag LOCUS_07000 18018 16843 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140737.1 protein_id gnl|my_center|LOCUS_07000 18773 18018 gene locus_tag LOCUS_07010 18773 18018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 19144 20181 gene locus_tag LOCUS_07020 19144 20181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 20188 20505 gene locus_tag LOCUS_07030 20188 20505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 20509 20649 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20702 21007 gene locus_tag LOCUS_07040 20702 21007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 21659 21033 gene locus_tag LOCUS_07050 21659 21033 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111108.1 protein_id gnl|my_center|LOCUS_07050 21871 22659 gene locus_tag LOCUS_07060 21871 22659 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141879.1 protein_id gnl|my_center|LOCUS_07060 >Feature sequence022 90 2495 gene locus_tag LOCUS_07070 gene gyrB 90 2495 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458663.1 protein_id gnl|my_center|LOCUS_07070 2509 5565 gene locus_tag LOCUS_07080 gene gyrA 2509 5565 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_07080 5951 6151 gene locus_tag LOCUS_07090 5951 6151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 6912 6319 gene locus_tag LOCUS_07100 6912 6319 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258555.1 protein_id gnl|my_center|LOCUS_07100 7989 7006 gene locus_tag LOCUS_07110 7989 7006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 8522 7986 gene locus_tag LOCUS_07120 8522 7986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 9666 8551 gene locus_tag LOCUS_07130 9666 8551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 9888 11630 gene locus_tag LOCUS_07140 9888 11630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 11665 12441 gene locus_tag LOCUS_07150 11665 12441 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392424.1 protein_id gnl|my_center|LOCUS_07150 12445 12945 gene locus_tag LOCUS_07160 gene fhaB 12445 12945 CDS product antibiotic biosynthesis regulator FhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975090.1 protein_id gnl|my_center|LOCUS_07160 12951 14303 gene locus_tag LOCUS_07170 12951 14303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 13961 13979 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14300 15607 gene locus_tag LOCUS_07180 14300 15607 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029267.1 protein_id gnl|my_center|LOCUS_07180 15604 17025 gene locus_tag LOCUS_07190 15604 17025 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776672.1 protein_id gnl|my_center|LOCUS_07190 17037 19079 gene locus_tag LOCUS_07200 gene pknB 17037 19079 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891355.1 protein_id gnl|my_center|LOCUS_07200 19079 20065 gene locus_tag LOCUS_07210 19079 20065 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056373.1 protein_id gnl|my_center|LOCUS_07210 21626 20103 gene locus_tag LOCUS_07220 21626 20103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 22747 21755 gene locus_tag LOCUS_07230 gene uvsE 22747 21755 CDS product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110499.1 protein_id gnl|my_center|LOCUS_07230 23612 22761 gene locus_tag LOCUS_07240 23612 22761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 24002 23772 gene locus_tag LOCUS_07250 gene csrA 24002 23772 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943667.1 protein_id gnl|my_center|LOCUS_07250 >Feature sequence023 1859 1383 gene locus_tag LOCUS_07260 gene greA 1859 1383 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391698.1 protein_id gnl|my_center|LOCUS_07260 2991 2002 gene locus_tag LOCUS_07270 gene dusB 2991 2002 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476300.1 protein_id gnl|my_center|LOCUS_07270 3780 3001 gene locus_tag LOCUS_07280 3780 3001 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_07280 4349 3792 gene locus_tag LOCUS_07290 4349 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 6493 4346 gene locus_tag LOCUS_07300 6493 4346 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730364.1 protein_id gnl|my_center|LOCUS_07300 6945 6508 gene locus_tag LOCUS_07310 6945 6508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 7790 6900 gene locus_tag LOCUS_07320 gene folP 7790 6900 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921057.1 protein_id gnl|my_center|LOCUS_07320 9783 7798 gene locus_tag LOCUS_07330 gene ftsH 9783 7798 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867756.1 protein_id gnl|my_center|LOCUS_07330 10546 10007 gene locus_tag LOCUS_07340 gene hpt 10546 10007 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230473.1 protein_id gnl|my_center|LOCUS_07340 11849 10533 gene locus_tag LOCUS_07350 gene tilS 11849 10533 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942455.1 protein_id gnl|my_center|LOCUS_07350 12074 12158 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12284 12988 gene locus_tag LOCUS_07360 12284 12988 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173486.1 protein_id gnl|my_center|LOCUS_07360 13648 13007 gene locus_tag LOCUS_07370 13648 13007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 14432 13689 gene locus_tag LOCUS_07380 14432 13689 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727181.1 protein_id gnl|my_center|LOCUS_07380 15729 14626 gene locus_tag LOCUS_07390 15729 14626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07390 16597 15719 gene locus_tag LOCUS_07400 16597 15719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07400 16634 17332 gene locus_tag LOCUS_07410 gene aat 16634 17332 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 protein_id gnl|my_center|LOCUS_07410 17370 17699 gene locus_tag LOCUS_07420 17370 17699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 18721 17783 gene locus_tag LOCUS_07430 18721 17783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 18840 20465 gene locus_tag LOCUS_07440 18840 20465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 20778 20479 gene locus_tag LOCUS_07450 20778 20479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 20871 21740 gene locus_tag LOCUS_07460 20871 21740 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393090.1 protein_id gnl|my_center|LOCUS_07460 21737 23173 gene locus_tag LOCUS_07470 21737 23173 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729941.1 protein_id gnl|my_center|LOCUS_07470 23310 24074 gene locus_tag LOCUS_07480 23310 24074 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256330.1 protein_id gnl|my_center|LOCUS_07480 >Feature sequence024 <1 1589 gene locus_tag LOCUS_07490 <1 1589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000119621.1:ferredoxin--nitrite reductase 1570 2304 gene locus_tag LOCUS_07500 1570 2304 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232103.1 protein_id gnl|my_center|LOCUS_07500 2304 3278 gene locus_tag LOCUS_07510 2304 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 3275 4192 gene locus_tag LOCUS_07520 gene cysD 3275 4192 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466878.1 protein_id gnl|my_center|LOCUS_07520 4242 5486 gene locus_tag LOCUS_07530 4242 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07530 5533 6120 gene locus_tag LOCUS_07540 5533 6120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07540 6145 6471 gene locus_tag LOCUS_07550 6145 6471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 7483 6569 gene locus_tag LOCUS_07560 7483 6569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07560 8862 7378 gene locus_tag LOCUS_07570 8862 7378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07570 9665 9252 gene locus_tag LOCUS_07580 9665 9252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 9846 11885 gene locus_tag LOCUS_07590 9846 11885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 11983 12747 gene locus_tag LOCUS_07600 11983 12747 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975902.1 protein_id gnl|my_center|LOCUS_07600 14405 12762 gene locus_tag LOCUS_07610 14405 12762 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027201.1 protein_id gnl|my_center|LOCUS_07610 14810 15451 gene locus_tag LOCUS_07620 14810 15451 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097831.1 protein_id gnl|my_center|LOCUS_07620 15503 16165 gene locus_tag LOCUS_07630 15503 16165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 16344 16880 gene locus_tag LOCUS_07640 16344 16880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 17310 17026 gene locus_tag LOCUS_07650 17310 17026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 18462 17332 gene locus_tag LOCUS_07660 18462 17332 CDS product glucose-1-phosphate adenylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350023.1 protein_id gnl|my_center|LOCUS_07660 19279 18548 gene locus_tag LOCUS_07670 19279 18548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 19506 20222 gene locus_tag LOCUS_07680 gene tenA 19506 20222 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144509.1 protein_id gnl|my_center|LOCUS_07680 20747 20232 gene locus_tag LOCUS_07690 gene purE 20747 20232 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056214.1 protein_id gnl|my_center|LOCUS_07690 21992 20832 gene locus_tag LOCUS_07700 21992 20832 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056211.1 protein_id gnl|my_center|LOCUS_07700 22662 22255 gene locus_tag LOCUS_07710 22662 22255 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222011.1 protein_id gnl|my_center|LOCUS_07710 23203 22685 gene locus_tag LOCUS_07720 23203 22685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 23087 23374 gene locus_tag LOCUS_07730 23087 23374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 23533 23874 gene locus_tag LOCUS_07740 23533 23874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 >Feature sequence025 <1 584 gene locus_tag LOCUS_07750 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812508.1:ATP-dependent Clp endopeptidase proteolytic subunit ClpP 670 1944 gene locus_tag LOCUS_07760 gene clpX 670 1944 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412634.1 protein_id gnl|my_center|LOCUS_07760 2017 4620 gene locus_tag LOCUS_07770 2017 4620 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392069.1 protein_id gnl|my_center|LOCUS_07770 4617 5954 gene locus_tag LOCUS_07780 4617 5954 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943004.1 protein_id gnl|my_center|LOCUS_07780 6086 6619 gene locus_tag LOCUS_07790 6086 6619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 6662 7066 gene locus_tag LOCUS_07800 gene ndk 6662 7066 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_07800 7082 7657 gene locus_tag LOCUS_07810 7082 7657 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_07810 7790 8845 gene locus_tag LOCUS_07820 7790 8845 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_07820 8922 9764 gene locus_tag LOCUS_07830 gene mreC 8922 9764 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392075.1 protein_id gnl|my_center|LOCUS_07830 9761 10327 gene locus_tag LOCUS_07840 9761 10327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 10021 10028 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10324 12546 gene locus_tag LOCUS_07850 10324 12546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 12546 13763 gene locus_tag LOCUS_07860 gene rodA 12546 13763 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460900.1 protein_id gnl|my_center|LOCUS_07860 13778 16081 gene locus_tag LOCUS_07870 13778 16081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 16090 16443 gene locus_tag LOCUS_07880 gene rplU 16090 16443 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896002.1 protein_id gnl|my_center|LOCUS_07880 16451 16750 gene locus_tag LOCUS_07890 16451 16750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 17339 16776 gene locus_tag LOCUS_07900 17339 16776 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933301.1 protein_id gnl|my_center|LOCUS_07900 18191 17502 gene locus_tag LOCUS_07910 18191 17502 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932977.1 protein_id gnl|my_center|LOCUS_07910 19193 18297 gene locus_tag LOCUS_07920 19193 18297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 20008 19241 gene locus_tag LOCUS_07930 20008 19241 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394499.1 protein_id gnl|my_center|LOCUS_07930 21546 20005 gene locus_tag LOCUS_07940 21546 20005 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730628.1 protein_id gnl|my_center|LOCUS_07940 >Feature sequence026 3480 1654 gene locus_tag LOCUS_07950 3480 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 4209 3628 gene locus_tag LOCUS_07960 gene scpB 4209 3628 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392873.1 protein_id gnl|my_center|LOCUS_07960 4964 4206 gene locus_tag LOCUS_07970 4964 4206 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565341.1 protein_id gnl|my_center|LOCUS_07970 6034 5012 gene locus_tag LOCUS_07980 gene trpS 6034 5012 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417440.1 protein_id gnl|my_center|LOCUS_07980 7624 6068 gene locus_tag LOCUS_07990 gene gcvPB 7624 6068 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230209.1 protein_id gnl|my_center|LOCUS_07990 9000 7627 gene locus_tag LOCUS_08000 gene gcvPA 9000 7627 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460675.1 protein_id gnl|my_center|LOCUS_08000 9392 8997 gene locus_tag LOCUS_08010 gene gcvH 9392 8997 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583866.1 protein_id gnl|my_center|LOCUS_08010 10488 9394 gene locus_tag LOCUS_08020 gene gcvT 10488 9394 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259334.1 protein_id gnl|my_center|LOCUS_08020 10752 11318 gene locus_tag LOCUS_08030 10752 11318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08030 11233 12225 gene locus_tag LOCUS_08040 11233 12225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08040 12222 12569 gene locus_tag LOCUS_08050 12222 12569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08050 12669 13091 gene locus_tag LOCUS_08060 12669 13091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 14318 13221 gene locus_tag LOCUS_08070 gene ftsZ 14318 13221 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069588917.1 protein_id gnl|my_center|LOCUS_08070 15604 14591 gene locus_tag LOCUS_08080 15604 14591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 17072 15705 gene locus_tag LOCUS_08090 gene murC 17072 15705 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392363.1 protein_id gnl|my_center|LOCUS_08090 17140 18774 gene locus_tag LOCUS_08100 17140 18774 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226038.1 protein_id gnl|my_center|LOCUS_08100 18861 19124 gene locus_tag LOCUS_08110 18861 19124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 19523 19170 gene locus_tag LOCUS_08120 19523 19170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 19754 21367 gene locus_tag LOCUS_08130 19754 21367 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226873.1 protein_id gnl|my_center|LOCUS_08130 21630 21430 gene locus_tag LOCUS_08140 21630 21430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 21580 22542 gene locus_tag LOCUS_08150 21580 22542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 <23516 22588 gene locus_tag LOCUS_08160 <23516 22588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392362.1:undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase >Feature sequence027 <1 1648 gene locus_tag LOCUS_08170 <1 1648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546379.1:NADH-quinone oxidoreductase subunit L 1645 3201 gene locus_tag LOCUS_08180 1645 3201 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_08180 3198 4910 gene locus_tag LOCUS_08190 3198 4910 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258761.1 protein_id gnl|my_center|LOCUS_08190 4986 6314 gene locus_tag LOCUS_08200 4986 6314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 6322 7908 gene locus_tag LOCUS_08210 6322 7908 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256261.1 protein_id gnl|my_center|LOCUS_08210 8029 8817 gene locus_tag LOCUS_08220 8029 8817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08220 9764 8832 gene locus_tag LOCUS_08230 9764 8832 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256103.1 protein_id gnl|my_center|LOCUS_08230 11006 9765 gene locus_tag LOCUS_08240 11006 9765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 11770 10994 gene locus_tag LOCUS_08250 11770 10994 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_08250 12762 11767 gene locus_tag LOCUS_08260 12762 11767 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458881.1 protein_id gnl|my_center|LOCUS_08260 14913 12952 gene locus_tag LOCUS_08270 gene acs 14913 12952 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230537.1 protein_id gnl|my_center|LOCUS_08270 15976 14969 gene locus_tag LOCUS_08280 15976 14969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 16019 16279 gene locus_tag LOCUS_08290 16019 16279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 16326 16895 gene locus_tag LOCUS_08300 16326 16895 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268255.1 protein_id gnl|my_center|LOCUS_08300 17416 16931 gene locus_tag LOCUS_08310 gene bcp 17416 16931 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704834.1 protein_id gnl|my_center|LOCUS_08310 18316 17477 gene locus_tag LOCUS_08320 18316 17477 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 protein_id gnl|my_center|LOCUS_08320 18344 18526 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19878 19528 gene locus_tag LOCUS_08330 19878 19528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 19901 20140 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <22186 21496 gene locus_tag LOCUS_08340 <22186 21496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005098467.1:aldehyde dehydrogenase family protein >Feature sequence028 45 824 gene locus_tag LOCUS_08350 45 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 855 1469 gene locus_tag LOCUS_08360 gene hisIE 855 1469 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243045.1 protein_id gnl|my_center|LOCUS_08360 1453 2925 gene locus_tag LOCUS_08370 1453 2925 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224165.1 protein_id gnl|my_center|LOCUS_08370 1792 1840 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2926 3558 gene locus_tag LOCUS_08380 2926 3558 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257601.1 protein_id gnl|my_center|LOCUS_08380 3540 4574 gene locus_tag LOCUS_08390 gene trpD 3540 4574 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_08390 4571 5368 gene locus_tag LOCUS_08400 gene trpC 4571 5368 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028830.1 protein_id gnl|my_center|LOCUS_08400 5373 6074 gene locus_tag LOCUS_08410 5373 6074 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_08410 6112 7287 gene locus_tag LOCUS_08420 gene trpB 6112 7287 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173169.1 protein_id gnl|my_center|LOCUS_08420 7284 8084 gene locus_tag LOCUS_08430 gene trpA 7284 8084 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022930.1 protein_id gnl|my_center|LOCUS_08430 8097 8318 gene locus_tag LOCUS_08440 8097 8318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 8582 9862 gene locus_tag LOCUS_08450 8582 9862 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976809.1 protein_id gnl|my_center|LOCUS_08450 9925 10983 gene locus_tag LOCUS_08460 9925 10983 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104449.1 protein_id gnl|my_center|LOCUS_08460 10980 12167 gene locus_tag LOCUS_08470 10980 12167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 12164 12997 gene locus_tag LOCUS_08480 12164 12997 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256821.1 protein_id gnl|my_center|LOCUS_08480 13003 13704 gene locus_tag LOCUS_08490 13003 13704 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256822.1 protein_id gnl|my_center|LOCUS_08490 13708 13998 gene locus_tag LOCUS_08500 13708 13998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 14025 14031 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14989 14081 gene locus_tag LOCUS_08510 14989 14081 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225382.1 protein_id gnl|my_center|LOCUS_08510 15983 15093 gene locus_tag LOCUS_08520 15983 15093 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731454.1 protein_id gnl|my_center|LOCUS_08520 16043 16627 gene locus_tag LOCUS_08530 16043 16627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 16700 19309 gene locus_tag LOCUS_08540 16700 19309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 19310 19753 gene locus_tag LOCUS_08550 19310 19753 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812126.1 protein_id gnl|my_center|LOCUS_08550 19869 21500 gene locus_tag LOCUS_08560 19869 21500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 21608 22090 gene locus_tag LOCUS_08570 21608 22090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 >Feature sequence029 2051 651 gene locus_tag LOCUS_08580 gene argH 2051 651 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056221.1 protein_id gnl|my_center|LOCUS_08580 3366 2188 gene locus_tag LOCUS_08590 3366 2188 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256834.1 protein_id gnl|my_center|LOCUS_08590 5038 3416 gene locus_tag LOCUS_08600 gene cimA 5038 3416 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393734.1 protein_id gnl|my_center|LOCUS_08600 5979 5035 gene locus_tag LOCUS_08610 5979 5035 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545688.1 protein_id gnl|my_center|LOCUS_08610 7023 5989 gene locus_tag LOCUS_08620 gene leuB 7023 5989 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399139.1 protein_id gnl|my_center|LOCUS_08620 7434 7024 gene locus_tag LOCUS_08630 7434 7024 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703163.1 protein_id gnl|my_center|LOCUS_08630 8018 7431 gene locus_tag LOCUS_08640 gene leuD 8018 7431 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091398.1 protein_id gnl|my_center|LOCUS_08640 9438 8071 gene locus_tag LOCUS_08650 gene leuC 9438 8071 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340234.1 protein_id gnl|my_center|LOCUS_08650 10028 9435 gene locus_tag LOCUS_08660 10028 9435 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919860.1 protein_id gnl|my_center|LOCUS_08660 10512 10210 gene locus_tag LOCUS_08670 10512 10210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 12247 10589 gene locus_tag LOCUS_08680 12247 10589 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393738.1 protein_id gnl|my_center|LOCUS_08680 13985 12360 gene locus_tag LOCUS_08690 gene serA 13985 12360 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020641.1 protein_id gnl|my_center|LOCUS_08690 15138 13993 gene locus_tag LOCUS_08700 15138 13993 CDS product serine-pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081619.1 protein_id gnl|my_center|LOCUS_08700 15523 15224 gene locus_tag LOCUS_08710 15523 15224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 15441 15704 gene locus_tag LOCUS_08720 15441 15704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 17608 15806 gene locus_tag LOCUS_08730 17608 15806 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222767.1 protein_id gnl|my_center|LOCUS_08730 18779 17790 gene locus_tag LOCUS_08740 gene ilvC 18779 17790 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392863.1 protein_id gnl|my_center|LOCUS_08740 19764 18922 gene locus_tag LOCUS_08750 19764 18922 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921324.1 protein_id gnl|my_center|LOCUS_08750 21208 19901 gene locus_tag LOCUS_08760 21208 19901 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449576.1 protein_id gnl|my_center|LOCUS_08760 21260 22096 gene locus_tag LOCUS_08770 gene menB 21260 22096 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963885.1 protein_id gnl|my_center|LOCUS_08770 >Feature sequence030 623 219 gene locus_tag LOCUS_08780 623 219 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325767.1 protein_id gnl|my_center|LOCUS_08780 860 693 gene locus_tag LOCUS_08790 860 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 1486 794 gene locus_tag LOCUS_08800 1486 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 3092 1473 gene locus_tag LOCUS_08810 3092 1473 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029141.1 protein_id gnl|my_center|LOCUS_08810 3224 4291 gene locus_tag LOCUS_08820 gene ligD 3224 4291 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972287.1 protein_id gnl|my_center|LOCUS_08820 4456 4848 gene locus_tag LOCUS_08830 4456 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 6454 4955 gene locus_tag LOCUS_08840 gene glpK 6454 4955 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731514.1 protein_id gnl|my_center|LOCUS_08840 6480 6662 gene locus_tag LOCUS_08850 6480 6662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 7133 7270 gene locus_tag LOCUS_08860 7133 7270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 7267 8442 gene locus_tag LOCUS_08870 7267 8442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 8379 8825 gene locus_tag LOCUS_08880 8379 8825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 9075 9656 gene locus_tag LOCUS_08890 9075 9656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 9817 10245 gene locus_tag LOCUS_08900 9817 10245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 10299 10832 gene locus_tag LOCUS_08910 10299 10832 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179664825.1 protein_id gnl|my_center|LOCUS_08910 11638 10949 gene locus_tag LOCUS_08920 11638 10949 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029984.1 protein_id gnl|my_center|LOCUS_08920 12489 11827 gene locus_tag LOCUS_08930 12489 11827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 13192 12470 gene locus_tag LOCUS_08940 13192 12470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 13523 13263 gene locus_tag LOCUS_08950 13523 13263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 13953 13603 gene locus_tag LOCUS_08960 13953 13603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 14158 14278 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16388 15639 gene locus_tag LOCUS_08970 16388 15639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 17882 16398 gene locus_tag LOCUS_08980 17882 16398 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337441.1 protein_id gnl|my_center|LOCUS_08980 20227 18017 gene locus_tag LOCUS_08990 20227 18017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 20799 20461 gene locus_tag LOCUS_09000 20799 20461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 21020 20841 gene locus_tag LOCUS_09010 21020 20841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 >Feature sequence031 541 134 gene locus_tag LOCUS_09020 541 134 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938550.1 protein_id gnl|my_center|LOCUS_09020 534 881 gene locus_tag LOCUS_09030 534 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 2082 901 gene locus_tag LOCUS_09040 2082 901 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233328.1 protein_id gnl|my_center|LOCUS_09040 2143 2874 gene locus_tag LOCUS_09050 2143 2874 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259632.1 protein_id gnl|my_center|LOCUS_09050 3443 2958 gene locus_tag LOCUS_09060 3443 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 3328 3579 gene locus_tag LOCUS_09070 3328 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 3572 4864 gene locus_tag LOCUS_09080 3572 4864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 4861 5904 gene locus_tag LOCUS_09090 4861 5904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 6830 6303 gene locus_tag LOCUS_09100 6830 6303 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404691.1 protein_id gnl|my_center|LOCUS_09100 6957 7505 gene locus_tag LOCUS_09110 6957 7505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 7984 7502 gene locus_tag LOCUS_09120 7984 7502 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031862.1 protein_id gnl|my_center|LOCUS_09120 9558 8038 gene locus_tag LOCUS_09130 gene gpmI 9558 8038 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541097.1 protein_id gnl|my_center|LOCUS_09130 10325 9558 gene locus_tag LOCUS_09140 gene tpiA 10325 9558 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861867.1 protein_id gnl|my_center|LOCUS_09140 11502 10369 gene locus_tag LOCUS_09150 11502 10369 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964029.1 protein_id gnl|my_center|LOCUS_09150 12509 11505 gene locus_tag LOCUS_09160 gene gap 12509 11505 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976871.1 protein_id gnl|my_center|LOCUS_09160 13605 12601 gene locus_tag LOCUS_09170 gene rapZ 13605 12601 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462179.1 protein_id gnl|my_center|LOCUS_09170 15488 13602 gene locus_tag LOCUS_09180 gene uvrC 15488 13602 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728800.1 protein_id gnl|my_center|LOCUS_09180 15570 16595 gene locus_tag LOCUS_09190 15570 16595 CDS product threonine aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967204.1 protein_id gnl|my_center|LOCUS_09190 16963 17382 gene locus_tag LOCUS_09200 16963 17382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 18746 17424 gene locus_tag LOCUS_09210 18746 17424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 19033 18779 gene locus_tag LOCUS_09220 19033 18779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 18977 19279 gene locus_tag LOCUS_09230 18977 19279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 19884 19537 gene locus_tag LOCUS_09240 19884 19537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 >Feature sequence032 843 313 gene locus_tag LOCUS_09250 843 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 1447 1866 gene locus_tag LOCUS_09260 1447 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 2073 2399 gene locus_tag LOCUS_09270 2073 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 2524 2727 gene locus_tag LOCUS_09280 2524 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 3458 4355 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgcaatggagtcccggcccgaaggccgggagca 4776 4531 gene locus_tag LOCUS_09290 4776 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 7715 5121 gene locus_tag LOCUS_09300 7715 5121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 7862 8849 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gccgcaatggagtcccggcccgaaggccgggagcac 9172 10782 gene locus_tag LOCUS_09310 9172 10782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 12687 11266 gene locus_tag LOCUS_09320 12687 11266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 13691 12684 gene locus_tag LOCUS_09330 13691 12684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 15934 13688 gene locus_tag LOCUS_09340 15934 13688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 16164 15931 gene locus_tag LOCUS_09350 16164 15931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 18338 16164 gene locus_tag LOCUS_09360 18338 16164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 18840 18640 gene locus_tag LOCUS_09370 18840 18640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 19093 19620 gene locus_tag LOCUS_09380 19093 19620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 >Feature sequence033 247 573 gene locus_tag LOCUS_09390 247 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 674 880 gene locus_tag LOCUS_09400 674 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 877 1623 gene locus_tag LOCUS_09410 877 1623 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405169.1 protein_id gnl|my_center|LOCUS_09410 1626 2411 gene locus_tag LOCUS_09420 gene fetB 1626 2411 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012390.1 protein_id gnl|my_center|LOCUS_09420 1719 1730 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2408 3820 gene locus_tag LOCUS_09430 gene chrA 2408 3820 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969287.1 protein_id gnl|my_center|LOCUS_09430 3100 3134 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3952 4137 gene locus_tag LOCUS_09440 3952 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 4396 5451 gene locus_tag LOCUS_09450 4396 5451 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467380.1 protein_id gnl|my_center|LOCUS_09450 5448 6239 gene locus_tag LOCUS_09460 5448 6239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 6236 7030 gene locus_tag LOCUS_09470 6236 7030 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975109.1 protein_id gnl|my_center|LOCUS_09470 7168 8994 gene locus_tag LOCUS_09480 7168 8994 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223305.1 protein_id gnl|my_center|LOCUS_09480 9059 10102 gene locus_tag LOCUS_09490 9059 10102 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223306.1 protein_id gnl|my_center|LOCUS_09490 10337 11779 gene locus_tag LOCUS_09500 10337 11779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 12327 11764 gene locus_tag LOCUS_09510 gene rfbC 12327 11764 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721499.1 protein_id gnl|my_center|LOCUS_09510 12385 13251 gene locus_tag LOCUS_09520 12385 13251 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533453.1 protein_id gnl|my_center|LOCUS_09520 13298 14224 gene locus_tag LOCUS_09530 gene pdxS 13298 14224 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728705.1 protein_id gnl|my_center|LOCUS_09530 14218 14805 gene locus_tag LOCUS_09540 gene pdxT 14218 14805 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111403.1 protein_id gnl|my_center|LOCUS_09540 14836 15417 gene locus_tag LOCUS_09550 14836 15417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 16983 15427 gene locus_tag LOCUS_09560 16983 15427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09560 18386 16980 gene locus_tag LOCUS_09570 18386 16980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09570 18538 19515 gene locus_tag LOCUS_09580 18538 19515 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256245.1 protein_id gnl|my_center|LOCUS_09580 >Feature sequence034 <1 581 gene locus_tag LOCUS_09590 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973075.1:MFS transporter 1182 667 gene locus_tag LOCUS_09600 1182 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 1361 2134 gene locus_tag LOCUS_09610 1361 2134 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906792.1 protein_id gnl|my_center|LOCUS_09610 2191 2598 gene locus_tag LOCUS_09620 2191 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 3468 2731 gene locus_tag LOCUS_09630 3468 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 4057 3560 gene locus_tag LOCUS_09640 4057 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 4243 5496 gene locus_tag LOCUS_09650 4243 5496 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031624.1 protein_id gnl|my_center|LOCUS_09650 5899 5603 gene locus_tag LOCUS_09660 5899 5603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 8169 5956 gene locus_tag LOCUS_09670 8169 5956 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031369.1 protein_id gnl|my_center|LOCUS_09670 8357 8647 gene locus_tag LOCUS_09680 8357 8647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 8754 9632 gene locus_tag LOCUS_09690 gene rpoD 8754 9632 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360364.1 protein_id gnl|my_center|LOCUS_09690 10325 9774 gene locus_tag LOCUS_09700 10325 9774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 10391 10613 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11106 11948 gene locus_tag LOCUS_09710 11106 11948 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971490.1 protein_id gnl|my_center|LOCUS_09710 12080 12406 gene locus_tag LOCUS_09720 12080 12406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 12632 12465 gene locus_tag LOCUS_09730 12632 12465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 13068 12691 gene locus_tag LOCUS_09740 13068 12691 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486342.1 protein_id gnl|my_center|LOCUS_09740 13234 16440 gene locus_tag LOCUS_09750 gene recC 13234 16440 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113008.1 protein_id gnl|my_center|LOCUS_09750 17122 17216 gene locus_tag LOCUS_t00080 17122 17216 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence035 2355 778 gene locus_tag LOCUS_09760 2355 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 3914 2352 gene locus_tag LOCUS_09770 gene pelF 3914 2352 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887358.1 protein_id gnl|my_center|LOCUS_09770 5044 3911 gene locus_tag LOCUS_09780 5044 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 5468 5019 gene locus_tag LOCUS_09790 5468 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 5823 5461 gene locus_tag LOCUS_09800 5823 5461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 7403 5820 gene locus_tag LOCUS_09810 7403 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 7786 7403 gene locus_tag LOCUS_09820 7786 7403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 9381 7783 gene locus_tag LOCUS_09830 9381 7783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 10708 10890 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11617 16137 gene locus_tag LOCUS_09840 11617 16137 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109508967.1 protein_id gnl|my_center|LOCUS_09840 16443 16183 gene locus_tag LOCUS_09850 16443 16183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 16563 17345 gene locus_tag LOCUS_09860 16563 17345 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030437.1 protein_id gnl|my_center|LOCUS_09860 17473 18062 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence036 1284 862 gene locus_tag LOCUS_09870 1284 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 1258 1581 gene locus_tag LOCUS_09880 1258 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 1691 4141 gene locus_tag LOCUS_09890 gene leuS 1691 4141 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_09890 4157 4666 gene locus_tag LOCUS_09900 4157 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 4763 5371 gene locus_tag LOCUS_09910 4763 5371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 5485 7941 gene locus_tag LOCUS_09920 5485 7941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 7965 8942 gene locus_tag LOCUS_09930 7965 8942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 9331 8939 gene locus_tag LOCUS_09940 9331 8939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 10845 9355 gene locus_tag LOCUS_09950 10845 9355 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142441.1 protein_id gnl|my_center|LOCUS_09950 11400 11134 gene locus_tag LOCUS_09960 11400 11134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 11452 11503 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11700 13367 gene locus_tag LOCUS_09970 gene murJ 11700 13367 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391285.1 protein_id gnl|my_center|LOCUS_09970 13384 15195 gene locus_tag LOCUS_09980 gene lepA 13384 15195 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229999.1 protein_id gnl|my_center|LOCUS_09980 15253 16257 gene locus_tag LOCUS_09990 gene hrcA 15253 16257 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_09990 16262 17377 gene locus_tag LOCUS_10000 gene dnaJ 16262 17377 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940501.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence037 883 362 gene locus_tag LOCUS_10010 gene rimI 883 362 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393645.1 protein_id gnl|my_center|LOCUS_10010 1578 880 gene locus_tag LOCUS_10020 gene tsaB 1578 880 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968552.1 protein_id gnl|my_center|LOCUS_10020 2062 1592 gene locus_tag LOCUS_10030 2062 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 2892 2194 gene locus_tag LOCUS_10040 2892 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 3387 4004 gene locus_tag LOCUS_10050 3387 4004 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030960.1 protein_id gnl|my_center|LOCUS_10050 4784 3981 gene locus_tag LOCUS_10060 4784 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 4941 5726 gene locus_tag LOCUS_10070 4941 5726 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230459.1 protein_id gnl|my_center|LOCUS_10070 5726 6634 gene locus_tag LOCUS_10080 gene panC 5726 6634 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_10080 6634 7542 gene locus_tag LOCUS_10090 gene panB 6634 7542 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869215.1 protein_id gnl|my_center|LOCUS_10090 7553 8179 gene locus_tag LOCUS_10100 7553 8179 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_10100 8958 9242 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10358 9411 gene locus_tag LOCUS_10110 10358 9411 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224650.1 protein_id gnl|my_center|LOCUS_10110 10564 11040 gene locus_tag LOCUS_10120 10564 11040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 12086 11082 gene locus_tag LOCUS_10130 12086 11082 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250183.1 protein_id gnl|my_center|LOCUS_10130 14607 12148 gene locus_tag LOCUS_10140 gene ligD 14607 12148 CDS product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337655.1 protein_id gnl|my_center|LOCUS_10140 15215 14607 gene locus_tag LOCUS_10150 15215 14607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 15309 16277 gene locus_tag LOCUS_10160 15309 16277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 <17792 16335 gene locus_tag LOCUS_10170 <17792 16335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003228057.1:excinuclease ABC subunit UvrA >Feature sequence038 2014 800 gene locus_tag LOCUS_10180 2014 800 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552154.1 protein_id gnl|my_center|LOCUS_10180 2641 2183 gene locus_tag LOCUS_10190 2641 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 3246 2704 gene locus_tag LOCUS_10200 3246 2704 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891449.1 protein_id gnl|my_center|LOCUS_10200 3403 3819 gene locus_tag LOCUS_10210 3403 3819 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975554.1 protein_id gnl|my_center|LOCUS_10210 3912 4121 gene locus_tag LOCUS_10220 3912 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 4366 4181 gene locus_tag LOCUS_10230 4366 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 4393 4711 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4904 6475 gene locus_tag LOCUS_10240 4904 6475 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186147.1 protein_id gnl|my_center|LOCUS_10240 6459 7055 gene locus_tag LOCUS_10250 6459 7055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 7052 8041 gene locus_tag LOCUS_10260 7052 8041 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031646.1 protein_id gnl|my_center|LOCUS_10260 8189 10579 gene locus_tag LOCUS_10270 8189 10579 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031619.1 protein_id gnl|my_center|LOCUS_10270 10576 11088 gene locus_tag LOCUS_10280 10576 11088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228336.1 protein_id gnl|my_center|LOCUS_10280 11125 12279 gene locus_tag LOCUS_10290 gene splB 11125 12279 CDS product spore photoproduct lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245173.1 protein_id gnl|my_center|LOCUS_10290 12557 13369 gene locus_tag LOCUS_10300 12557 13369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 14287 13487 gene locus_tag LOCUS_10310 14287 13487 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172591901.1 protein_id gnl|my_center|LOCUS_10310 14430 15071 gene locus_tag LOCUS_10320 14430 15071 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257831.1 protein_id gnl|my_center|LOCUS_10320 15377 15093 gene locus_tag LOCUS_10330 15377 15093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 <17377 15374 gene locus_tag LOCUS_10340 <17377 15374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056504.1:heavy metal translocating P-type ATPase >Feature sequence039 2390 1029 gene locus_tag LOCUS_10350 gene dapE 2390 1029 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406235.1 protein_id gnl|my_center|LOCUS_10350 3252 2398 gene locus_tag LOCUS_10360 3252 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 3585 4994 gene locus_tag LOCUS_10370 gene hflX 3585 4994 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_10370 5405 5076 gene locus_tag LOCUS_10380 5405 5076 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125076.1 protein_id gnl|my_center|LOCUS_10380 6242 5499 gene locus_tag LOCUS_10390 6242 5499 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817427.1 protein_id gnl|my_center|LOCUS_10390 7015 6272 gene locus_tag LOCUS_10400 7015 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 8385 7012 gene locus_tag LOCUS_10410 8385 7012 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258102.1 protein_id gnl|my_center|LOCUS_10410 9239 8382 gene locus_tag LOCUS_10420 9239 8382 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404626.1 protein_id gnl|my_center|LOCUS_10420 9238 9924 gene locus_tag LOCUS_10430 9238 9924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 10455 9928 gene locus_tag LOCUS_10440 10455 9928 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028072.1 protein_id gnl|my_center|LOCUS_10440 10494 10639 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11756 11127 gene locus_tag LOCUS_10450 11756 11127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 12826 11768 gene locus_tag LOCUS_10460 12826 11768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 12850 14961 gene locus_tag LOCUS_10470 12850 14961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 16519 14951 gene locus_tag LOCUS_10480 16519 14951 CDS product TIGR03663 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023977.1 protein_id gnl|my_center|LOCUS_10480 >Feature sequence040 1805 1734 gene locus_tag LOCUS_t00090 1805 1734 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2916 1828 gene locus_tag LOCUS_10490 2916 1828 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225683.1 protein_id gnl|my_center|LOCUS_10490 4244 2913 gene locus_tag LOCUS_10500 4244 2913 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090523.1 protein_id gnl|my_center|LOCUS_10500 2992 3062 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4313 5416 gene locus_tag LOCUS_10510 4313 5416 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141357.1 protein_id gnl|my_center|LOCUS_10510 5413 6153 gene locus_tag LOCUS_10520 5413 6153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 7645 6131 gene locus_tag LOCUS_10530 gene crtI 7645 6131 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225928.1 protein_id gnl|my_center|LOCUS_10530 8496 7657 gene locus_tag LOCUS_10540 8496 7657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 7784 7859 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9410 8493 gene locus_tag LOCUS_10550 9410 8493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225109.1 protein_id gnl|my_center|LOCUS_10550 10285 9470 gene locus_tag LOCUS_10560 10285 9470 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177599.1 protein_id gnl|my_center|LOCUS_10560 11748 10282 gene locus_tag LOCUS_10570 11748 10282 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404788.1 protein_id gnl|my_center|LOCUS_10570 12808 11792 gene locus_tag LOCUS_10580 gene fni 12808 11792 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057243.1 protein_id gnl|my_center|LOCUS_10580 13707 12934 gene locus_tag LOCUS_10590 13707 12934 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941515.1 protein_id gnl|my_center|LOCUS_10590 14676 13708 gene locus_tag LOCUS_10600 gene lipA 14676 13708 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522930.1 protein_id gnl|my_center|LOCUS_10600 15377 14691 gene locus_tag LOCUS_10610 gene lipB 15377 14691 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411458.1 protein_id gnl|my_center|LOCUS_10610 15376 16074 gene locus_tag LOCUS_10620 15376 16074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 <17176 16250 gene locus_tag LOCUS_10630 <17176 16250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404704.1:pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase >Feature sequence041 2672 3169 gene locus_tag LOCUS_10640 2672 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 3394 4068 gene locus_tag LOCUS_10650 3394 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 4065 4292 gene locus_tag LOCUS_10660 4065 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 4322 5611 gene locus_tag LOCUS_10670 4322 5611 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970232.1 protein_id gnl|my_center|LOCUS_10670 5950 5633 gene locus_tag LOCUS_10680 5950 5633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 5970 6133 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7641 6619 gene locus_tag LOCUS_10690 7641 6619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 7694 8143 gene locus_tag LOCUS_10700 7694 8143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 8140 8628 gene locus_tag LOCUS_10710 gene rsbW 8140 8628 CDS product anti-sigma B factor RsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970576.1 protein_id gnl|my_center|LOCUS_10710 9735 8710 gene locus_tag LOCUS_10720 gene rpoD 9735 8710 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358052.1 protein_id gnl|my_center|LOCUS_10720 9973 10803 gene locus_tag LOCUS_10730 9973 10803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 11910 10858 gene locus_tag LOCUS_10740 11910 10858 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027358.1 protein_id gnl|my_center|LOCUS_10740 12602 12066 gene locus_tag LOCUS_10750 12602 12066 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227042.1 protein_id gnl|my_center|LOCUS_10750 13396 12818 gene locus_tag LOCUS_10760 13396 12818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 13474 13602 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15158 14184 gene locus_tag LOCUS_10770 15158 14184 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226116.1 protein_id gnl|my_center|LOCUS_10770 15850 15155 gene locus_tag LOCUS_10780 15850 15155 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226117.1 protein_id gnl|my_center|LOCUS_10780 <17056 15840 gene locus_tag LOCUS_10790 <17056 15840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_161270276.1:D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase >Feature sequence042 849 130 gene locus_tag LOCUS_10800 849 130 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775964.1 protein_id gnl|my_center|LOCUS_10800 1595 1743 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3207 1876 gene locus_tag LOCUS_10810 3207 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 3896 3387 gene locus_tag LOCUS_10820 3896 3387 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940030.1 protein_id gnl|my_center|LOCUS_10820 3923 4648 gene locus_tag LOCUS_10830 3923 4648 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529020.1 protein_id gnl|my_center|LOCUS_10830 6145 4742 gene locus_tag LOCUS_10840 6145 4742 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223979.1 protein_id gnl|my_center|LOCUS_10840 6453 6142 gene locus_tag LOCUS_10850 6453 6142 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223978.1 protein_id gnl|my_center|LOCUS_10850 7557 6469 gene locus_tag LOCUS_10860 7557 6469 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223977.1 protein_id gnl|my_center|LOCUS_10860 7468 7821 gene locus_tag LOCUS_10870 7468 7821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 8728 7823 gene locus_tag LOCUS_10880 8728 7823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 9131 9691 gene locus_tag LOCUS_10890 9131 9691 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406839.1 protein_id gnl|my_center|LOCUS_10890 10131 9706 gene locus_tag LOCUS_10900 10131 9706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 10286 10678 gene locus_tag LOCUS_10910 10286 10678 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145171248.1 protein_id gnl|my_center|LOCUS_10910 10884 10675 gene locus_tag LOCUS_10920 10884 10675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 12990 10900 gene locus_tag LOCUS_10930 12990 10900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 14541 13585 gene locus_tag LOCUS_10940 14541 13585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 15152 15649 gene locus_tag LOCUS_10950 15152 15649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 16288 15761 gene locus_tag LOCUS_10960 16288 15761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10960 >Feature sequence043 <1 1696 gene locus_tag LOCUS_10970 <1 1696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393297.1:site-specific integrase 3005 2397 gene locus_tag LOCUS_10980 3005 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 3016 3077 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3202 4023 gene locus_tag LOCUS_10990 3202 4023 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312104.1 protein_id gnl|my_center|LOCUS_10990 4001 4783 gene locus_tag LOCUS_11000 4001 4783 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970003.1 protein_id gnl|my_center|LOCUS_11000 4788 5864 gene locus_tag LOCUS_11010 4788 5864 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970002.1 protein_id gnl|my_center|LOCUS_11010 6006 7061 gene locus_tag LOCUS_11020 6006 7061 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970004.1 protein_id gnl|my_center|LOCUS_11020 7209 8438 gene locus_tag LOCUS_11030 7209 8438 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524840.1 protein_id gnl|my_center|LOCUS_11030 8461 10647 gene locus_tag LOCUS_11040 8461 10647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 10738 12093 gene locus_tag LOCUS_11050 10738 12093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 12300 13136 gene locus_tag LOCUS_11060 12300 13136 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311603.1 protein_id gnl|my_center|LOCUS_11060 13153 13989 gene locus_tag LOCUS_11070 13153 13989 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229020.1 protein_id gnl|my_center|LOCUS_11070 14087 16372 gene locus_tag LOCUS_11080 14087 16372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 16366 16689 gene locus_tag LOCUS_11090 16366 16689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence044 <1 1662 gene locus_tag LOCUS_11100 <1 1662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393857.1:F0F1 ATP synthase subunit alpha 1563 1651 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1684 2610 gene locus_tag LOCUS_11110 1684 2610 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973625.1 protein_id gnl|my_center|LOCUS_11110 2633 4150 gene locus_tag LOCUS_11120 gene atpD 2633 4150 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032431.1 protein_id gnl|my_center|LOCUS_11120 4156 4578 gene locus_tag LOCUS_11130 4156 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 4745 5911 gene locus_tag LOCUS_11140 4745 5911 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259168.1 protein_id gnl|my_center|LOCUS_11140 5908 7440 gene locus_tag LOCUS_11150 5908 7440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 7554 8864 gene locus_tag LOCUS_11160 gene tuaD 7554 8864 CDS product UDP-glucose 6-dehydrogenase TuaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242596.1 protein_id gnl|my_center|LOCUS_11160 8877 9980 gene locus_tag LOCUS_11170 8877 9980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 9980 11026 gene locus_tag LOCUS_11180 9980 11026 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_11180 11077 11442 gene locus_tag LOCUS_11190 11077 11442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 11439 12914 gene locus_tag LOCUS_11200 gene ahcY 11439 12914 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 protein_id gnl|my_center|LOCUS_11200 12932 14188 gene locus_tag LOCUS_11210 gene ahcY 12932 14188 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880742.1 protein_id gnl|my_center|LOCUS_11210 14257 15627 gene locus_tag LOCUS_11220 14257 15627 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775783.1 protein_id gnl|my_center|LOCUS_11220 16524 15670 gene locus_tag LOCUS_11230 16524 15670 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533219.1 protein_id gnl|my_center|LOCUS_11230 >Feature sequence045 1091 531 gene locus_tag LOCUS_11240 1091 531 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894458.1 protein_id gnl|my_center|LOCUS_11240 2158 1160 gene locus_tag LOCUS_11250 gene ribD 2158 1160 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_11250 2117 2314 gene locus_tag LOCUS_11260 2117 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 2772 3827 gene locus_tag LOCUS_11270 2772 3827 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_11270 3883 4509 gene locus_tag LOCUS_11280 3883 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 4506 5873 gene locus_tag LOCUS_11290 4506 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 6591 5917 gene locus_tag LOCUS_11300 gene rpe 6591 5917 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259044.1 protein_id gnl|my_center|LOCUS_11300 8155 6818 gene locus_tag LOCUS_11310 gene rsmB 8155 6818 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_11310 9072 8152 gene locus_tag LOCUS_11320 gene fmt 9072 8152 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227858.1 protein_id gnl|my_center|LOCUS_11320 9770 9087 gene locus_tag LOCUS_11330 9770 9087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 11836 9767 gene locus_tag LOCUS_11340 gene priA 11836 9767 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940804.1 protein_id gnl|my_center|LOCUS_11340 12702 11833 gene locus_tag LOCUS_11350 12702 11833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 12752 13525 gene locus_tag LOCUS_11360 12752 13525 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805161.1 protein_id gnl|my_center|LOCUS_11360 14468 13695 gene locus_tag LOCUS_11370 14468 13695 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184045.1 protein_id gnl|my_center|LOCUS_11370 14825 14490 gene locus_tag LOCUS_11380 14825 14490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 16328 14910 gene locus_tag LOCUS_11390 16328 14910 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977903.1 protein_id gnl|my_center|LOCUS_11390 >Feature sequence046 <1 801 gene locus_tag LOCUS_11400 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256942.1:undecaprenyl-phosphate glucose phosphotransferase 2100 820 gene locus_tag LOCUS_11410 2100 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 2954 3117 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6020 3177 gene locus_tag LOCUS_11420 6020 3177 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226785.1 protein_id gnl|my_center|LOCUS_11420 6837 6130 gene locus_tag LOCUS_11430 6837 6130 CDS product DUF5995 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259509.1 protein_id gnl|my_center|LOCUS_11430 7304 8347 gene locus_tag LOCUS_11440 7304 8347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 8319 10940 gene locus_tag LOCUS_11450 8319 10940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 12298 11135 gene locus_tag LOCUS_11460 12298 11135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 12349 12648 gene locus_tag LOCUS_11470 12349 12648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 12896 13402 gene locus_tag LOCUS_11480 12896 13402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 13538 14752 gene locus_tag LOCUS_11490 13538 14752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 15479 14916 gene locus_tag LOCUS_11500 15479 14916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 16483 15731 gene locus_tag LOCUS_11510 16483 15731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 16685 16690 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence047 <1 797 gene locus_tag LOCUS_11520 <1 797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393367.1:pyruvate kinase 1639 854 gene locus_tag LOCUS_11530 1639 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 3115 1715 gene locus_tag LOCUS_11540 3115 1715 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081989.1 protein_id gnl|my_center|LOCUS_11540 3866 3123 gene locus_tag LOCUS_11550 3866 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 3923 4300 gene locus_tag LOCUS_11560 gene gloA 3923 4300 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165939.1 protein_id gnl|my_center|LOCUS_11560 4430 5968 gene locus_tag LOCUS_11570 4430 5968 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259263.1 protein_id gnl|my_center|LOCUS_11570 6314 5994 gene locus_tag LOCUS_11580 6314 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 6349 7005 gene locus_tag LOCUS_11590 6349 7005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 7002 7331 gene locus_tag LOCUS_11600 7002 7331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 7331 11734 gene locus_tag LOCUS_11610 7331 11734 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403927.1 protein_id gnl|my_center|LOCUS_11610 11810 12538 gene locus_tag LOCUS_11620 11810 12538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 12555 12977 gene locus_tag LOCUS_11630 12555 12977 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350861.1 protein_id gnl|my_center|LOCUS_11630 13277 13047 gene locus_tag LOCUS_11640 13277 13047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 14242 13424 gene locus_tag LOCUS_11650 14242 13424 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485328.1 protein_id gnl|my_center|LOCUS_11650 14297 15484 gene locus_tag LOCUS_11660 14297 15484 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029200.1 protein_id gnl|my_center|LOCUS_11660 >Feature sequence048 1710 421 gene locus_tag LOCUS_11670 gene nusA 1710 421 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_11670 2130 1714 gene locus_tag LOCUS_11680 gene rimP 2130 1714 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958225.1 protein_id gnl|my_center|LOCUS_11680 2859 2494 gene locus_tag LOCUS_11690 2859 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 4286 2979 gene locus_tag LOCUS_11700 gene coaBC 4286 2979 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392412.1 protein_id gnl|my_center|LOCUS_11700 4535 4308 gene locus_tag LOCUS_11710 4535 4308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 5149 4532 gene locus_tag LOCUS_11720 gene gmk 5149 4532 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977347.1 protein_id gnl|my_center|LOCUS_11720 5441 5157 gene locus_tag LOCUS_11730 5441 5157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 6818 5820 gene locus_tag LOCUS_11740 6818 5820 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977344.1 protein_id gnl|my_center|LOCUS_11740 10146 6994 gene locus_tag LOCUS_11750 gene carB 10146 6994 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706535.1 protein_id gnl|my_center|LOCUS_11750 11269 10139 gene locus_tag LOCUS_11760 gene carA 11269 10139 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224617.1 protein_id gnl|my_center|LOCUS_11760 12507 11266 gene locus_tag LOCUS_11770 12507 11266 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460659.1 protein_id gnl|my_center|LOCUS_11770 13532 12603 gene locus_tag LOCUS_11780 13532 12603 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583924.1 protein_id gnl|my_center|LOCUS_11780 14095 13547 gene locus_tag LOCUS_11790 gene pyrR 14095 13547 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729510.1 protein_id gnl|my_center|LOCUS_11790 15116 14169 gene locus_tag LOCUS_11800 gene rnz 15116 14169 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878439.1 protein_id gnl|my_center|LOCUS_11800 15722 15231 gene locus_tag LOCUS_11810 15722 15231 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027329.1 protein_id gnl|my_center|LOCUS_11810 >Feature sequence049 824 138 gene locus_tag LOCUS_11820 824 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 1952 828 gene locus_tag LOCUS_11830 1952 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 2272 1970 gene locus_tag LOCUS_11840 2272 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 2413 2835 gene locus_tag LOCUS_11850 2413 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 3820 2849 gene locus_tag LOCUS_11860 3820 2849 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 protein_id gnl|my_center|LOCUS_11860 4557 3817 gene locus_tag LOCUS_11870 gene ubiE 4557 3817 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392794.1 protein_id gnl|my_center|LOCUS_11870 5296 4568 gene locus_tag LOCUS_11880 5296 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 6081 5293 gene locus_tag LOCUS_11890 6081 5293 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546179.1 protein_id gnl|my_center|LOCUS_11890 6762 6085 gene locus_tag LOCUS_11900 6762 6085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 7317 6835 gene locus_tag LOCUS_11910 7317 6835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 8519 7320 gene locus_tag LOCUS_11920 gene hemL 8519 7320 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_11920 9681 8605 gene locus_tag LOCUS_11930 9681 8605 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460176.1 protein_id gnl|my_center|LOCUS_11930 10601 9666 gene locus_tag LOCUS_11940 gene hemB 10601 9666 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_11940 11657 10755 gene locus_tag LOCUS_11950 11657 10755 CDS product FRG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017872006.1 protein_id gnl|my_center|LOCUS_11950 12171 11683 gene locus_tag LOCUS_11960 12171 11683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 12252 13037 gene locus_tag LOCUS_11970 12252 13037 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_11970 14616 13066 gene locus_tag LOCUS_11980 14616 13066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 13406 13446 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence050 1935 1714 gene locus_tag LOCUS_11990 1935 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1987 2943 gene locus_tag LOCUS_12000 gene cysK 1987 2943 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056355.1 protein_id gnl|my_center|LOCUS_12000 3137 2886 gene locus_tag LOCUS_12010 3137 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 3147 3797 gene locus_tag LOCUS_12020 3147 3797 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365615.1 protein_id gnl|my_center|LOCUS_12020 3916 4329 gene locus_tag LOCUS_12030 3916 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 4421 5161 gene locus_tag LOCUS_12040 gene cysE 4421 5161 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943208.1 protein_id gnl|my_center|LOCUS_12040 5494 5736 gene locus_tag LOCUS_12050 5494 5736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 5905 8250 gene locus_tag LOCUS_12060 gene pcrA 5905 8250 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_12060 8277 9437 gene locus_tag LOCUS_12070 8277 9437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 9507 9749 gene locus_tag LOCUS_12080 9507 9749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 9802 10671 gene locus_tag LOCUS_12090 gene folD 9802 10671 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384886.1 protein_id gnl|my_center|LOCUS_12090 10926 10997 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11177 11467 gene locus_tag LOCUS_12100 gene gatC 11177 11467 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461445.1 protein_id gnl|my_center|LOCUS_12100 11464 12915 gene locus_tag LOCUS_12110 gene gatA 11464 12915 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_12110 12912 14345 gene locus_tag LOCUS_12120 gene gatB 12912 14345 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880264.1 protein_id gnl|my_center|LOCUS_12120 14357 14635 gene locus_tag LOCUS_12130 14357 14635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 14826 15050 gene locus_tag LOCUS_12140 14826 15050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 >Feature sequence051 166 666 gene locus_tag LOCUS_12150 166 666 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942211.1 protein_id gnl|my_center|LOCUS_12150 1096 692 gene locus_tag LOCUS_12160 1096 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1240 2706 gene locus_tag LOCUS_12170 1240 2706 CDS product malate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338924.1 protein_id gnl|my_center|LOCUS_12170 2963 3166 gene locus_tag LOCUS_12180 2963 3166 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071803.1 protein_id gnl|my_center|LOCUS_12180 4336 3452 gene locus_tag LOCUS_12190 gene rarD 4336 3452 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029749.1 protein_id gnl|my_center|LOCUS_12190 6182 4482 gene locus_tag LOCUS_12200 6182 4482 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256527.1 protein_id gnl|my_center|LOCUS_12200 6195 6419 gene locus_tag LOCUS_12210 6195 6419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 6619 6416 gene locus_tag LOCUS_12220 6619 6416 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222289.1 protein_id gnl|my_center|LOCUS_12220 7687 8895 gene locus_tag LOCUS_12230 7687 8895 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081140.1 protein_id gnl|my_center|LOCUS_12230 9003 10079 gene locus_tag LOCUS_12240 9003 10079 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974028.1 protein_id gnl|my_center|LOCUS_12240 10482 10057 gene locus_tag LOCUS_12250 10482 10057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 11024 10952 gene locus_tag LOCUS_t00100 11024 10952 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 11691 11209 gene locus_tag LOCUS_12260 11691 11209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 11786 12676 gene locus_tag LOCUS_12270 11786 12676 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403827.1 protein_id gnl|my_center|LOCUS_12270 13755 12649 gene locus_tag LOCUS_12280 13755 12649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 13788 13929 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13938 14576 gene locus_tag LOCUS_12290 gene tmk 13938 14576 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886759.1 protein_id gnl|my_center|LOCUS_12290 >Feature sequence052 1364 78 gene locus_tag LOCUS_12300 1364 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 1404 2753 gene locus_tag LOCUS_12310 1404 2753 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265725.1 protein_id gnl|my_center|LOCUS_12310 4353 2953 gene locus_tag LOCUS_12320 4353 2953 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929955.1 protein_id gnl|my_center|LOCUS_12320 5306 4350 gene locus_tag LOCUS_12330 5306 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 5394 7250 gene locus_tag LOCUS_12340 5394 7250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 8530 7199 gene locus_tag LOCUS_12350 8530 7199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 8707 9696 gene locus_tag LOCUS_12360 8707 9696 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523309.1 protein_id gnl|my_center|LOCUS_12360 9693 10526 gene locus_tag LOCUS_12370 9693 10526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 10519 11379 gene locus_tag LOCUS_12380 10519 11379 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144243.1 protein_id gnl|my_center|LOCUS_12380 11798 11439 gene locus_tag LOCUS_12390 11798 11439 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094643.1 protein_id gnl|my_center|LOCUS_12390 11901 13292 gene locus_tag LOCUS_12400 11901 13292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 13307 13927 gene locus_tag LOCUS_12410 13307 13927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 13990 14328 gene locus_tag LOCUS_12420 13990 14328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 >Feature sequence053 1438 575 gene locus_tag LOCUS_12430 1438 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 2310 1441 gene locus_tag LOCUS_12440 2310 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 3465 2314 gene locus_tag LOCUS_12450 gene steA 3465 2314 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804976.1 protein_id gnl|my_center|LOCUS_12450 5241 3550 gene locus_tag LOCUS_12460 gene recN 5241 3550 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_12460 6195 5341 gene locus_tag LOCUS_12470 6195 5341 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679270.1 protein_id gnl|my_center|LOCUS_12470 7001 6195 gene locus_tag LOCUS_12480 7001 6195 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_12480 8959 7028 gene locus_tag LOCUS_12490 gene dxs 8959 7028 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056470.1 protein_id gnl|my_center|LOCUS_12490 9834 8956 gene locus_tag LOCUS_12500 9834 8956 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792441.1 protein_id gnl|my_center|LOCUS_12500 10037 9831 gene locus_tag LOCUS_12510 10037 9831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 10446 10030 gene locus_tag LOCUS_12520 10446 10030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 11014 10454 gene locus_tag LOCUS_12530 gene efp 11014 10454 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_12530 12020 11643 gene locus_tag LOCUS_12540 12020 11643 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063587.1 protein_id gnl|my_center|LOCUS_12540 12138 12282 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12791 12303 gene locus_tag LOCUS_12550 12791 12303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 13242 13036 gene locus_tag LOCUS_12560 13242 13036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 >Feature sequence054 706 2010 gene locus_tag LOCUS_12570 706 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 2183 3130 gene locus_tag LOCUS_12580 2183 3130 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224691.1 protein_id gnl|my_center|LOCUS_12580 2752 2758 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3001 3036 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3467 3150 gene locus_tag LOCUS_12590 3467 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 5007 3484 gene locus_tag LOCUS_12600 5007 3484 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141226.1 protein_id gnl|my_center|LOCUS_12600 6995 5013 gene locus_tag LOCUS_12610 6995 5013 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530170.1 protein_id gnl|my_center|LOCUS_12610 7693 7106 gene locus_tag LOCUS_12620 7693 7106 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977971.1 protein_id gnl|my_center|LOCUS_12620 8253 7696 gene locus_tag LOCUS_12630 8253 7696 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112465.1 protein_id gnl|my_center|LOCUS_12630 11993 8475 gene locus_tag LOCUS_12640 11993 8475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 12754 12032 gene locus_tag LOCUS_12650 12754 12032 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970242.1 protein_id gnl|my_center|LOCUS_12650 <13951 12768 gene locus_tag LOCUS_12660 <13951 12768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228162.1:glycosyltransferase >Feature sequence055 <1 1295 gene locus_tag LOCUS_12670 <1 1295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887976.1:isoleucine--tRNA ligase 1356 5099 gene locus_tag LOCUS_12680 1356 5099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 5422 5096 gene locus_tag LOCUS_12690 gene trxA 5422 5096 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392444.1 protein_id gnl|my_center|LOCUS_12690 5517 7268 gene locus_tag LOCUS_12700 gene polX 5517 7268 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551361.1 protein_id gnl|my_center|LOCUS_12700 8322 7306 gene locus_tag LOCUS_12710 8322 7306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 8378 8545 gene locus_tag LOCUS_12720 8378 8545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 8542 8784 gene locus_tag LOCUS_12730 8542 8784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 9438 8884 gene locus_tag LOCUS_12740 9438 8884 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030649.1 protein_id gnl|my_center|LOCUS_12740 9454 10170 gene locus_tag LOCUS_12750 9454 10170 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393990.1 protein_id gnl|my_center|LOCUS_12750 10747 10214 gene locus_tag LOCUS_12760 10747 10214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 11563 10748 gene locus_tag LOCUS_12770 gene otsB 11563 10748 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029558.1 protein_id gnl|my_center|LOCUS_12770 12471 11563 gene locus_tag LOCUS_12780 12471 11563 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_12780 12489 13382 gene locus_tag LOCUS_12790 gene parJ 12489 13382 CDS product filament polymerization regulator ParJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_12790 <13903 13395 gene locus_tag LOCUS_12800 <13903 13395 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226741.1:RecB family exonuclease >Feature sequence056 <1 545 gene locus_tag LOCUS_12810 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228498.1:redox-regulated ATPase YchF 1457 561 gene locus_tag LOCUS_12820 1457 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 2721 1582 gene locus_tag LOCUS_12830 2721 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 2835 4511 gene locus_tag LOCUS_12840 2835 4511 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920935.1 protein_id gnl|my_center|LOCUS_12840 4516 5985 gene locus_tag LOCUS_12850 4516 5985 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229619.1 protein_id gnl|my_center|LOCUS_12850 5996 6349 gene locus_tag LOCUS_12860 5996 6349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 6497 6913 gene locus_tag LOCUS_12870 6497 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 7205 7531 gene locus_tag LOCUS_12880 7205 7531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 9095 7758 gene locus_tag LOCUS_12890 9095 7758 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088586.1 protein_id gnl|my_center|LOCUS_12890 8912 8936 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10016 9177 gene locus_tag LOCUS_12900 10016 9177 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229360.1 protein_id gnl|my_center|LOCUS_12900 10073 11374 gene locus_tag LOCUS_12910 10073 11374 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485269.1 protein_id gnl|my_center|LOCUS_12910 11885 11424 gene locus_tag LOCUS_12920 11885 11424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 >Feature sequence057 125 796 gene locus_tag LOCUS_12930 125 796 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142016.1 protein_id gnl|my_center|LOCUS_12930 768 1829 gene locus_tag LOCUS_12940 768 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 2167 2469 gene locus_tag LOCUS_12950 2167 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 3024 4028 gene locus_tag LOCUS_12960 3024 4028 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969364.1 protein_id gnl|my_center|LOCUS_12960 4470 4150 gene locus_tag LOCUS_12970 gene erpA 4470 4150 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881213.1 protein_id gnl|my_center|LOCUS_12970 4381 4809 gene locus_tag LOCUS_12980 4381 4809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 4818 5267 gene locus_tag LOCUS_12990 4818 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 6154 5360 gene locus_tag LOCUS_13000 6154 5360 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392476.1 protein_id gnl|my_center|LOCUS_13000 7121 6234 gene locus_tag LOCUS_13010 7121 6234 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392475.1 protein_id gnl|my_center|LOCUS_13010 7176 8045 gene locus_tag LOCUS_13020 7176 8045 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244125.1 protein_id gnl|my_center|LOCUS_13020 8430 8203 gene locus_tag LOCUS_13030 8430 8203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 8936 8430 gene locus_tag LOCUS_13040 8936 8430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 9471 8941 gene locus_tag LOCUS_13050 9471 8941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 9665 10309 gene locus_tag LOCUS_13060 9665 10309 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892159.1 protein_id gnl|my_center|LOCUS_13060 10428 10703 gene locus_tag LOCUS_13070 10428 10703 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225295.1 protein_id gnl|my_center|LOCUS_13070 11556 10798 gene locus_tag LOCUS_13080 11556 10798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 12345 11608 gene locus_tag LOCUS_13090 12345 11608 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438150.1 protein_id gnl|my_center|LOCUS_13090 12361 12573 gene locus_tag LOCUS_13100 12361 12573 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001985297.1 protein_id gnl|my_center|LOCUS_13100 >Feature sequence058 3834 880 gene locus_tag LOCUS_13110 3834 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 3965 4255 gene locus_tag LOCUS_13120 3965 4255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 6550 4289 gene locus_tag LOCUS_13130 6550 4289 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525850.1 protein_id gnl|my_center|LOCUS_13130 6787 8622 gene locus_tag LOCUS_13140 6787 8622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 8403 8420 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9460 8885 gene locus_tag LOCUS_13150 9460 8885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 9991 9473 gene locus_tag LOCUS_13160 9991 9473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 10414 10905 gene locus_tag LOCUS_13170 10414 10905 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058543.1 protein_id gnl|my_center|LOCUS_13170 11174 11758 gene locus_tag LOCUS_13180 11174 11758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 11841 12107 gene locus_tag LOCUS_13190 11841 12107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 13062 12196 gene locus_tag LOCUS_13200 gene thrB 13062 12196 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392818.1 protein_id gnl|my_center|LOCUS_13200 <13634 13100 gene locus_tag LOCUS_13210 <13634 13100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005110129.1:threonine synthase >Feature sequence059 2 493 gene locus_tag LOCUS_13220 2 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 486 1883 gene locus_tag LOCUS_13230 486 1883 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224469.1 protein_id gnl|my_center|LOCUS_13230 1880 4201 gene locus_tag LOCUS_13240 gene glgB 1880 4201 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224470.1 protein_id gnl|my_center|LOCUS_13240 4409 6019 gene locus_tag LOCUS_13250 gene treZ 4409 6019 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393309.1 protein_id gnl|my_center|LOCUS_13250 6019 8139 gene locus_tag LOCUS_13260 gene glgX 6019 8139 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224925.1 protein_id gnl|my_center|LOCUS_13260 8198 10150 gene locus_tag LOCUS_13270 8198 10150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 10184 10325 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10419 10832 gene locus_tag LOCUS_13280 10419 10832 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089898.1 protein_id gnl|my_center|LOCUS_13280 11558 10923 gene locus_tag LOCUS_13290 gene pdxH 11558 10923 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403320.1 protein_id gnl|my_center|LOCUS_13290 >Feature sequence060 605 390 gene locus_tag LOCUS_13300 605 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 1028 3388 gene locus_tag LOCUS_13310 1028 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 4394 3459 gene locus_tag LOCUS_13320 gene rlmN 4394 3459 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922584.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13320 4490 5239 gene locus_tag LOCUS_13330 4490 5239 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460221.1 protein_id gnl|my_center|LOCUS_13330 5253 5618 gene locus_tag LOCUS_13340 gene aroH 5253 5618 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392856.1 protein_id gnl|my_center|LOCUS_13340 5652 6737 gene locus_tag LOCUS_13350 gene hisC 5652 6737 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_13350 6996 8027 gene locus_tag LOCUS_13360 gene aroF 6996 8027 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393889.1 protein_id gnl|my_center|LOCUS_13360 8024 9094 gene locus_tag LOCUS_13370 8024 9094 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392846.1 protein_id gnl|my_center|LOCUS_13370 9091 10386 gene locus_tag LOCUS_13380 gene aroA 9091 10386 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227950.1 protein_id gnl|my_center|LOCUS_13380 10397 11017 gene locus_tag LOCUS_13390 gene cmk 10397 11017 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943242.1 protein_id gnl|my_center|LOCUS_13390 11014 12396 gene locus_tag LOCUS_13400 gene der 11014 12396 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_13400 >Feature sequence061 1023 301 gene locus_tag LOCUS_13410 1023 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 1721 1038 gene locus_tag LOCUS_13420 1721 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 1848 5426 gene locus_tag LOCUS_13430 gene metH 1848 5426 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259744.1 protein_id gnl|my_center|LOCUS_13430 5607 5443 gene locus_tag LOCUS_13440 5607 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 6202 5726 gene locus_tag LOCUS_13450 6202 5726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 7061 6366 gene locus_tag LOCUS_13460 7061 6366 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207910.1 protein_id gnl|my_center|LOCUS_13460 9438 7129 gene locus_tag LOCUS_13470 9438 7129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 11664 9448 gene locus_tag LOCUS_13480 11664 9448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 11650 12357 gene locus_tag LOCUS_13490 11650 12357 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869292.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13490 >Feature sequence062 143 206 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1424 975 gene locus_tag LOCUS_13500 gene aroQ 1424 975 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083137.1 protein_id gnl|my_center|LOCUS_13500 2962 1424 gene locus_tag LOCUS_13510 2962 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 4134 2959 gene locus_tag LOCUS_13520 gene aroC 4134 2959 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768335.1 protein_id gnl|my_center|LOCUS_13520 5257 4256 gene locus_tag LOCUS_13530 5257 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 6015 5254 gene locus_tag LOCUS_13540 6015 5254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 6806 6012 gene locus_tag LOCUS_13550 6806 6012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 7689 6922 gene locus_tag LOCUS_13560 7689 6922 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_13560 8765 7707 gene locus_tag LOCUS_13570 8765 7707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 10065 8812 gene locus_tag LOCUS_13580 10065 8812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 11057 10068 gene locus_tag LOCUS_13590 11057 10068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 12496 11054 gene locus_tag LOCUS_13600 12496 11054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 >Feature sequence063 189 271 gene locus_tag LOCUS_t00110 189 271 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 376 657 gene locus_tag LOCUS_13610 376 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 654 1283 gene locus_tag LOCUS_13620 654 1283 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460932.1 protein_id gnl|my_center|LOCUS_13620 2135 1359 gene locus_tag LOCUS_13630 2135 1359 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153505920.1 protein_id gnl|my_center|LOCUS_13630 2186 2644 gene locus_tag LOCUS_13640 2186 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 3796 2648 gene locus_tag LOCUS_13650 3796 2648 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270166.1 protein_id gnl|my_center|LOCUS_13650 3865 4545 gene locus_tag LOCUS_13660 gene npdG 3865 4545 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060779.1 protein_id gnl|my_center|LOCUS_13660 4536 5444 gene locus_tag LOCUS_13670 gene cofD 4536 5444 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_13670 5516 6175 gene locus_tag LOCUS_13680 5516 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 6172 6933 gene locus_tag LOCUS_13690 gene cofE 6172 6933 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259452.1 protein_id gnl|my_center|LOCUS_13690 9437 7182 gene locus_tag LOCUS_13700 9437 7182 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121009479.1 protein_id gnl|my_center|LOCUS_13700 9631 10515 gene locus_tag LOCUS_13710 9631 10515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 10811 10551 gene locus_tag LOCUS_13720 10811 10551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 11263 10904 gene locus_tag LOCUS_13730 11263 10904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 11324 11524 gene locus_tag LOCUS_13740 11324 11524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 11634 12620 gene locus_tag LOCUS_13750 11634 12620 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_13750 >Feature sequence064 <1 972 gene locus_tag LOCUS_13760 <1 972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389818.1:4-hydroxyproline epimerase 975 1640 gene locus_tag LOCUS_13770 975 1640 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206385.1 protein_id gnl|my_center|LOCUS_13770 1645 3081 gene locus_tag LOCUS_13780 1645 3081 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039281.1 protein_id gnl|my_center|LOCUS_13780 3095 4870 gene locus_tag LOCUS_13790 3095 4870 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039109.1 protein_id gnl|my_center|LOCUS_13790 5356 5051 gene locus_tag LOCUS_13800 5356 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 5608 5796 gene locus_tag LOCUS_13810 5608 5796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13810 7644 5803 gene locus_tag LOCUS_13820 7644 5803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 6133 6156 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9689 7641 gene locus_tag LOCUS_13830 9689 7641 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928446.1 protein_id gnl|my_center|LOCUS_13830 9860 10174 gene locus_tag LOCUS_13840 9860 10174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 11178 10171 gene locus_tag LOCUS_13850 11178 10171 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537496.1 protein_id gnl|my_center|LOCUS_13850 12725 11175 gene locus_tag LOCUS_13860 12725 11175 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918026.1 protein_id gnl|my_center|LOCUS_13860 >Feature sequence065 407 2092 gene locus_tag LOCUS_13870 407 2092 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727088.1 protein_id gnl|my_center|LOCUS_13870 2151 3200 gene locus_tag LOCUS_13880 2151 3200 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727087.1 protein_id gnl|my_center|LOCUS_13880 3203 4153 gene locus_tag LOCUS_13890 3203 4153 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892061.1 protein_id gnl|my_center|LOCUS_13890 4150 6375 gene locus_tag LOCUS_13900 4150 6375 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812442.1 protein_id gnl|my_center|LOCUS_13900 6445 6849 gene locus_tag LOCUS_13910 gene spoIIAB 6445 6849 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_13910 7282 6899 gene locus_tag LOCUS_13920 7282 6899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 7584 7513 gene locus_tag LOCUS_t00120 7584 7513 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8177 7623 gene locus_tag LOCUS_13930 gene pyrE 8177 7623 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029143.1 protein_id gnl|my_center|LOCUS_13930 9138 8233 gene locus_tag LOCUS_13940 9138 8233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 9921 9235 gene locus_tag LOCUS_13950 9921 9235 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530139.1 protein_id gnl|my_center|LOCUS_13950 10028 10885 gene locus_tag LOCUS_13960 10028 10885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 >Feature sequence066 1049 258 gene locus_tag LOCUS_13970 1049 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 942 1337 gene locus_tag LOCUS_13980 942 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 2389 1322 gene locus_tag LOCUS_13990 2389 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 3101 2394 gene locus_tag LOCUS_14000 3101 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 3768 3217 gene locus_tag LOCUS_14010 3768 3217 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 protein_id gnl|my_center|LOCUS_14010 5057 3894 gene locus_tag LOCUS_14020 5057 3894 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903488.1 protein_id gnl|my_center|LOCUS_14020 5081 5815 gene locus_tag LOCUS_14030 5081 5815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 6054 7907 gene locus_tag LOCUS_14040 6054 7907 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392261.1 protein_id gnl|my_center|LOCUS_14040 9255 8020 gene locus_tag LOCUS_14050 9255 8020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 9467 11416 gene locus_tag LOCUS_14060 9467 11416 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030248.1 protein_id gnl|my_center|LOCUS_14060 >Feature sequence067 879 202 gene locus_tag LOCUS_14070 879 202 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 protein_id gnl|my_center|LOCUS_14070 1765 872 gene locus_tag LOCUS_14080 1765 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14080 2370 1762 gene locus_tag LOCUS_14090 2370 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14090 3439 2405 gene locus_tag LOCUS_14100 3439 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 3916 3653 gene locus_tag LOCUS_14110 3916 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 4086 5015 gene locus_tag LOCUS_14120 4086 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 5436 5029 gene locus_tag LOCUS_14130 5436 5029 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403693.1 protein_id gnl|my_center|LOCUS_14130 5532 5966 gene locus_tag LOCUS_14140 5532 5966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 7001 6009 gene locus_tag LOCUS_14150 7001 6009 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974145.1 protein_id gnl|my_center|LOCUS_14150 7087 8415 gene locus_tag LOCUS_14160 7087 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 8445 10136 gene locus_tag LOCUS_14170 8445 10136 CDS product succinate dehydrogenase/fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878184.1 protein_id gnl|my_center|LOCUS_14170 10109 11251 gene locus_tag LOCUS_14180 10109 11251 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057591.1 protein_id gnl|my_center|LOCUS_14180 11330 12190 gene locus_tag LOCUS_14190 11330 12190 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142939.1 protein_id gnl|my_center|LOCUS_14190 >Feature sequence068 218 1333 gene locus_tag LOCUS_14200 218 1333 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230195.1 protein_id gnl|my_center|LOCUS_14200 1208 1225 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1629 1408 gene locus_tag LOCUS_14210 1629 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 1513 2427 gene locus_tag LOCUS_14220 1513 2427 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226781.1 protein_id gnl|my_center|LOCUS_14220 2424 3326 gene locus_tag LOCUS_14230 2424 3326 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226780.1 protein_id gnl|my_center|LOCUS_14230 3323 4273 gene locus_tag LOCUS_14240 3323 4273 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226779.1 protein_id gnl|my_center|LOCUS_14240 4487 4960 gene locus_tag LOCUS_14250 4487 4960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14250 4979 5485 gene locus_tag LOCUS_14260 4979 5485 CDS product heme-degrading domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230675.1 protein_id gnl|my_center|LOCUS_14260 5634 6212 gene locus_tag LOCUS_14270 5634 6212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 6215 8104 gene locus_tag LOCUS_14280 gene uidA 6215 8104 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003648792.1 protein_id gnl|my_center|LOCUS_14280 8329 8147 gene locus_tag LOCUS_14290 8329 8147 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222993.1 protein_id gnl|my_center|LOCUS_14290 8745 8527 gene locus_tag LOCUS_14300 8745 8527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 8669 9106 gene locus_tag LOCUS_14310 8669 9106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 11014 9215 gene locus_tag LOCUS_14320 gene recD 11014 9215 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113007.1 protein_id gnl|my_center|LOCUS_14320 <12150 11011 gene locus_tag LOCUS_14330 <12150 11011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005092099.1:exodeoxyribonuclease V subunit beta >Feature sequence069 <1 1734 gene locus_tag LOCUS_14340 <1 1734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393251.1:phenylalanine--tRNA ligase subunit beta 1727 2734 gene locus_tag LOCUS_14350 gene argC 1727 2734 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_14350 2731 3969 gene locus_tag LOCUS_14360 gene argJ 2731 3969 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_14360 3966 4853 gene locus_tag LOCUS_14370 gene argB 3966 4853 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_14370 4850 5995 gene locus_tag LOCUS_14380 4850 5995 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870226.1 protein_id gnl|my_center|LOCUS_14380 6038 7306 gene locus_tag LOCUS_14390 6038 7306 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028537.1 protein_id gnl|my_center|LOCUS_14390 7348 7506 gene locus_tag LOCUS_14400 7348 7506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 7588 9984 gene locus_tag LOCUS_14410 7588 9984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 >Feature sequence070 737 2770 gene locus_tag LOCUS_14420 737 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 3225 2854 gene locus_tag LOCUS_14430 3225 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 3328 3522 gene locus_tag LOCUS_14440 3328 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 3519 4010 gene locus_tag LOCUS_14450 3519 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 4460 4086 gene locus_tag LOCUS_14460 4460 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 5552 4689 gene locus_tag LOCUS_14470 5552 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 5982 6075 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6252 6734 gene locus_tag LOCUS_14480 6252 6734 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731391.1 protein_id gnl|my_center|LOCUS_14480 7217 6804 gene locus_tag LOCUS_14490 7217 6804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 8059 7283 gene locus_tag LOCUS_14500 8059 7283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 8142 8630 gene locus_tag LOCUS_14510 8142 8630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 8660 9127 gene locus_tag LOCUS_14520 8660 9127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 9667 9347 gene locus_tag LOCUS_14530 9667 9347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14530 9941 9669 gene locus_tag LOCUS_14540 9941 9669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 10093 11142 gene locus_tag LOCUS_14550 10093 11142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 <11959 11366 gene locus_tag LOCUS_14560 <11959 11366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776685.1:FAD-binding oxidoreductase >Feature sequence071 1392 1201 gene locus_tag LOCUS_14570 1392 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 1813 1995 gene locus_tag LOCUS_14580 1813 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 2370 2110 gene locus_tag LOCUS_14590 2370 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 3149 2367 gene locus_tag LOCUS_14600 gene folE2 3149 2367 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039532.1 protein_id gnl|my_center|LOCUS_14600 3507 3142 gene locus_tag LOCUS_14610 gene queD 3507 3142 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268282.1 protein_id gnl|my_center|LOCUS_14610 4142 3507 gene locus_tag LOCUS_14620 gene queE 4142 3507 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085270.1 protein_id gnl|my_center|LOCUS_14620 4851 4144 gene locus_tag LOCUS_14630 gene queC 4851 4144 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389710.1 protein_id gnl|my_center|LOCUS_14630 4956 5852 gene locus_tag LOCUS_14640 4956 5852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 5845 6978 gene locus_tag LOCUS_14650 5845 6978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 6975 8198 gene locus_tag LOCUS_14660 6975 8198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 8208 9326 gene locus_tag LOCUS_14670 8208 9326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 9781 9539 gene locus_tag LOCUS_14680 9781 9539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 10338 9979 gene locus_tag LOCUS_14690 10338 9979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 10455 10661 gene locus_tag LOCUS_14700 10455 10661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 10932 10588 gene locus_tag LOCUS_14710 10932 10588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 <11927 11107 gene locus_tag LOCUS_14720 <11927 11107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727856.1:IS256 family transposase >Feature sequence072 1991 687 gene locus_tag LOCUS_14730 1991 687 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258059.1 protein_id gnl|my_center|LOCUS_14730 2524 1991 gene locus_tag LOCUS_14740 gene ybeY 2524 1991 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895867.1 protein_id gnl|my_center|LOCUS_14740 3492 2524 gene locus_tag LOCUS_14750 3492 2524 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_14750 3588 3881 gene locus_tag LOCUS_14760 3588 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 3987 4541 gene locus_tag LOCUS_14770 3987 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 4526 5986 gene locus_tag LOCUS_14780 4526 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 6276 6019 gene locus_tag LOCUS_14790 6276 6019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 6438 7478 gene locus_tag LOCUS_14800 6438 7478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 7623 8327 gene locus_tag LOCUS_14810 7623 8327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 8324 9559 gene locus_tag LOCUS_14820 8324 9559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 9559 10854 gene locus_tag LOCUS_14830 9559 10854 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776058.1 protein_id gnl|my_center|LOCUS_14830 10851 11720 gene locus_tag LOCUS_14840 10851 11720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 >Feature sequence073 494 1264 gene locus_tag LOCUS_14850 494 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14850 1274 2368 gene locus_tag LOCUS_14860 gene proB 1274 2368 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546492.1 protein_id gnl|my_center|LOCUS_14860 2459 3778 gene locus_tag LOCUS_14870 2459 3778 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976218.1 protein_id gnl|my_center|LOCUS_14870 3796 4401 gene locus_tag LOCUS_14880 gene nadD 3796 4401 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460892.1 protein_id gnl|my_center|LOCUS_14880 4398 4781 gene locus_tag LOCUS_14890 gene rsfS 4398 4781 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976226.1 protein_id gnl|my_center|LOCUS_14890 5206 4847 gene locus_tag LOCUS_14900 5206 4847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 5735 6442 gene locus_tag LOCUS_14910 5735 6442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 6439 6819 gene locus_tag LOCUS_14920 6439 6819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 6816 7688 gene locus_tag LOCUS_14930 6816 7688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 7685 7912 gene locus_tag LOCUS_14940 7685 7912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 7912 8694 gene locus_tag LOCUS_14950 7912 8694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 9063 9254 gene locus_tag LOCUS_14960 9063 9254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 9377 9673 gene locus_tag LOCUS_14970 9377 9673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 9670 10359 gene locus_tag LOCUS_14980 9670 10359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 10496 10672 gene locus_tag LOCUS_14990 10496 10672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 11469 10795 gene locus_tag LOCUS_15000 11469 10795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 10845 10911 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11591 11608 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence074 1684 419 gene locus_tag LOCUS_15010 1684 419 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229542.1 protein_id gnl|my_center|LOCUS_15010 2936 1677 gene locus_tag LOCUS_15020 gene lysA 2936 1677 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775960.1 protein_id gnl|my_center|LOCUS_15020 3808 3023 gene locus_tag LOCUS_15030 3808 3023 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567061.1 protein_id gnl|my_center|LOCUS_15030 5066 3870 gene locus_tag LOCUS_15040 5066 3870 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_15040 4951 5262 gene locus_tag LOCUS_15050 4951 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 5350 6243 gene locus_tag LOCUS_15060 gene htpX 5350 6243 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392235.1 protein_id gnl|my_center|LOCUS_15060 6262 6837 gene locus_tag LOCUS_15070 6262 6837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022099.1 protein_id gnl|my_center|LOCUS_15070 8396 8118 gene locus_tag LOCUS_15080 8396 8118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392238.1 protein_id gnl|my_center|LOCUS_15080 9169 8393 gene locus_tag LOCUS_15090 9169 8393 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021474.1 protein_id gnl|my_center|LOCUS_15090 9289 10461 gene locus_tag LOCUS_15100 9289 10461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710413.1 protein_id gnl|my_center|LOCUS_15100 10225 10265 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10467 10778 gene locus_tag LOCUS_15110 10467 10778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 >Feature sequence075 <1 770 gene locus_tag LOCUS_15120 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224631.1:gamma-glutamyltransferase 887 2089 gene locus_tag LOCUS_15130 887 2089 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225393.1 protein_id gnl|my_center|LOCUS_15130 2860 2117 gene locus_tag LOCUS_15140 2860 2117 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404382.1 protein_id gnl|my_center|LOCUS_15140 3923 2865 gene locus_tag LOCUS_15150 3923 2865 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257568.1 protein_id gnl|my_center|LOCUS_15150 4999 4067 gene locus_tag LOCUS_15160 4999 4067 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031621.1 protein_id gnl|my_center|LOCUS_15160 4920 5585 gene locus_tag LOCUS_15170 4920 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 5594 6736 gene locus_tag LOCUS_15180 gene prf1 5594 6736 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020101.1 protein_id gnl|my_center|LOCUS_15180 6752 7294 gene locus_tag LOCUS_15190 gene pncA 6752 7294 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135075.1 protein_id gnl|my_center|LOCUS_15190 8382 7291 gene locus_tag LOCUS_15200 8382 7291 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658369.1 protein_id gnl|my_center|LOCUS_15200 10054 8456 gene locus_tag LOCUS_15210 10054 8456 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727596.1 protein_id gnl|my_center|LOCUS_15210 >Feature sequence076 834 1370 gene locus_tag LOCUS_15220 834 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 1345 2313 gene locus_tag LOCUS_15230 gene rsmH 1345 2313 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_15230 2442 3191 gene locus_tag LOCUS_15240 2442 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 3234 4892 gene locus_tag LOCUS_15250 3234 4892 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_15250 4939 6369 gene locus_tag LOCUS_15260 4939 6369 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_15260 6374 7747 gene locus_tag LOCUS_15270 6374 7747 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272489.1 protein_id gnl|my_center|LOCUS_15270 7747 8709 gene locus_tag LOCUS_15280 gene mraY 7747 8709 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460699.1 protein_id gnl|my_center|LOCUS_15280 8706 10034 gene locus_tag LOCUS_15290 gene murD 8706 10034 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_15290 >Feature sequence077 <1 1061 gene locus_tag LOCUS_15300 <1 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016326127.1:galactose mutarotase 1105 2514 gene locus_tag LOCUS_15310 1105 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 2773 2519 gene locus_tag LOCUS_15320 2773 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15320 2955 2764 gene locus_tag LOCUS_15330 2955 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 4697 3087 gene locus_tag LOCUS_15340 4697 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 5788 4694 gene locus_tag LOCUS_15350 5788 4694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 5700 6593 gene locus_tag LOCUS_15360 5700 6593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 6637 7149 gene locus_tag LOCUS_15370 6637 7149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 7215 7628 gene locus_tag LOCUS_15380 7215 7628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 7700 8638 gene locus_tag LOCUS_15390 7700 8638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 8709 9491 gene locus_tag LOCUS_15400 8709 9491 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141879.1 protein_id gnl|my_center|LOCUS_15400 9574 10113 gene locus_tag LOCUS_15410 9574 10113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15410 10368 10637 gene locus_tag LOCUS_15420 10368 10637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 10634 10993 gene locus_tag LOCUS_15430 10634 10993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence078 16 2967 gene locus_tag LOCUS_15440 16 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 3002 3829 gene locus_tag LOCUS_15450 3002 3829 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429025.1 protein_id gnl|my_center|LOCUS_15450 3829 4422 gene locus_tag LOCUS_15460 3829 4422 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105137.1 protein_id gnl|my_center|LOCUS_15460 4419 5360 gene locus_tag LOCUS_15470 4419 5360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 5463 5390 gene locus_tag LOCUS_t00130 5463 5390 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5965 6981 gene locus_tag LOCUS_15480 5965 6981 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224333.1 protein_id gnl|my_center|LOCUS_15480 7387 7058 gene locus_tag LOCUS_15490 7387 7058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 7558 7699 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7708 9390 gene locus_tag LOCUS_15500 7708 9390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 8250 8342 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10118 9387 gene locus_tag LOCUS_15510 10118 9387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 10583 10284 gene locus_tag LOCUS_15520 10583 10284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 10714 11070 gene locus_tag LOCUS_15530 gene arfB 10714 11070 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974697.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence079 1181 423 gene locus_tag LOCUS_15540 1181 423 CDS product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222911.1 protein_id gnl|my_center|LOCUS_15540 1307 1510 gene locus_tag LOCUS_15550 1307 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 1662 1859 gene locus_tag LOCUS_15560 1662 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 2018 3349 gene locus_tag LOCUS_15570 2018 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 3357 4553 gene locus_tag LOCUS_15580 3357 4553 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188367504.1 protein_id gnl|my_center|LOCUS_15580 4550 5170 gene locus_tag LOCUS_15590 4550 5170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 5845 5267 gene locus_tag LOCUS_15600 5845 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 5962 6243 gene locus_tag LOCUS_15610 5962 6243 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422948.1 protein_id gnl|my_center|LOCUS_15610 6254 7186 gene locus_tag LOCUS_15620 6254 7186 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229653.1 protein_id gnl|my_center|LOCUS_15620 8655 7183 gene locus_tag LOCUS_15630 8655 7183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 8822 8750 gene locus_tag LOCUS_t00140 8822 8750 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 9037 8813 gene locus_tag LOCUS_15640 9037 8813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 8921 9628 gene locus_tag LOCUS_15650 8921 9628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 10390 10205 gene locus_tag LOCUS_15660 10390 10205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15660 >Feature sequence080 1162 1419 gene locus_tag LOCUS_15670 1162 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 1429 2892 gene locus_tag LOCUS_15680 1429 2892 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012477091.1 protein_id gnl|my_center|LOCUS_15680 3887 4513 gene locus_tag LOCUS_15690 3887 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 4675 4983 gene locus_tag LOCUS_15700 4675 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 5533 4928 gene locus_tag LOCUS_15710 5533 4928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 5990 6595 gene locus_tag LOCUS_15720 5990 6595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 10338 6964 gene locus_tag LOCUS_15730 10338 6964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 >Feature sequence081 1186 452 gene locus_tag LOCUS_15740 1186 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 2439 1183 gene locus_tag LOCUS_15750 gene nuoD 2439 1183 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258751.1 protein_id gnl|my_center|LOCUS_15750 2952 2443 gene locus_tag LOCUS_15760 2952 2443 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258750.1 protein_id gnl|my_center|LOCUS_15760 3634 2945 gene locus_tag LOCUS_15770 3634 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 3981 3625 gene locus_tag LOCUS_15780 3981 3625 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974383.1 protein_id gnl|my_center|LOCUS_15780 4484 4047 gene locus_tag LOCUS_15790 4484 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 4532 5050 gene locus_tag LOCUS_15800 4532 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 5119 6381 gene locus_tag LOCUS_15810 gene serS 5119 6381 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974982.1 protein_id gnl|my_center|LOCUS_15810 7671 6778 gene locus_tag LOCUS_15820 7671 6778 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525132.1 protein_id gnl|my_center|LOCUS_15820 7764 7988 gene locus_tag LOCUS_15830 7764 7988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 8400 8044 gene locus_tag LOCUS_15840 gene crcB 8400 8044 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941171.1 protein_id gnl|my_center|LOCUS_15840 8601 9311 gene locus_tag LOCUS_15850 8601 9311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 9801 9352 gene locus_tag LOCUS_15860 9801 9352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 10789 9761 gene locus_tag LOCUS_15870 10789 9761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 >Feature sequence082 1968 2234 gene locus_tag LOCUS_15880 1968 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 2997 2671 gene locus_tag LOCUS_15890 2997 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 4156 3866 gene locus_tag LOCUS_15900 4156 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 4178 4453 gene locus_tag LOCUS_15910 4178 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 4942 5820 gene locus_tag LOCUS_15920 4942 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 5882 6775 gene locus_tag LOCUS_15930 5882 6775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 6903 8237 gene locus_tag LOCUS_15940 6903 8237 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537490.1 protein_id gnl|my_center|LOCUS_15940 8395 9723 gene locus_tag LOCUS_15950 8395 9723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 >Feature sequence083 1818 637 gene locus_tag LOCUS_15960 1818 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 4073 1854 gene locus_tag LOCUS_15970 4073 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 4257 6710 gene locus_tag LOCUS_15980 4257 6710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 6770 7036 gene locus_tag LOCUS_15990 6770 7036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 7024 7212 gene locus_tag LOCUS_16000 7024 7212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 9069 9791 gene locus_tag LOCUS_16010 9069 9791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 >Feature sequence084 781 419 gene locus_tag LOCUS_16020 gene rplT 781 419 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880587.1 protein_id gnl|my_center|LOCUS_16020 981 778 gene locus_tag LOCUS_16030 gene rpmI 981 778 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808207.1 protein_id gnl|my_center|LOCUS_16030 1793 1239 gene locus_tag LOCUS_16040 gene infC 1793 1239 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071997922.1 protein_id gnl|my_center|LOCUS_16040 3852 1936 gene locus_tag LOCUS_16050 gene thrS 3852 1936 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869471.1 protein_id gnl|my_center|LOCUS_16050 3936 5006 gene locus_tag LOCUS_16060 3936 5006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 5029 6984 gene locus_tag LOCUS_16070 5029 6984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 8024 7047 gene locus_tag LOCUS_16080 8024 7047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 8618 8349 gene locus_tag LOCUS_16090 8618 8349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16090 9865 8618 gene locus_tag LOCUS_16100 9865 8618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16100 10220 10417 gene locus_tag LOCUS_16110 10220 10417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 >Feature sequence085 226 376 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 439 1911 gene locus_tag LOCUS_16120 439 1911 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_16120 1980 2363 gene locus_tag LOCUS_16130 1980 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 3017 2394 gene locus_tag LOCUS_16140 3017 2394 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403957.1 protein_id gnl|my_center|LOCUS_16140 3339 3085 gene locus_tag LOCUS_16150 3339 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 4382 3381 gene locus_tag LOCUS_16160 4382 3381 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223513.1 protein_id gnl|my_center|LOCUS_16160 4381 5181 gene locus_tag LOCUS_16170 4381 5181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 5437 6081 gene locus_tag LOCUS_16180 5437 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 6904 6146 gene locus_tag LOCUS_16190 6904 6146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 8343 6901 gene locus_tag LOCUS_16200 8343 6901 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259178.1 protein_id gnl|my_center|LOCUS_16200 8916 8380 gene locus_tag LOCUS_16210 8916 8380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 10489 8909 gene locus_tag LOCUS_16220 10489 8909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 >Feature sequence086 218 721 gene locus_tag LOCUS_16230 218 721 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160147.1 protein_id gnl|my_center|LOCUS_16230 5100 1870 gene locus_tag LOCUS_16240 5100 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 6702 5743 gene locus_tag LOCUS_16250 6702 5743 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027112.1 protein_id gnl|my_center|LOCUS_16250 6861 7298 gene locus_tag LOCUS_16260 6861 7298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 7377 8264 gene locus_tag LOCUS_16270 7377 8264 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970130.1 protein_id gnl|my_center|LOCUS_16270 8372 8157 gene locus_tag LOCUS_16280 8372 8157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 9335 8379 gene locus_tag LOCUS_16290 9335 8379 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731454.1 protein_id gnl|my_center|LOCUS_16290 9431 10324 gene locus_tag LOCUS_16300 9431 10324 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807047.1 protein_id gnl|my_center|LOCUS_16300 >Feature sequence087 104 880 gene locus_tag LOCUS_16310 104 880 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583949.1 protein_id gnl|my_center|LOCUS_16310 877 2058 gene locus_tag LOCUS_16320 gene marP 877 2058 CDS product acid resistance serine protease MarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731101.1 protein_id gnl|my_center|LOCUS_16320 2126 2737 gene locus_tag LOCUS_16330 2126 2737 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976168.1 protein_id gnl|my_center|LOCUS_16330 2835 3113 gene locus_tag LOCUS_16340 2835 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 3124 4509 gene locus_tag LOCUS_16350 gene xseA 3124 4509 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938641.1 protein_id gnl|my_center|LOCUS_16350 4506 4772 gene locus_tag LOCUS_16360 4506 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 4769 5632 gene locus_tag LOCUS_16370 4769 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 6135 5659 gene locus_tag LOCUS_16380 6135 5659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 6500 6252 gene locus_tag LOCUS_16390 6500 6252 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977176.1 protein_id gnl|my_center|LOCUS_16390 6667 8442 gene locus_tag LOCUS_16400 gene arc 6667 8442 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_16400 8617 9690 gene locus_tag LOCUS_16410 8617 9690 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729221.1 protein_id gnl|my_center|LOCUS_16410 9700 9717 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence088 <1 547 gene locus_tag LOCUS_16420 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057788.1:class I SAM-dependent methyltransferase 599 1021 gene locus_tag LOCUS_16430 599 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 1103 2119 gene locus_tag LOCUS_16440 1103 2119 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812034.1 protein_id gnl|my_center|LOCUS_16440 2140 2922 gene locus_tag LOCUS_16450 2140 2922 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812032.1 protein_id gnl|my_center|LOCUS_16450 2919 3788 gene locus_tag LOCUS_16460 2919 3788 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257864.1 protein_id gnl|my_center|LOCUS_16460 3904 4359 gene locus_tag LOCUS_16470 3904 4359 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812063.1 protein_id gnl|my_center|LOCUS_16470 6048 4405 gene locus_tag LOCUS_16480 6048 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 7304 6045 gene locus_tag LOCUS_16490 7304 6045 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270060.1 protein_id gnl|my_center|LOCUS_16490 8987 7449 gene locus_tag LOCUS_16500 8987 7449 CDS product DUF4331 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929156.1 protein_id gnl|my_center|LOCUS_16500 9899 9168 gene locus_tag LOCUS_16510 9899 9168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 >Feature sequence089 355 783 gene locus_tag LOCUS_16520 355 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 926 1075 gene locus_tag LOCUS_16530 926 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 1810 1259 gene locus_tag LOCUS_16540 1810 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 1798 2118 gene locus_tag LOCUS_16550 1798 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 2586 2365 gene locus_tag LOCUS_16560 2586 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 2744 2583 gene locus_tag LOCUS_16570 2744 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 3058 3885 gene locus_tag LOCUS_16580 3058 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 7772 3969 gene locus_tag LOCUS_16590 7772 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 8704 7898 gene locus_tag LOCUS_16600 8704 7898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 10222 9386 gene locus_tag LOCUS_16610 10222 9386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 >Feature sequence090 <1 899 gene locus_tag LOCUS_16620 <1 899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029805.1:NlpC/P60 family protein 1856 912 gene locus_tag LOCUS_16630 gene catE 1856 912 CDS product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233597.1 protein_id gnl|my_center|LOCUS_16630 2022 3020 gene locus_tag LOCUS_16640 2022 3020 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228266.1 protein_id gnl|my_center|LOCUS_16640 3174 4070 gene locus_tag LOCUS_16650 3174 4070 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036279.1 protein_id gnl|my_center|LOCUS_16650 4224 5048 gene locus_tag LOCUS_16660 4224 5048 CDS product PRC and DUF2382 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027446.1 protein_id gnl|my_center|LOCUS_16660 5954 5055 gene locus_tag LOCUS_16670 5954 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 7603 5987 gene locus_tag LOCUS_16680 7603 5987 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123683.1 protein_id gnl|my_center|LOCUS_16680 7738 8133 gene locus_tag LOCUS_16690 7738 8133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 8133 8501 gene locus_tag LOCUS_16700 8133 8501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 8494 9639 gene locus_tag LOCUS_16710 8494 9639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 9020 9037 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence091 2290 1841 gene locus_tag LOCUS_16720 2290 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 3092 3994 gene locus_tag LOCUS_16730 3092 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16730 4481 4086 gene locus_tag LOCUS_16740 4481 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 4723 5067 gene locus_tag LOCUS_16750 4723 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 5064 5204 gene locus_tag LOCUS_16760 5064 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 5847 5245 gene locus_tag LOCUS_16770 5847 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 5834 6127 gene locus_tag LOCUS_16780 5834 6127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 6186 6887 gene locus_tag LOCUS_16790 6186 6887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 7414 7878 gene locus_tag LOCUS_16800 7414 7878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 8200 7895 gene locus_tag LOCUS_16810 8200 7895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 8686 8342 gene locus_tag LOCUS_16820 8686 8342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 9728 8796 gene locus_tag LOCUS_16830 9728 8796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence092 2463 1837 gene locus_tag LOCUS_16840 2463 1837 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 protein_id gnl|my_center|LOCUS_16840 2682 2867 gene locus_tag LOCUS_16850 2682 2867 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763586.1 protein_id gnl|my_center|LOCUS_16850 4315 2996 gene locus_tag LOCUS_16860 gene bioA 4315 2996 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939829.1 protein_id gnl|my_center|LOCUS_16860 4430 5926 gene locus_tag LOCUS_16870 4430 5926 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258554.1 protein_id gnl|my_center|LOCUS_16870 5923 6666 gene locus_tag LOCUS_16880 5923 6666 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730656.1 protein_id gnl|my_center|LOCUS_16880 6802 6876 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7548 6883 gene locus_tag LOCUS_16890 7548 6883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 8299 7616 gene locus_tag LOCUS_16900 8299 7616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 9516 8305 gene locus_tag LOCUS_16910 gene bioF 9516 8305 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_16910 >Feature sequence093 <1 687 gene locus_tag LOCUS_16920 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256005.1:1,4-dihydroxy-2-naphthoate polyprenyltransferase 690 1739 gene locus_tag LOCUS_16930 690 1739 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490874.1 protein_id gnl|my_center|LOCUS_16930 1750 2103 gene locus_tag LOCUS_16940 1750 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 2632 2237 gene locus_tag LOCUS_16950 2632 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 3638 2985 gene locus_tag LOCUS_16960 gene menH 3638 2985 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255997.1 protein_id gnl|my_center|LOCUS_16960 3719 5455 gene locus_tag LOCUS_16970 gene menD 3719 5455 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902775.1 protein_id gnl|my_center|LOCUS_16970 6952 5486 gene locus_tag LOCUS_16980 6952 5486 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_16980 7546 6989 gene locus_tag LOCUS_16990 gene ilvN 7546 6989 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_16990 9236 7557 gene locus_tag LOCUS_17000 gene ilvB 9236 7557 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228519.1 protein_id gnl|my_center|LOCUS_17000 >Feature sequence094 1871 1119 gene locus_tag LOCUS_17010 gene hisF 1871 1119 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393527.1 protein_id gnl|my_center|LOCUS_17010 2621 1893 gene locus_tag LOCUS_17020 gene hisA 2621 1893 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393528.1 protein_id gnl|my_center|LOCUS_17020 3253 2618 gene locus_tag LOCUS_17030 gene hisH 3253 2618 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_17030 3846 3250 gene locus_tag LOCUS_17040 gene hisB 3846 3250 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393530.1 protein_id gnl|my_center|LOCUS_17040 3503 3533 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5084 3843 gene locus_tag LOCUS_17050 gene hisD 5084 3843 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903049.1 protein_id gnl|my_center|LOCUS_17050 5706 5074 gene locus_tag LOCUS_17060 gene hisG 5706 5074 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817216.1 protein_id gnl|my_center|LOCUS_17060 6671 5697 gene locus_tag LOCUS_17070 gene hisZ 6671 5697 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393533.1 protein_id gnl|my_center|LOCUS_17070 7983 6697 gene locus_tag LOCUS_17080 gene murA 7983 6697 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083644.1 protein_id gnl|my_center|LOCUS_17080 7982 8701 gene locus_tag LOCUS_17090 7982 8701 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_17090 >Feature sequence095 <1 1525 gene locus_tag LOCUS_17100 <1 1525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974308.1:DNA-directed RNA polymerase subunit beta' 1942 2649 gene locus_tag LOCUS_17110 1942 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 2805 4412 gene locus_tag LOCUS_17120 2805 4412 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086694.1 protein_id gnl|my_center|LOCUS_17120 4423 5547 gene locus_tag LOCUS_17130 gene ald 4423 5547 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704256.1 protein_id gnl|my_center|LOCUS_17130 5571 5966 gene locus_tag LOCUS_17140 gene rpsL 5571 5966 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948652.1 protein_id gnl|my_center|LOCUS_17140 5969 6439 gene locus_tag LOCUS_17150 gene rpsG 5969 6439 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583341.1 protein_id gnl|my_center|LOCUS_17150 6667 8769 gene locus_tag LOCUS_17160 gene fusA 6667 8769 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_17160 9212 9240 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence096 1651 455 gene locus_tag LOCUS_17170 1651 455 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034798928.1 protein_id gnl|my_center|LOCUS_17170 2665 1658 gene locus_tag LOCUS_17180 2665 1658 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184768132.1 protein_id gnl|my_center|LOCUS_17180 3773 2670 gene locus_tag LOCUS_17190 3773 2670 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243020.1 protein_id gnl|my_center|LOCUS_17190 5089 3815 gene locus_tag LOCUS_17200 5089 3815 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974552.1 protein_id gnl|my_center|LOCUS_17200 6066 5086 gene locus_tag LOCUS_17210 6066 5086 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226891.1 protein_id gnl|my_center|LOCUS_17210 6265 7581 gene locus_tag LOCUS_17220 6265 7581 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226891.1 protein_id gnl|my_center|LOCUS_17220 8927 7815 gene locus_tag LOCUS_17230 8927 7815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence097 156 980 gene locus_tag LOCUS_17240 156 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1015 1749 gene locus_tag LOCUS_17250 1015 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 1753 2790 gene locus_tag LOCUS_17260 1753 2790 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030362.1 protein_id gnl|my_center|LOCUS_17260 4295 2838 gene locus_tag LOCUS_17270 4295 2838 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211039795.1 protein_id gnl|my_center|LOCUS_17270 4574 5074 gene locus_tag LOCUS_17280 4574 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 5874 5140 gene locus_tag LOCUS_17290 5874 5140 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028999.1 protein_id gnl|my_center|LOCUS_17290 6278 5871 gene locus_tag LOCUS_17300 6278 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 7903 6488 gene locus_tag LOCUS_17310 7903 6488 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027415.1 protein_id gnl|my_center|LOCUS_17310 8933 8223 gene locus_tag LOCUS_17320 8933 8223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 9190 8930 gene locus_tag LOCUS_17330 9190 8930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 >Feature sequence098 1067 174 gene locus_tag LOCUS_17340 1067 174 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721719.1 protein_id gnl|my_center|LOCUS_17340 1818 1060 gene locus_tag LOCUS_17350 1818 1060 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_17350 1877 2020 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3174 2704 gene locus_tag LOCUS_17360 3174 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 4049 3171 gene locus_tag LOCUS_17370 4049 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 4328 4053 gene locus_tag LOCUS_17380 4328 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 4737 4336 gene locus_tag LOCUS_17390 4737 4336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 4925 4737 gene locus_tag LOCUS_17400 4925 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 5214 6551 gene locus_tag LOCUS_17410 gene dnaA 5214 6551 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428021.1 protein_id gnl|my_center|LOCUS_17410 6715 7824 gene locus_tag LOCUS_17420 gene dnaN 6715 7824 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012615304.1 protein_id gnl|my_center|LOCUS_17420 7843 8967 gene locus_tag LOCUS_17430 gene recF 7843 8967 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259706.1 protein_id gnl|my_center|LOCUS_17430 8951 9256 gene locus_tag LOCUS_17440 8951 9256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 >Feature sequence099 1330 2547 gene locus_tag LOCUS_17450 1330 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 2593 3822 gene locus_tag LOCUS_17460 2593 3822 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083215.1 protein_id gnl|my_center|LOCUS_17460 3825 5324 gene locus_tag LOCUS_17470 3825 5324 CDS product glycosyltransferase family 20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877359.1 protein_id gnl|my_center|LOCUS_17470 5440 5569 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6056 6436 gene locus_tag LOCUS_17480 6056 6436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 6912 7382 gene locus_tag LOCUS_17490 6912 7382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 7564 7947 gene locus_tag LOCUS_17500 7564 7947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 8128 8406 gene locus_tag LOCUS_17510 8128 8406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 8410 8862 gene locus_tag LOCUS_17520 gene rplI 8410 8862 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256838.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence100 1201 227 gene locus_tag LOCUS_17530 1201 227 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393776.1 protein_id gnl|my_center|LOCUS_17530 1310 1750 gene locus_tag LOCUS_17540 1310 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 1747 3090 gene locus_tag LOCUS_17550 1747 3090 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17550 3203 4288 gene locus_tag LOCUS_17560 3203 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 4397 4472 gene locus_tag LOCUS_t00150 4397 4472 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4916 4515 gene locus_tag LOCUS_17570 4916 4515 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811999.1 protein_id gnl|my_center|LOCUS_17570 5065 6681 gene locus_tag LOCUS_17580 5065 6681 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461447.1 protein_id gnl|my_center|LOCUS_17580 6733 7197 gene locus_tag LOCUS_17590 gene greA 6733 7197 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339475.1 protein_id gnl|my_center|LOCUS_17590 7223 8044 gene locus_tag LOCUS_17600 7223 8044 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226473.1 protein_id gnl|my_center|LOCUS_17600 >Feature sequence101 390 1079 gene locus_tag LOCUS_17610 390 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 1086 2087 gene locus_tag LOCUS_17620 1086 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 2176 3699 gene locus_tag LOCUS_17630 gene metG 2176 3699 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869940.1 protein_id gnl|my_center|LOCUS_17630 3696 4445 gene locus_tag LOCUS_17640 3696 4445 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531574.1 protein_id gnl|my_center|LOCUS_17640 4442 5299 gene locus_tag LOCUS_17650 gene rsmA 4442 5299 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216869.1 protein_id gnl|my_center|LOCUS_17650 5296 6192 gene locus_tag LOCUS_17660 5296 6192 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028794.1 protein_id gnl|my_center|LOCUS_17660 6294 6509 gene locus_tag LOCUS_17670 6294 6509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 6527 7792 gene locus_tag LOCUS_17680 6527 7792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 7175 7222 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence102 <1 1651 gene locus_tag LOCUS_17690 <1 1651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265514.1:TonB-dependent receptor 1651 2790 gene locus_tag LOCUS_17700 1651 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 3654 2848 gene locus_tag LOCUS_17710 3654 2848 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035403.1 protein_id gnl|my_center|LOCUS_17710 4370 3750 gene locus_tag LOCUS_17720 4370 3750 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163029.1 protein_id gnl|my_center|LOCUS_17720 4563 4372 gene locus_tag LOCUS_17730 4563 4372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 4673 5812 gene locus_tag LOCUS_17740 4673 5812 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919363.1 protein_id gnl|my_center|LOCUS_17740 5923 6474 gene locus_tag LOCUS_17750 5923 6474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 6474 7481 gene locus_tag LOCUS_17760 6474 7481 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035376.1 protein_id gnl|my_center|LOCUS_17760 8279 7551 gene locus_tag LOCUS_17770 8279 7551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 >Feature sequence103 15 521 gene locus_tag LOCUS_17780 15 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 1381 566 gene locus_tag LOCUS_17790 1381 566 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660467.1 protein_id gnl|my_center|LOCUS_17790 1721 3631 gene locus_tag LOCUS_17800 1721 3631 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027999.1 protein_id gnl|my_center|LOCUS_17800 3700 4074 gene locus_tag LOCUS_17810 3700 4074 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846473.1 protein_id gnl|my_center|LOCUS_17810 4312 5928 gene locus_tag LOCUS_17820 gene merA 4312 5928 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031938.1 protein_id gnl|my_center|LOCUS_17820 5968 7314 gene locus_tag LOCUS_17830 5968 7314 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225363.1 protein_id gnl|my_center|LOCUS_17830 8100 7396 gene locus_tag LOCUS_17840 8100 7396 CDS product DUF4396 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227530.1 protein_id gnl|my_center|LOCUS_17840 >Feature sequence104 335 1234 gene locus_tag LOCUS_17850 gene ruvB 335 1234 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_17850 1274 1723 gene locus_tag LOCUS_17860 1274 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 1729 4644 gene locus_tag LOCUS_17870 gene secDF 1729 4644 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531306.1 protein_id gnl|my_center|LOCUS_17870 4679 4951 gene locus_tag LOCUS_17880 4679 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 5062 7515 gene locus_tag LOCUS_17890 5062 7515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence105 1484 180 gene locus_tag LOCUS_17900 1484 180 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920957.1 protein_id gnl|my_center|LOCUS_17900 2092 1553 gene locus_tag LOCUS_17910 2092 1553 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_17910 3047 2103 gene locus_tag LOCUS_17920 3047 2103 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140745.1 protein_id gnl|my_center|LOCUS_17920 2516 2558 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3207 3058 gene locus_tag LOCUS_17930 3207 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 3421 3951 gene locus_tag LOCUS_17940 3421 3951 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113674.1 protein_id gnl|my_center|LOCUS_17940 4228 4004 gene locus_tag LOCUS_17950 4228 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 4961 4302 gene locus_tag LOCUS_17960 4961 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 6524 5055 gene locus_tag LOCUS_17970 6524 5055 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048142299.1 protein_id gnl|my_center|LOCUS_17970 8054 6678 gene locus_tag LOCUS_17980 8054 6678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 >Feature sequence106 <1 1377 gene locus_tag LOCUS_17990 <1 1377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005815191.1:replicative DNA helicase 1420 2316 gene locus_tag LOCUS_18000 1420 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 2330 3646 gene locus_tag LOCUS_18010 2330 3646 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393792.1 protein_id gnl|my_center|LOCUS_18010 4534 3704 gene locus_tag LOCUS_18020 4534 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 5168 4527 gene locus_tag LOCUS_18030 5168 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 5932 5171 gene locus_tag LOCUS_18040 5932 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 7153 6083 gene locus_tag LOCUS_18050 gene wecB 7153 6083 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048109.1 protein_id gnl|my_center|LOCUS_18050 8104 7304 gene locus_tag LOCUS_18060 8104 7304 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977279.1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence107 486 1172 gene locus_tag LOCUS_18070 gene rpe 486 1172 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977361.1 protein_id gnl|my_center|LOCUS_18070 2358 1279 gene locus_tag LOCUS_18080 2358 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 2699 3727 gene locus_tag LOCUS_18090 gene ribD 2699 3727 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803669.1 protein_id gnl|my_center|LOCUS_18090 2835 2903 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3733 4335 gene locus_tag LOCUS_18100 3733 4335 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057751.1 protein_id gnl|my_center|LOCUS_18100 4332 5570 gene locus_tag LOCUS_18110 4332 5570 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977384.1 protein_id gnl|my_center|LOCUS_18110 5923 6097 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6099 6479 gene locus_tag LOCUS_18120 6099 6479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 6947 7594 gene locus_tag LOCUS_18130 gene merB 6947 7594 CDS product organomercurial lyase MerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790334.1 protein_id gnl|my_center|LOCUS_18130 >Feature sequence108 603 1295 gene locus_tag LOCUS_18140 603 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 1324 1824 gene locus_tag LOCUS_18150 1324 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18150 1867 2526 gene locus_tag LOCUS_18160 1867 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 3490 2906 gene locus_tag LOCUS_18170 3490 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 3857 3672 gene locus_tag LOCUS_18180 3857 3672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 4918 3854 gene locus_tag LOCUS_18190 4918 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 5168 5635 gene locus_tag LOCUS_18200 5168 5635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 5632 6174 gene locus_tag LOCUS_18210 5632 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 6606 6346 gene locus_tag LOCUS_18220 6606 6346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 6781 7425 gene locus_tag LOCUS_18230 6781 7425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 7425 7622 gene locus_tag LOCUS_18240 7425 7622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 >Feature sequence109 39 518 gene locus_tag LOCUS_18250 39 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 685 4056 gene locus_tag LOCUS_18260 685 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 5840 4158 gene locus_tag LOCUS_18270 gene mutL 5840 4158 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257019.1 protein_id gnl|my_center|LOCUS_18270 6302 6745 gene locus_tag LOCUS_18280 6302 6745 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812063.1 protein_id gnl|my_center|LOCUS_18280 7906 6854 gene locus_tag LOCUS_18290 7906 6854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 >Feature sequence110 1314 1592 gene locus_tag LOCUS_18300 1314 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 5153 1659 gene locus_tag LOCUS_18310 5153 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 3548 3665 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6692 5340 gene locus_tag LOCUS_18320 6692 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 7255 6689 gene locus_tag LOCUS_18330 7255 6689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 7836 7252 gene locus_tag LOCUS_18340 7836 7252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 >Feature sequence111 530 460 gene locus_tag LOCUS_t00160 530 460 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 677 1966 gene locus_tag LOCUS_18350 gene glmU 677 1966 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730527.1 protein_id gnl|my_center|LOCUS_18350 1963 3033 gene locus_tag LOCUS_18360 1963 3033 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814952.1 protein_id gnl|my_center|LOCUS_18360 3102 3350 gene locus_tag LOCUS_18370 3102 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 3632 3357 gene locus_tag LOCUS_18380 3632 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 3741 4430 gene locus_tag LOCUS_18390 3741 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 4597 5025 gene locus_tag LOCUS_18400 4597 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 5434 5093 gene locus_tag LOCUS_18410 5434 5093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 5528 6229 gene locus_tag LOCUS_18420 5528 6229 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391626.1 protein_id gnl|my_center|LOCUS_18420 6433 6804 gene locus_tag LOCUS_18430 6433 6804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 7503 6949 gene locus_tag LOCUS_18440 7503 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 >Feature sequence112 142 447 gene locus_tag LOCUS_18450 142 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 664 870 gene locus_tag LOCUS_18460 664 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 1026 1244 gene locus_tag LOCUS_18470 1026 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 1676 2515 gene locus_tag LOCUS_18480 1676 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 2747 2493 gene locus_tag LOCUS_18490 2747 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 3651 3579 gene locus_tag LOCUS_t00170 3651 3579 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3849 4703 gene locus_tag LOCUS_18500 3849 4703 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388041.1 protein_id gnl|my_center|LOCUS_18500 4777 4847 gene locus_tag LOCUS_t00180 4777 4847 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 4903 5412 gene locus_tag LOCUS_18510 4903 5412 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941194.1 protein_id gnl|my_center|LOCUS_18510 7597 5456 gene locus_tag LOCUS_18520 gene ftsH 7597 5456 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030322.1 protein_id gnl|my_center|LOCUS_18520 5548 5564 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7704 7777 gene locus_tag LOCUS_t00190 7704 7777 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence113 581 2272 gene locus_tag LOCUS_18530 gene ilvD 581 2272 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258705.1 protein_id gnl|my_center|LOCUS_18530 3321 2323 gene locus_tag LOCUS_18540 3321 2323 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223699.1 protein_id gnl|my_center|LOCUS_18540 3342 3944 gene locus_tag LOCUS_18550 3342 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 4026 5060 gene locus_tag LOCUS_18560 4026 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 5481 5164 gene locus_tag LOCUS_18570 5481 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 5465 6388 gene locus_tag LOCUS_18580 gene xerD 5465 6388 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921953.1 protein_id gnl|my_center|LOCUS_18580 6492 7184 gene locus_tag LOCUS_18590 gene whiG 6492 7184 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973389.1 protein_id gnl|my_center|LOCUS_18590 >Feature sequence114 1651 719 gene locus_tag LOCUS_18600 1651 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 1854 2741 gene locus_tag LOCUS_18610 1854 2741 CDS product SigB/SigF/SigG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228009.1 protein_id gnl|my_center|LOCUS_18610 3130 2873 gene locus_tag LOCUS_18620 3130 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 3151 3825 gene locus_tag LOCUS_18630 3151 3825 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880973.1 protein_id gnl|my_center|LOCUS_18630 4243 3890 gene locus_tag LOCUS_18640 gene bldG 4243 3890 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_18640 4676 4293 gene locus_tag LOCUS_18650 4676 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 4972 5406 gene locus_tag LOCUS_18660 4972 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 5920 5378 gene locus_tag LOCUS_18670 5920 5378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 6637 6200 gene locus_tag LOCUS_18680 6637 6200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 6794 7483 gene locus_tag LOCUS_18690 6794 7483 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225121.1 protein_id gnl|my_center|LOCUS_18690 >Feature sequence115 137 373 gene locus_tag LOCUS_18700 137 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 595 431 gene locus_tag LOCUS_18710 595 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 1372 827 gene locus_tag LOCUS_18720 1372 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 2020 1628 gene locus_tag LOCUS_18730 2020 1628 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_18730 2102 2449 gene locus_tag LOCUS_18740 2102 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 3531 2422 gene locus_tag LOCUS_18750 3531 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 5099 3687 gene locus_tag LOCUS_18760 gene gltX 5099 3687 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389476.1 protein_id gnl|my_center|LOCUS_18760 5165 6034 gene locus_tag LOCUS_18770 5165 6034 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_18770 <7578 6051 gene locus_tag LOCUS_18780 <7578 6051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942050.1:DNA polymerase III subunit alpha >Feature sequence116 1573 2421 gene locus_tag LOCUS_18790 1573 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 2470 2886 gene locus_tag LOCUS_18800 2470 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 3228 2941 gene locus_tag LOCUS_18810 gene clpS 3228 2941 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056930.1 protein_id gnl|my_center|LOCUS_18810 4120 3260 gene locus_tag LOCUS_18820 4120 3260 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888069.1 protein_id gnl|my_center|LOCUS_18820 4339 4512 gene locus_tag LOCUS_18830 4339 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 5132 4704 gene locus_tag LOCUS_18840 5132 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 5240 5740 gene locus_tag LOCUS_18850 5240 5740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 6928 5774 gene locus_tag LOCUS_18860 6928 5774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 >Feature sequence117 1190 969 gene locus_tag LOCUS_18870 1190 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 2140 1268 gene locus_tag LOCUS_18880 gene dapF 2140 1268 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583145.1 protein_id gnl|my_center|LOCUS_18880 3139 2201 gene locus_tag LOCUS_18890 gene miaA 3139 2201 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908061.1 protein_id gnl|my_center|LOCUS_18890 3272 4411 gene locus_tag LOCUS_18900 3272 4411 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403248.1 protein_id gnl|my_center|LOCUS_18900 4421 5236 gene locus_tag LOCUS_18910 4421 5236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 5233 5532 gene locus_tag LOCUS_18920 5233 5532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 6638 5529 gene locus_tag LOCUS_18930 6638 5529 CDS product Rv2578c family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972497.1 protein_id gnl|my_center|LOCUS_18930 <7511 6654 gene locus_tag LOCUS_18940 <7511 6654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986381.1:tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB >Feature sequence118 96 431 gene locus_tag LOCUS_18950 96 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 391 666 gene locus_tag LOCUS_18960 391 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 1863 781 gene locus_tag LOCUS_18970 gene hppD 1863 781 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256700.1 protein_id gnl|my_center|LOCUS_18970 2889 1966 gene locus_tag LOCUS_18980 gene yedA 2889 1966 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168169.1 protein_id gnl|my_center|LOCUS_18980 3257 2946 gene locus_tag LOCUS_18990 3257 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 3360 4289 gene locus_tag LOCUS_19000 3360 4289 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222703.1 protein_id gnl|my_center|LOCUS_19000 4312 4827 gene locus_tag LOCUS_19010 4312 4827 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776841.1 protein_id gnl|my_center|LOCUS_19010 5313 4975 gene locus_tag LOCUS_19020 5313 4975 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728346.1 protein_id gnl|my_center|LOCUS_19020 5665 5483 gene locus_tag LOCUS_19030 5665 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 6254 5994 gene locus_tag LOCUS_19040 6254 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 <7444 6337 gene locus_tag LOCUS_19050 <7444 6337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941578.1:aldehyde ferredoxin oxidoreductase family protein >Feature sequence119 <1 1643 gene locus_tag LOCUS_19060 <1 1643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919356.1:sulfate adenylyltransferase subunit CysN 1647 3470 gene locus_tag LOCUS_19070 1647 3470 CDS product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243259.1 protein_id gnl|my_center|LOCUS_19070 3483 5186 gene locus_tag LOCUS_19080 gene cysI 3483 5186 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243849.1 protein_id gnl|my_center|LOCUS_19080 5867 5187 gene locus_tag LOCUS_19090 5867 5187 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036039.1 protein_id gnl|my_center|LOCUS_19090 <7346 6052 gene locus_tag LOCUS_19100 <7346 6052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920074.1:diaminopimelate decarboxylase 6233 6353 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence120 327 1292 gene locus_tag LOCUS_19110 327 1292 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114426.1 protein_id gnl|my_center|LOCUS_19110 1633 2406 gene locus_tag LOCUS_19120 1633 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 2974 2768 gene locus_tag LOCUS_19130 2974 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 3217 3056 gene locus_tag LOCUS_19140 3217 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 3273 3575 gene locus_tag LOCUS_19150 3273 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 6651 3766 gene locus_tag LOCUS_19160 6651 3766 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030467.1 protein_id gnl|my_center|LOCUS_19160 >Feature sequence121 236 1690 gene locus_tag LOCUS_19170 236 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 1575 1979 gene locus_tag LOCUS_19180 1575 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 3260 2214 gene locus_tag LOCUS_19190 3260 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 4880 3495 gene locus_tag LOCUS_19200 4880 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 5465 5310 gene locus_tag LOCUS_19210 5465 5310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 5713 6066 gene locus_tag LOCUS_19220 5713 6066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 6463 7086 gene locus_tag LOCUS_19230 6463 7086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 >Feature sequence122 1070 1417 gene locus_tag LOCUS_19240 1070 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 1423 1911 gene locus_tag LOCUS_19250 1423 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 2134 3189 gene locus_tag LOCUS_19260 2134 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 3327 3881 gene locus_tag LOCUS_19270 3327 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 3878 4543 gene locus_tag LOCUS_19280 3878 4543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 4549 6339 gene locus_tag LOCUS_19290 4549 6339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 7004 6567 gene locus_tag LOCUS_19300 7004 6567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 >Feature sequence123 159 2735 gene locus_tag LOCUS_19310 159 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19310 2642 3526 gene locus_tag LOCUS_19320 2642 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19320 3409 5961 gene locus_tag LOCUS_19330 3409 5961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19330 5964 6383 gene locus_tag LOCUS_19340 5964 6383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 >Feature sequence124 2 307 gene locus_tag LOCUS_19350 2 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 389 895 gene locus_tag LOCUS_19360 389 895 CDS product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071017.1 protein_id gnl|my_center|LOCUS_19360 1618 1163 gene locus_tag LOCUS_19370 1618 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 2729 1761 gene locus_tag LOCUS_19380 2729 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 3259 2972 gene locus_tag LOCUS_19390 3259 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 4825 3269 gene locus_tag LOCUS_19400 4825 3269 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527896.1 protein_id gnl|my_center|LOCUS_19400 <6876 4825 gene locus_tag LOCUS_19410 <6876 4825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014878656.1:glutamate synthase large subunit >Feature sequence125 401 1759 gene locus_tag LOCUS_19420 401 1759 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207962.1 protein_id gnl|my_center|LOCUS_19420 2068 2742 gene locus_tag LOCUS_19430 2068 2742 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973261.1 protein_id gnl|my_center|LOCUS_19430 2739 3041 gene locus_tag LOCUS_19440 2739 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 3426 3070 gene locus_tag LOCUS_19450 3426 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 3742 4599 gene locus_tag LOCUS_19460 3742 4599 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275150.1 protein_id gnl|my_center|LOCUS_19460 >Feature sequence126 2569 2237 gene locus_tag LOCUS_19470 2569 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 2630 2897 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4120 3557 gene locus_tag LOCUS_19480 4120 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 4180 4590 gene locus_tag LOCUS_19490 4180 4590 CDS product ChaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228348.1 protein_id gnl|my_center|LOCUS_19490 5218 4556 gene locus_tag LOCUS_19500 5218 4556 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545748.1 protein_id gnl|my_center|LOCUS_19500 5530 5309 gene locus_tag LOCUS_19510 5530 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 6431 5664 gene locus_tag LOCUS_19520 6431 5664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 >Feature sequence127 1276 1608 gene locus_tag LOCUS_19530 1276 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 1961 1605 gene locus_tag LOCUS_19540 1961 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 1918 2145 gene locus_tag LOCUS_19550 1918 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 3274 2720 gene locus_tag LOCUS_19560 3274 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 4293 3433 gene locus_tag LOCUS_19570 gene rlmB 4293 3433 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887855.1 protein_id gnl|my_center|LOCUS_19570 4778 4290 gene locus_tag LOCUS_19580 gene ispF 4778 4290 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098560.1 protein_id gnl|my_center|LOCUS_19580 5416 4775 gene locus_tag LOCUS_19590 gene ispD 5416 4775 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074324290.1 protein_id gnl|my_center|LOCUS_19590 5980 5492 gene locus_tag LOCUS_19600 5980 5492 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804554.1 protein_id gnl|my_center|LOCUS_19600 <6671 6090 gene locus_tag LOCUS_19610 <6671 6090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003094867.1:DNA repair protein RadA >Feature sequence128 626 105 gene locus_tag LOCUS_19620 626 105 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706269.1 protein_id gnl|my_center|LOCUS_19620 1078 686 gene locus_tag LOCUS_19630 1078 686 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227914.1 protein_id gnl|my_center|LOCUS_19630 2361 1090 gene locus_tag LOCUS_19640 2361 1090 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921547.1 protein_id gnl|my_center|LOCUS_19640 2434 2508 gene locus_tag LOCUS_t00200 2434 2508 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2961 2527 gene locus_tag LOCUS_19650 2961 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 3266 2958 gene locus_tag LOCUS_19660 3266 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 3389 3463 gene locus_tag LOCUS_t00210 3389 3463 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4725 4423 gene locus_tag LOCUS_19670 4725 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 4643 4924 gene locus_tag LOCUS_19680 4643 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 5157 5579 gene locus_tag LOCUS_19690 5157 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 >Feature sequence129 899 1291 gene locus_tag LOCUS_19700 899 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 1671 1967 gene locus_tag LOCUS_19710 1671 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19710 2818 2423 gene locus_tag LOCUS_19720 2818 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 3712 2831 gene locus_tag LOCUS_19730 3712 2831 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904947.1 protein_id gnl|my_center|LOCUS_19730 4296 3712 gene locus_tag LOCUS_19740 4296 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 5897 4281 gene locus_tag LOCUS_19750 gene merA 5897 4281 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296234.1 protein_id gnl|my_center|LOCUS_19750 6186 5887 gene locus_tag LOCUS_19760 6186 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 >Feature sequence130 378 55 gene locus_tag LOCUS_19770 378 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 1131 823 gene locus_tag LOCUS_19780 1131 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 1292 1697 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1715 5053 gene locus_tag LOCUS_19790 1715 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 >Feature sequence131 1776 403 gene locus_tag LOCUS_19800 gene rlmD 1776 403 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021134739.1 protein_id gnl|my_center|LOCUS_19800 2708 1806 gene locus_tag LOCUS_19810 gene argF 2708 1806 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257452.1 protein_id gnl|my_center|LOCUS_19810 2740 3417 gene locus_tag LOCUS_19820 2740 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 3447 3806 gene locus_tag LOCUS_19830 3447 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 4282 3809 gene locus_tag LOCUS_19840 4282 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 5125 4328 gene locus_tag LOCUS_19850 5125 4328 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976707.1 protein_id gnl|my_center|LOCUS_19850 5339 5133 gene locus_tag LOCUS_19860 gene thiS 5339 5133 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112838.1 protein_id gnl|my_center|LOCUS_19860 <6437 5336 gene locus_tag LOCUS_19870 <6437 5336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_205421597.1:glycine oxidase ThiO >Feature sequence132 333 956 gene locus_tag LOCUS_19880 333 956 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790385.1 protein_id gnl|my_center|LOCUS_19880 985 1953 gene locus_tag LOCUS_19890 985 1953 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730921.1 protein_id gnl|my_center|LOCUS_19890 2004 3254 gene locus_tag LOCUS_19900 2004 3254 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_19900 4202 3288 gene locus_tag LOCUS_19910 gene galE1 4202 3288 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419610.1 protein_id gnl|my_center|LOCUS_19910 5353 4244 gene locus_tag LOCUS_19920 5353 4244 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222487.1 protein_id gnl|my_center|LOCUS_19920 >Feature sequence133 2429 1611 gene locus_tag LOCUS_19930 2429 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 4041 2617 gene locus_tag LOCUS_19940 4041 2617 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449604.1 protein_id gnl|my_center|LOCUS_19940 4357 4491 gene locus_tag LOCUS_19950 4357 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 5184 4798 gene locus_tag LOCUS_19960 5184 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 5475 5203 gene locus_tag LOCUS_19970 5475 5203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 5968 5543 gene locus_tag LOCUS_19980 5968 5543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 >Feature sequence134 2076 2804 gene locus_tag LOCUS_19990 2076 2804 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027230.1 protein_id gnl|my_center|LOCUS_19990 2916 3674 gene locus_tag LOCUS_20000 2916 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 3671 4957 gene locus_tag LOCUS_20010 3671 4957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 5589 6224 gene locus_tag LOCUS_20020 5589 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 >Feature sequence135 732 133 gene locus_tag LOCUS_20030 732 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 1079 795 gene locus_tag LOCUS_20040 1079 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 1743 1264 gene locus_tag LOCUS_20050 1743 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 1943 1740 gene locus_tag LOCUS_20060 1943 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 3368 2433 gene locus_tag LOCUS_20070 3368 2433 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_20070 3435 4871 gene locus_tag LOCUS_20080 3435 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 4991 5446 gene locus_tag LOCUS_20090 4991 5446 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475488.1 protein_id gnl|my_center|LOCUS_20090 >Feature sequence136 305 1492 gene locus_tag LOCUS_20100 305 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 3502 1547 gene locus_tag LOCUS_20110 3502 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 4229 3438 gene locus_tag LOCUS_20120 4229 3438 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776098.1 protein_id gnl|my_center|LOCUS_20120 3553 3570 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5008 4226 gene locus_tag LOCUS_20130 5008 4226 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096887.1 protein_id gnl|my_center|LOCUS_20130 5110 5229 gene locus_tag LOCUS_20140 5110 5229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 5616 5422 gene locus_tag LOCUS_20150 5616 5422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 5588 5950 gene locus_tag LOCUS_20160 5588 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 >Feature sequence137 <1 801 gene locus_tag LOCUS_20170 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969255.1:NADH-quinone oxidoreductase subunit NuoF 802 3432 gene locus_tag LOCUS_20180 gene nuoG 802 3432 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258754.1 protein_id gnl|my_center|LOCUS_20180 3429 4472 gene locus_tag LOCUS_20190 gene nuoH 3429 4472 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944046.1 protein_id gnl|my_center|LOCUS_20190 4472 5005 gene locus_tag LOCUS_20200 gene nuoI 4472 5005 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258756.1 protein_id gnl|my_center|LOCUS_20200 5022 5687 gene locus_tag LOCUS_20210 5022 5687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 5691 5990 gene locus_tag LOCUS_20220 gene nuoK 5691 5990 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893422.1 protein_id gnl|my_center|LOCUS_20220 >Feature sequence138 <1 1875 gene locus_tag LOCUS_20230 <1 1875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546130.1:translation initiation factor IF-2 1899 2213 gene locus_tag LOCUS_20240 1899 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 2246 2554 gene locus_tag LOCUS_20250 gene rbfA 2246 2554 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967251.1 protein_id gnl|my_center|LOCUS_20250 2551 3540 gene locus_tag LOCUS_20260 2551 3540 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_20260 3551 4366 gene locus_tag LOCUS_20270 gene truB 3551 4366 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414147.1 protein_id gnl|my_center|LOCUS_20270 4367 5299 gene locus_tag LOCUS_20280 4367 5299 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404517.1 protein_id gnl|my_center|LOCUS_20280 5296 6189 gene locus_tag LOCUS_20290 5296 6189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 >Feature sequence139 228 1154 gene locus_tag LOCUS_20300 228 1154 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229709.1 protein_id gnl|my_center|LOCUS_20300 2729 1266 gene locus_tag LOCUS_20310 2729 1266 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229710.1 protein_id gnl|my_center|LOCUS_20310 3837 2731 gene locus_tag LOCUS_20320 3837 2731 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_20320 4742 3834 gene locus_tag LOCUS_20330 4742 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 5006 4770 gene locus_tag LOCUS_20340 5006 4770 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893314.1 protein_id gnl|my_center|LOCUS_20340 >Feature sequence140 1984 1580 gene locus_tag LOCUS_20350 1984 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 2209 1985 gene locus_tag LOCUS_20360 2209 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 4233 2233 gene locus_tag LOCUS_20370 4233 2233 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257189.1 protein_id gnl|my_center|LOCUS_20370 3139 3147 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4775 4302 gene locus_tag LOCUS_20380 4775 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 5141 4884 gene locus_tag LOCUS_20390 5141 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 5719 5138 gene locus_tag LOCUS_20400 5719 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 6080 5868 gene locus_tag LOCUS_20410 6080 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 >Feature sequence141 212 533 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 723 2201 gene locus_tag LOCUS_20420 723 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 1028 1055 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1945 2054 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3237 2194 gene locus_tag LOCUS_20430 3237 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 4519 3194 gene locus_tag LOCUS_20440 gene pgsB 4519 3194 CDS product poly-gamma-glutamate synthase PgsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118210.1 protein_id gnl|my_center|LOCUS_20440 4731 4829 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5468 5635 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence142 <1 1382 gene locus_tag LOCUS_20450 <1 1382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256439.1:NAD(P)/FAD-dependent oxidoreductase 1402 1854 gene locus_tag LOCUS_20460 1402 1854 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027656.1 protein_id gnl|my_center|LOCUS_20460 3256 1880 gene locus_tag LOCUS_20470 3256 1880 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255954.1 protein_id gnl|my_center|LOCUS_20470 3225 4184 gene locus_tag LOCUS_20480 3225 4184 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928954.1 protein_id gnl|my_center|LOCUS_20480 4275 5024 gene locus_tag LOCUS_20490 4275 5024 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977306.1 protein_id gnl|my_center|LOCUS_20490 5139 5684 gene locus_tag LOCUS_20500 gene ruvC 5139 5684 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393204.1 protein_id gnl|my_center|LOCUS_20500 >Feature sequence143 2539 962 gene locus_tag LOCUS_20510 2539 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 3099 2533 gene locus_tag LOCUS_20520 3099 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 3980 3096 gene locus_tag LOCUS_20530 3980 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 <6052 4005 gene locus_tag LOCUS_20540 <6052 4005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584100.1:diguanylate cyclase >Feature sequence144 639 1307 gene locus_tag LOCUS_20550 639 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 2479 1856 gene locus_tag LOCUS_20560 2479 1856 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007140.1 protein_id gnl|my_center|LOCUS_20560 2572 3726 gene locus_tag LOCUS_20570 2572 3726 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461032.1 protein_id gnl|my_center|LOCUS_20570 3881 5812 gene locus_tag LOCUS_20580 3881 5812 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272023.1 protein_id gnl|my_center|LOCUS_20580 >Feature sequence145 342 1283 gene locus_tag LOCUS_20590 342 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 3125 1326 gene locus_tag LOCUS_20600 3125 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 3218 3235 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence146 101 739 gene locus_tag LOCUS_20610 gene thiE 101 739 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172766.1 protein_id gnl|my_center|LOCUS_20610 726 1400 gene locus_tag LOCUS_20620 726 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 1400 2800 gene locus_tag LOCUS_20630 gene lpdA 1400 2800 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389631.1 protein_id gnl|my_center|LOCUS_20630 2883 3392 gene locus_tag LOCUS_20640 2883 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 3389 3634 gene locus_tag LOCUS_20650 3389 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 3802 5028 gene locus_tag LOCUS_20660 3802 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 >Feature sequence147 2324 2989 gene locus_tag LOCUS_20670 2324 2989 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392204.1 protein_id gnl|my_center|LOCUS_20670 3967 3299 gene locus_tag LOCUS_20680 3967 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20680 5181 3931 gene locus_tag LOCUS_20690 5181 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20690 5343 5651 gene locus_tag LOCUS_20700 5343 5651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 >Feature sequence148 2172 1759 gene locus_tag LOCUS_20710 2172 1759 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227025.1 protein_id gnl|my_center|LOCUS_20710 2968 3669 gene locus_tag LOCUS_20720 2968 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 3501 3568 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3674 3880 gene locus_tag LOCUS_20730 3674 3880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 4178 4390 gene locus_tag LOCUS_20740 4178 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 4565 4753 gene locus_tag LOCUS_20750 4565 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 >Feature sequence149 687 319 gene locus_tag LOCUS_20760 687 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 1683 850 gene locus_tag LOCUS_20770 1683 850 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272485.1 protein_id gnl|my_center|LOCUS_20770 2535 1852 gene locus_tag LOCUS_20780 gene phoU 2535 1852 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230711.1 protein_id gnl|my_center|LOCUS_20780 3450 2542 gene locus_tag LOCUS_20790 gene pstB 3450 2542 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_20790 4372 3461 gene locus_tag LOCUS_20800 gene pstA 4372 3461 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405019.1 protein_id gnl|my_center|LOCUS_20800 5310 4369 gene locus_tag LOCUS_20810 gene pstC 5310 4369 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256174.1 protein_id gnl|my_center|LOCUS_20810 >Feature sequence150 917 627 gene locus_tag LOCUS_20820 917 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 4085 1860 gene locus_tag LOCUS_20830 4085 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 4198 4203 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence151 1092 2648 gene locus_tag LOCUS_20840 1092 2648 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143698.1 protein_id gnl|my_center|LOCUS_20840 3138 4388 gene locus_tag LOCUS_20850 3138 4388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 3264 3341 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <5716 4535 gene locus_tag LOCUS_20860 <5716 4535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776625.1:CDP-glycerol glycerophosphotransferase family protein >Feature sequence152 <1 648 gene locus_tag LOCUS_20870 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015943403.1:tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD 645 923 gene locus_tag LOCUS_20880 645 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 932 1615 gene locus_tag LOCUS_20890 932 1615 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082798.1 protein_id gnl|my_center|LOCUS_20890 1623 2774 gene locus_tag LOCUS_20900 1623 2774 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142291.1 protein_id gnl|my_center|LOCUS_20900 2771 3232 gene locus_tag LOCUS_20910 2771 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 3397 4404 gene locus_tag LOCUS_20920 3397 4404 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189282703.1 protein_id gnl|my_center|LOCUS_20920 4577 4990 gene locus_tag LOCUS_20930 4577 4990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 >Feature sequence153 716 1207 gene locus_tag LOCUS_20940 716 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 1267 1821 gene locus_tag LOCUS_20950 1267 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 1818 2150 gene locus_tag LOCUS_20960 1818 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 2828 3670 gene locus_tag LOCUS_20970 2828 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 4509 3919 gene locus_tag LOCUS_20980 4509 3919 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531936.1 protein_id gnl|my_center|LOCUS_20980 5455 4748 gene locus_tag LOCUS_20990 5455 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 >Feature sequence154 713 369 gene locus_tag LOCUS_21000 713 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 699 1181 gene locus_tag LOCUS_21010 699 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 1205 2032 gene locus_tag LOCUS_21020 1205 2032 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082088944.1 protein_id gnl|my_center|LOCUS_21020 2420 2178 gene locus_tag LOCUS_21030 2420 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 2322 4487 gene locus_tag LOCUS_21040 2322 4487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 2708 2922 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5245 5359 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence155 253 71 gene locus_tag LOCUS_21050 253 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 488 811 gene locus_tag LOCUS_21060 gene groES 488 811 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804491.1 protein_id gnl|my_center|LOCUS_21060 942 1364 gene locus_tag LOCUS_21070 942 1364 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230457.1 protein_id gnl|my_center|LOCUS_21070 1404 3263 gene locus_tag LOCUS_21080 gene typA 1404 3263 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_21080 3920 3342 gene locus_tag LOCUS_21090 3920 3342 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977253.1 protein_id gnl|my_center|LOCUS_21090 3980 4435 gene locus_tag LOCUS_21100 3980 4435 CDS product YtoQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229263.1 protein_id gnl|my_center|LOCUS_21100 >Feature sequence156 203 793 gene locus_tag LOCUS_21110 203 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 1082 915 gene locus_tag LOCUS_21120 1082 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 1550 1125 gene locus_tag LOCUS_21130 1550 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21130 2025 2297 gene locus_tag LOCUS_21140 2025 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 2485 3096 gene locus_tag LOCUS_21150 2485 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21150 2504 2524 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3785 3192 gene locus_tag LOCUS_21160 3785 3192 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229593.1 protein_id gnl|my_center|LOCUS_21160 5439 4402 gene locus_tag LOCUS_21170 5439 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 >Feature sequence157 435 2207 gene locus_tag LOCUS_21180 gene aspS 435 2207 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393178.1 protein_id gnl|my_center|LOCUS_21180 3164 2241 gene locus_tag LOCUS_21190 3164 2241 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_21190 3454 3960 gene locus_tag LOCUS_21200 3454 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 4054 5493 gene locus_tag LOCUS_21210 4054 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 >Feature sequence158 <1 1528 gene locus_tag LOCUS_21220 <1 1528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235190878.1:EAL domain-containing protein 1823 1749 gene locus_tag LOCUS_t00220 1823 1749 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1945 1853 gene locus_tag LOCUS_t00230 1945 1853 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2445 1987 gene locus_tag LOCUS_21230 2445 1987 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937702.1 protein_id gnl|my_center|LOCUS_21230 2678 2442 gene locus_tag LOCUS_21240 2678 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 2736 3260 gene locus_tag LOCUS_21250 2736 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 3668 3264 gene locus_tag LOCUS_21260 3668 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 3570 4442 gene locus_tag LOCUS_21270 3570 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 4463 5386 gene locus_tag LOCUS_21280 4463 5386 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143321.1 protein_id gnl|my_center|LOCUS_21280 >Feature sequence159 87 1154 gene locus_tag LOCUS_21290 87 1154 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_21290 1278 2426 gene locus_tag LOCUS_21300 1278 2426 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973825.1 protein_id gnl|my_center|LOCUS_21300 2751 2485 gene locus_tag LOCUS_21310 2751 2485 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_21310 4317 2875 gene locus_tag LOCUS_21320 4317 2875 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268929.1 protein_id gnl|my_center|LOCUS_21320 4353 4871 gene locus_tag LOCUS_21330 4353 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 <5470 4888 gene locus_tag LOCUS_21340 <5470 4888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013614293.1:serine esterase >Feature sequence160 969 295 gene locus_tag LOCUS_21350 969 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 1812 1351 gene locus_tag LOCUS_21360 1812 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 2484 2005 gene locus_tag LOCUS_21370 2484 2005 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227660.1 protein_id gnl|my_center|LOCUS_21370 2947 2543 gene locus_tag LOCUS_21380 2947 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21380 3454 3023 gene locus_tag LOCUS_21390 3454 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21390 3582 4190 gene locus_tag LOCUS_21400 3582 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21400 3916 3963 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4076 4516 gene locus_tag LOCUS_21410 4076 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 4683 5093 gene locus_tag LOCUS_21420 4683 5093 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223357.1 protein_id gnl|my_center|LOCUS_21420 >Feature sequence161 2 1036 gene locus_tag LOCUS_21430 2 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 1036 1329 gene locus_tag LOCUS_21440 1036 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 1333 1938 gene locus_tag LOCUS_21450 gene recR 1333 1938 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_21450 1956 3869 gene locus_tag LOCUS_21460 gene acs 1956 3869 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975373.1 protein_id gnl|my_center|LOCUS_21460 3814 3831 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3873 4751 gene locus_tag LOCUS_21470 3873 4751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 4855 5223 gene locus_tag LOCUS_21480 4855 5223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 >Feature sequence162 458 844 gene locus_tag LOCUS_21490 458 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 814 966 gene locus_tag LOCUS_21500 814 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 1230 1841 gene locus_tag LOCUS_21510 1230 1841 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533542.1 protein_id gnl|my_center|LOCUS_21510 2614 2342 gene locus_tag LOCUS_21520 2614 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 2998 2639 gene locus_tag LOCUS_21530 2998 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 2952 3167 gene locus_tag LOCUS_21540 2952 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 4651 3245 gene locus_tag LOCUS_21550 4651 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 4892 5110 gene locus_tag LOCUS_21560 4892 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 >Feature sequence163 245 583 gene locus_tag LOCUS_21570 gene flgB 245 583 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392289.1 protein_id gnl|my_center|LOCUS_21570 888 1225 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1296 2909 gene locus_tag LOCUS_21580 gene fliF 1296 2909 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870079.1 protein_id gnl|my_center|LOCUS_21580 2914 3918 gene locus_tag LOCUS_21590 gene fliG 2914 3918 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460758.1 protein_id gnl|my_center|LOCUS_21590 3926 4642 gene locus_tag LOCUS_21600 3926 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 >Feature sequence164 190 105 gene locus_tag LOCUS_t00240 190 105 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 359 431 gene locus_tag LOCUS_t00250 359 431 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 443 517 gene locus_tag LOCUS_t00260 443 517 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1763 930 gene locus_tag LOCUS_21610 1763 930 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225189.1 protein_id gnl|my_center|LOCUS_21610 2062 3345 gene locus_tag LOCUS_21620 2062 3345 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256441.1 protein_id gnl|my_center|LOCUS_21620 3721 3503 gene locus_tag LOCUS_21630 3721 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 4655 4191 gene locus_tag LOCUS_21640 4655 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 4948 4652 gene locus_tag LOCUS_21650 4948 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 >Feature sequence165 308 2245 gene locus_tag LOCUS_21660 308 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 2261 3709 gene locus_tag LOCUS_21670 2261 3709 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973927.1 protein_id gnl|my_center|LOCUS_21670 4539 4667 gene locus_tag LOCUS_21680 4539 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 >Feature sequence166 <1 564 gene locus_tag LOCUS_21690 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015909164.1:HAD hydrolase-like protein 1322 576 gene locus_tag LOCUS_21700 gene pyrH 1322 576 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248059.1 protein_id gnl|my_center|LOCUS_21700 1395 2486 gene locus_tag LOCUS_21710 1395 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 2670 4367 gene locus_tag LOCUS_21720 2670 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 3442 3480 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5213 4377 gene locus_tag LOCUS_21730 5213 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 >Feature sequence167 1039 485 gene locus_tag LOCUS_21740 1039 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 1946 1236 gene locus_tag LOCUS_21750 1946 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 2587 1943 gene locus_tag LOCUS_21760 2587 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 3210 2584 gene locus_tag LOCUS_21770 3210 2584 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176066.1 protein_id gnl|my_center|LOCUS_21770 4074 3790 gene locus_tag LOCUS_21780 4074 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 4229 4493 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence168 326 174 gene locus_tag LOCUS_21790 326 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 360 377 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 632 1003 gene locus_tag LOCUS_21800 632 1003 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037733.1 protein_id gnl|my_center|LOCUS_21800 1736 996 gene locus_tag LOCUS_21810 1736 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 3878 1758 gene locus_tag LOCUS_21820 gene uvrC 3878 1758 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028063.1 protein_id gnl|my_center|LOCUS_21820 3986 4396 gene locus_tag LOCUS_21830 3986 4396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 >Feature sequence169 475 203 gene locus_tag LOCUS_21840 475 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 408 755 gene locus_tag LOCUS_21850 408 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 811 1013 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3147 1438 gene locus_tag LOCUS_21860 3147 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 3616 3949 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence170 1094 363 gene locus_tag LOCUS_21870 1094 363 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224976.1 protein_id gnl|my_center|LOCUS_21870 1144 1377 gene locus_tag LOCUS_21880 1144 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 1397 1657 gene locus_tag LOCUS_21890 1397 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 3415 2180 gene locus_tag LOCUS_21900 3415 2180 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259422.1 protein_id gnl|my_center|LOCUS_21900 4881 3499 gene locus_tag LOCUS_21910 4881 3499 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007445862.1 protein_id gnl|my_center|LOCUS_21910 >Feature sequence171 365 1876 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1927 2340 gene locus_tag LOCUS_21920 1927 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 3223 2363 gene locus_tag LOCUS_21930 3223 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 4979 3384 gene locus_tag LOCUS_21940 4979 3384 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932832.1 protein_id gnl|my_center|LOCUS_21940 >Feature sequence172 1319 2680 gene locus_tag LOCUS_21950 1319 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 3107 2775 gene locus_tag LOCUS_21960 3107 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 3202 3867 gene locus_tag LOCUS_21970 3202 3867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21970 3904 4818 gene locus_tag LOCUS_21980 3904 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 >Feature sequence173 474 1439 gene locus_tag LOCUS_21990 474 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 1452 1736 gene locus_tag LOCUS_22000 1452 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 1726 3237 gene locus_tag LOCUS_22010 1726 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 3497 4069 gene locus_tag LOCUS_22020 3497 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 4114 4974 gene locus_tag LOCUS_22030 4114 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 >Feature sequence174 263 553 gene locus_tag LOCUS_22040 263 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 624 1469 gene locus_tag LOCUS_22050 624 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 2462 2169 gene locus_tag LOCUS_22060 2462 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 2699 2493 gene locus_tag LOCUS_22070 2699 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 4134 2815 gene locus_tag LOCUS_22080 4134 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 4561 4352 gene locus_tag LOCUS_22090 4561 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 >Feature sequence175 1590 877 gene locus_tag LOCUS_22100 1590 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 2566 1838 gene locus_tag LOCUS_22110 2566 1838 CDS product ZIP family zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225190.1 protein_id gnl|my_center|LOCUS_22110 2759 2986 gene locus_tag LOCUS_22120 2759 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 4029 3166 gene locus_tag LOCUS_22130 4029 3166 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729296.1 protein_id gnl|my_center|LOCUS_22130 4057 4599 gene locus_tag LOCUS_22140 4057 4599 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406624.1 protein_id gnl|my_center|LOCUS_22140 >Feature sequence176 1167 52 gene locus_tag LOCUS_22150 gene galK 1167 52 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228053.1 protein_id gnl|my_center|LOCUS_22150 1216 2745 gene locus_tag LOCUS_22160 1216 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 2912 2831 gene locus_tag LOCUS_t00270 2912 2831 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 4132 2996 gene locus_tag LOCUS_22170 gene rpoD 4132 2996 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764065.1 protein_id gnl|my_center|LOCUS_22170 >Feature sequence177 <1 573 gene locus_tag LOCUS_22180 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977279.1:aminodeoxychorismate lyase 1057 611 gene locus_tag LOCUS_22190 1057 611 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975886.1 protein_id gnl|my_center|LOCUS_22190 1438 1510 gene locus_tag LOCUS_t00280 1438 1510 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1874 3358 gene locus_tag LOCUS_22200 1874 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 3558 4913 gene locus_tag LOCUS_22210 3558 4913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 >Feature sequence178 1163 453 gene locus_tag LOCUS_22220 1163 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 1873 1301 gene locus_tag LOCUS_22230 1873 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 1775 2107 gene locus_tag LOCUS_22240 1775 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 3389 2073 gene locus_tag LOCUS_22250 3389 2073 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_22250 2120 2152 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4117 3404 gene locus_tag LOCUS_22260 4117 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 >Feature sequence179 529 323 gene locus_tag LOCUS_22270 529 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 1199 921 gene locus_tag LOCUS_22280 1199 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 1393 1719 gene locus_tag LOCUS_22290 1393 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 1949 1716 gene locus_tag LOCUS_22300 1949 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 1861 2058 gene locus_tag LOCUS_22310 1861 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 2077 2520 gene locus_tag LOCUS_22320 2077 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 2868 2536 gene locus_tag LOCUS_22330 2868 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 3675 2881 gene locus_tag LOCUS_22340 3675 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 4047 3679 gene locus_tag LOCUS_22350 4047 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 4595 4047 gene locus_tag LOCUS_22360 4595 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 4866 4597 gene locus_tag LOCUS_22370 4866 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 >Feature sequence180 1237 770 gene locus_tag LOCUS_22380 1237 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 1512 1234 gene locus_tag LOCUS_22390 gene rpsS 1512 1234 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_22390 2363 1518 gene locus_tag LOCUS_22400 gene rplB 2363 1518 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393934.1 protein_id gnl|my_center|LOCUS_22400 2694 2398 gene locus_tag LOCUS_22410 gene rplW 2694 2398 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_22410 3341 2694 gene locus_tag LOCUS_22420 gene rplD 3341 2694 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869927.1 protein_id gnl|my_center|LOCUS_22420 3951 3334 gene locus_tag LOCUS_22430 gene rplC 3951 3334 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140089.1 protein_id gnl|my_center|LOCUS_22430 4271 3951 gene locus_tag LOCUS_22440 gene rpsJ 4271 3951 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_22440 <4974 4431 gene locus_tag LOCUS_22450 <4974 4431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545401.1:elongation factor Tu >Feature sequence181 >Feature sequence182 262 1137 gene locus_tag LOCUS_22460 262 1137 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_22460 1137 2825 gene locus_tag LOCUS_22470 gene recN 1137 2825 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_22470 2825 3994 gene locus_tag LOCUS_22480 gene steA 2825 3994 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804976.1 protein_id gnl|my_center|LOCUS_22480 3988 4917 gene locus_tag LOCUS_22490 3988 4917 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058615.1 protein_id gnl|my_center|LOCUS_22490 >Feature sequence183 780 1010 gene locus_tag LOCUS_22500 780 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228349.1 protein_id gnl|my_center|LOCUS_22500 3226 1928 gene locus_tag LOCUS_22510 3226 1928 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031624.1 protein_id gnl|my_center|LOCUS_22510 4268 3315 gene locus_tag LOCUS_22520 4268 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 >Feature sequence184 <1 1088 gene locus_tag LOCUS_22530 <1 1088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391762.1:MraY family glycosyltransferase 1670 1299 gene locus_tag LOCUS_22540 1670 1299 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838707.1 protein_id gnl|my_center|LOCUS_22540 2163 2537 gene locus_tag LOCUS_22550 2163 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 2534 3430 gene locus_tag LOCUS_22560 2534 3430 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084006.1 protein_id gnl|my_center|LOCUS_22560 3440 3727 gene locus_tag LOCUS_22570 3440 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 3733 4320 gene locus_tag LOCUS_22580 gene atpF 3733 4320 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025478.1 protein_id gnl|my_center|LOCUS_22580 4320 4853 gene locus_tag LOCUS_22590 gene atpH 4320 4853 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393858.1 protein_id gnl|my_center|LOCUS_22590 >Feature sequence185 1095 2000 gene locus_tag LOCUS_22600 1095 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 2899 1997 gene locus_tag LOCUS_22610 2899 1997 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877324.1 protein_id gnl|my_center|LOCUS_22610 3241 2906 gene locus_tag LOCUS_22620 3241 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 3333 4670 gene locus_tag LOCUS_22630 3333 4670 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976298.1 protein_id gnl|my_center|LOCUS_22630 >Feature sequence186 392 1081 gene locus_tag LOCUS_22640 392 1081 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031779.1 protein_id gnl|my_center|LOCUS_22640 2479 1883 gene locus_tag LOCUS_22650 2479 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 <4836 2902 gene locus_tag LOCUS_22660 <4836 2902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971555.1:TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein >Feature sequence187 939 2657 gene locus_tag LOCUS_22670 939 2657 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230617.1 protein_id gnl|my_center|LOCUS_22670 2737 3741 gene locus_tag LOCUS_22680 2737 3741 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887604.1 protein_id gnl|my_center|LOCUS_22680 3738 4631 gene locus_tag LOCUS_22690 3738 4631 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453817.1 protein_id gnl|my_center|LOCUS_22690 >Feature sequence188 <1 781 gene locus_tag LOCUS_22700 <1 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226110.1:HAD-IIIA family hydrolase 778 1833 gene locus_tag LOCUS_22710 778 1833 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030719.1 protein_id gnl|my_center|LOCUS_22710 1830 2762 gene locus_tag LOCUS_22720 1830 2762 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030720.1 protein_id gnl|my_center|LOCUS_22720 2759 3982 gene locus_tag LOCUS_22730 2759 3982 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226125.1 protein_id gnl|my_center|LOCUS_22730 4126 4602 gene locus_tag LOCUS_22740 4126 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22740 >Feature sequence189 297 353 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 437 1792 gene locus_tag LOCUS_22750 437 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 1699 2040 gene locus_tag LOCUS_22760 1699 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 2054 2764 gene locus_tag LOCUS_22770 2054 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 3325 3957 gene locus_tag LOCUS_22780 3325 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 4587 3970 gene locus_tag LOCUS_22790 4587 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 >Feature sequence190 262 546 gene locus_tag LOCUS_22800 262 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 818 1426 gene locus_tag LOCUS_22810 818 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 2080 1370 gene locus_tag LOCUS_22820 2080 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 2080 2937 gene locus_tag LOCUS_22830 2080 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 4081 2984 gene locus_tag LOCUS_22840 4081 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 >Feature sequence191 1021 290 gene locus_tag LOCUS_22850 1021 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 2182 1190 gene locus_tag LOCUS_22860 2182 1190 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_22860 3278 2352 gene locus_tag LOCUS_22870 3278 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 3384 4712 gene locus_tag LOCUS_22880 3384 4712 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973777.1 protein_id gnl|my_center|LOCUS_22880 >Feature sequence192 784 1800 gene locus_tag LOCUS_22890 784 1800 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977764.1 protein_id gnl|my_center|LOCUS_22890 2613 1810 gene locus_tag LOCUS_22900 2613 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 4370 2730 gene locus_tag LOCUS_22910 4370 2730 CDS product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284089.1 protein_id gnl|my_center|LOCUS_22910 4748 4521 gene locus_tag LOCUS_22920 4748 4521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 >Feature sequence193 358 167 gene locus_tag LOCUS_22930 358 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 1179 772 gene locus_tag LOCUS_22940 1179 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 1836 1588 gene locus_tag LOCUS_22950 1836 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 1977 2732 gene locus_tag LOCUS_22960 1977 2732 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031670.1 protein_id gnl|my_center|LOCUS_22960 4387 3443 gene locus_tag LOCUS_22970 4387 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 >Feature sequence194 1945 248 gene locus_tag LOCUS_22980 1945 248 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258493.1 protein_id gnl|my_center|LOCUS_22980 954 977 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2016 2058 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2660 3472 gene locus_tag LOCUS_22990 2660 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 3630 3815 gene locus_tag LOCUS_23000 3630 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 3823 3931 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence195 604 293 gene locus_tag LOCUS_23010 604 293 CDS product EthD family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727587.1 protein_id gnl|my_center|LOCUS_23010 1480 1226 gene locus_tag LOCUS_23020 1480 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 1770 1477 gene locus_tag LOCUS_23030 1770 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 1958 2293 gene locus_tag LOCUS_23040 1958 2293 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975458.1 protein_id gnl|my_center|LOCUS_23040 2924 2508 gene locus_tag LOCUS_23050 2924 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 3531 4640 gene locus_tag LOCUS_23060 3531 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 >Feature sequence196 1843 410 gene locus_tag LOCUS_23070 1843 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 601 606 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3264 1966 gene locus_tag LOCUS_23080 3264 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977727.1 protein_id gnl|my_center|LOCUS_23080 4288 3962 gene locus_tag LOCUS_23090 4288 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23090 >Feature sequence197 410 433 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1101 1615 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1745 2257 gene locus_tag LOCUS_23100 1745 2257 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234318.1 protein_id gnl|my_center|LOCUS_23100 2618 2860 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3954 4112 gene locus_tag LOCUS_23110 3954 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 >Feature sequence198 592 768 gene locus_tag LOCUS_23120 592 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 1336 1530 gene locus_tag LOCUS_23130 1336 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 2534 1749 gene locus_tag LOCUS_23140 2534 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 2909 3124 gene locus_tag LOCUS_23150 2909 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 3564 3319 gene locus_tag LOCUS_23160 3564 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 3901 3680 gene locus_tag LOCUS_23170 3901 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 4383 4114 gene locus_tag LOCUS_23180 4383 4114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 >Feature sequence199 4177 203 gene locus_tag LOCUS_23190 4177 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 4062 4424 gene locus_tag LOCUS_23200 4062 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 >Feature sequence200 1789 233 gene locus_tag LOCUS_23210 1789 233 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258223.1 protein_id gnl|my_center|LOCUS_23210 3022 2234 gene locus_tag LOCUS_23220 3022 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 <4498 3033 gene locus_tag LOCUS_23230 <4498 3033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920930.1:EAL domain-containing protein >Feature sequence201 95 517 gene locus_tag LOCUS_23240 gene rplP 95 517 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225801.1 protein_id gnl|my_center|LOCUS_23240 514 744 gene locus_tag LOCUS_23250 gene rpmC 514 744 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974259.1 protein_id gnl|my_center|LOCUS_23250 737 1492 gene locus_tag LOCUS_23260 737 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 1489 1857 gene locus_tag LOCUS_23270 gene rplN 1489 1857 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854312.1 protein_id gnl|my_center|LOCUS_23270 1861 2187 gene locus_tag LOCUS_23280 gene rplX 1861 2187 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975178.1 protein_id gnl|my_center|LOCUS_23280 2187 2777 gene locus_tag LOCUS_23290 gene rplE 2187 2777 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390426.1 protein_id gnl|my_center|LOCUS_23290 2808 2993 gene locus_tag LOCUS_23300 2808 2993 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010550318.1 protein_id gnl|my_center|LOCUS_23300 2996 3394 gene locus_tag LOCUS_23310 gene rpsH 2996 3394 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055710.1 protein_id gnl|my_center|LOCUS_23310 3418 3951 gene locus_tag LOCUS_23320 gene rplF 3418 3951 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393922.1 protein_id gnl|my_center|LOCUS_23320 3948 4301 gene locus_tag LOCUS_23330 gene rplR 3948 4301 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624044.1 protein_id gnl|my_center|LOCUS_23330 >Feature sequence202 <1 564 gene locus_tag LOCUS_23340 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975321.1:recombination mediator RecR 593 1861 gene locus_tag LOCUS_23350 593 1861 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063166.1 protein_id gnl|my_center|LOCUS_23350 1858 2892 gene locus_tag LOCUS_23360 gene asd 1858 2892 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881220.1 protein_id gnl|my_center|LOCUS_23360 3027 3950 gene locus_tag LOCUS_23370 3027 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 >Feature sequence203 414 1571 gene locus_tag LOCUS_23380 gene metB 414 1571 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925915.1 protein_id gnl|my_center|LOCUS_23380 1613 2623 gene locus_tag LOCUS_23390 gene argC 1613 2623 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_23390 2620 3780 gene locus_tag LOCUS_23400 gene argJ 2620 3780 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027859.1 protein_id gnl|my_center|LOCUS_23400 >Feature sequence204 179 964 gene locus_tag LOCUS_23410 179 964 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233792.1 protein_id gnl|my_center|LOCUS_23410 1055 3940 gene locus_tag LOCUS_23420 gene fdhF 1055 3940 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 protein_id gnl|my_center|LOCUS_23420 >Feature sequence205 <1 557 gene locus_tag LOCUS_23430 <1 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919103.1:NAD kinase 633 707 gene locus_tag LOCUS_t00290 633 707 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1052 1678 gene locus_tag LOCUS_23440 1052 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 <4451 1702 gene locus_tag LOCUS_23450 <4451 1702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003533499.1:preprotein translocase subunit SecA >Feature sequence206 >Feature sequence207 1428 37 gene locus_tag LOCUS_23460 1428 37 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937602.1 protein_id gnl|my_center|LOCUS_23460 2621 1425 gene locus_tag LOCUS_23470 2621 1425 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025568152.1 protein_id gnl|my_center|LOCUS_23470 3940 2618 gene locus_tag LOCUS_23480 3940 2618 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525271.1 protein_id gnl|my_center|LOCUS_23480 >Feature sequence208 1332 556 gene locus_tag LOCUS_23490 1332 556 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029292.1 protein_id gnl|my_center|LOCUS_23490 1991 1392 gene locus_tag LOCUS_23500 gene rsmG 1991 1392 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081032.1 protein_id gnl|my_center|LOCUS_23500 2471 1995 gene locus_tag LOCUS_23510 2471 1995 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467902.1 protein_id gnl|my_center|LOCUS_23510 2660 2724 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3792 2902 gene locus_tag LOCUS_23520 3792 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 4310 4053 gene locus_tag LOCUS_23530 4310 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 >Feature sequence209 296 1855 gene locus_tag LOCUS_23540 296 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 1918 2799 gene locus_tag LOCUS_23550 1918 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 2853 4175 gene locus_tag LOCUS_23560 2853 4175 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975759.1 protein_id gnl|my_center|LOCUS_23560 >Feature sequence210 718 870 gene locus_tag LOCUS_23570 718 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 2472 904 gene locus_tag LOCUS_23580 gene purH 2472 904 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187566.1 protein_id gnl|my_center|LOCUS_23580 3163 2549 gene locus_tag LOCUS_23590 gene purN 3163 2549 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938037.1 protein_id gnl|my_center|LOCUS_23590 4323 3160 gene locus_tag LOCUS_23600 4323 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 >Feature sequence211 71 1330 gene locus_tag LOCUS_23610 71 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 1407 2465 gene locus_tag LOCUS_23620 1407 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 2502 3329 gene locus_tag LOCUS_23630 2502 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 >Feature sequence212 235 453 gene locus_tag LOCUS_23640 235 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 499 1671 gene locus_tag LOCUS_23650 499 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 1691 2695 gene locus_tag LOCUS_23660 1691 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 3620 2700 gene locus_tag LOCUS_23670 3620 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 3254 3279 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3644 3844 gene locus_tag LOCUS_23680 3644 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 3871 4206 gene locus_tag LOCUS_23690 3871 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 >Feature sequence213 1459 1052 gene locus_tag LOCUS_23700 1459 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 1762 1502 gene locus_tag LOCUS_23710 1762 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 2516 1827 gene locus_tag LOCUS_23720 2516 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 4234 2576 gene locus_tag LOCUS_23730 4234 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 2677 2829 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence214 852 373 gene locus_tag LOCUS_23740 852 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 1340 948 gene locus_tag LOCUS_23750 1340 948 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227914.1 protein_id gnl|my_center|LOCUS_23750 2620 1361 gene locus_tag LOCUS_23760 2620 1361 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_23760 2684 2759 gene locus_tag LOCUS_t00300 2684 2759 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2832 2906 gene locus_tag LOCUS_t00310 2832 2906 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3551 3739 gene locus_tag LOCUS_23770 3551 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 >Feature sequence215 1086 547 gene locus_tag LOCUS_23780 1086 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 1514 2935 gene locus_tag LOCUS_23790 1514 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 3981 2956 gene locus_tag LOCUS_23800 gene trxB 3981 2956 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731638.1 protein_id gnl|my_center|LOCUS_23800 >Feature sequence216 362 718 gene locus_tag LOCUS_23810 362 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 1018 1248 gene locus_tag LOCUS_23820 1018 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 1197 1370 gene locus_tag LOCUS_23830 1197 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 1893 1633 gene locus_tag LOCUS_23840 1893 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 2183 2497 gene locus_tag LOCUS_23850 2183 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 2481 2909 gene locus_tag LOCUS_23860 2481 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 2912 3250 gene locus_tag LOCUS_23870 2912 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 3571 3305 gene locus_tag LOCUS_23880 3571 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 >Feature sequence217 58 768 gene locus_tag LOCUS_23890 58 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 2735 2421 gene locus_tag LOCUS_23900 2735 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 3223 2732 gene locus_tag LOCUS_23910 3223 2732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 3608 3225 gene locus_tag LOCUS_23920 3608 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 >Feature sequence218 382 469 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1555 884 gene locus_tag LOCUS_23930 1555 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 1901 1557 gene locus_tag LOCUS_23940 1901 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 2183 1905 gene locus_tag LOCUS_23950 2183 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 3052 2207 gene locus_tag LOCUS_23960 3052 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 3821 3057 gene locus_tag LOCUS_23970 3821 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 >Feature sequence219 594 229 gene locus_tag LOCUS_23980 594 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 <4172 750 gene locus_tag LOCUS_23990 <4172 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010950644.1:DEAD/DEAH box helicase >Feature sequence220 1405 761 gene locus_tag LOCUS_24000 1405 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 1444 1638 gene locus_tag LOCUS_24010 1444 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 1631 1846 gene locus_tag LOCUS_24020 1631 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 2450 1944 gene locus_tag LOCUS_24030 2450 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 2975 2562 gene locus_tag LOCUS_24040 2975 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 3071 3322 gene locus_tag LOCUS_24050 3071 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 4072 3614 gene locus_tag LOCUS_24060 4072 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 >Feature sequence221 2687 3958 gene locus_tag LOCUS_24070 gene tyrS 2687 3958 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_24070 >Feature sequence222 1414 524 gene locus_tag LOCUS_24080 gene hisG 1414 524 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886604.1 protein_id gnl|my_center|LOCUS_24080 1730 1401 gene locus_tag LOCUS_24090 1730 1401 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036977.1 protein_id gnl|my_center|LOCUS_24090 2576 2163 gene locus_tag LOCUS_24100 gene flgB 2576 2163 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640104.1 protein_id gnl|my_center|LOCUS_24100 3603 3679 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence223 1042 1320 gene locus_tag LOCUS_24110 1042 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 1502 1828 gene locus_tag LOCUS_24120 1502 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 2143 1922 gene locus_tag LOCUS_24130 2143 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 2724 3155 gene locus_tag LOCUS_24140 2724 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 <4142 3414 gene locus_tag LOCUS_24150 <4142 3414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003418263.1:IS3 family transposase note possible pseudo, frameshifted >Feature sequence224 385 1209 gene locus_tag LOCUS_24160 385 1209 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941055.1 protein_id gnl|my_center|LOCUS_24160 622 639 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1206 2282 gene locus_tag LOCUS_24170 gene purM 1206 2282 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876828.1 protein_id gnl|my_center|LOCUS_24170 2467 2279 gene locus_tag LOCUS_24180 2467 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 2713 2486 gene locus_tag LOCUS_24190 2713 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 3444 2755 gene locus_tag LOCUS_24200 3444 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 <4135 3573 gene locus_tag LOCUS_24210 <4135 3573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943665.1:flagellin >Feature sequence225 876 1466 gene locus_tag LOCUS_24220 876 1466 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897489.1 protein_id gnl|my_center|LOCUS_24220 1463 2413 gene locus_tag LOCUS_24230 1463 2413 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729726.1 protein_id gnl|my_center|LOCUS_24230 2410 3927 gene locus_tag LOCUS_24240 2410 3927 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028007.1 protein_id gnl|my_center|LOCUS_24240 >Feature sequence226 <1 524 gene locus_tag LOCUS_24250 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005079890.1:YciI family protein 1369 875 gene locus_tag LOCUS_24260 1369 875 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891973.1 protein_id gnl|my_center|LOCUS_24260 1780 2523 gene locus_tag LOCUS_24270 1780 2523 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804265.1 protein_id gnl|my_center|LOCUS_24270 3352 2843 gene locus_tag LOCUS_24280 3352 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24280 3567 3364 gene locus_tag LOCUS_24290 3567 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 >Feature sequence227 181 465 gene locus_tag LOCUS_24300 181 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 438 1007 gene locus_tag LOCUS_24310 438 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24310 1205 2725 gene locus_tag LOCUS_24320 1205 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24320 2746 3942 gene locus_tag LOCUS_24330 2746 3942 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728535.1 protein_id gnl|my_center|LOCUS_24330 >Feature sequence228 2386 1541 gene locus_tag LOCUS_24340 2386 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 >Feature sequence229 >Feature sequence230 736 927 gene locus_tag LOCUS_24350 736 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 1221 913 gene locus_tag LOCUS_24360 1221 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 3363 2284 gene locus_tag LOCUS_24370 3363 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 2793 2857 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3391 3555 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence231 384 875 gene locus_tag LOCUS_24380 384 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 878 2329 gene locus_tag LOCUS_24390 gene flgK 878 2329 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460797.1 protein_id gnl|my_center|LOCUS_24390 1202 1237 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2342 3229 gene locus_tag LOCUS_24400 gene flgL 2342 3229 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 protein_id gnl|my_center|LOCUS_24400 3230 3706 gene locus_tag LOCUS_24410 gene fliW 3230 3706 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228007.1 protein_id gnl|my_center|LOCUS_24410 >Feature sequence232 <1 685 gene locus_tag LOCUS_24420 <1 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964817.1:sigma-70 family RNA polymerase sigma factor 1672 869 gene locus_tag LOCUS_24430 1672 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 3643 3666 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence233 485 276 gene locus_tag LOCUS_24440 485 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 588 1808 gene locus_tag LOCUS_24450 588 1808 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229842.1 protein_id gnl|my_center|LOCUS_24450 1919 2344 gene locus_tag LOCUS_24460 1919 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 2284 2559 gene locus_tag LOCUS_24470 2284 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 2563 3663 gene locus_tag LOCUS_24480 2563 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 >Feature sequence234 3829 3853 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence235 2993 1470 gene locus_tag LOCUS_24490 2993 1470 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257763.1 protein_id gnl|my_center|LOCUS_24490 3907 2993 gene locus_tag LOCUS_24500 3907 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 >Feature sequence236 2720 1359 gene locus_tag LOCUS_24510 gene phoR 2720 1359 CDS product sensory box histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403870.1 protein_id gnl|my_center|LOCUS_24510 3457 2741 gene locus_tag LOCUS_24520 3457 2741 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863097.1 protein_id gnl|my_center|LOCUS_24520 >Feature sequence237 >Feature sequence238 303 103 gene locus_tag LOCUS_24530 303 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 976 647 gene locus_tag LOCUS_24540 976 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 1478 1122 gene locus_tag LOCUS_24550 1478 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 1768 1508 gene locus_tag LOCUS_24560 1768 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 2984 2655 gene locus_tag LOCUS_24570 2984 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 3072 3347 gene locus_tag LOCUS_24580 3072 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 >Feature sequence239 956 456 gene locus_tag LOCUS_24590 956 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 1681 1058 gene locus_tag LOCUS_24600 1681 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 2325 1750 gene locus_tag LOCUS_24610 2325 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 2464 3393 gene locus_tag LOCUS_24620 gene rarD 2464 3393 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029749.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24620 <3930 3401 gene locus_tag LOCUS_24630 <3930 3401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011013616.1:formyltetrahydrofolate deformylase 3683 3717 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence240 <1 1551 gene locus_tag LOCUS_24640 <1 1551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546422.1:elongation factor G 1583 2425 gene locus_tag LOCUS_24650 1583 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 2528 2734 gene locus_tag LOCUS_24660 2528 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 2900 3700 gene locus_tag LOCUS_24670 2900 3700 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198511.1 protein_id gnl|my_center|LOCUS_24670 >Feature sequence241 2568 94 gene locus_tag LOCUS_24680 2568 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 3364 2876 gene locus_tag LOCUS_24690 3364 2876 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084031.1 protein_id gnl|my_center|LOCUS_24690 >Feature sequence242 2114 1602 gene locus_tag LOCUS_24700 2114 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 3017 2145 gene locus_tag LOCUS_24710 3017 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 >Feature sequence243 1251 256 gene locus_tag LOCUS_24720 gene corA 1251 256 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821727.1 protein_id gnl|my_center|LOCUS_24720 1553 2785 gene locus_tag LOCUS_24730 gene thrC 1553 2785 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056826.1 protein_id gnl|my_center|LOCUS_24730 2788 3066 gene locus_tag LOCUS_24740 2788 3066 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_24740 3459 3139 gene locus_tag LOCUS_24750 3459 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 >Feature sequence244 569 940 gene locus_tag LOCUS_24760 569 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 1371 946 gene locus_tag LOCUS_24770 1371 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 1398 1529 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1631 3799 gene locus_tag LOCUS_24780 1631 3799 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480377.1 protein_id gnl|my_center|LOCUS_24780 >Feature sequence245 738 100 gene locus_tag LOCUS_24790 738 100 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975690.1 protein_id gnl|my_center|LOCUS_24790 1758 787 gene locus_tag LOCUS_24800 1758 787 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975691.1 protein_id gnl|my_center|LOCUS_24800 2773 1766 gene locus_tag LOCUS_24810 2773 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 2977 3187 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence246 876 166 gene locus_tag LOCUS_24820 876 166 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888933.1 protein_id gnl|my_center|LOCUS_24820 865 2097 gene locus_tag LOCUS_24830 865 2097 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226756.1 protein_id gnl|my_center|LOCUS_24830 2818 2273 gene locus_tag LOCUS_24840 2818 2273 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918753.1 protein_id gnl|my_center|LOCUS_24840 2988 2797 gene locus_tag LOCUS_24850 2988 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 3009 3395 gene locus_tag LOCUS_24860 3009 3395 CDS product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061392.1 protein_id gnl|my_center|LOCUS_24860 >Feature sequence247 229 552 gene locus_tag LOCUS_24870 229 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 755 1123 gene locus_tag LOCUS_24880 755 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 1306 1815 gene locus_tag LOCUS_24890 1306 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 3297 3409 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence248 <1 1275 gene locus_tag LOCUS_24900 <1 1275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256716.1:ATP-dependent RecD-like DNA helicase 1401 1553 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1680 2453 gene locus_tag LOCUS_24910 1680 2453 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921580.1 protein_id gnl|my_center|LOCUS_24910 2450 3025 gene locus_tag LOCUS_24920 2450 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 3048 3500 gene locus_tag LOCUS_24930 3048 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 3771 3511 gene locus_tag LOCUS_24940 3771 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 >Feature sequence249 <1 974 gene locus_tag LOCUS_24950 <1 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003811788.1:1-deoxy-D-xylulose-5-phosphate reductoisomerase 971 2236 gene locus_tag LOCUS_24960 971 2236 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014824.1 protein_id gnl|my_center|LOCUS_24960 2249 3472 gene locus_tag LOCUS_24970 gene ispG 2249 3472 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096456766.1 protein_id gnl|my_center|LOCUS_24970 >Feature sequence250 838 83 gene locus_tag LOCUS_24980 838 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 1942 902 gene locus_tag LOCUS_24990 1942 902 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_24990 2383 1952 gene locus_tag LOCUS_25000 gene ndk 2383 1952 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908355.1 protein_id gnl|my_center|LOCUS_25000 <3742 2427 gene locus_tag LOCUS_25010 <3742 2427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228491.1:folylpolyglutamate synthase/dihydrofolate synthase family protein >Feature sequence251 1065 1352 gene locus_tag LOCUS_25020 gene gatC 1065 1352 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533050.1 protein_id gnl|my_center|LOCUS_25020 1411 2892 gene locus_tag LOCUS_25030 gene gatA 1411 2892 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920295.1 protein_id gnl|my_center|LOCUS_25030 >Feature sequence252 2464 872 gene locus_tag LOCUS_25040 2464 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 >Feature sequence253 502 242 gene locus_tag LOCUS_25050 502 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 1917 502 gene locus_tag LOCUS_25060 1917 502 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726975.1 protein_id gnl|my_center|LOCUS_25060 2236 1895 gene locus_tag LOCUS_25070 2236 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 2928 2551 gene locus_tag LOCUS_25080 2928 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 3431 3090 gene locus_tag LOCUS_25090 3431 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 >Feature sequence254 1204 1560 gene locus_tag LOCUS_25100 1204 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 1570 2553 gene locus_tag LOCUS_25110 1570 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 2566 2886 gene locus_tag LOCUS_25120 2566 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 2887 3372 gene locus_tag LOCUS_25130 2887 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 >Feature sequence255 649 398 gene locus_tag LOCUS_25140 649 398 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228157.1 protein_id gnl|my_center|LOCUS_25140 827 675 gene locus_tag LOCUS_25150 827 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 1186 824 gene locus_tag LOCUS_25160 1186 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 1584 1156 gene locus_tag LOCUS_25170 1584 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 2222 1584 gene locus_tag LOCUS_25180 2222 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 2611 2219 gene locus_tag LOCUS_25190 2611 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 3150 2611 gene locus_tag LOCUS_25200 3150 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 3217 3477 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence256 <3707 965 gene locus_tag LOCUS_25210 <3707 965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942467.1:DNA mismatch repair protein MutS >Feature sequence257 1705 2 gene locus_tag LOCUS_25220 1705 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 2277 1702 gene locus_tag LOCUS_25230 2277 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 2944 3261 gene locus_tag LOCUS_25240 2944 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 >Feature sequence258 1735 1028 gene locus_tag LOCUS_25250 1735 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 2077 2586 gene locus_tag LOCUS_25260 2077 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 >Feature sequence259 <3694 1958 gene locus_tag LOCUS_25270 <3694 1958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029792.1:DNA-directed RNA polymerase subunit beta >Feature sequence260 262 816 gene locus_tag LOCUS_25280 262 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25280 1456 884 gene locus_tag LOCUS_25290 1456 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 3539 2052 gene locus_tag LOCUS_25300 3539 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 >Feature sequence261 1045 125 gene locus_tag LOCUS_25310 1045 125 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257155.1 protein_id gnl|my_center|LOCUS_25310 2430 1132 gene locus_tag LOCUS_25320 2430 1132 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321046.1 protein_id gnl|my_center|LOCUS_25320 3536 2427 gene locus_tag LOCUS_25330 3536 2427 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257043.1 protein_id gnl|my_center|LOCUS_25330 >Feature sequence262 596 1030 gene locus_tag LOCUS_25340 596 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25340 1203 1358 gene locus_tag LOCUS_25350 1203 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25350 1500 1697 gene locus_tag LOCUS_25360 1500 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 2670 1960 gene locus_tag LOCUS_25370 2670 1960 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089728.1 protein_id gnl|my_center|LOCUS_25370 2860 3612 gene locus_tag LOCUS_25380 2860 3612 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227392.1 protein_id gnl|my_center|LOCUS_25380 >Feature sequence263 1592 1371 gene locus_tag LOCUS_25390 1592 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25390 3036 2020 gene locus_tag LOCUS_25400 3036 2020 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114426.1 protein_id gnl|my_center|LOCUS_25400 3310 3389 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence264 2476 1367 gene locus_tag LOCUS_25410 gene ftsZ 2476 1367 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_25410 >Feature sequence265 <1 599 gene locus_tag LOCUS_25420 <1 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258358.1:TlpA disulfide reductase family protein 596 1177 gene locus_tag LOCUS_25430 596 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 1174 1917 gene locus_tag LOCUS_25440 1174 1917 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_25440 1926 2213 gene locus_tag LOCUS_25450 1926 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 3590 2232 gene locus_tag LOCUS_25460 gene argS 3590 2232 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869400.1 protein_id gnl|my_center|LOCUS_25460 >Feature sequence266 939 1097 gene locus_tag LOCUS_25470 939 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 1295 1083 gene locus_tag LOCUS_25480 1295 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 2961 2479 gene locus_tag LOCUS_25490 2961 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 3437 2976 gene locus_tag LOCUS_25500 3437 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 >Feature sequence267 722 1711 gene locus_tag LOCUS_25510 722 1711 CDS product DUF3179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256451.1 protein_id gnl|my_center|LOCUS_25510 2097 2426 gene locus_tag LOCUS_25520 2097 2426 CDS product ParD-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894879.1 protein_id gnl|my_center|LOCUS_25520 2423 2992 gene locus_tag LOCUS_25530 2423 2992 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729066.1 protein_id gnl|my_center|LOCUS_25530 >Feature sequence268 1030 74 gene locus_tag LOCUS_25540 1030 74 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392654.1 protein_id gnl|my_center|LOCUS_25540 2337 1027 gene locus_tag LOCUS_25550 2337 1027 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249141.1 protein_id gnl|my_center|LOCUS_25550 2381 2956 gene locus_tag LOCUS_25560 2381 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 >Feature sequence269 41 328 gene locus_tag LOCUS_25570 41 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 930 289 gene locus_tag LOCUS_25580 gene pgsA 930 289 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392589.1 protein_id gnl|my_center|LOCUS_25580 1845 958 gene locus_tag LOCUS_25590 1845 958 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974609.1 protein_id gnl|my_center|LOCUS_25590 2018 2485 gene locus_tag LOCUS_25600 2018 2485 CDS product DUF2243 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878720.1 protein_id gnl|my_center|LOCUS_25600 2675 3250 gene locus_tag LOCUS_25610 2675 3250 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978444.1 protein_id gnl|my_center|LOCUS_25610 >Feature sequence270 90 539 gene locus_tag LOCUS_25620 90 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 536 853 gene locus_tag LOCUS_25630 536 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 932 1300 gene locus_tag LOCUS_25640 932 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 1322 2425 gene locus_tag LOCUS_25650 1322 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 >Feature sequence271 3122 933 gene locus_tag LOCUS_25660 3122 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 3222 3275 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence272 112 399 gene locus_tag LOCUS_25670 112 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 1298 396 gene locus_tag LOCUS_25680 gene metF 1298 396 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880925.1 protein_id gnl|my_center|LOCUS_25680 1364 1723 gene locus_tag LOCUS_25690 1364 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 1720 2811 gene locus_tag LOCUS_25700 1720 2811 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871885.1 protein_id gnl|my_center|LOCUS_25700 >Feature sequence273 1122 493 gene locus_tag LOCUS_25710 gene rpsD 1122 493 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583370.1 protein_id gnl|my_center|LOCUS_25710 610 644 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1535 1137 gene locus_tag LOCUS_25720 gene rpsK 1535 1137 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_25720 1912 1535 gene locus_tag LOCUS_25730 gene rpsM 1912 1535 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908646.1 protein_id gnl|my_center|LOCUS_25730 1553 1568 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2446 2135 gene locus_tag LOCUS_25740 2446 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 3232 2486 gene locus_tag LOCUS_25750 gene map 3232 2486 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_25750 >Feature sequence274 23 115 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 416 1495 gene locus_tag LOCUS_25760 416 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 1543 2079 gene locus_tag LOCUS_25770 1543 2079 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898359.1 protein_id gnl|my_center|LOCUS_25770 2707 3114 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence275 780 190 gene locus_tag LOCUS_25780 780 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 223 239 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 801 1799 gene locus_tag LOCUS_25790 801 1799 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223699.1 protein_id gnl|my_center|LOCUS_25790 <3459 1880 gene locus_tag LOCUS_25800 <3459 1880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228538.1:dihydroxy-acid dehydratase >Feature sequence276 206 1312 gene locus_tag LOCUS_25810 gene menE 206 1312 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496096.1 protein_id gnl|my_center|LOCUS_25810 1895 1302 gene locus_tag LOCUS_25820 1895 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 2581 1970 gene locus_tag LOCUS_25830 2581 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 >Feature sequence277 3 239 gene locus_tag LOCUS_25840 3 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 296 547 gene locus_tag LOCUS_25850 296 547 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058449.1 protein_id gnl|my_center|LOCUS_25850 1064 519 gene locus_tag LOCUS_25860 1064 519 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977232.1 protein_id gnl|my_center|LOCUS_25860 2936 1101 gene locus_tag LOCUS_25870 2936 1101 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 protein_id gnl|my_center|LOCUS_25870 3143 3054 gene locus_tag LOCUS_t00320 3143 3054 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence278 2302 341 gene locus_tag LOCUS_25880 2302 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25880 3003 2299 gene locus_tag LOCUS_25890 3003 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25890 3354 3112 gene locus_tag LOCUS_25900 3354 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 >Feature sequence279 308 15 gene locus_tag LOCUS_25910 308 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 262 411 gene locus_tag LOCUS_25920 262 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 475 933 gene locus_tag LOCUS_25930 475 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25930 1062 1083 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1884 1435 gene locus_tag LOCUS_25940 1884 1435 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545419.1 protein_id gnl|my_center|LOCUS_25940 2052 2223 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence280 1038 601 gene locus_tag LOCUS_25950 1038 601 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063625.1 protein_id gnl|my_center|LOCUS_25950 1228 2070 gene locus_tag LOCUS_25960 1228 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223993.1 protein_id gnl|my_center|LOCUS_25960 2872 2309 gene locus_tag LOCUS_25970 2872 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 >Feature sequence281 2677 2853 gene locus_tag LOCUS_25980 2677 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 >Feature sequence282 621 1796 gene locus_tag LOCUS_25990 621 1796 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104311.1 protein_id gnl|my_center|LOCUS_25990 >Feature sequence283 1385 531 gene locus_tag LOCUS_26000 1385 531 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776057.1 protein_id gnl|my_center|LOCUS_26000 2631 1387 gene locus_tag LOCUS_26010 2631 1387 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776058.1 protein_id gnl|my_center|LOCUS_26010 3112 3310 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence284 409 618 gene locus_tag LOCUS_26020 409 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 1793 573 gene locus_tag LOCUS_26030 1793 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 2281 2451 gene locus_tag LOCUS_26040 2281 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 2912 3070 gene locus_tag LOCUS_26050 2912 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26050 >Feature sequence285 1427 312 gene locus_tag LOCUS_26060 1427 312 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057240.1 protein_id gnl|my_center|LOCUS_26060 1581 1661 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2452 1694 gene locus_tag LOCUS_26070 2452 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 >Feature sequence286 847 1067 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1326 1516 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2974 3130 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence287 901 602 gene locus_tag LOCUS_26080 901 602 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529756.1 protein_id gnl|my_center|LOCUS_26080 1412 1664 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1823 2059 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <3368 2747 gene locus_tag LOCUS_26090 <3368 2747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531531.1:protein-L-isoaspartate(D-aspartate) O-methyltransferase >Feature sequence288 947 672 gene locus_tag LOCUS_26100 947 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 870 1481 gene locus_tag LOCUS_26110 870 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 1577 1825 gene locus_tag LOCUS_26120 1577 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 1839 2033 gene locus_tag LOCUS_26130 1839 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 2059 3207 gene locus_tag LOCUS_26140 2059 3207 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086130.1 protein_id gnl|my_center|LOCUS_26140 >Feature sequence289 825 1886 gene locus_tag LOCUS_26150 825 1886 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228908.1 protein_id gnl|my_center|LOCUS_26150 1927 3327 gene locus_tag LOCUS_26160 1927 3327 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_26160 >Feature sequence290 533 738 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1033 2817 gene locus_tag LOCUS_26170 1033 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 1057 1084 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2133 2171 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2445 2462 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2858 3130 gene locus_tag LOCUS_26180 2858 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 >Feature sequence291 958 545 gene locus_tag LOCUS_26190 958 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 1275 1505 gene locus_tag LOCUS_26200 1275 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 1727 2194 gene locus_tag LOCUS_26210 1727 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 2550 2263 gene locus_tag LOCUS_26220 2550 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 2762 2547 gene locus_tag LOCUS_26230 2762 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413717.1 protein_id gnl|my_center|LOCUS_26230 >Feature sequence292 892 335 gene locus_tag LOCUS_26240 892 335 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226057.1 protein_id gnl|my_center|LOCUS_26240 1005 1529 gene locus_tag LOCUS_26250 1005 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 1467 1484 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2193 1555 gene locus_tag LOCUS_26260 2193 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 2508 2930 gene locus_tag LOCUS_26270 gene arfB 2508 2930 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974697.1 protein_id gnl|my_center|LOCUS_26270 2805 2816 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence293 769 443 gene locus_tag LOCUS_26280 769 443 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392367.1 protein_id gnl|my_center|LOCUS_26280 1479 769 gene locus_tag LOCUS_26290 1479 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 <3337 1476 gene locus_tag LOCUS_26300 <3337 1476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027759.1:mannose-1-phosphate guanyltransferase >Feature sequence294 2482 3150 gene locus_tag LOCUS_26310 2482 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 >Feature sequence295 248 1303 gene locus_tag LOCUS_26320 248 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26320 1322 1537 gene locus_tag LOCUS_26330 1322 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 1543 2535 gene locus_tag LOCUS_26340 1543 2535 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027842956.1 protein_id gnl|my_center|LOCUS_26340 >Feature sequence296 1894 545 gene locus_tag LOCUS_26350 1894 545 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225363.1 protein_id gnl|my_center|LOCUS_26350 <3298 1891 gene locus_tag LOCUS_26360 <3298 1891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012296234.1:mercury(II) reductase >Feature sequence297 765 1055 gene locus_tag LOCUS_26370 765 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 1802 1083 gene locus_tag LOCUS_26380 1802 1083 CDS product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776677.1 protein_id gnl|my_center|LOCUS_26380 <3296 2696 gene locus_tag LOCUS_26390 <3296 2696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021687.1:ribose 5-phosphate isomerase A >Feature sequence298 1087 191 gene locus_tag LOCUS_26400 1087 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 2616 1213 gene locus_tag LOCUS_26410 2616 1213 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088620334.1 protein_id gnl|my_center|LOCUS_26410 >Feature sequence299 1562 135 gene locus_tag LOCUS_26420 gene glpK 1562 135 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731514.1 protein_id gnl|my_center|LOCUS_26420 1771 2172 gene locus_tag LOCUS_26430 1771 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 <3291 2183 gene locus_tag LOCUS_26440 <3291 2183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967206.1:low temperature requirement protein A >Feature sequence300 421 233 gene locus_tag LOCUS_26450 421 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 401 1141 gene locus_tag LOCUS_26460 401 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 1307 1546 gene locus_tag LOCUS_26470 1307 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 1614 2207 gene locus_tag LOCUS_26480 1614 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 >Feature sequence301 175 453 gene locus_tag LOCUS_26490 175 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 999 478 gene locus_tag LOCUS_26500 999 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 886 1215 gene locus_tag LOCUS_26510 886 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 2411 1134 gene locus_tag LOCUS_26520 2411 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26520 >Feature sequence302 1588 524 gene locus_tag LOCUS_26530 1588 524 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973519.1 protein_id gnl|my_center|LOCUS_26530 2577 1588 gene locus_tag LOCUS_26540 2577 1588 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973520.1 protein_id gnl|my_center|LOCUS_26540 3281 2685 gene locus_tag LOCUS_26550 3281 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 >Feature sequence303 789 151 gene locus_tag LOCUS_26560 789 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 891 1778 gene locus_tag LOCUS_26570 gene mshD 891 1778 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230716.1 protein_id gnl|my_center|LOCUS_26570 2506 1775 gene locus_tag LOCUS_26580 2506 1775 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976789.1 protein_id gnl|my_center|LOCUS_26580 >Feature sequence304 498 22 gene locus_tag LOCUS_26590 498 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 2380 530 gene locus_tag LOCUS_26600 2380 530 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403165.1 protein_id gnl|my_center|LOCUS_26600 2775 2377 gene locus_tag LOCUS_26610 gene trxA 2775 2377 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846557.1 protein_id gnl|my_center|LOCUS_26610 >Feature sequence305 748 1548 gene locus_tag LOCUS_26620 748 1548 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530494.1 protein_id gnl|my_center|LOCUS_26620 1833 1997 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2010 2053 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2340 2858 gene locus_tag LOCUS_26630 2340 2858 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971886.1 protein_id gnl|my_center|LOCUS_26630 >Feature sequence306 382 23 gene locus_tag LOCUS_26640 382 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 760 840 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 997 1047 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1724 1759 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2283 1897 gene locus_tag LOCUS_26650 2283 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 2665 2297 gene locus_tag LOCUS_26660 2665 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 2432 2460 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2888 3121 gene locus_tag LOCUS_26670 2888 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 3031 3050 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence307 1822 521 gene locus_tag LOCUS_26680 1822 521 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897686.1 protein_id gnl|my_center|LOCUS_26680 2827 1997 gene locus_tag LOCUS_26690 2827 1997 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243784.1 protein_id gnl|my_center|LOCUS_26690 >Feature sequence308 77 583 gene locus_tag LOCUS_26700 77 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 1443 628 gene locus_tag LOCUS_26710 1443 628 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660467.1 protein_id gnl|my_center|LOCUS_26710 >Feature sequence309 >Feature sequence310 <1 1713 gene locus_tag LOCUS_26720 <1 1713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389280.1:energy-dependent translational throttle protein EttA 1782 2702 gene locus_tag LOCUS_26730 1782 2702 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392617.1 protein_id gnl|my_center|LOCUS_26730 >Feature sequence311 <1 1110 gene locus_tag LOCUS_26740 <1 1110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976192.1:rod shape-determining protein RodA 368 428 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1226 1285 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1290 2261 gene locus_tag LOCUS_26750 1290 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 1766 1850 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence312 1644 352 gene locus_tag LOCUS_26760 1644 352 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256167.1 protein_id gnl|my_center|LOCUS_26760 1635 1541 gene locus_tag LOCUS_t00330 1635 1541 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 1782 2783 gene locus_tag LOCUS_26770 gene selD 1782 2783 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727954.1 protein_id gnl|my_center|LOCUS_26770 2222 2241 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2493 2556 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence313 761 863 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1391 1470 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1920 1606 gene locus_tag LOCUS_26780 1920 1606 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973611.1 protein_id gnl|my_center|LOCUS_26780 2268 2603 gene locus_tag LOCUS_26790 2268 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 >Feature sequence314 616 374 gene locus_tag LOCUS_26800 616 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 1186 1551 gene locus_tag LOCUS_26810 1186 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 1701 3071 gene locus_tag LOCUS_26820 1701 3071 CDS product IS1380-like element IS1677 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014460.1 protein_id gnl|my_center|LOCUS_26820 >Feature sequence315 560 1882 gene locus_tag LOCUS_26830 gene pgsB 560 1882 CDS product poly-gamma-glutamate synthase PgsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118210.1 protein_id gnl|my_center|LOCUS_26830 1875 2921 gene locus_tag LOCUS_26840 1875 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 >Feature sequence316 3 1043 gene locus_tag LOCUS_26850 3 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 1091 1696 gene locus_tag LOCUS_26860 1091 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 1669 2247 gene locus_tag LOCUS_26870 1669 2247 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234318.1 protein_id gnl|my_center|LOCUS_26870 >Feature sequence317 202 1494 gene locus_tag LOCUS_26880 202 1494 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831529.1 protein_id gnl|my_center|LOCUS_26880 1491 2444 gene locus_tag LOCUS_26890 1491 2444 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_26890 >Feature sequence318 1088 2404 gene locus_tag LOCUS_26900 1088 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 3142 2498 gene locus_tag LOCUS_26910 3142 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 >Feature sequence319 247 83 gene locus_tag LOCUS_26920 247 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 891 304 gene locus_tag LOCUS_26930 891 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 2048 891 gene locus_tag LOCUS_26940 2048 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 2776 2375 gene locus_tag LOCUS_26950 2776 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 >Feature sequence320 67 801 gene locus_tag LOCUS_26960 67 801 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730918.1 protein_id gnl|my_center|LOCUS_26960 1273 818 gene locus_tag LOCUS_26970 1273 818 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283762.1 protein_id gnl|my_center|LOCUS_26970 1761 1270 gene locus_tag LOCUS_26980 1761 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26980 1799 1816 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2561 2175 gene locus_tag LOCUS_26990 2561 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 >Feature sequence321 252 842 gene locus_tag LOCUS_27000 252 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905778.1 protein_id gnl|my_center|LOCUS_27000 875 1402 gene locus_tag LOCUS_27010 gene cobO 875 1402 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071298.1 protein_id gnl|my_center|LOCUS_27010 2303 1416 gene locus_tag LOCUS_27020 2303 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 2384 3121 gene locus_tag LOCUS_27030 2384 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 >Feature sequence322 666 807 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1229 1145 gene locus_tag LOCUS_t00340 1229 1145 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2489 1566 gene locus_tag LOCUS_27040 2489 1566 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_27040 >Feature sequence323 <1 899 gene locus_tag LOCUS_27050 <1 899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039186.1:glucuronate isomerase 1034 2041 gene locus_tag LOCUS_27060 1034 2041 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035376.1 protein_id gnl|my_center|LOCUS_27060 2987 2265 gene locus_tag LOCUS_27070 2987 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 >Feature sequence324 >Feature sequence325 >Feature sequence326 289 963 gene locus_tag LOCUS_27080 289 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 >Feature sequence327 562 1449 gene locus_tag LOCUS_27090 562 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 1638 3068 gene locus_tag LOCUS_27100 gene lpdA 1638 3068 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051289.1 protein_id gnl|my_center|LOCUS_27100 >Feature sequence328 1199 2092 gene locus_tag LOCUS_27110 1199 2092 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094336.1 protein_id gnl|my_center|LOCUS_27110 <3103 2145 gene locus_tag LOCUS_27120 <3103 2145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031624.1:PP2C family protein-serine/threonine phosphatase >Feature sequence329 1542 199 gene locus_tag LOCUS_27130 1542 199 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393050.1 protein_id gnl|my_center|LOCUS_27130 2933 1539 gene locus_tag LOCUS_27140 2933 1539 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393051.1 protein_id gnl|my_center|LOCUS_27140 >Feature sequence330 1491 175 gene locus_tag LOCUS_27150 1491 175 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141651.1 protein_id gnl|my_center|LOCUS_27150 622 659 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1688 2623 gene locus_tag LOCUS_27160 1688 2623 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929709.1 protein_id gnl|my_center|LOCUS_27160 >Feature sequence331 2477 276 gene locus_tag LOCUS_27170 2477 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 1069 1119 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence332 621 295 gene locus_tag LOCUS_27180 621 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 755 2683 gene locus_tag LOCUS_27190 755 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 >Feature sequence333 499 957 gene locus_tag LOCUS_27200 499 957 CDS product DUF2243 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878720.1 protein_id gnl|my_center|LOCUS_27200 957 1337 gene locus_tag LOCUS_27210 957 1337 CDS product ChaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079526.1 protein_id gnl|my_center|LOCUS_27210 1368 2150 gene locus_tag LOCUS_27220 1368 2150 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417961.1 protein_id gnl|my_center|LOCUS_27220 >Feature sequence334 888 427 gene locus_tag LOCUS_27230 888 427 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058664.1 protein_id gnl|my_center|LOCUS_27230 1763 888 gene locus_tag LOCUS_27240 gene argF 1763 888 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257452.1 protein_id gnl|my_center|LOCUS_27240 2632 1760 gene locus_tag LOCUS_27250 gene argB 2632 1760 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057248.1 protein_id gnl|my_center|LOCUS_27250 >Feature sequence335 1073 474 gene locus_tag LOCUS_27260 1073 474 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037459.1 protein_id gnl|my_center|LOCUS_27260 2377 1070 gene locus_tag LOCUS_27270 gene argH 2377 1070 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027854.1 protein_id gnl|my_center|LOCUS_27270 1872 1889 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <3070 2457 gene locus_tag LOCUS_27280 <3070 2457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940575.1:L-glutamate gamma-semialdehyde dehydrogenase >Feature sequence336 168 596 gene locus_tag LOCUS_27290 168 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 840 676 gene locus_tag LOCUS_27300 840 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 1270 1013 gene locus_tag LOCUS_27310 1270 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 2420 1368 gene locus_tag LOCUS_27320 2420 1368 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931304.1 protein_id gnl|my_center|LOCUS_27320 >Feature sequence337 441 1304 gene locus_tag LOCUS_27330 441 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 1472 1720 gene locus_tag LOCUS_27340 1472 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 >Feature sequence338 966 343 gene locus_tag LOCUS_27350 966 343 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727585.1 protein_id gnl|my_center|LOCUS_27350 1159 1335 gene locus_tag LOCUS_27360 1159 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 1332 1766 gene locus_tag LOCUS_27370 1332 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27370 2139 2231 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2480 2902 gene locus_tag LOCUS_27380 2480 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 >Feature sequence339 1535 3013 gene locus_tag LOCUS_27390 1535 3013 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388213.1 protein_id gnl|my_center|LOCUS_27390 >Feature sequence340 <1 1943 gene locus_tag LOCUS_27400 <1 1943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974308.1:DNA-directed RNA polymerase subunit beta' >Feature sequence341 >Feature sequence342 2771 2568 gene locus_tag LOCUS_27410 2771 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 >Feature sequence343 853 272 gene locus_tag LOCUS_27420 853 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 1359 772 gene locus_tag LOCUS_27430 1359 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 1969 1598 gene locus_tag LOCUS_27440 1969 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 2693 2400 gene locus_tag LOCUS_27450 2693 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 >Feature sequence344 25 508 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 807 1054 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2358 2687 gene locus_tag LOCUS_27460 2358 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 >Feature sequence345 1120 2565 gene locus_tag LOCUS_27470 1120 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 >Feature sequence346 1186 230 gene locus_tag LOCUS_27480 1186 230 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971796.1 protein_id gnl|my_center|LOCUS_27480 1473 2393 gene locus_tag LOCUS_27490 1473 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27490 2765 2439 gene locus_tag LOCUS_27500 2765 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 >Feature sequence347 1345 1073 gene locus_tag LOCUS_27510 gene pqqD 1345 1073 CDS product pyrroloquinoline quinone biosynthesis peptide chaperone PqqD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089477.1 protein_id gnl|my_center|LOCUS_27510 2082 1342 gene locus_tag LOCUS_27520 gene pqqC 2082 1342 CDS product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038061.1 protein_id gnl|my_center|LOCUS_27520 <2992 2079 gene locus_tag LOCUS_27530 <2992 2079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038060.1:pyrroloquinoline quinone biosynthesis protein PqqB >Feature sequence348 <1 2597 gene locus_tag LOCUS_27540 <1 2597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038276.1:efflux RND transporter permease subunit >Feature sequence349 640 1281 gene locus_tag LOCUS_27550 640 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 1676 1455 gene locus_tag LOCUS_27560 1676 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 2051 1836 gene locus_tag LOCUS_27570 2051 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 >Feature sequence350 739 59 gene locus_tag LOCUS_27580 739 59 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257323.1 protein_id gnl|my_center|LOCUS_27580 2092 857 gene locus_tag LOCUS_27590 2092 857 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226315.1 protein_id gnl|my_center|LOCUS_27590 1860 1935 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2524 2799 gene locus_tag LOCUS_27600 2524 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 >Feature sequence351 2580 1993 gene locus_tag LOCUS_27610 gene dcd 2580 1993 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064104.1 protein_id gnl|my_center|LOCUS_27610 2929 2603 gene locus_tag LOCUS_27620 2929 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 >Feature sequence352 285 1877 gene locus_tag LOCUS_27630 285 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 993 1116 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence353 507 791 gene locus_tag LOCUS_27640 507 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 788 1489 gene locus_tag LOCUS_27650 788 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258031.1 protein_id gnl|my_center|LOCUS_27650 1545 1835 gene locus_tag LOCUS_27660 1545 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258032.1 protein_id gnl|my_center|LOCUS_27660 1945 2694 gene locus_tag LOCUS_27670 1945 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27670 >Feature sequence354 <2871 535 gene locus_tag LOCUS_27680 <2871 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640554.1:Xaa-Pro dipeptidase >Feature sequence355 1 531 gene locus_tag LOCUS_27690 1 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 927 769 gene locus_tag LOCUS_27700 927 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 1156 935 gene locus_tag LOCUS_27710 1156 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 1134 1832 gene locus_tag LOCUS_27720 1134 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 2350 1898 gene locus_tag LOCUS_27730 2350 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 2232 2265 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence356 <1 1154 gene locus_tag LOCUS_27740 <1 1154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389624.1:AAA family ATPase 1151 2644 gene locus_tag LOCUS_27750 1151 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 >Feature sequence357 1254 775 gene locus_tag LOCUS_27760 1254 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 1207 1644 gene locus_tag LOCUS_27770 1207 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 <2814 2222 gene locus_tag LOCUS_27780 <2814 2222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103519.1:sensor domain-containing diguanylate cyclase >Feature sequence358 1791 1087 gene locus_tag LOCUS_27790 1791 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 >Feature sequence359 2168 1359 gene locus_tag LOCUS_27800 2168 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 >Feature sequence360 480 19 gene locus_tag LOCUS_27810 480 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 803 1660 gene locus_tag LOCUS_27820 803 1660 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027942.1 protein_id gnl|my_center|LOCUS_27820 1757 2533 gene locus_tag LOCUS_27830 1757 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 >Feature sequence361 2235 757 gene locus_tag LOCUS_27840 2235 757 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143698.1 protein_id gnl|my_center|LOCUS_27840 >Feature sequence362 >Feature sequence363