>Feature sequence001 795 79 gene locus_tag LOCUS_00010 795 79 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024003.1 protein_id gnl|my_center|LOCUS_00010 1161 802 gene locus_tag LOCUS_00020 1161 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1349 1711 gene locus_tag LOCUS_00030 gene queD 1349 1711 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003389277.1 protein_id gnl|my_center|LOCUS_00030 2032 1751 gene locus_tag LOCUS_00040 2032 1751 CDS product Rpp14/Pop5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876326.1 protein_id gnl|my_center|LOCUS_00040 2863 2195 gene locus_tag LOCUS_00050 2863 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 3002 4336 gene locus_tag LOCUS_00060 3002 4336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5482 4397 gene locus_tag LOCUS_00070 gene aroC 5482 4397 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 protein_id gnl|my_center|LOCUS_00070 6685 5546 gene locus_tag LOCUS_00080 6685 5546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 6954 6613 gene locus_tag LOCUS_00090 6954 6613 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020812.1 protein_id gnl|my_center|LOCUS_00090 7241 6951 gene locus_tag LOCUS_00100 7241 6951 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869934.1 protein_id gnl|my_center|LOCUS_00100 8414 7341 gene locus_tag LOCUS_00110 8414 7341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9857 8766 gene locus_tag LOCUS_00120 gene ahbD 9857 8766 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_00120 10808 9999 gene locus_tag LOCUS_00130 10808 9999 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879200.1 protein_id gnl|my_center|LOCUS_00130 10860 12065 gene locus_tag LOCUS_00140 10860 12065 CDS product putative sulfate/molybdate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057197.1 protein_id gnl|my_center|LOCUS_00140 12739 11993 gene locus_tag LOCUS_00150 12739 11993 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867813.1 protein_id gnl|my_center|LOCUS_00150 13127 12789 gene locus_tag LOCUS_00160 13127 12789 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024007.1 protein_id gnl|my_center|LOCUS_00160 13587 13117 gene locus_tag LOCUS_00170 13587 13117 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870197.1 protein_id gnl|my_center|LOCUS_00170 13662 15098 gene locus_tag LOCUS_00180 gene gatB 13662 15098 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064531.1 protein_id gnl|my_center|LOCUS_00180 16107 15103 gene locus_tag LOCUS_00190 gene cofG 16107 15103 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878300.1 protein_id gnl|my_center|LOCUS_00190 16241 17098 gene locus_tag LOCUS_00200 16241 17098 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021191.1 protein_id gnl|my_center|LOCUS_00200 18584 17109 gene locus_tag LOCUS_00210 gene secY 18584 17109 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021124.1 protein_id gnl|my_center|LOCUS_00210 19010 18585 gene locus_tag LOCUS_00220 19010 18585 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021123.1 protein_id gnl|my_center|LOCUS_00220 19140 19691 gene locus_tag LOCUS_00230 19140 19691 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024211.1 protein_id gnl|my_center|LOCUS_00230 19701 20117 gene locus_tag LOCUS_00240 19701 20117 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876760.1 protein_id gnl|my_center|LOCUS_00240 20168 22138 gene locus_tag LOCUS_00250 gene hdrA 20168 22138 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_00250 22166 22450 gene locus_tag LOCUS_00260 22166 22450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 22437 22700 gene locus_tag LOCUS_00270 22437 22700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 22838 25249 gene locus_tag LOCUS_00280 gene rad50 22838 25249 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868338.1 protein_id gnl|my_center|LOCUS_00280 25541 25852 gene locus_tag LOCUS_00290 25541 25852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 25849 26208 gene locus_tag LOCUS_00300 25849 26208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 27091 26375 gene locus_tag LOCUS_00310 27091 26375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 27276 28730 gene locus_tag LOCUS_00320 27276 28730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 28727 29062 gene locus_tag LOCUS_00330 28727 29062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 29069 30232 gene locus_tag LOCUS_00340 29069 30232 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065374.1 protein_id gnl|my_center|LOCUS_00340 30226 31416 gene locus_tag LOCUS_00350 30226 31416 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065771.1 protein_id gnl|my_center|LOCUS_00350 31410 31571 gene locus_tag LOCUS_00360 31410 31571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 31561 31935 gene locus_tag LOCUS_00370 31561 31935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 31938 32342 gene locus_tag LOCUS_00380 31938 32342 CDS product DUF2111 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589540.1 protein_id gnl|my_center|LOCUS_00380 32339 32776 gene locus_tag LOCUS_00390 32339 32776 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812273.1 protein_id gnl|my_center|LOCUS_00390 33346 32768 gene locus_tag LOCUS_00400 33346 32768 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867165.1 protein_id gnl|my_center|LOCUS_00400 33492 33974 gene locus_tag LOCUS_00410 33492 33974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 33971 34552 gene locus_tag LOCUS_00420 33971 34552 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903531.1 protein_id gnl|my_center|LOCUS_00420 34941 34573 gene locus_tag LOCUS_00430 34941 34573 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_00430 35951 34998 gene locus_tag LOCUS_00440 35951 34998 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020659.1 protein_id gnl|my_center|LOCUS_00440 36629 35988 gene locus_tag LOCUS_00450 gene rnhB 36629 35988 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021954.1 protein_id gnl|my_center|LOCUS_00450 37750 36626 gene locus_tag LOCUS_00460 gene trxB 37750 36626 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060886.1 protein_id gnl|my_center|LOCUS_00460 37640 37714 gene locus_tag LOCUS_t00010 37640 37714 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 38169 37864 gene locus_tag LOCUS_00470 38169 37864 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021460.1 protein_id gnl|my_center|LOCUS_00470 38335 39570 gene locus_tag LOCUS_00480 gene mpgS 38335 39570 CDS product mannosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868345.1 protein_id gnl|my_center|LOCUS_00480 39567 40373 gene locus_tag LOCUS_00490 gene mpgP 39567 40373 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228324.1 protein_id gnl|my_center|LOCUS_00490 40393 43011 gene locus_tag LOCUS_00500 40393 43011 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204437144.1 protein_id gnl|my_center|LOCUS_00500 43040 43786 gene locus_tag LOCUS_00510 43040 43786 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393577.1 protein_id gnl|my_center|LOCUS_00510 43829 44563 gene locus_tag LOCUS_00520 gene eutA 43829 44563 CDS product ectoine utilization protein EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969332.1 protein_id gnl|my_center|LOCUS_00520 44610 45503 gene locus_tag LOCUS_00530 44610 45503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 46150 45629 gene locus_tag LOCUS_00540 46150 45629 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867179.1 protein_id gnl|my_center|LOCUS_00540 46210 46761 gene locus_tag LOCUS_00550 gene ectA 46210 46761 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930801.1 protein_id gnl|my_center|LOCUS_00550 46758 48071 gene locus_tag LOCUS_00560 gene ectB 46758 48071 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063970.1 protein_id gnl|my_center|LOCUS_00560 48068 48466 gene locus_tag LOCUS_00570 48068 48466 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464385.1 protein_id gnl|my_center|LOCUS_00570 48711 50264 gene locus_tag LOCUS_00580 gene asnB 48711 50264 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060813.1 protein_id gnl|my_center|LOCUS_00580 50598 53213 gene locus_tag LOCUS_00590 50598 53213 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204437144.1 protein_id gnl|my_center|LOCUS_00590 53763 53221 gene locus_tag LOCUS_00600 gene cdhB 53763 53221 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877317.1 protein_id gnl|my_center|LOCUS_00600 56341 53888 gene locus_tag LOCUS_00610 56341 53888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 56817 56497 gene locus_tag LOCUS_00620 56817 56497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 57100 56822 gene locus_tag LOCUS_00630 57100 56822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 58498 57182 gene locus_tag LOCUS_00640 58498 57182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 58967 58563 gene locus_tag LOCUS_00650 58967 58563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 59177 58968 gene locus_tag LOCUS_00660 59177 58968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 60329 59232 gene locus_tag LOCUS_00670 60329 59232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 62690 60336 gene locus_tag LOCUS_00680 gene cdhA 62690 60336 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061124.1 protein_id gnl|my_center|LOCUS_00680 63289 62918 gene locus_tag LOCUS_00690 63289 62918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 64123 63446 gene locus_tag LOCUS_00700 64123 63446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 64533 64120 gene locus_tag LOCUS_00710 64533 64120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 64748 64542 gene locus_tag LOCUS_00720 64748 64542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 64868 65527 gene locus_tag LOCUS_00730 64868 65527 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_00730 65538 66230 gene locus_tag LOCUS_00740 65538 66230 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065118.1 protein_id gnl|my_center|LOCUS_00740 68528 66471 gene locus_tag LOCUS_00750 68528 66471 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022481.1 protein_id gnl|my_center|LOCUS_00750 68578 69648 gene locus_tag LOCUS_00760 gene amrS 68578 69648 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879767.1 protein_id gnl|my_center|LOCUS_00760 70735 69668 gene locus_tag LOCUS_00770 70735 69668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 72170 70887 gene locus_tag LOCUS_00780 gene eno 72170 70887 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065179.1 protein_id gnl|my_center|LOCUS_00780 72284 73933 gene locus_tag LOCUS_00790 gene serA 72284 73933 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020641.1 protein_id gnl|my_center|LOCUS_00790 73958 74311 gene locus_tag LOCUS_00800 73958 74311 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875662.1 protein_id gnl|my_center|LOCUS_00800 74479 74934 gene locus_tag LOCUS_00810 74479 74934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 75613 74939 gene locus_tag LOCUS_00820 gene pyrH 75613 74939 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879534.1 protein_id gnl|my_center|LOCUS_00820 75669 75854 gene locus_tag LOCUS_00830 75669 75854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 75854 76522 gene locus_tag LOCUS_00840 75854 76522 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762274.1 protein_id gnl|my_center|LOCUS_00840 76639 76565 gene locus_tag LOCUS_t00020 76639 76565 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 78561 76708 gene locus_tag LOCUS_00850 78561 76708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 78644 79714 gene locus_tag LOCUS_00860 78644 79714 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250274.1 protein_id gnl|my_center|LOCUS_00860 >Feature sequence002 491 964 gene locus_tag LOCUS_00870 491 964 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878133.1 protein_id gnl|my_center|LOCUS_00870 961 1968 gene locus_tag LOCUS_00880 gene argC 961 1968 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065747.1 protein_id gnl|my_center|LOCUS_00880 2051 2668 gene locus_tag LOCUS_00890 2051 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 4832 2715 gene locus_tag LOCUS_00900 4832 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 6331 4835 gene locus_tag LOCUS_00910 6331 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 7063 6485 gene locus_tag LOCUS_00920 7063 6485 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868022.1 protein_id gnl|my_center|LOCUS_00920 7561 7091 gene locus_tag LOCUS_00930 7561 7091 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249685.1 protein_id gnl|my_center|LOCUS_00930 7736 7515 gene locus_tag LOCUS_00940 7736 7515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 9059 7953 gene locus_tag LOCUS_00950 9059 7953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 9391 9164 gene locus_tag LOCUS_00960 9391 9164 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048048124.1 protein_id gnl|my_center|LOCUS_00960 9627 9836 gene locus_tag LOCUS_00970 9627 9836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 9896 10135 gene locus_tag LOCUS_00980 9896 10135 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_00980 10184 10522 gene locus_tag LOCUS_00990 10184 10522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 11812 10916 gene locus_tag LOCUS_01000 11812 10916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 13683 12034 gene locus_tag LOCUS_01010 13683 12034 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986602.1 protein_id gnl|my_center|LOCUS_01010 15055 14228 gene locus_tag LOCUS_01020 15055 14228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 15214 15092 gene locus_tag LOCUS_01030 15214 15092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 16097 15201 gene locus_tag LOCUS_01040 16097 15201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 16237 16094 gene locus_tag LOCUS_01050 16237 16094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 17598 16267 gene locus_tag LOCUS_01060 17598 16267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 18173 17595 gene locus_tag LOCUS_01070 18173 17595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 19732 18230 gene locus_tag LOCUS_01080 19732 18230 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021937.1 protein_id gnl|my_center|LOCUS_01080 20635 19781 gene locus_tag LOCUS_01090 20635 19781 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024526.1 protein_id gnl|my_center|LOCUS_01090 22098 20770 gene locus_tag LOCUS_01100 22098 20770 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598734.1 protein_id gnl|my_center|LOCUS_01100 25633 22253 gene locus_tag LOCUS_01110 gene polC 25633 22253 CDS product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879218.1 protein_id gnl|my_center|LOCUS_01110 27128 25659 gene locus_tag LOCUS_01120 27128 25659 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060924.1 protein_id gnl|my_center|LOCUS_01120 27429 28136 gene locus_tag LOCUS_01130 27429 28136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 28356 28511 gene locus_tag LOCUS_01140 28356 28511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 28894 28622 gene locus_tag LOCUS_01150 28894 28622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 29140 28970 gene locus_tag LOCUS_01160 29140 28970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 30086 29301 gene locus_tag LOCUS_01170 30086 29301 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020876.1 protein_id gnl|my_center|LOCUS_01170 31803 30112 gene locus_tag LOCUS_01180 31803 30112 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877166.1 protein_id gnl|my_center|LOCUS_01180 33130 31832 gene locus_tag LOCUS_01190 33130 31832 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020878.1 protein_id gnl|my_center|LOCUS_01190 33565 33152 gene locus_tag LOCUS_01200 33565 33152 CDS product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020879.1 protein_id gnl|my_center|LOCUS_01200 33687 34514 gene locus_tag LOCUS_01210 33687 34514 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024467.1 protein_id gnl|my_center|LOCUS_01210 36799 34511 gene locus_tag LOCUS_01220 36799 34511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 36845 37438 gene locus_tag LOCUS_01230 36845 37438 CDS product NAAT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871201.1 protein_id gnl|my_center|LOCUS_01230 37495 37570 gene locus_tag LOCUS_t00030 37495 37570 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 38991 37600 gene locus_tag LOCUS_01240 38991 37600 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066507.1 protein_id gnl|my_center|LOCUS_01240 39069 40715 gene locus_tag LOCUS_01250 39069 40715 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022420.1 protein_id gnl|my_center|LOCUS_01250 41536 40871 gene locus_tag LOCUS_01260 41536 40871 CDS product DUF106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021131.1 protein_id gnl|my_center|LOCUS_01260 42101 41625 gene locus_tag LOCUS_01270 42101 41625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 44072 42192 gene locus_tag LOCUS_01280 44072 42192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 44582 44193 gene locus_tag LOCUS_01290 44582 44193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 44900 45181 gene locus_tag LOCUS_01300 44900 45181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 45214 47373 gene locus_tag LOCUS_01310 45214 47373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 47570 48649 gene locus_tag LOCUS_01320 47570 48649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 48780 49655 gene locus_tag LOCUS_01330 48780 49655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 49857 50579 gene locus_tag LOCUS_01340 49857 50579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 50676 51761 gene locus_tag LOCUS_01350 gene bcbE 50676 51761 CDS product bacillibactin exporter BcbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886509.1 protein_id gnl|my_center|LOCUS_01350 51772 53112 gene locus_tag LOCUS_01360 51772 53112 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061087.1 protein_id gnl|my_center|LOCUS_01360 53664 53389 gene locus_tag LOCUS_01370 53664 53389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 54188 54409 gene locus_tag LOCUS_01380 54188 54409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 54503 55252 gene locus_tag LOCUS_01390 54503 55252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 55473 56582 gene locus_tag LOCUS_01400 55473 56582 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023987.1 protein_id gnl|my_center|LOCUS_01400 56686 56925 gene locus_tag LOCUS_01410 56686 56925 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_01410 56922 57275 gene locus_tag LOCUS_01420 56922 57275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 57341 58273 gene locus_tag LOCUS_01430 gene ilvE 57341 58273 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061049.1 protein_id gnl|my_center|LOCUS_01430 58439 58771 gene locus_tag LOCUS_01440 58439 58771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 58949 59584 gene locus_tag LOCUS_01450 58949 59584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 59764 60129 gene locus_tag LOCUS_01460 59764 60129 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979628.1 protein_id gnl|my_center|LOCUS_01460 60102 60422 gene locus_tag LOCUS_01470 60102 60422 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868474.1 protein_id gnl|my_center|LOCUS_01470 62029 60458 gene locus_tag LOCUS_01480 62029 60458 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877524.1 protein_id gnl|my_center|LOCUS_01480 62144 63091 gene locus_tag LOCUS_01490 62144 63091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 63414 63893 gene locus_tag LOCUS_01500 63414 63893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 64754 64092 gene locus_tag LOCUS_01510 64754 64092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 65296 65111 gene locus_tag LOCUS_01520 65296 65111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 65535 65750 gene locus_tag LOCUS_01530 65535 65750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 65747 66418 gene locus_tag LOCUS_01540 65747 66418 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_01540 66589 68823 gene locus_tag LOCUS_01550 66589 68823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 68936 69316 gene locus_tag LOCUS_01560 68936 69316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 70691 69321 gene locus_tag LOCUS_01570 70691 69321 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020230.1 protein_id gnl|my_center|LOCUS_01570 70948 70685 gene locus_tag LOCUS_01580 gene purS 70948 70685 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871117.1 protein_id gnl|my_center|LOCUS_01580 72063 71077 gene locus_tag LOCUS_01590 72063 71077 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584064.1 protein_id gnl|my_center|LOCUS_01590 72310 72858 gene locus_tag LOCUS_01600 72310 72858 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868483.1 protein_id gnl|my_center|LOCUS_01600 72913 73203 gene locus_tag LOCUS_01610 gene porD 72913 73203 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868479.1 protein_id gnl|my_center|LOCUS_01610 73263 74450 gene locus_tag LOCUS_01620 gene porA 73263 74450 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496445.1 protein_id gnl|my_center|LOCUS_01620 74697 75629 gene locus_tag LOCUS_01630 gene porB 74697 75629 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496444.1 protein_id gnl|my_center|LOCUS_01630 75631 76731 gene locus_tag LOCUS_01640 75631 76731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 77740 76760 gene locus_tag LOCUS_01650 77740 76760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_01650 <79024 77858 gene locus_tag LOCUS_01660 <79024 77858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066007.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA >Feature sequence003 498 1976 gene locus_tag LOCUS_01670 498 1976 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065134.1 protein_id gnl|my_center|LOCUS_01670 2080 2322 gene locus_tag LOCUS_01680 2080 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 2325 2792 gene locus_tag LOCUS_01690 2325 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 2783 4303 gene locus_tag LOCUS_01700 2783 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 4325 5245 gene locus_tag LOCUS_01710 gene uppS 4325 5245 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990666.1 protein_id gnl|my_center|LOCUS_01710 5321 5893 gene locus_tag LOCUS_01720 gene thpR 5321 5893 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250689.1 protein_id gnl|my_center|LOCUS_01720 5899 7296 gene locus_tag LOCUS_01730 gene xseA 5899 7296 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_01730 7410 7730 gene locus_tag LOCUS_01740 7410 7730 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393078.1 protein_id gnl|my_center|LOCUS_01740 7727 7963 gene locus_tag LOCUS_01750 7727 7963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 8045 8281 gene locus_tag LOCUS_01760 8045 8281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 11040 8452 gene locus_tag LOCUS_01770 gene mutS 11040 8452 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020572.1 protein_id gnl|my_center|LOCUS_01770 11155 11230 gene locus_tag LOCUS_t00040 11155 11230 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11591 12565 gene locus_tag LOCUS_01780 11591 12565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 12895 12629 gene locus_tag LOCUS_01790 12895 12629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 13064 14545 gene locus_tag LOCUS_01800 13064 14545 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589535.1 protein_id gnl|my_center|LOCUS_01800 14960 14763 gene locus_tag LOCUS_01810 14960 14763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 15189 14929 gene locus_tag LOCUS_01820 15189 14929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 15952 15575 gene locus_tag LOCUS_01830 15952 15575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 16219 15956 gene locus_tag LOCUS_01840 16219 15956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 18003 16276 gene locus_tag LOCUS_01850 18003 16276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 18256 17978 gene locus_tag LOCUS_01860 18256 17978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 18960 18220 gene locus_tag LOCUS_01870 18960 18220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 19182 18970 gene locus_tag LOCUS_01880 19182 18970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 19805 19218 gene locus_tag LOCUS_01890 19805 19218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 20205 19798 gene locus_tag LOCUS_01900 20205 19798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 20444 20208 gene locus_tag LOCUS_01910 20444 20208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 20662 20444 gene locus_tag LOCUS_01920 20662 20444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 20684 20783 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21574 21152 gene locus_tag LOCUS_01930 21574 21152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 22020 21595 gene locus_tag LOCUS_01940 22020 21595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 23165 22038 gene locus_tag LOCUS_01950 23165 22038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 23626 23180 gene locus_tag LOCUS_01960 23626 23180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 23706 23843 gene locus_tag LOCUS_01970 23706 23843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 23861 24049 gene locus_tag LOCUS_01980 23861 24049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 24052 24573 gene locus_tag LOCUS_01990 24052 24573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 24724 25578 gene locus_tag LOCUS_02000 24724 25578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 25852 26169 gene locus_tag LOCUS_02010 25852 26169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 26993 26775 gene locus_tag LOCUS_02020 26993 26775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 27214 27002 gene locus_tag LOCUS_02030 27214 27002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 27473 27348 gene locus_tag LOCUS_02040 27473 27348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 28673 27615 gene locus_tag LOCUS_02050 28673 27615 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135390550.1 protein_id gnl|my_center|LOCUS_02050 28788 28717 gene locus_tag LOCUS_t00050 28788 28717 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 28867 29772 gene locus_tag LOCUS_02060 28867 29772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 29783 30724 gene locus_tag LOCUS_02070 29783 30724 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877868.1 protein_id gnl|my_center|LOCUS_02070 32217 30778 gene locus_tag LOCUS_02080 32217 30778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 35752 32996 gene locus_tag LOCUS_02090 35752 32996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 36754 35834 gene locus_tag LOCUS_02100 36754 35834 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023430.1 protein_id gnl|my_center|LOCUS_02100 37526 36777 gene locus_tag LOCUS_02110 37526 36777 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436912.1 protein_id gnl|my_center|LOCUS_02110 37642 38628 gene locus_tag LOCUS_02120 gene mptA 37642 38628 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066005.1 protein_id gnl|my_center|LOCUS_02120 38614 38687 gene locus_tag LOCUS_t00060 38614 38687 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 39118 38858 gene locus_tag LOCUS_02130 39118 38858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 42574 39176 gene locus_tag LOCUS_02140 42574 39176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 42726 44081 gene locus_tag LOCUS_02150 42726 44081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 44550 45572 gene locus_tag LOCUS_02160 44550 45572 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256068.1 protein_id gnl|my_center|LOCUS_02160 45565 45942 gene locus_tag LOCUS_02170 45565 45942 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256069.1 protein_id gnl|my_center|LOCUS_02170 46628 45981 gene locus_tag LOCUS_02180 46628 45981 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_02180 47077 46736 gene locus_tag LOCUS_02190 47077 46736 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990651.1 protein_id gnl|my_center|LOCUS_02190 47955 47185 gene locus_tag LOCUS_02200 gene tatC 47955 47185 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023409.1 protein_id gnl|my_center|LOCUS_02200 48008 48754 gene locus_tag LOCUS_02210 gene tatC 48008 48754 CDS product Sec-independent protein translocase TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023410.1 protein_id gnl|my_center|LOCUS_02210 50504 48765 gene locus_tag LOCUS_02220 50504 48765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 50703 51131 gene locus_tag LOCUS_02230 50703 51131 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876762.1 protein_id gnl|my_center|LOCUS_02230 51128 52195 gene locus_tag LOCUS_02240 51128 52195 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869498.1 protein_id gnl|my_center|LOCUS_02240 52197 52802 gene locus_tag LOCUS_02250 52197 52802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 52799 53665 gene locus_tag LOCUS_02260 52799 53665 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_02260 53666 56383 gene locus_tag LOCUS_02270 53666 56383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 56957 56496 gene locus_tag LOCUS_02280 56957 56496 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052747714.1 protein_id gnl|my_center|LOCUS_02280 57195 56941 gene locus_tag LOCUS_02290 57195 56941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 57680 57288 gene locus_tag LOCUS_02300 57680 57288 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545657.1 protein_id gnl|my_center|LOCUS_02300 57984 57667 gene locus_tag LOCUS_02310 57984 57667 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_02310 58096 58551 gene locus_tag LOCUS_02320 58096 58551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 58955 58548 gene locus_tag LOCUS_02330 58955 58548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 59855 59001 gene locus_tag LOCUS_02340 59855 59001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 59954 61264 gene locus_tag LOCUS_02350 gene aspS 59954 61264 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878420.1 protein_id gnl|my_center|LOCUS_02350 61330 62943 gene locus_tag LOCUS_02360 61330 62943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 62973 65144 gene locus_tag LOCUS_02370 gene hdrA 62973 65144 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_02370 66882 65164 gene locus_tag LOCUS_02380 gene ade 66882 65164 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877751.1 protein_id gnl|my_center|LOCUS_02380 68001 67822 gene locus_tag LOCUS_02390 68001 67822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 68204 68013 gene locus_tag LOCUS_02400 68204 68013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 68536 68207 gene locus_tag LOCUS_02410 68536 68207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 >Feature sequence004 280 1116 gene locus_tag LOCUS_02420 280 1116 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020339.1 protein_id gnl|my_center|LOCUS_02420 1113 2165 gene locus_tag LOCUS_02430 1113 2165 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020340.1 protein_id gnl|my_center|LOCUS_02430 2691 2134 gene locus_tag LOCUS_02440 2691 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 2740 3228 gene locus_tag LOCUS_02450 gene amzA 2740 3228 CDS product archaemetzincin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877837.1 protein_id gnl|my_center|LOCUS_02450 3241 3771 gene locus_tag LOCUS_02460 3241 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 4490 3801 gene locus_tag LOCUS_02470 4490 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 4603 5481 gene locus_tag LOCUS_02480 4603 5481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 5430 5723 gene locus_tag LOCUS_02490 5430 5723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 5726 7021 gene locus_tag LOCUS_02500 5726 7021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 7021 7905 gene locus_tag LOCUS_02510 7021 7905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 8200 9423 gene locus_tag LOCUS_02520 8200 9423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 9440 10933 gene locus_tag LOCUS_02530 9440 10933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 11041 11478 gene locus_tag LOCUS_02540 11041 11478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 11560 12210 gene locus_tag LOCUS_02550 11560 12210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 12236 12688 gene locus_tag LOCUS_02560 12236 12688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 12958 13716 gene locus_tag LOCUS_02570 12958 13716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 14597 13782 gene locus_tag LOCUS_02580 14597 13782 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877312.1 protein_id gnl|my_center|LOCUS_02580 15379 14576 gene locus_tag LOCUS_02590 gene cbiQ 15379 14576 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496871.1 protein_id gnl|my_center|LOCUS_02590 15685 15380 gene locus_tag LOCUS_02600 15685 15380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02600 16323 15688 gene locus_tag LOCUS_02610 16323 15688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02610 16547 18226 gene locus_tag LOCUS_02620 16547 18226 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064918.1 protein_id gnl|my_center|LOCUS_02620 19507 18287 gene locus_tag LOCUS_02630 gene hmgA 19507 18287 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249865.1 protein_id gnl|my_center|LOCUS_02630 20491 19559 gene locus_tag LOCUS_02640 20491 19559 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279153.1 protein_id gnl|my_center|LOCUS_02640 20622 21455 gene locus_tag LOCUS_02650 20622 21455 CDS product F420-dependent methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878217.1 protein_id gnl|my_center|LOCUS_02650 21578 21507 gene locus_tag LOCUS_t00070 21578 21507 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 21740 22105 gene locus_tag LOCUS_02660 21740 22105 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064993.1 protein_id gnl|my_center|LOCUS_02660 22102 22941 gene locus_tag LOCUS_02670 22102 22941 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876505.1 protein_id gnl|my_center|LOCUS_02670 22997 23260 gene locus_tag LOCUS_02680 22997 23260 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023444.1 protein_id gnl|my_center|LOCUS_02680 23472 24923 gene locus_tag LOCUS_02690 23472 24923 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023357.1 protein_id gnl|my_center|LOCUS_02690 25169 24939 gene locus_tag LOCUS_02700 25169 24939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 25568 25233 gene locus_tag LOCUS_02710 25568 25233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 26159 25827 gene locus_tag LOCUS_02720 26159 25827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 27879 26281 gene locus_tag LOCUS_02730 27879 26281 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052292216.1 protein_id gnl|my_center|LOCUS_02730 28336 27887 gene locus_tag LOCUS_02740 28336 27887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 28451 28879 gene locus_tag LOCUS_02750 28451 28879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 28876 30219 gene locus_tag LOCUS_02760 gene cfbE 28876 30219 CDS product coenzyme F430 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023538.1 protein_id gnl|my_center|LOCUS_02760 30735 30289 gene locus_tag LOCUS_02770 30735 30289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 30929 30696 gene locus_tag LOCUS_02780 30929 30696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 31028 32170 gene locus_tag LOCUS_02790 gene cfbD 31028 32170 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023536.1 protein_id gnl|my_center|LOCUS_02790 32248 33222 gene locus_tag LOCUS_02800 gene ala 32248 33222 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061064.1 protein_id gnl|my_center|LOCUS_02800 33415 34146 gene locus_tag LOCUS_02810 gene cobA 33415 34146 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022972.1 protein_id gnl|my_center|LOCUS_02810 34181 34951 gene locus_tag LOCUS_02820 34181 34951 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022973.1 protein_id gnl|my_center|LOCUS_02820 35012 36130 gene locus_tag LOCUS_02830 gene fni 35012 36130 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020653.1 protein_id gnl|my_center|LOCUS_02830 39982 36155 gene locus_tag LOCUS_02840 39982 36155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 40063 41322 gene locus_tag LOCUS_02850 40063 41322 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064356.1 protein_id gnl|my_center|LOCUS_02850 41312 41638 gene locus_tag LOCUS_02860 41312 41638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 41661 42527 gene locus_tag LOCUS_02870 41661 42527 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148183444.1 protein_id gnl|my_center|LOCUS_02870 42607 43287 gene locus_tag LOCUS_02880 42607 43287 CDS product winged helix-turn-helix domain-containing protein/riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048169713.1 protein_id gnl|my_center|LOCUS_02880 43295 44017 gene locus_tag LOCUS_02890 gene ribB 43295 44017 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020597.1 protein_id gnl|my_center|LOCUS_02890 44454 44233 gene locus_tag LOCUS_02900 44454 44233 CDS product UPF0058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902916.1 protein_id gnl|my_center|LOCUS_02900 44578 44649 gene locus_tag LOCUS_t00080 44578 44649 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 44661 46166 gene locus_tag LOCUS_02910 gene proS 44661 46166 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023782.1 protein_id gnl|my_center|LOCUS_02910 46213 47334 gene locus_tag LOCUS_02920 46213 47334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 47347 48195 gene locus_tag LOCUS_02930 47347 48195 CDS product A24 family peptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020568.1 protein_id gnl|my_center|LOCUS_02930 48369 48208 gene locus_tag LOCUS_02940 48369 48208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 48973 48518 gene locus_tag LOCUS_02950 48973 48518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 49298 49092 gene locus_tag LOCUS_02960 49298 49092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 49971 49315 gene locus_tag LOCUS_02970 49971 49315 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020593.1 protein_id gnl|my_center|LOCUS_02970 50543 49995 gene locus_tag LOCUS_02980 50543 49995 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020937.1 protein_id gnl|my_center|LOCUS_02980 51389 50547 gene locus_tag LOCUS_02990 51389 50547 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020938.1 protein_id gnl|my_center|LOCUS_02990 51682 51359 gene locus_tag LOCUS_03000 gene eif1A 51682 51359 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064992.1 protein_id gnl|my_center|LOCUS_03000 51847 52551 gene locus_tag LOCUS_03010 51847 52551 CDS product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878677.1 protein_id gnl|my_center|LOCUS_03010 52593 52925 gene locus_tag LOCUS_03020 52593 52925 CDS product DUF2073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021399.1 protein_id gnl|my_center|LOCUS_03020 52975 53286 gene locus_tag LOCUS_03030 52975 53286 CDS product Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066022.1 protein_id gnl|my_center|LOCUS_03030 53848 53354 gene locus_tag LOCUS_03040 53848 53354 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064945.1 protein_id gnl|my_center|LOCUS_03040 54854 53838 gene locus_tag LOCUS_03050 gene twy1 54854 53838 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020099.1 protein_id gnl|my_center|LOCUS_03050 55227 54823 gene locus_tag LOCUS_03060 55227 54823 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020302.1 protein_id gnl|my_center|LOCUS_03060 55277 55738 gene locus_tag LOCUS_03070 55277 55738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 55799 56830 gene locus_tag LOCUS_03080 55799 56830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 56858 57940 gene locus_tag LOCUS_03090 56858 57940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 58973 57969 gene locus_tag LOCUS_03100 58973 57969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 59228 59725 gene locus_tag LOCUS_03110 59228 59725 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880077.1 protein_id gnl|my_center|LOCUS_03110 61134 60046 gene locus_tag LOCUS_03120 61134 60046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876041.1 protein_id gnl|my_center|LOCUS_03120 61340 61792 gene locus_tag LOCUS_03130 61340 61792 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879882.1 protein_id gnl|my_center|LOCUS_03130 61927 62196 gene locus_tag LOCUS_03140 61927 62196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 62211 63914 gene locus_tag LOCUS_03150 62211 63914 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869281.1 protein_id gnl|my_center|LOCUS_03150 64995 63916 gene locus_tag LOCUS_03160 gene hisC 64995 63916 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064817.1 protein_id gnl|my_center|LOCUS_03160 65080 65334 gene locus_tag LOCUS_03170 65080 65334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 >Feature sequence005 1984 581 gene locus_tag LOCUS_03180 gene cfbB 1984 581 CDS product Ni-sirohydrochlorin a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023534.1 protein_id gnl|my_center|LOCUS_03180 2105 2281 gene locus_tag LOCUS_03190 2105 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 2289 3149 gene locus_tag LOCUS_03200 2289 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 3228 3989 gene locus_tag LOCUS_03210 3228 3989 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867167.1 protein_id gnl|my_center|LOCUS_03210 3986 4777 gene locus_tag LOCUS_03220 3986 4777 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013747453.1 protein_id gnl|my_center|LOCUS_03220 7458 4927 gene locus_tag LOCUS_03230 7458 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 7831 7460 gene locus_tag LOCUS_03240 7831 7460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 8625 7987 gene locus_tag LOCUS_03250 8625 7987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 8704 9450 gene locus_tag LOCUS_03260 gene pyrE 8704 9450 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877462.1 protein_id gnl|my_center|LOCUS_03260 9435 9686 gene locus_tag LOCUS_03270 9435 9686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 9652 9816 gene locus_tag LOCUS_03280 9652 9816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 9820 10029 gene locus_tag LOCUS_03290 9820 10029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 10053 10619 gene locus_tag LOCUS_03300 gene radC 10053 10619 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941054.1 protein_id gnl|my_center|LOCUS_03300 10621 12462 gene locus_tag LOCUS_03310 10621 12462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 12464 12643 gene locus_tag LOCUS_03320 12464 12643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 12672 13016 gene locus_tag LOCUS_03330 12672 13016 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229003.1 protein_id gnl|my_center|LOCUS_03330 13009 13407 gene locus_tag LOCUS_03340 13009 13407 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012349870.1 protein_id gnl|my_center|LOCUS_03340 13469 15442 gene locus_tag LOCUS_03350 13469 15442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 16129 15557 gene locus_tag LOCUS_03360 16129 15557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249130.1 protein_id gnl|my_center|LOCUS_03360 16212 16505 gene locus_tag LOCUS_03370 16212 16505 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_03370 16493 16816 gene locus_tag LOCUS_03380 gene mnhG 16493 16816 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249571.1 protein_id gnl|my_center|LOCUS_03380 16813 17319 gene locus_tag LOCUS_03390 16813 17319 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867824.1 protein_id gnl|my_center|LOCUS_03390 17380 17625 gene locus_tag LOCUS_03400 17380 17625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 17622 18152 gene locus_tag LOCUS_03410 17622 18152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03410 18215 18709 gene locus_tag LOCUS_03420 18215 18709 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328225.1 protein_id gnl|my_center|LOCUS_03420 18712 19092 gene locus_tag LOCUS_03430 18712 19092 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_03430 19300 20832 gene locus_tag LOCUS_03440 19300 20832 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389325.1 protein_id gnl|my_center|LOCUS_03440 20834 22393 gene locus_tag LOCUS_03450 20834 22393 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242829.1 protein_id gnl|my_center|LOCUS_03450 22390 22626 gene locus_tag LOCUS_03460 22390 22626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 22642 24492 gene locus_tag LOCUS_03470 22642 24492 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967805.1 protein_id gnl|my_center|LOCUS_03470 24489 25988 gene locus_tag LOCUS_03480 24489 25988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 26053 26319 gene locus_tag LOCUS_03490 26053 26319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 27131 26430 gene locus_tag LOCUS_03500 27131 26430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 27590 27147 gene locus_tag LOCUS_03510 27590 27147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 28326 28559 gene locus_tag LOCUS_03520 28326 28559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 28511 28654 gene locus_tag LOCUS_03530 28511 28654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 28696 29004 gene locus_tag LOCUS_03540 28696 29004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 29010 30401 gene locus_tag LOCUS_03550 29010 30401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 30767 30420 gene locus_tag LOCUS_03560 30767 30420 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259069.1 protein_id gnl|my_center|LOCUS_03560 30921 30721 gene locus_tag LOCUS_03570 30921 30721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 32016 31030 gene locus_tag LOCUS_03580 32016 31030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 32431 33456 gene locus_tag LOCUS_03590 32431 33456 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024396.1 protein_id gnl|my_center|LOCUS_03590 33453 35426 gene locus_tag LOCUS_03600 gene hdrA 33453 35426 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_03600 35748 37256 gene locus_tag LOCUS_03610 35748 37256 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_03610 37256 39346 gene locus_tag LOCUS_03620 gene nuoL 37256 39346 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392500.1 protein_id gnl|my_center|LOCUS_03620 39435 40946 gene locus_tag LOCUS_03630 39435 40946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 41210 42595 gene locus_tag LOCUS_03640 41210 42595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 42608 42778 gene locus_tag LOCUS_03650 42608 42778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 42964 42701 gene locus_tag LOCUS_03660 42964 42701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 43299 43571 gene locus_tag LOCUS_03670 43299 43571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 43625 43897 gene locus_tag LOCUS_03680 43625 43897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 43981 44187 gene locus_tag LOCUS_03690 43981 44187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 44180 46003 gene locus_tag LOCUS_03700 44180 46003 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396787.1 protein_id gnl|my_center|LOCUS_03700 46318 47208 gene locus_tag LOCUS_03710 46318 47208 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877341.1 protein_id gnl|my_center|LOCUS_03710 47216 48328 gene locus_tag LOCUS_03720 47216 48328 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705134.1 protein_id gnl|my_center|LOCUS_03720 48393 49088 gene locus_tag LOCUS_03730 48393 49088 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250671.1 protein_id gnl|my_center|LOCUS_03730 49530 49123 gene locus_tag LOCUS_03740 49530 49123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 49913 50140 gene locus_tag LOCUS_03750 49913 50140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 50759 50953 gene locus_tag LOCUS_03760 50759 50953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 52150 51158 gene locus_tag LOCUS_03770 52150 51158 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020197.1 protein_id gnl|my_center|LOCUS_03770 52237 54564 gene locus_tag LOCUS_03780 gene purL 52237 54564 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879433.1 protein_id gnl|my_center|LOCUS_03780 54565 55800 gene locus_tag LOCUS_03790 54565 55800 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014128488.1 protein_id gnl|my_center|LOCUS_03790 55801 56427 gene locus_tag LOCUS_03800 55801 56427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 56443 57387 gene locus_tag LOCUS_03810 56443 57387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 57606 57821 gene locus_tag LOCUS_03820 57606 57821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 57800 58042 gene locus_tag LOCUS_03830 57800 58042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 58755 58132 gene locus_tag LOCUS_03840 58755 58132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 60102 58810 gene locus_tag LOCUS_03850 gene hisS 60102 58810 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020981.1 protein_id gnl|my_center|LOCUS_03850 60228 60656 gene locus_tag LOCUS_03860 60228 60656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 60641 61042 gene locus_tag LOCUS_03870 60641 61042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 61039 61788 gene locus_tag LOCUS_03880 61039 61788 CDS product HisA/HisF-related TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024313.1 protein_id gnl|my_center|LOCUS_03880 62357 61947 gene locus_tag LOCUS_03890 62357 61947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 63639 62335 gene locus_tag LOCUS_03900 63639 62335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 >Feature sequence006 403 924 gene locus_tag LOCUS_03910 403 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 968 1150 gene locus_tag LOCUS_03920 968 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 1286 1113 gene locus_tag LOCUS_03930 1286 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 2088 1921 gene locus_tag LOCUS_03940 2088 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 2913 2356 gene locus_tag LOCUS_03950 gene udg 2913 2356 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147255.1 protein_id gnl|my_center|LOCUS_03950 3062 3217 gene locus_tag LOCUS_03960 3062 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 3431 3288 gene locus_tag LOCUS_03970 3431 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 4210 3476 gene locus_tag LOCUS_03980 4210 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 4940 4212 gene locus_tag LOCUS_03990 4940 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 5603 4959 gene locus_tag LOCUS_04000 5603 4959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 6035 5625 gene locus_tag LOCUS_04010 6035 5625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 6216 6049 gene locus_tag LOCUS_04020 6216 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 6390 6220 gene locus_tag LOCUS_04030 6390 6220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 6917 7819 gene locus_tag LOCUS_04040 6917 7819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 7859 8479 gene locus_tag LOCUS_04050 7859 8479 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768286.1 protein_id gnl|my_center|LOCUS_04050 9174 8494 gene locus_tag LOCUS_04060 9174 8494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545105.1 protein_id gnl|my_center|LOCUS_04060 9836 9171 gene locus_tag LOCUS_04070 9836 9171 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080614.1 protein_id gnl|my_center|LOCUS_04070 9906 10535 gene locus_tag LOCUS_04080 9906 10535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 10560 10940 gene locus_tag LOCUS_04090 10560 10940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 13206 11170 gene locus_tag LOCUS_04100 13206 11170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 13675 14553 gene locus_tag LOCUS_04110 13675 14553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 15512 15114 gene locus_tag LOCUS_04120 15512 15114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 16435 15509 gene locus_tag LOCUS_04130 16435 15509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 17450 16734 gene locus_tag LOCUS_04140 17450 16734 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024314.1 protein_id gnl|my_center|LOCUS_04140 17647 17456 gene locus_tag LOCUS_04150 17647 17456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 18007 17654 gene locus_tag LOCUS_04160 18007 17654 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012965103.1 protein_id gnl|my_center|LOCUS_04160 18726 18037 gene locus_tag LOCUS_04170 gene rpiA 18726 18037 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021687.1 protein_id gnl|my_center|LOCUS_04170 18821 20299 gene locus_tag LOCUS_04180 18821 20299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 21113 20352 gene locus_tag LOCUS_04190 21113 20352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 22630 21305 gene locus_tag LOCUS_04200 22630 21305 CDS product 7,8-dihydro-6-hydroxymethylpterin dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870124.1 protein_id gnl|my_center|LOCUS_04200 22842 23591 gene locus_tag LOCUS_04210 22842 23591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 23588 23746 gene locus_tag LOCUS_04220 23588 23746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 25725 23896 gene locus_tag LOCUS_04230 25725 23896 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023139.1 protein_id gnl|my_center|LOCUS_04230 25886 26440 gene locus_tag LOCUS_04240 25886 26440 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892795.1 protein_id gnl|my_center|LOCUS_04240 27437 26640 gene locus_tag LOCUS_04250 27437 26640 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020652.1 protein_id gnl|my_center|LOCUS_04250 27527 30361 gene locus_tag LOCUS_04260 27527 30361 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024289.1 protein_id gnl|my_center|LOCUS_04260 31053 30370 gene locus_tag LOCUS_04270 31053 30370 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022401.1 protein_id gnl|my_center|LOCUS_04270 31144 32640 gene locus_tag LOCUS_04280 31144 32640 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065053.1 protein_id gnl|my_center|LOCUS_04280 33097 32789 gene locus_tag LOCUS_04290 33097 32789 CDS product DUF424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868107.1 protein_id gnl|my_center|LOCUS_04290 33159 33233 gene locus_tag LOCUS_t00090 33159 33233 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 33289 33690 gene locus_tag LOCUS_04300 33289 33690 CDS product methanogenesis marker 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065869.1 protein_id gnl|my_center|LOCUS_04300 33674 33976 gene locus_tag LOCUS_04310 33674 33976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 33969 35180 gene locus_tag LOCUS_04320 33969 35180 CDS product bifunctional 5,6,7,8-tetrahydromethanopterin hydro-lyase/3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024481.1 protein_id gnl|my_center|LOCUS_04320 36064 35291 gene locus_tag LOCUS_04330 36064 35291 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249165.1 protein_id gnl|my_center|LOCUS_04330 36194 36778 gene locus_tag LOCUS_04340 gene hisB 36194 36778 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020277.1 protein_id gnl|my_center|LOCUS_04340 37192 37443 gene locus_tag LOCUS_04350 37192 37443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 37622 38680 gene locus_tag LOCUS_04360 37622 38680 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064821.1 protein_id gnl|my_center|LOCUS_04360 38751 39143 gene locus_tag LOCUS_04370 38751 39143 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023936.1 protein_id gnl|my_center|LOCUS_04370 39288 39509 gene locus_tag LOCUS_04380 39288 39509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 39521 39814 gene locus_tag LOCUS_04390 39521 39814 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249168.1 protein_id gnl|my_center|LOCUS_04390 39943 40284 gene locus_tag LOCUS_04400 39943 40284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04400 40265 40486 gene locus_tag LOCUS_04410 40265 40486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 40587 40937 gene locus_tag LOCUS_04420 40587 40937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 41702 41136 gene locus_tag LOCUS_04430 41702 41136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 43645 41732 gene locus_tag LOCUS_04440 gene acs 43645 41732 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978720.1 protein_id gnl|my_center|LOCUS_04440 44285 43800 gene locus_tag LOCUS_04450 44285 43800 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880818.1 protein_id gnl|my_center|LOCUS_04450 44883 45239 gene locus_tag LOCUS_04460 44883 45239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 45145 47175 gene locus_tag LOCUS_04470 45145 47175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 47248 47787 gene locus_tag LOCUS_04480 47248 47787 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042684410.1 protein_id gnl|my_center|LOCUS_04480 48250 48789 gene locus_tag LOCUS_04490 48250 48789 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042684410.1 protein_id gnl|my_center|LOCUS_04490 48843 49841 gene locus_tag LOCUS_04500 48843 49841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 50059 50421 gene locus_tag LOCUS_04510 50059 50421 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249583.1 protein_id gnl|my_center|LOCUS_04510 50481 51566 gene locus_tag LOCUS_04520 50481 51566 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878541.1 protein_id gnl|my_center|LOCUS_04520 51572 53662 gene locus_tag LOCUS_04530 51572 53662 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878540.1 protein_id gnl|my_center|LOCUS_04530 53681 54367 gene locus_tag LOCUS_04540 53681 54367 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012940758.1 protein_id gnl|my_center|LOCUS_04540 54434 55090 gene locus_tag LOCUS_04550 54434 55090 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012940758.1 protein_id gnl|my_center|LOCUS_04550 55108 55749 gene locus_tag LOCUS_04560 55108 55749 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774235.1 protein_id gnl|my_center|LOCUS_04560 55751 56260 gene locus_tag LOCUS_04570 55751 56260 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359122.1 protein_id gnl|my_center|LOCUS_04570 56321 57661 gene locus_tag LOCUS_04580 56321 57661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 57661 59595 gene locus_tag LOCUS_04590 57661 59595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 61624 59873 gene locus_tag LOCUS_04600 61624 59873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 62531 61692 gene locus_tag LOCUS_04610 62531 61692 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878537.1 protein_id gnl|my_center|LOCUS_04610 62726 63421 gene locus_tag LOCUS_04620 gene cofC 62726 63421 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021502.1 protein_id gnl|my_center|LOCUS_04620 >Feature sequence007 1769 516 gene locus_tag LOCUS_04630 gene dnaG 1769 516 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879392.1 protein_id gnl|my_center|LOCUS_04630 1861 2826 gene locus_tag LOCUS_04640 gene guaA 1861 2826 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877764.1 protein_id gnl|my_center|LOCUS_04640 2902 2829 gene locus_tag LOCUS_t00100 2902 2829 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2981 4183 gene locus_tag LOCUS_04650 gene argJ 2981 4183 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023478.1 protein_id gnl|my_center|LOCUS_04650 4830 4204 gene locus_tag LOCUS_04660 4830 4204 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022469.1 protein_id gnl|my_center|LOCUS_04660 4921 6213 gene locus_tag LOCUS_04670 4921 6213 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064444.1 protein_id gnl|my_center|LOCUS_04670 6464 7941 gene locus_tag LOCUS_r00010 6464 7941 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 8047 8118 gene locus_tag LOCUS_t00110 8047 8118 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 8273 11182 gene locus_tag LOCUS_r00020 8273 11182 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 11293 11365 gene locus_tag LOCUS_t00120 11293 11365 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 12437 11373 gene locus_tag LOCUS_04680 12437 11373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 12567 12492 gene locus_tag LOCUS_t00130 12567 12492 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12660 13655 gene locus_tag LOCUS_04690 12660 13655 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021005.1 protein_id gnl|my_center|LOCUS_04690 13721 14386 gene locus_tag LOCUS_04700 13721 14386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 15464 14445 gene locus_tag LOCUS_04710 15464 14445 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020066.1 protein_id gnl|my_center|LOCUS_04710 15680 15970 gene locus_tag LOCUS_04720 15680 15970 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020862.1 protein_id gnl|my_center|LOCUS_04720 15998 16771 gene locus_tag LOCUS_04730 15998 16771 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_04730 16768 17529 gene locus_tag LOCUS_04740 16768 17529 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871169.1 protein_id gnl|my_center|LOCUS_04740 18310 17585 gene locus_tag LOCUS_04750 18310 17585 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546420.1 protein_id gnl|my_center|LOCUS_04750 18847 19965 gene locus_tag LOCUS_04760 18847 19965 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267479.1 protein_id gnl|my_center|LOCUS_04760 20854 19946 gene locus_tag LOCUS_04770 20854 19946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 21510 20977 gene locus_tag LOCUS_04780 21510 20977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 21571 23118 gene locus_tag LOCUS_04790 21571 23118 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868291.1 protein_id gnl|my_center|LOCUS_04790 23198 24682 gene locus_tag LOCUS_04800 23198 24682 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_04800 26228 24714 gene locus_tag LOCUS_04810 26228 24714 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868288.1 protein_id gnl|my_center|LOCUS_04810 27747 26260 gene locus_tag LOCUS_04820 27747 26260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 29027 27900 gene locus_tag LOCUS_04830 29027 27900 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021498.1 protein_id gnl|my_center|LOCUS_04830 31293 29359 gene locus_tag LOCUS_04840 31293 29359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 32249 31290 gene locus_tag LOCUS_04850 32249 31290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 32489 33643 gene locus_tag LOCUS_04860 32489 33643 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868574.1 protein_id gnl|my_center|LOCUS_04860 33640 34542 gene locus_tag LOCUS_04870 33640 34542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 34544 35683 gene locus_tag LOCUS_04880 34544 35683 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582516.1 protein_id gnl|my_center|LOCUS_04880 37708 35795 gene locus_tag LOCUS_04890 37708 35795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 38440 37847 gene locus_tag LOCUS_04900 38440 37847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 40942 38747 gene locus_tag LOCUS_04910 40942 38747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 42567 41785 gene locus_tag LOCUS_04920 42567 41785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 43886 42597 gene locus_tag LOCUS_04930 43886 42597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 45160 43952 gene locus_tag LOCUS_04940 45160 43952 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064633.1 protein_id gnl|my_center|LOCUS_04940 45290 46426 gene locus_tag LOCUS_04950 45290 46426 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816051.1 protein_id gnl|my_center|LOCUS_04950 47794 46508 gene locus_tag LOCUS_04960 47794 46508 CDS product endonuclease Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020688.1 protein_id gnl|my_center|LOCUS_04960 47879 47805 gene locus_tag LOCUS_t00140 47879 47805 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 56489 48057 gene locus_tag LOCUS_04970 56489 48057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 56752 56486 gene locus_tag LOCUS_04980 56752 56486 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064801.1 protein_id gnl|my_center|LOCUS_04980 56974 58479 gene locus_tag LOCUS_04990 56974 58479 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024485.1 protein_id gnl|my_center|LOCUS_04990 59430 58630 gene locus_tag LOCUS_05000 59430 58630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 >Feature sequence008 <1 2547 gene locus_tag LOCUS_05010 <1 2547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023974.1:calcium-translocating P-type ATPase, SERCA-type 2729 3781 gene locus_tag LOCUS_05020 2729 3781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 3921 4070 gene locus_tag LOCUS_05030 3921 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 4024 4236 gene locus_tag LOCUS_05040 4024 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 4607 4404 gene locus_tag LOCUS_05050 4607 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 4759 4604 gene locus_tag LOCUS_05060 4759 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 5014 4763 gene locus_tag LOCUS_05070 5014 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 5789 5445 gene locus_tag LOCUS_05080 5789 5445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 6250 6645 gene locus_tag LOCUS_05090 6250 6645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 7984 6731 gene locus_tag LOCUS_05100 7984 6731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 8171 9181 gene locus_tag LOCUS_05110 8171 9181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391744.1 protein_id gnl|my_center|LOCUS_05110 9191 9442 gene locus_tag LOCUS_05120 9191 9442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 11442 9517 gene locus_tag LOCUS_05130 11442 9517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 12691 11591 gene locus_tag LOCUS_05140 12691 11591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 13865 12720 gene locus_tag LOCUS_05150 13865 12720 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142619.1 protein_id gnl|my_center|LOCUS_05150 14626 13961 gene locus_tag LOCUS_05160 14626 13961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 14742 14891 gene locus_tag LOCUS_05170 14742 14891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 15620 15327 gene locus_tag LOCUS_05180 15620 15327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 19599 15712 gene locus_tag LOCUS_05190 19599 15712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 19665 20525 gene locus_tag LOCUS_05200 19665 20525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 20522 21379 gene locus_tag LOCUS_05210 gene galU 20522 21379 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065994.1 protein_id gnl|my_center|LOCUS_05210 21382 22326 gene locus_tag LOCUS_05220 21382 22326 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229036.1 protein_id gnl|my_center|LOCUS_05220 22331 23593 gene locus_tag LOCUS_05230 22331 23593 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545193.1 protein_id gnl|my_center|LOCUS_05230 23748 24128 gene locus_tag LOCUS_05240 23748 24128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 24175 24489 gene locus_tag LOCUS_05250 24175 24489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 24486 24926 gene locus_tag LOCUS_05260 24486 24926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392404.1 protein_id gnl|my_center|LOCUS_05260 25005 26558 gene locus_tag LOCUS_05270 25005 26558 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021083.1 protein_id gnl|my_center|LOCUS_05270 27381 26596 gene locus_tag LOCUS_05280 27381 26596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 28826 27378 gene locus_tag LOCUS_05290 28826 27378 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_05290 29653 28826 gene locus_tag LOCUS_05300 29653 28826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 30302 29646 gene locus_tag LOCUS_05310 30302 29646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 30962 30315 gene locus_tag LOCUS_05320 30962 30315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 32028 30988 gene locus_tag LOCUS_05330 32028 30988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 33161 32034 gene locus_tag LOCUS_05340 33161 32034 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868579.1 protein_id gnl|my_center|LOCUS_05340 33746 33183 gene locus_tag LOCUS_05350 33746 33183 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167942160.1 protein_id gnl|my_center|LOCUS_05350 34371 33871 gene locus_tag LOCUS_05360 34371 33871 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877830.1 protein_id gnl|my_center|LOCUS_05360 35231 34365 gene locus_tag LOCUS_05370 35231 34365 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980041.1 protein_id gnl|my_center|LOCUS_05370 36221 35232 gene locus_tag LOCUS_05380 gene rfbB 36221 35232 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877832.1 protein_id gnl|my_center|LOCUS_05380 37284 36232 gene locus_tag LOCUS_05390 37284 36232 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868292.1 protein_id gnl|my_center|LOCUS_05390 38041 37382 gene locus_tag LOCUS_05400 38041 37382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 39080 38028 gene locus_tag LOCUS_05410 39080 38028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 39198 39821 gene locus_tag LOCUS_05420 39198 39821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 39818 40795 gene locus_tag LOCUS_05430 39818 40795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 40966 40775 gene locus_tag LOCUS_05440 40966 40775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 41165 40896 gene locus_tag LOCUS_05450 41165 40896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 42501 41137 gene locus_tag LOCUS_05460 42501 41137 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147306.1 protein_id gnl|my_center|LOCUS_05460 43898 42513 gene locus_tag LOCUS_05470 43898 42513 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053756.1 protein_id gnl|my_center|LOCUS_05470 44989 44039 gene locus_tag LOCUS_05480 gene aglG 44989 44039 CDS product glucosyl-dolichyl phosphate glucuronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289272.1 protein_id gnl|my_center|LOCUS_05480 45369 45151 gene locus_tag LOCUS_05490 45369 45151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 46558 45437 gene locus_tag LOCUS_05500 46558 45437 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021469.1 protein_id gnl|my_center|LOCUS_05500 46698 47441 gene locus_tag LOCUS_05510 46698 47441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 47787 50267 gene locus_tag LOCUS_05520 47787 50267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 52022 50484 gene locus_tag LOCUS_05530 52022 50484 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877864.1 protein_id gnl|my_center|LOCUS_05530 53223 52009 gene locus_tag LOCUS_05540 53223 52009 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022374.1 protein_id gnl|my_center|LOCUS_05540 53588 53767 gene locus_tag LOCUS_05550 53588 53767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 53758 54438 gene locus_tag LOCUS_05560 53758 54438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 54482 54961 gene locus_tag LOCUS_05570 54482 54961 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024098.1 protein_id gnl|my_center|LOCUS_05570 55118 55594 gene locus_tag LOCUS_05580 55118 55594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 55807 56610 gene locus_tag LOCUS_05590 55807 56610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 56728 57615 gene locus_tag LOCUS_05600 56728 57615 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942258.1 protein_id gnl|my_center|LOCUS_05600 >Feature sequence009 297 1697 gene locus_tag LOCUS_05610 gene cca 297 1697 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023473.1 protein_id gnl|my_center|LOCUS_05610 3081 1945 gene locus_tag LOCUS_05620 3081 1945 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249334.1 protein_id gnl|my_center|LOCUS_05620 3608 3078 gene locus_tag LOCUS_05630 3608 3078 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870497.1 protein_id gnl|my_center|LOCUS_05630 3636 3788 gene locus_tag LOCUS_05640 3636 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 3766 4083 gene locus_tag LOCUS_05650 3766 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 4264 4349 gene locus_tag LOCUS_t00150 4264 4349 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4401 4829 gene locus_tag LOCUS_05660 4401 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 5828 4875 gene locus_tag LOCUS_05670 5828 4875 CDS product methanogenesis marker 12 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023754.1 protein_id gnl|my_center|LOCUS_05670 6350 5895 gene locus_tag LOCUS_05680 6350 5895 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023592.1 protein_id gnl|my_center|LOCUS_05680 7456 6380 gene locus_tag LOCUS_05690 7456 6380 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023593.1 protein_id gnl|my_center|LOCUS_05690 8358 7453 gene locus_tag LOCUS_05700 8358 7453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 9088 8288 gene locus_tag LOCUS_05710 9088 8288 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020650.1 protein_id gnl|my_center|LOCUS_05710 9753 9100 gene locus_tag LOCUS_05720 gene rpsB 9753 9100 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878629.1 protein_id gnl|my_center|LOCUS_05720 9804 11849 gene locus_tag LOCUS_05730 gene ligA 9804 11849 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_05730 11846 13615 gene locus_tag LOCUS_05740 gene polX 11846 13615 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_05740 14348 13737 gene locus_tag LOCUS_05750 14348 13737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 14827 15030 gene locus_tag LOCUS_05760 14827 15030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 15014 15385 gene locus_tag LOCUS_05770 15014 15385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 15576 15382 gene locus_tag LOCUS_05780 15576 15382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 15835 16119 gene locus_tag LOCUS_05790 15835 16119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 17724 16519 gene locus_tag LOCUS_05800 17724 16519 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020274.1 protein_id gnl|my_center|LOCUS_05800 18274 17783 gene locus_tag LOCUS_05810 18274 17783 CDS product ZPR1 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868148.1 protein_id gnl|my_center|LOCUS_05810 18681 18307 gene locus_tag LOCUS_05820 18681 18307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 18765 20015 gene locus_tag LOCUS_05830 18765 20015 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892607.1 protein_id gnl|my_center|LOCUS_05830 20189 21364 gene locus_tag LOCUS_05840 20189 21364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 21880 21410 gene locus_tag LOCUS_05850 21880 21410 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021922.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05850 24384 22201 gene locus_tag LOCUS_05860 24384 22201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 25933 24374 gene locus_tag LOCUS_05870 25933 24374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 26309 26157 gene locus_tag LOCUS_05880 26309 26157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 26611 26312 gene locus_tag LOCUS_05890 26611 26312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 27661 26771 gene locus_tag LOCUS_05900 27661 26771 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020228.1 protein_id gnl|my_center|LOCUS_05900 29116 27848 gene locus_tag LOCUS_05910 29116 27848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 29354 29100 gene locus_tag LOCUS_05920 29354 29100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 29656 29351 gene locus_tag LOCUS_05930 29656 29351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 30570 29683 gene locus_tag LOCUS_05940 gene dapA 30570 29683 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024349.1 protein_id gnl|my_center|LOCUS_05940 30755 30567 gene locus_tag LOCUS_05950 30755 30567 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878411.1 protein_id gnl|my_center|LOCUS_05950 30985 30758 gene locus_tag LOCUS_05960 30985 30758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 31469 30999 gene locus_tag LOCUS_05970 31469 30999 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020987.1 protein_id gnl|my_center|LOCUS_05970 32787 31519 gene locus_tag LOCUS_05980 32787 31519 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022842.1 protein_id gnl|my_center|LOCUS_05980 32837 33418 gene locus_tag LOCUS_05990 32837 33418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 33415 33786 gene locus_tag LOCUS_06000 gene rplX 33415 33786 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250481.1 protein_id gnl|my_center|LOCUS_06000 34354 33824 gene locus_tag LOCUS_06010 34354 33824 CDS product TIGR00295 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870283.1 protein_id gnl|my_center|LOCUS_06010 34836 34327 gene locus_tag LOCUS_06020 34836 34327 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066543.1 protein_id gnl|my_center|LOCUS_06020 34990 36009 gene locus_tag LOCUS_06030 34990 36009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 37284 36016 gene locus_tag LOCUS_06040 37284 36016 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021461.1 protein_id gnl|my_center|LOCUS_06040 37361 37756 gene locus_tag LOCUS_06050 37361 37756 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868473.1 protein_id gnl|my_center|LOCUS_06050 37723 38040 gene locus_tag LOCUS_06060 37723 38040 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868474.1 protein_id gnl|my_center|LOCUS_06060 38488 38739 gene locus_tag LOCUS_06070 38488 38739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 38913 39155 gene locus_tag LOCUS_06080 38913 39155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 40428 39187 gene locus_tag LOCUS_06090 40428 39187 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870171.1 protein_id gnl|my_center|LOCUS_06090 40919 40431 gene locus_tag LOCUS_06100 40919 40431 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023598.1 protein_id gnl|my_center|LOCUS_06100 41015 42199 gene locus_tag LOCUS_06110 41015 42199 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870834.1 protein_id gnl|my_center|LOCUS_06110 42278 42715 gene locus_tag LOCUS_06120 gene cfbA 42278 42715 CDS product sirohydrochlorin nickelochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870484.1 protein_id gnl|my_center|LOCUS_06120 43695 42745 gene locus_tag LOCUS_06130 gene nifB 43695 42745 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024080.1 protein_id gnl|my_center|LOCUS_06130 43913 44677 gene locus_tag LOCUS_06140 gene sufC 43913 44677 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876773.1 protein_id gnl|my_center|LOCUS_06140 44674 45897 gene locus_tag LOCUS_06150 44674 45897 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876774.1 protein_id gnl|my_center|LOCUS_06150 45936 46454 gene locus_tag LOCUS_06160 45936 46454 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941146.1 protein_id gnl|my_center|LOCUS_06160 46461 47084 gene locus_tag LOCUS_06170 46461 47084 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065789.1 protein_id gnl|my_center|LOCUS_06170 48764 47328 gene locus_tag LOCUS_06180 48764 47328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 49344 48841 gene locus_tag LOCUS_06190 49344 48841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 49694 50260 gene locus_tag LOCUS_06200 gene afpA 49694 50260 CDS product archaeoflavoprotein AfpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870235.1 protein_id gnl|my_center|LOCUS_06200 50692 50438 gene locus_tag LOCUS_06210 50692 50438 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022120.1 protein_id gnl|my_center|LOCUS_06210 51637 50789 gene locus_tag LOCUS_06220 51637 50789 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_06220 >Feature sequence010 782 303 gene locus_tag LOCUS_06230 782 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 2136 892 gene locus_tag LOCUS_06240 gene leuC 2136 892 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868465.1 protein_id gnl|my_center|LOCUS_06240 2435 2178 gene locus_tag LOCUS_06250 2435 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 2511 3113 gene locus_tag LOCUS_06260 gene tmk 2511 3113 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250354.1 protein_id gnl|my_center|LOCUS_06260 3237 3827 gene locus_tag LOCUS_06270 3237 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 3829 7416 gene locus_tag LOCUS_06280 3829 7416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 9639 7465 gene locus_tag LOCUS_06290 9639 7465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 10083 10706 gene locus_tag LOCUS_06300 10083 10706 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080009.1 protein_id gnl|my_center|LOCUS_06300 10965 10801 gene locus_tag LOCUS_06310 10965 10801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 11282 10962 gene locus_tag LOCUS_06320 11282 10962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 11435 12133 gene locus_tag LOCUS_06330 gene nfi 11435 12133 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583138.1 protein_id gnl|my_center|LOCUS_06330 12604 12170 gene locus_tag LOCUS_06340 12604 12170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 12991 12746 gene locus_tag LOCUS_06350 12991 12746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 14716 13127 gene locus_tag LOCUS_06360 gene dop 14716 13127 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_06360 16596 14842 gene locus_tag LOCUS_06370 16596 14842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 18246 16612 gene locus_tag LOCUS_06380 18246 16612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 18362 19396 gene locus_tag LOCUS_06390 18362 19396 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023043.1 protein_id gnl|my_center|LOCUS_06390 19400 20737 gene locus_tag LOCUS_06400 19400 20737 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024460.1 protein_id gnl|my_center|LOCUS_06400 21154 20879 gene locus_tag LOCUS_06410 21154 20879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 21452 21132 gene locus_tag LOCUS_06420 21452 21132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 22507 21524 gene locus_tag LOCUS_06430 gene purM 22507 21524 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066059.1 protein_id gnl|my_center|LOCUS_06430 23805 22645 gene locus_tag LOCUS_06440 23805 22645 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023766.1 protein_id gnl|my_center|LOCUS_06440 23922 26915 gene locus_tag LOCUS_06450 gene ileS 23922 26915 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583781.1 protein_id gnl|my_center|LOCUS_06450 26968 27204 gene locus_tag LOCUS_06460 26968 27204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 27269 27757 gene locus_tag LOCUS_06470 27269 27757 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879909.1 protein_id gnl|my_center|LOCUS_06470 27902 28144 gene locus_tag LOCUS_06480 27902 28144 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250027.1 protein_id gnl|my_center|LOCUS_06480 28153 28320 gene locus_tag LOCUS_06490 28153 28320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 29747 28371 gene locus_tag LOCUS_06500 29747 28371 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876694.1 protein_id gnl|my_center|LOCUS_06500 30432 29884 gene locus_tag LOCUS_06510 30432 29884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 30598 30407 gene locus_tag LOCUS_06520 30598 30407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 30718 32004 gene locus_tag LOCUS_06530 gene lysA 30718 32004 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878303.1 protein_id gnl|my_center|LOCUS_06530 32037 32252 gene locus_tag LOCUS_06540 32037 32252 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393298.1 protein_id gnl|my_center|LOCUS_06540 32471 32292 gene locus_tag LOCUS_06550 32471 32292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 32891 33664 gene locus_tag LOCUS_06560 32891 33664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 33664 34086 gene locus_tag LOCUS_06570 33664 34086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 34110 34649 gene locus_tag LOCUS_06580 34110 34649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 35010 34813 gene locus_tag LOCUS_06590 35010 34813 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 protein_id gnl|my_center|LOCUS_06590 35325 35125 gene locus_tag LOCUS_06600 35325 35125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 36602 35373 gene locus_tag LOCUS_06610 36602 35373 CDS product methanogenesis marker 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877471.1 protein_id gnl|my_center|LOCUS_06610 37065 36610 gene locus_tag LOCUS_06620 37065 36610 CDS product methanogenesis marker 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877470.1 protein_id gnl|my_center|LOCUS_06620 37906 37151 gene locus_tag LOCUS_06630 gene radB 37906 37151 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860416.1 protein_id gnl|my_center|LOCUS_06630 38144 38341 gene locus_tag LOCUS_06640 38144 38341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 38345 38773 gene locus_tag LOCUS_06650 38345 38773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 38798 38956 gene locus_tag LOCUS_06660 38798 38956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 39514 39191 gene locus_tag LOCUS_06670 39514 39191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 39575 39871 gene locus_tag LOCUS_06680 39575 39871 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869744.1 protein_id gnl|my_center|LOCUS_06680 39880 40347 gene locus_tag LOCUS_06690 gene rimI 39880 40347 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066037.1 protein_id gnl|my_center|LOCUS_06690 41960 40353 gene locus_tag LOCUS_06700 gene sepS 41960 40353 CDS product O-phosphoserine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877624.1 protein_id gnl|my_center|LOCUS_06700 42810 42055 gene locus_tag LOCUS_06710 42810 42055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 42881 43888 gene locus_tag LOCUS_06720 42881 43888 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021488.1 protein_id gnl|my_center|LOCUS_06720 44130 44732 gene locus_tag LOCUS_06730 gene coaE 44130 44732 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941181.1 protein_id gnl|my_center|LOCUS_06730 45133 44792 gene locus_tag LOCUS_06740 45133 44792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 46880 45201 gene locus_tag LOCUS_06750 gene arcS 46880 45201 CDS product archaeosine synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024500.1 protein_id gnl|my_center|LOCUS_06750 47119 46967 gene locus_tag LOCUS_06760 47119 46967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 47191 48183 gene locus_tag LOCUS_06770 47191 48183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 48281 48466 gene locus_tag LOCUS_06780 48281 48466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 48454 48672 gene locus_tag LOCUS_06790 48454 48672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 49133 49714 gene locus_tag LOCUS_06800 49133 49714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 >Feature sequence011 1778 441 gene locus_tag LOCUS_06810 1778 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 3114 1762 gene locus_tag LOCUS_06820 3114 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 4916 3117 gene locus_tag LOCUS_06830 4916 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 6350 5427 gene locus_tag LOCUS_06840 6350 5427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 6800 7000 gene locus_tag LOCUS_06850 gene hpkA 6800 7000 CDS product archaeal histone HpkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250364.1 protein_id gnl|my_center|LOCUS_06850 8382 7273 gene locus_tag LOCUS_06860 gene dinB 8382 7273 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172312.1 protein_id gnl|my_center|LOCUS_06860 9192 8473 gene locus_tag LOCUS_06870 9192 8473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 9476 11212 gene locus_tag LOCUS_06880 9476 11212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 11091 11190 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11247 11861 gene locus_tag LOCUS_06890 11247 11861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 13988 12102 gene locus_tag LOCUS_06900 13988 12102 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361675.1 protein_id gnl|my_center|LOCUS_06900 14954 13992 gene locus_tag LOCUS_06910 gene mptN 14954 13992 CDS product tetrahydromethanopterin:alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023202.1 protein_id gnl|my_center|LOCUS_06910 15600 15091 gene locus_tag LOCUS_06920 15600 15091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 16512 15613 gene locus_tag LOCUS_06930 16512 15613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 16951 16538 gene locus_tag LOCUS_06940 16951 16538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 17587 16961 gene locus_tag LOCUS_06950 17587 16961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 18891 17773 gene locus_tag LOCUS_06960 18891 17773 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020699.1 protein_id gnl|my_center|LOCUS_06960 18947 20233 gene locus_tag LOCUS_06970 18947 20233 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545078.1 protein_id gnl|my_center|LOCUS_06970 20433 21224 gene locus_tag LOCUS_06980 20433 21224 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020802.1 protein_id gnl|my_center|LOCUS_06980 22254 21226 gene locus_tag LOCUS_06990 22254 21226 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274451.1 protein_id gnl|my_center|LOCUS_06990 22988 22260 gene locus_tag LOCUS_07000 22988 22260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 24094 22985 gene locus_tag LOCUS_07010 gene nuoH 24094 22985 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015591312.1 protein_id gnl|my_center|LOCUS_07010 26418 24106 gene locus_tag LOCUS_07020 26418 24106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 26820 26446 gene locus_tag LOCUS_07030 gene ndhC 26820 26446 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879323.1 protein_id gnl|my_center|LOCUS_07030 28126 26840 gene locus_tag LOCUS_07040 28126 26840 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064736.1 protein_id gnl|my_center|LOCUS_07040 30036 28123 gene locus_tag LOCUS_07050 30036 28123 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879321.1 protein_id gnl|my_center|LOCUS_07050 31526 30033 gene locus_tag LOCUS_07060 31526 30033 CDS product complex I subunit 5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879320.1 protein_id gnl|my_center|LOCUS_07060 31849 31523 gene locus_tag LOCUS_07070 31849 31523 CDS product F420H(2):quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064470.1 protein_id gnl|my_center|LOCUS_07070 32338 31850 gene locus_tag LOCUS_07080 32338 31850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 33413 32409 gene locus_tag LOCUS_07090 gene idsA 33413 32409 CDS product short chain isoprenyl diphosphate synthase IdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875690.1 protein_id gnl|my_center|LOCUS_07090 33662 33462 gene locus_tag LOCUS_07100 33662 33462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 34853 33774 gene locus_tag LOCUS_07110 34853 33774 CDS product MSMEG_0568 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876804.1 protein_id gnl|my_center|LOCUS_07110 36364 34829 gene locus_tag LOCUS_07120 36364 34829 CDS product L-aspartate semialdehyde sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021823.1 protein_id gnl|my_center|LOCUS_07120 37449 36424 gene locus_tag LOCUS_07130 37449 36424 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942993.1 protein_id gnl|my_center|LOCUS_07130 37546 38493 gene locus_tag LOCUS_07140 37546 38493 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066146.1 protein_id gnl|my_center|LOCUS_07140 39364 38714 gene locus_tag LOCUS_07150 39364 38714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 39513 39764 gene locus_tag LOCUS_07160 39513 39764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 39776 40129 gene locus_tag LOCUS_07170 39776 40129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 40113 40919 gene locus_tag LOCUS_07180 40113 40919 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020890.1 protein_id gnl|my_center|LOCUS_07180 41001 43802 gene locus_tag LOCUS_07190 gene leuS 41001 43802 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496564.1 protein_id gnl|my_center|LOCUS_07190 43883 45631 gene locus_tag LOCUS_07200 43883 45631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 45529 45628 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 45702 46730 gene locus_tag LOCUS_07210 45702 46730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 46733 48046 gene locus_tag LOCUS_07220 46733 48046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 48018 48206 gene locus_tag LOCUS_07230 48018 48206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 48423 48151 gene locus_tag LOCUS_07240 48423 48151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 48838 48431 gene locus_tag LOCUS_07250 48838 48431 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013683272.1 protein_id gnl|my_center|LOCUS_07250 >Feature sequence012 3110 768 gene locus_tag LOCUS_07260 3110 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 5332 3149 gene locus_tag LOCUS_07270 5332 3149 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_07270 5723 5346 gene locus_tag LOCUS_07280 5723 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 7096 5726 gene locus_tag LOCUS_07290 7096 5726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 7596 8024 gene locus_tag LOCUS_07300 7596 8024 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404934.1 protein_id gnl|my_center|LOCUS_07300 8837 8106 gene locus_tag LOCUS_07310 gene sfsA 8837 8106 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249730.1 protein_id gnl|my_center|LOCUS_07310 9028 10305 gene locus_tag LOCUS_07320 9028 10305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 10643 10888 gene locus_tag LOCUS_07330 10643 10888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 11140 11904 gene locus_tag LOCUS_07340 11140 11904 CDS product YoaP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948704.1 protein_id gnl|my_center|LOCUS_07340 12099 12320 gene locus_tag LOCUS_07350 12099 12320 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546765.1 protein_id gnl|my_center|LOCUS_07350 12313 12558 gene locus_tag LOCUS_07360 12313 12558 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545521.1 protein_id gnl|my_center|LOCUS_07360 12691 12894 gene locus_tag LOCUS_07370 12691 12894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 13973 12876 gene locus_tag LOCUS_07380 gene mqnC 13973 12876 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877897.1 protein_id gnl|my_center|LOCUS_07380 14706 13954 gene locus_tag LOCUS_07390 14706 13954 CDS product menaquinone biosynthetic enzyme MqnA/MqnD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064224.1 protein_id gnl|my_center|LOCUS_07390 15754 14708 gene locus_tag LOCUS_07400 15754 14708 CDS product CofH family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064223.1 protein_id gnl|my_center|LOCUS_07400 15980 16471 gene locus_tag LOCUS_07410 15980 16471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 16931 16656 gene locus_tag LOCUS_07420 16931 16656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 17061 17378 gene locus_tag LOCUS_07430 17061 17378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 17620 19164 gene locus_tag LOCUS_07440 17620 19164 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_07440 19164 20696 gene locus_tag LOCUS_07450 19164 20696 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902375.1 protein_id gnl|my_center|LOCUS_07450 20728 21987 gene locus_tag LOCUS_07460 20728 21987 CDS product methanogenesis marker 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877471.1 protein_id gnl|my_center|LOCUS_07460 21994 22407 gene locus_tag LOCUS_07470 gene tsaA 21994 22407 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877752.1 protein_id gnl|my_center|LOCUS_07470 22614 22919 gene locus_tag LOCUS_07480 22614 22919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07480 23012 26332 gene locus_tag LOCUS_07490 23012 26332 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890095.1 protein_id gnl|my_center|LOCUS_07490 26335 27609 gene locus_tag LOCUS_07500 26335 27609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 27613 28077 gene locus_tag LOCUS_07510 27613 28077 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866321.1 protein_id gnl|my_center|LOCUS_07510 28148 29026 gene locus_tag LOCUS_07520 28148 29026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 29028 29900 gene locus_tag LOCUS_07530 29028 29900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 29926 30441 gene locus_tag LOCUS_07540 29926 30441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 30454 31500 gene locus_tag LOCUS_07550 gene coxFIC1 30454 31500 CDS product Dot/Icm type IV secretion system effector CoxFIC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769896.1 protein_id gnl|my_center|LOCUS_07550 31588 33075 gene locus_tag LOCUS_07560 gene argH 31588 33075 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021337.1 protein_id gnl|my_center|LOCUS_07560 33127 33588 gene locus_tag LOCUS_07570 33127 33588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 33606 33953 gene locus_tag LOCUS_07580 33606 33953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 33971 34207 gene locus_tag LOCUS_07590 33971 34207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 34729 34220 gene locus_tag LOCUS_07600 34729 34220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 36734 34758 gene locus_tag LOCUS_07610 36734 34758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 37995 36724 gene locus_tag LOCUS_07620 gene hemL 37995 36724 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020630.1 protein_id gnl|my_center|LOCUS_07620 38081 38233 gene locus_tag LOCUS_07630 38081 38233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 38291 38722 gene locus_tag LOCUS_07640 38291 38722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023265.1 protein_id gnl|my_center|LOCUS_07640 40018 38744 gene locus_tag LOCUS_07650 40018 38744 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023489.1 protein_id gnl|my_center|LOCUS_07650 40147 41271 gene locus_tag LOCUS_07660 gene proB 40147 41271 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392099.1 protein_id gnl|my_center|LOCUS_07660 42777 41281 gene locus_tag LOCUS_07670 42777 41281 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878560.1 protein_id gnl|my_center|LOCUS_07670 43153 42779 gene locus_tag LOCUS_07680 43153 42779 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870178.1 protein_id gnl|my_center|LOCUS_07680 43928 43248 gene locus_tag LOCUS_07690 43928 43248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 43979 45025 gene locus_tag LOCUS_07700 43979 45025 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870945.1 protein_id gnl|my_center|LOCUS_07700 45121 46248 gene locus_tag LOCUS_07710 45121 46248 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060968.1 protein_id gnl|my_center|LOCUS_07710 46205 47179 gene locus_tag LOCUS_07720 46205 47179 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256060.1 protein_id gnl|my_center|LOCUS_07720 47204 48058 gene locus_tag LOCUS_07730 47204 48058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 >Feature sequence013 116 451 gene locus_tag LOCUS_07740 116 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 1476 499 gene locus_tag LOCUS_07750 1476 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 1607 1876 gene locus_tag LOCUS_07760 1607 1876 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064806.1 protein_id gnl|my_center|LOCUS_07760 1880 3106 gene locus_tag LOCUS_07770 1880 3106 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024280.1 protein_id gnl|my_center|LOCUS_07770 3158 3604 gene locus_tag LOCUS_07780 3158 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 3610 3906 gene locus_tag LOCUS_07790 3610 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 4200 3871 gene locus_tag LOCUS_07800 4200 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 4293 5090 gene locus_tag LOCUS_07810 4293 5090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 5104 6660 gene locus_tag LOCUS_07820 5104 6660 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020870.1 protein_id gnl|my_center|LOCUS_07820 6898 7143 gene locus_tag LOCUS_07830 6898 7143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 8499 7195 gene locus_tag LOCUS_07840 gene gatD 8499 7195 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021336.1 protein_id gnl|my_center|LOCUS_07840 8597 9001 gene locus_tag LOCUS_07850 8597 9001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 9526 9014 gene locus_tag LOCUS_07860 9526 9014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 9838 9593 gene locus_tag LOCUS_07870 9838 9593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 10970 9906 gene locus_tag LOCUS_07880 gene rtcA 10970 9906 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878932.1 protein_id gnl|my_center|LOCUS_07880 11896 11003 gene locus_tag LOCUS_07890 gene map 11896 11003 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020270.1 protein_id gnl|my_center|LOCUS_07890 12632 11988 gene locus_tag LOCUS_07900 12632 11988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 12800 12949 gene locus_tag LOCUS_07910 12800 12949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 12983 13438 gene locus_tag LOCUS_07920 12983 13438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 13452 13637 gene locus_tag LOCUS_07930 13452 13637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 15855 13813 gene locus_tag LOCUS_07940 15855 13813 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023138.1 protein_id gnl|my_center|LOCUS_07940 15955 16299 gene locus_tag LOCUS_07950 15955 16299 CDS product 50S ribosomal protein L37ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021778.1 protein_id gnl|my_center|LOCUS_07950 16515 16790 gene locus_tag LOCUS_07960 16515 16790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 18177 16963 gene locus_tag LOCUS_07970 18177 16963 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496851.1 protein_id gnl|my_center|LOCUS_07970 19367 18177 gene locus_tag LOCUS_07980 19367 18177 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496851.1 protein_id gnl|my_center|LOCUS_07980 19997 19371 gene locus_tag LOCUS_07990 19997 19371 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_07990 21373 20051 gene locus_tag LOCUS_08000 21373 20051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 21903 21370 gene locus_tag LOCUS_08010 21903 21370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 22560 22027 gene locus_tag LOCUS_08020 22560 22027 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020400.1 protein_id gnl|my_center|LOCUS_08020 23516 22581 gene locus_tag LOCUS_08030 23516 22581 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879220.1 protein_id gnl|my_center|LOCUS_08030 23629 24789 gene locus_tag LOCUS_08040 23629 24789 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871137.1 protein_id gnl|my_center|LOCUS_08040 26057 24801 gene locus_tag LOCUS_08050 26057 24801 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147334.1 protein_id gnl|my_center|LOCUS_08050 26185 26565 gene locus_tag LOCUS_08060 26185 26565 CDS product RNA polymerase Rpb4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021458.1 protein_id gnl|my_center|LOCUS_08060 26562 27212 gene locus_tag LOCUS_08070 26562 27212 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879028.1 protein_id gnl|my_center|LOCUS_08070 27227 29194 gene locus_tag LOCUS_08080 gene hdrA 27227 29194 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_08080 29196 32675 gene locus_tag LOCUS_08090 29196 32675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 32977 33201 gene locus_tag LOCUS_08100 32977 33201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 33758 33928 gene locus_tag LOCUS_08110 33758 33928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 34271 35686 gene locus_tag LOCUS_08120 34271 35686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 35674 36546 gene locus_tag LOCUS_08130 35674 36546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 38337 36709 gene locus_tag LOCUS_08140 38337 36709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 38520 40082 gene locus_tag LOCUS_08150 38520 40082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08150 40088 40519 gene locus_tag LOCUS_08160 40088 40519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08160 40533 41288 gene locus_tag LOCUS_08170 40533 41288 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012940758.1 protein_id gnl|my_center|LOCUS_08170 41275 42681 gene locus_tag LOCUS_08180 41275 42681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 42754 42984 gene locus_tag LOCUS_08190 42754 42984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 43136 44587 gene locus_tag LOCUS_08200 43136 44587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 44572 45003 gene locus_tag LOCUS_08210 44572 45003 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022813.1 protein_id gnl|my_center|LOCUS_08210 45024 45335 gene locus_tag LOCUS_08220 45024 45335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 45346 45666 gene locus_tag LOCUS_08230 45346 45666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 45804 46994 gene locus_tag LOCUS_08240 45804 46994 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877916.1 protein_id gnl|my_center|LOCUS_08240 47701 47045 gene locus_tag LOCUS_08250 47701 47045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08250 >Feature sequence014 713 1141 gene locus_tag LOCUS_08260 713 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 1268 2383 gene locus_tag LOCUS_08270 gene fbp 1268 2383 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878939.1 protein_id gnl|my_center|LOCUS_08270 2425 3300 gene locus_tag LOCUS_08280 2425 3300 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879565.1 protein_id gnl|my_center|LOCUS_08280 3475 3834 gene locus_tag LOCUS_08290 3475 3834 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064921.1 protein_id gnl|my_center|LOCUS_08290 3903 4346 gene locus_tag LOCUS_08300 3903 4346 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020645.1 protein_id gnl|my_center|LOCUS_08300 4325 4756 gene locus_tag LOCUS_08310 4325 4756 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061175.1 protein_id gnl|my_center|LOCUS_08310 4776 4961 gene locus_tag LOCUS_08320 4776 4961 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020647.1 protein_id gnl|my_center|LOCUS_08320 4976 5050 gene locus_tag LOCUS_t00160 4976 5050 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5081 5272 gene locus_tag LOCUS_08330 5081 5272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 5726 5322 gene locus_tag LOCUS_08340 5726 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 6648 5770 gene locus_tag LOCUS_08350 gene nifH 6648 5770 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870393.1 protein_id gnl|my_center|LOCUS_08350 7524 6751 gene locus_tag LOCUS_08360 7524 6751 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020890.1 protein_id gnl|my_center|LOCUS_08360 8537 7521 gene locus_tag LOCUS_08370 8537 7521 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066146.1 protein_id gnl|my_center|LOCUS_08370 9325 8510 gene locus_tag LOCUS_08380 9325 8510 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 protein_id gnl|my_center|LOCUS_08380 10471 9341 gene locus_tag LOCUS_08390 10471 9341 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 protein_id gnl|my_center|LOCUS_08390 12609 10468 gene locus_tag LOCUS_08400 12609 10468 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020921.1 protein_id gnl|my_center|LOCUS_08400 13694 12723 gene locus_tag LOCUS_08410 13694 12723 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870386.1 protein_id gnl|my_center|LOCUS_08410 13887 15263 gene locus_tag LOCUS_08420 13887 15263 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868417.1 protein_id gnl|my_center|LOCUS_08420 19105 15365 gene locus_tag LOCUS_08430 gene cobN 19105 15365 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020926.1 protein_id gnl|my_center|LOCUS_08430 23055 19282 gene locus_tag LOCUS_08440 gene bchH 23055 19282 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761986.1 protein_id gnl|my_center|LOCUS_08440 23953 23057 gene locus_tag LOCUS_08450 23953 23057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 25187 23943 gene locus_tag LOCUS_08460 25187 23943 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990611.1 protein_id gnl|my_center|LOCUS_08460 26386 25184 gene locus_tag LOCUS_08470 26386 25184 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990611.1 protein_id gnl|my_center|LOCUS_08470 27753 26383 gene locus_tag LOCUS_08480 27753 26383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 27916 30237 gene locus_tag LOCUS_08490 27916 30237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 30407 31777 gene locus_tag LOCUS_08500 30407 31777 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023489.1 protein_id gnl|my_center|LOCUS_08500 33054 31813 gene locus_tag LOCUS_08510 33054 31813 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990611.1 protein_id gnl|my_center|LOCUS_08510 34207 33047 gene locus_tag LOCUS_08520 34207 33047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 34817 34200 gene locus_tag LOCUS_08530 34817 34200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 35657 34965 gene locus_tag LOCUS_08540 35657 34965 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877750.1 protein_id gnl|my_center|LOCUS_08540 35794 37029 gene locus_tag LOCUS_08550 35794 37029 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 protein_id gnl|my_center|LOCUS_08550 37524 37327 gene locus_tag LOCUS_08560 37524 37327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 38631 37666 gene locus_tag LOCUS_08570 38631 37666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 >Feature sequence015 668 141 gene locus_tag LOCUS_08580 668 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 747 1577 gene locus_tag LOCUS_08590 gene purQ 747 1577 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878755.1 protein_id gnl|my_center|LOCUS_08590 1709 2275 gene locus_tag LOCUS_08600 1709 2275 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023341.1 protein_id gnl|my_center|LOCUS_08600 2277 3542 gene locus_tag LOCUS_08610 2277 3542 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022483.1 protein_id gnl|my_center|LOCUS_08610 3835 4047 gene locus_tag LOCUS_08620 3835 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 4347 4027 gene locus_tag LOCUS_08630 4347 4027 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869785.1 protein_id gnl|my_center|LOCUS_08630 4528 4370 gene locus_tag LOCUS_08640 4528 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 5010 4558 gene locus_tag LOCUS_08650 5010 4558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 5934 5287 gene locus_tag LOCUS_08660 5934 5287 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876584.1 protein_id gnl|my_center|LOCUS_08660 6568 5987 gene locus_tag LOCUS_08670 gene rpl6p 6568 5987 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021117.1 protein_id gnl|my_center|LOCUS_08670 6656 7891 gene locus_tag LOCUS_08680 gene hisD 6656 7891 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023136.1 protein_id gnl|my_center|LOCUS_08680 7888 9054 gene locus_tag LOCUS_08690 7888 9054 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021821.1 protein_id gnl|my_center|LOCUS_08690 9074 10831 gene locus_tag LOCUS_08700 9074 10831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 10876 11628 gene locus_tag LOCUS_08710 10876 11628 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250847.1 protein_id gnl|my_center|LOCUS_08710 11672 12037 gene locus_tag LOCUS_08720 11672 12037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 12085 12690 gene locus_tag LOCUS_08730 12085 12690 CDS product DUF4255 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941640.1 protein_id gnl|my_center|LOCUS_08730 12671 13282 gene locus_tag LOCUS_08740 12671 13282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 13358 15757 gene locus_tag LOCUS_08750 13358 15757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 15775 16221 gene locus_tag LOCUS_08760 15775 16221 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_08760 16236 16595 gene locus_tag LOCUS_08770 16236 16595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941644.1 protein_id gnl|my_center|LOCUS_08770 16763 17371 gene locus_tag LOCUS_08780 16763 17371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 17387 17821 gene locus_tag LOCUS_08790 17387 17821 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_08790 19297 19548 gene locus_tag LOCUS_08800 19297 19548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 19552 20223 gene locus_tag LOCUS_08810 19552 20223 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941648.1 protein_id gnl|my_center|LOCUS_08810 20223 21302 gene locus_tag LOCUS_08820 20223 21302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08820 21299 21961 gene locus_tag LOCUS_08830 21299 21961 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941650.1 protein_id gnl|my_center|LOCUS_08830 21975 22268 gene locus_tag LOCUS_08840 21975 22268 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941651.1 protein_id gnl|my_center|LOCUS_08840 22293 22688 gene locus_tag LOCUS_08850 22293 22688 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_08850 22735 26091 gene locus_tag LOCUS_08860 22735 26091 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941653.1 protein_id gnl|my_center|LOCUS_08860 26091 28034 gene locus_tag LOCUS_08870 26091 28034 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941654.1 protein_id gnl|my_center|LOCUS_08870 28015 30030 gene locus_tag LOCUS_08880 28015 30030 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941655.1 protein_id gnl|my_center|LOCUS_08880 30182 32917 gene locus_tag LOCUS_08890 30182 32917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 33032 33223 gene locus_tag LOCUS_08900 33032 33223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 33265 35439 gene locus_tag LOCUS_08910 33265 35439 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941639.1 protein_id gnl|my_center|LOCUS_08910 35502 36860 gene locus_tag LOCUS_08920 35502 36860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 36922 38343 gene locus_tag LOCUS_08930 36922 38343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 38586 38903 gene locus_tag LOCUS_08940 38586 38903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 >Feature sequence016 841 1146 gene locus_tag LOCUS_08950 841 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 1772 1341 gene locus_tag LOCUS_08960 1772 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 2491 2009 gene locus_tag LOCUS_08970 2491 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 2845 2624 gene locus_tag LOCUS_08980 2845 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 3112 3978 gene locus_tag LOCUS_08990 3112 3978 CDS product HindIII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023995236.1 protein_id gnl|my_center|LOCUS_08990 6476 4011 gene locus_tag LOCUS_09000 6476 4011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 6861 6640 gene locus_tag LOCUS_09010 6861 6640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 7090 7293 gene locus_tag LOCUS_09020 7090 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 10584 8992 gene locus_tag LOCUS_09030 10584 8992 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060924.1 protein_id gnl|my_center|LOCUS_09030 11254 13650 gene locus_tag LOCUS_09040 11254 13650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 13719 14891 gene locus_tag LOCUS_09050 13719 14891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 15384 14962 gene locus_tag LOCUS_09060 15384 14962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 16276 15404 gene locus_tag LOCUS_09070 16276 15404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 16493 17494 gene locus_tag LOCUS_09080 16493 17494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 17529 19184 gene locus_tag LOCUS_09090 17529 19184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 23084 19194 gene locus_tag LOCUS_09100 23084 19194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 27422 23379 gene locus_tag LOCUS_09110 27422 23379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 30074 27636 gene locus_tag LOCUS_09120 30074 27636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 31426 30434 gene locus_tag LOCUS_09130 31426 30434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 31678 31538 gene locus_tag LOCUS_09140 31678 31538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 33413 31923 gene locus_tag LOCUS_09150 33413 31923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 33589 33410 gene locus_tag LOCUS_09160 33589 33410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 34018 34224 gene locus_tag LOCUS_09170 34018 34224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 34267 34479 gene locus_tag LOCUS_09180 34267 34479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 34945 35922 gene locus_tag LOCUS_09190 34945 35922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 36110 36772 gene locus_tag LOCUS_09200 36110 36772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 36936 37154 gene locus_tag LOCUS_09210 36936 37154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 37593 37243 gene locus_tag LOCUS_09220 37593 37243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 >Feature sequence017 550 1875 gene locus_tag LOCUS_09230 550 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 2242 3132 gene locus_tag LOCUS_09240 2242 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 3165 6002 gene locus_tag LOCUS_09250 3165 6002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 6616 6371 gene locus_tag LOCUS_09260 6616 6371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 6974 6702 gene locus_tag LOCUS_09270 6974 6702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 7128 6940 gene locus_tag LOCUS_09280 7128 6940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 7528 7229 gene locus_tag LOCUS_09290 7528 7229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 7685 7506 gene locus_tag LOCUS_09300 7685 7506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 8373 7720 gene locus_tag LOCUS_09310 8373 7720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 8736 8491 gene locus_tag LOCUS_09320 8736 8491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 9722 8781 gene locus_tag LOCUS_09330 9722 8781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 10073 10564 gene locus_tag LOCUS_09340 10073 10564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 10565 10741 gene locus_tag LOCUS_09350 10565 10741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 11051 12163 gene locus_tag LOCUS_09360 11051 12163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 12473 13672 gene locus_tag LOCUS_09370 12473 13672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 14384 14163 gene locus_tag LOCUS_09380 14384 14163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 14874 14674 gene locus_tag LOCUS_09390 14874 14674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 14827 15234 gene locus_tag LOCUS_09400 14827 15234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 16241 16927 gene locus_tag LOCUS_09410 16241 16927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 16894 18585 gene locus_tag LOCUS_09420 16894 18585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 18622 22140 gene locus_tag LOCUS_09430 18622 22140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 22137 25364 gene locus_tag LOCUS_09440 22137 25364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 25380 29732 gene locus_tag LOCUS_09450 25380 29732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 29776 31707 gene locus_tag LOCUS_09460 29776 31707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 31883 32026 gene locus_tag LOCUS_09470 31883 32026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 32032 32964 gene locus_tag LOCUS_09480 32032 32964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 35524 34349 gene locus_tag LOCUS_09490 35524 34349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 38141 37305 gene locus_tag LOCUS_09500 38141 37305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 >Feature sequence018 511 125 gene locus_tag LOCUS_09510 511 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 1433 552 gene locus_tag LOCUS_09520 1433 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 2895 2290 gene locus_tag LOCUS_09530 2895 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 3826 3743 gene locus_tag LOCUS_t00170 3826 3743 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4272 3808 gene locus_tag LOCUS_09540 gene moaC 4272 3808 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066185.1 protein_id gnl|my_center|LOCUS_09540 4516 4286 gene locus_tag LOCUS_09550 4516 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 7455 4993 gene locus_tag LOCUS_09560 7455 4993 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022991.1 protein_id gnl|my_center|LOCUS_09560 7528 7899 gene locus_tag LOCUS_09570 gene pth2 7528 7899 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023203.1 protein_id gnl|my_center|LOCUS_09570 7918 8532 gene locus_tag LOCUS_09580 7918 8532 CDS product DUF2119 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870002.1 protein_id gnl|my_center|LOCUS_09580 8815 9123 gene locus_tag LOCUS_09590 8815 9123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 9255 11117 gene locus_tag LOCUS_09600 9255 11117 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868460.1 protein_id gnl|my_center|LOCUS_09600 11586 11218 gene locus_tag LOCUS_09610 11586 11218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 11685 11891 gene locus_tag LOCUS_09620 11685 11891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 11888 12274 gene locus_tag LOCUS_09630 11888 12274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 13366 12365 gene locus_tag LOCUS_09640 13366 12365 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022537.1 protein_id gnl|my_center|LOCUS_09640 13874 13383 gene locus_tag LOCUS_09650 13874 13383 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065441.1 protein_id gnl|my_center|LOCUS_09650 14111 13878 gene locus_tag LOCUS_09660 14111 13878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 14352 14116 gene locus_tag LOCUS_09670 14352 14116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 16106 14400 gene locus_tag LOCUS_09680 gene metG 16106 14400 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902197.1 protein_id gnl|my_center|LOCUS_09680 17003 16665 gene locus_tag LOCUS_09690 17003 16665 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249910.1 protein_id gnl|my_center|LOCUS_09690 17937 17170 gene locus_tag LOCUS_09700 gene dph5 17937 17170 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021388.1 protein_id gnl|my_center|LOCUS_09700 18021 19028 gene locus_tag LOCUS_09710 18021 19028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 19085 21427 gene locus_tag LOCUS_09720 19085 21427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 22403 21522 gene locus_tag LOCUS_09730 22403 21522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 23261 22410 gene locus_tag LOCUS_09740 23261 22410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 23460 25157 gene locus_tag LOCUS_09750 gene argS 23460 25157 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064797.1 protein_id gnl|my_center|LOCUS_09750 26136 25315 gene locus_tag LOCUS_09760 26136 25315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 27142 26336 gene locus_tag LOCUS_09770 27142 26336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 27583 29184 gene locus_tag LOCUS_09780 27583 29184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 29165 30046 gene locus_tag LOCUS_09790 29165 30046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 30068 31015 gene locus_tag LOCUS_09800 30068 31015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 33245 31017 gene locus_tag LOCUS_09810 33245 31017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 35551 33389 gene locus_tag LOCUS_09820 35551 33389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 36246 35803 gene locus_tag LOCUS_09830 36246 35803 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877825.1 protein_id gnl|my_center|LOCUS_09830 36466 36239 gene locus_tag LOCUS_09840 36466 36239 CDS product antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048094905.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence019 843 124 gene locus_tag LOCUS_09850 843 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 884 1102 gene locus_tag LOCUS_09860 884 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 2159 2380 gene locus_tag LOCUS_09870 2159 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 2549 2899 gene locus_tag LOCUS_09880 2549 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 2935 3219 gene locus_tag LOCUS_09890 2935 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 3278 4399 gene locus_tag LOCUS_09900 3278 4399 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250683.1 protein_id gnl|my_center|LOCUS_09900 4607 4846 gene locus_tag LOCUS_09910 4607 4846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 4897 5217 gene locus_tag LOCUS_09920 4897 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 5698 6012 gene locus_tag LOCUS_09930 5698 6012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 6009 6467 gene locus_tag LOCUS_09940 6009 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392404.1 protein_id gnl|my_center|LOCUS_09940 6917 7162 gene locus_tag LOCUS_09950 6917 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 7152 7499 gene locus_tag LOCUS_09960 7152 7499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 7537 7698 gene locus_tag LOCUS_09970 7537 7698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 7695 7916 gene locus_tag LOCUS_09980 7695 7916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 7925 8347 gene locus_tag LOCUS_09990 7925 8347 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875944.1 protein_id gnl|my_center|LOCUS_09990 8933 9154 gene locus_tag LOCUS_10000 8933 9154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 9144 9308 gene locus_tag LOCUS_10010 9144 9308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 9522 9827 gene locus_tag LOCUS_10020 9522 9827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 9811 10314 gene locus_tag LOCUS_10030 9811 10314 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225807463.1 protein_id gnl|my_center|LOCUS_10030 10298 10477 gene locus_tag LOCUS_10040 10298 10477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 10554 10838 gene locus_tag LOCUS_10050 10554 10838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021611.1 protein_id gnl|my_center|LOCUS_10050 10838 11104 gene locus_tag LOCUS_10060 10838 11104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 11130 11450 gene locus_tag LOCUS_10070 11130 11450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 11478 11753 gene locus_tag LOCUS_10080 11478 11753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 11789 11971 gene locus_tag LOCUS_10090 11789 11971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 12008 12238 gene locus_tag LOCUS_10100 12008 12238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 12482 13447 gene locus_tag LOCUS_10110 12482 13447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 13444 14826 gene locus_tag LOCUS_10120 gene hpnJ 13444 14826 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941811.1 protein_id gnl|my_center|LOCUS_10120 14839 16095 gene locus_tag LOCUS_10130 14839 16095 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 protein_id gnl|my_center|LOCUS_10130 16124 16696 gene locus_tag LOCUS_10140 16124 16696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 16689 17723 gene locus_tag LOCUS_10150 16689 17723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 17858 18838 gene locus_tag LOCUS_10160 17858 18838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 18898 19047 gene locus_tag LOCUS_10170 18898 19047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 19044 20237 gene locus_tag LOCUS_10180 19044 20237 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250274.1 protein_id gnl|my_center|LOCUS_10180 20215 21519 gene locus_tag LOCUS_10190 20215 21519 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875980.1 protein_id gnl|my_center|LOCUS_10190 21537 22829 gene locus_tag LOCUS_10200 21537 22829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 22829 24043 gene locus_tag LOCUS_10210 22829 24043 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545872.1 protein_id gnl|my_center|LOCUS_10210 24521 24186 gene locus_tag LOCUS_10220 24521 24186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 25351 26361 gene locus_tag LOCUS_10230 25351 26361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 27387 26386 gene locus_tag LOCUS_10240 27387 26386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 28853 27387 gene locus_tag LOCUS_10250 28853 27387 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767818.1 protein_id gnl|my_center|LOCUS_10250 29582 28860 gene locus_tag LOCUS_10260 29582 28860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 30830 29586 gene locus_tag LOCUS_10270 30830 29586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 31791 30868 gene locus_tag LOCUS_10280 31791 30868 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990845.1 protein_id gnl|my_center|LOCUS_10280 32903 31788 gene locus_tag LOCUS_10290 32903 31788 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875973.1 protein_id gnl|my_center|LOCUS_10290 33228 32959 gene locus_tag LOCUS_10300 33228 32959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 33502 33215 gene locus_tag LOCUS_10310 33502 33215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 34339 33575 gene locus_tag LOCUS_10320 34339 33575 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105572.1 protein_id gnl|my_center|LOCUS_10320 34746 34336 gene locus_tag LOCUS_10330 34746 34336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 35798 34743 gene locus_tag LOCUS_10340 35798 34743 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875972.1 protein_id gnl|my_center|LOCUS_10340 36279 35848 gene locus_tag LOCUS_10350 36279 35848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 >Feature sequence020 968 765 gene locus_tag LOCUS_10360 968 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 1548 1171 gene locus_tag LOCUS_10370 1548 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 1784 1536 gene locus_tag LOCUS_10380 1784 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 3044 1827 gene locus_tag LOCUS_10390 3044 1827 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024465.1 protein_id gnl|my_center|LOCUS_10390 3954 3133 gene locus_tag LOCUS_10400 3954 3133 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876218.1 protein_id gnl|my_center|LOCUS_10400 5925 4039 gene locus_tag LOCUS_10410 5925 4039 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023770.1 protein_id gnl|my_center|LOCUS_10410 6731 6096 gene locus_tag LOCUS_10420 gene psmB 6731 6096 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023769.1 protein_id gnl|my_center|LOCUS_10420 7157 6735 gene locus_tag LOCUS_10430 gene nikR 7157 6735 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023967.1 protein_id gnl|my_center|LOCUS_10430 7584 7159 gene locus_tag LOCUS_10440 7584 7159 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021822.1 protein_id gnl|my_center|LOCUS_10440 7991 7578 gene locus_tag LOCUS_10450 7991 7578 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066255.1 protein_id gnl|my_center|LOCUS_10450 8922 7996 gene locus_tag LOCUS_10460 8922 7996 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021489.1 protein_id gnl|my_center|LOCUS_10460 9874 8924 gene locus_tag LOCUS_10470 9874 8924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 11144 10122 gene locus_tag LOCUS_10480 11144 10122 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_10480 11276 11665 gene locus_tag LOCUS_10490 gene eif5A 11276 11665 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878148.1 protein_id gnl|my_center|LOCUS_10490 11692 11946 gene locus_tag LOCUS_10500 11692 11946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 11991 12848 gene locus_tag LOCUS_10510 11991 12848 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023985.1 protein_id gnl|my_center|LOCUS_10510 12870 13322 gene locus_tag LOCUS_10520 12870 13322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 13369 14823 gene locus_tag LOCUS_10530 13369 14823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 14992 15240 gene locus_tag LOCUS_10540 14992 15240 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_10540 15241 15453 gene locus_tag LOCUS_10550 15241 15453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 15685 16494 gene locus_tag LOCUS_10560 15685 16494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 18084 16531 gene locus_tag LOCUS_10570 18084 16531 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021194.1 protein_id gnl|my_center|LOCUS_10570 21394 18158 gene locus_tag LOCUS_10580 21394 18158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 24945 21391 gene locus_tag LOCUS_10590 24945 21391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 25154 25008 gene locus_tag LOCUS_10600 25154 25008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 25215 25460 gene locus_tag LOCUS_10610 25215 25460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 26770 25547 gene locus_tag LOCUS_10620 gene thrC 26770 25547 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021620.1 protein_id gnl|my_center|LOCUS_10620 26891 28036 gene locus_tag LOCUS_10630 26891 28036 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878013.1 protein_id gnl|my_center|LOCUS_10630 28086 28337 gene locus_tag LOCUS_10640 28086 28337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 28327 28512 gene locus_tag LOCUS_10650 28327 28512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 28610 30013 gene locus_tag LOCUS_10660 28610 30013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 30130 30591 gene locus_tag LOCUS_10670 gene rimI 30130 30591 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251164.1 protein_id gnl|my_center|LOCUS_10670 30965 30786 gene locus_tag LOCUS_10680 30965 30786 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065133.1 protein_id gnl|my_center|LOCUS_10680 31531 30968 gene locus_tag LOCUS_10690 31531 30968 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879461.1 protein_id gnl|my_center|LOCUS_10690 31677 31595 gene locus_tag LOCUS_t00180 31677 31595 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 31727 33661 gene locus_tag LOCUS_10700 gene rqcH 31727 33661 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879530.1 protein_id gnl|my_center|LOCUS_10700 34065 33802 gene locus_tag LOCUS_10710 34065 33802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 34530 36254 gene locus_tag LOCUS_10720 34530 36254 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061055.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence021 809 357 gene locus_tag LOCUS_10730 809 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 963 2174 gene locus_tag LOCUS_10740 963 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 2152 3138 gene locus_tag LOCUS_10750 2152 3138 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877877.1 protein_id gnl|my_center|LOCUS_10750 4112 3183 gene locus_tag LOCUS_10760 4112 3183 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065056.1 protein_id gnl|my_center|LOCUS_10760 4200 4556 gene locus_tag LOCUS_10770 4200 4556 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064682.1 protein_id gnl|my_center|LOCUS_10770 4558 5022 gene locus_tag LOCUS_10780 gene ribC 4558 5022 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021819.1 protein_id gnl|my_center|LOCUS_10780 5133 5558 gene locus_tag LOCUS_10790 gene ribH 5133 5558 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879619.1 protein_id gnl|my_center|LOCUS_10790 6439 5495 gene locus_tag LOCUS_10800 gene cbiB 6439 5495 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867171.1 protein_id gnl|my_center|LOCUS_10800 6762 6436 gene locus_tag LOCUS_10810 6762 6436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 6840 7565 gene locus_tag LOCUS_10820 6840 7565 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021719.1 protein_id gnl|my_center|LOCUS_10820 7645 9159 gene locus_tag LOCUS_10830 7645 9159 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021937.1 protein_id gnl|my_center|LOCUS_10830 9277 10551 gene locus_tag LOCUS_10840 gene thiC 9277 10551 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021793.1 protein_id gnl|my_center|LOCUS_10840 10968 10570 gene locus_tag LOCUS_10850 gene rpl14p 10968 10570 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879408.1 protein_id gnl|my_center|LOCUS_10850 11282 10965 gene locus_tag LOCUS_10860 11282 10965 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011696863.1 protein_id gnl|my_center|LOCUS_10860 11548 11279 gene locus_tag LOCUS_10870 11548 11279 CDS product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869964.1 protein_id gnl|my_center|LOCUS_10870 11851 11552 gene locus_tag LOCUS_10880 gene yciH 11851 11552 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875652.1 protein_id gnl|my_center|LOCUS_10880 12084 11854 gene locus_tag LOCUS_10890 gene rpmC 12084 11854 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021108.1 protein_id gnl|my_center|LOCUS_10890 12770 12081 gene locus_tag LOCUS_10900 12770 12081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 13250 12780 gene locus_tag LOCUS_10910 gene rplV 13250 12780 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064485.1 protein_id gnl|my_center|LOCUS_10910 13683 13267 gene locus_tag LOCUS_10920 gene rpsS 13683 13267 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879414.1 protein_id gnl|my_center|LOCUS_10920 14439 13693 gene locus_tag LOCUS_10930 14439 13693 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021104.1 protein_id gnl|my_center|LOCUS_10930 14711 14457 gene locus_tag LOCUS_10940 14711 14457 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021103.1 protein_id gnl|my_center|LOCUS_10940 15593 14718 gene locus_tag LOCUS_10950 gene rpl4p 15593 14718 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021102.1 protein_id gnl|my_center|LOCUS_10950 16598 15621 gene locus_tag LOCUS_10960 gene rpl3p 16598 15621 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879418.1 protein_id gnl|my_center|LOCUS_10960 17844 16675 gene locus_tag LOCUS_10970 17844 16675 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020303.1 protein_id gnl|my_center|LOCUS_10970 17925 18146 gene locus_tag LOCUS_10980 17925 18146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 18150 18320 gene locus_tag LOCUS_10990 18150 18320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 18505 19128 gene locus_tag LOCUS_11000 18505 19128 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167392103.1 protein_id gnl|my_center|LOCUS_11000 19215 19787 gene locus_tag LOCUS_11010 19215 19787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 21447 20458 gene locus_tag LOCUS_11020 gene ilvC 21447 20458 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496863.1 protein_id gnl|my_center|LOCUS_11020 21989 21816 gene locus_tag LOCUS_11030 21989 21816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 22902 22036 gene locus_tag LOCUS_11040 22902 22036 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496706.1 protein_id gnl|my_center|LOCUS_11040 23031 23693 gene locus_tag LOCUS_11050 23031 23693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 23839 26373 gene locus_tag LOCUS_11060 23839 26373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 26596 27657 gene locus_tag LOCUS_11070 26596 27657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 27967 27734 gene locus_tag LOCUS_11080 27967 27734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 28029 28553 gene locus_tag LOCUS_11090 28029 28553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 30216 28567 gene locus_tag LOCUS_11100 gene ilvD 30216 28567 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546643.1 protein_id gnl|my_center|LOCUS_11100 30932 30696 gene locus_tag LOCUS_11110 30932 30696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 31215 30925 gene locus_tag LOCUS_11120 31215 30925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 31532 31320 gene locus_tag LOCUS_11130 31532 31320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 32160 31738 gene locus_tag LOCUS_11140 32160 31738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 33204 32275 gene locus_tag LOCUS_11150 33204 32275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 33572 33201 gene locus_tag LOCUS_11160 33572 33201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 34334 33756 gene locus_tag LOCUS_11170 34334 33756 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496987.1 protein_id gnl|my_center|LOCUS_11170 34702 34361 gene locus_tag LOCUS_11180 34702 34361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 >Feature sequence022 1183 632 gene locus_tag LOCUS_11190 1183 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 1988 1260 gene locus_tag LOCUS_11200 1988 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 3024 2134 gene locus_tag LOCUS_11210 3024 2134 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250267.1 protein_id gnl|my_center|LOCUS_11210 3502 3044 gene locus_tag LOCUS_11220 3502 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 4336 3557 gene locus_tag LOCUS_11230 gene cofE 4336 3557 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023428.1 protein_id gnl|my_center|LOCUS_11230 4873 4643 gene locus_tag LOCUS_11240 4873 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 5875 5009 gene locus_tag LOCUS_11250 5875 5009 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023435.1 protein_id gnl|my_center|LOCUS_11250 7135 5888 gene locus_tag LOCUS_11260 7135 5888 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924918.1 protein_id gnl|my_center|LOCUS_11260 7324 8034 gene locus_tag LOCUS_11270 7324 8034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 8429 8271 gene locus_tag LOCUS_11280 8429 8271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 8805 8461 gene locus_tag LOCUS_11290 8805 8461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 10528 8822 gene locus_tag LOCUS_11300 10528 8822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 11034 10525 gene locus_tag LOCUS_11310 11034 10525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 11324 11031 gene locus_tag LOCUS_11320 11324 11031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 11924 11355 gene locus_tag LOCUS_11330 11924 11355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 12330 12139 gene locus_tag LOCUS_11340 12330 12139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 13434 12370 gene locus_tag LOCUS_11350 13434 12370 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869629.1 protein_id gnl|my_center|LOCUS_11350 14567 13440 gene locus_tag LOCUS_11360 14567 13440 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249158.1 protein_id gnl|my_center|LOCUS_11360 14645 14729 gene locus_tag LOCUS_t00190 14645 14729 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15404 14733 gene locus_tag LOCUS_11370 15404 14733 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942096.1 protein_id gnl|my_center|LOCUS_11370 15715 15401 gene locus_tag LOCUS_11380 15715 15401 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880624.1 protein_id gnl|my_center|LOCUS_11380 15874 15719 gene locus_tag LOCUS_11390 15874 15719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 16157 15894 gene locus_tag LOCUS_11400 16157 15894 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_11400 16300 18852 gene locus_tag LOCUS_11410 gene cdhA 16300 18852 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879884.1 protein_id gnl|my_center|LOCUS_11410 18899 20641 gene locus_tag LOCUS_11420 18899 20641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 20645 20908 gene locus_tag LOCUS_11430 20645 20908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 21060 21398 gene locus_tag LOCUS_11440 21060 21398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 21399 21689 gene locus_tag LOCUS_11450 21399 21689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 21990 22583 gene locus_tag LOCUS_11460 21990 22583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 22642 24564 gene locus_tag LOCUS_11470 22642 24564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 24944 26560 gene locus_tag LOCUS_11480 gene dgt 24944 26560 CDS product dNTP triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774969.1 protein_id gnl|my_center|LOCUS_11480 26954 27121 gene locus_tag LOCUS_11490 26954 27121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 27189 27608 gene locus_tag LOCUS_11500 27189 27608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 27624 29342 gene locus_tag LOCUS_11510 27624 29342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 29864 30472 gene locus_tag LOCUS_11520 29864 30472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 30739 30951 gene locus_tag LOCUS_11530 30739 30951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 31121 32563 gene locus_tag LOCUS_11540 31121 32563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 33505 32591 gene locus_tag LOCUS_11550 33505 32591 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878796.1 protein_id gnl|my_center|LOCUS_11550 >Feature sequence023 295 1782 gene locus_tag LOCUS_11560 gene purF 295 1782 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065634.1 protein_id gnl|my_center|LOCUS_11560 1822 2958 gene locus_tag LOCUS_11570 1822 2958 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066217.1 protein_id gnl|my_center|LOCUS_11570 3160 3861 gene locus_tag LOCUS_11580 3160 3861 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546873.1 protein_id gnl|my_center|LOCUS_11580 4384 4250 gene locus_tag LOCUS_11590 4384 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 4562 5206 gene locus_tag LOCUS_11600 4562 5206 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024509.1 protein_id gnl|my_center|LOCUS_11600 5184 5537 gene locus_tag LOCUS_11610 5184 5537 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020403.1 protein_id gnl|my_center|LOCUS_11610 5534 9502 gene locus_tag LOCUS_11620 5534 9502 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094228360.1 protein_id gnl|my_center|LOCUS_11620 9509 10096 gene locus_tag LOCUS_11630 gene cbiT 9509 10096 CDS product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979887.1 protein_id gnl|my_center|LOCUS_11630 10093 10791 gene locus_tag LOCUS_11640 gene cobI 10093 10791 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876960.1 protein_id gnl|my_center|LOCUS_11640 10788 11516 gene locus_tag LOCUS_11650 gene cobM 10788 11516 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871103.1 protein_id gnl|my_center|LOCUS_11650 11513 11908 gene locus_tag LOCUS_11660 11513 11908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 11895 12287 gene locus_tag LOCUS_11670 11895 12287 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990686.1 protein_id gnl|my_center|LOCUS_11670 12275 13672 gene locus_tag LOCUS_11680 gene cobJ 12275 13672 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878227.1 protein_id gnl|my_center|LOCUS_11680 13951 17565 gene locus_tag LOCUS_11690 13951 17565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 17549 18028 gene locus_tag LOCUS_11700 17549 18028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 18034 21267 gene locus_tag LOCUS_11710 18034 21267 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_11710 21335 22405 gene locus_tag LOCUS_11720 21335 22405 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020570.1 protein_id gnl|my_center|LOCUS_11720 22872 22546 gene locus_tag LOCUS_11730 22872 22546 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869714.1 protein_id gnl|my_center|LOCUS_11730 23622 22930 gene locus_tag LOCUS_11740 23622 22930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 24030 23713 gene locus_tag LOCUS_11750 24030 23713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 24162 24614 gene locus_tag LOCUS_11760 24162 24614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 24799 25542 gene locus_tag LOCUS_11770 24799 25542 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024526.1 protein_id gnl|my_center|LOCUS_11770 27454 25553 gene locus_tag LOCUS_11780 gene dnaK 27454 25553 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582444.1 protein_id gnl|my_center|LOCUS_11780 29205 27568 gene locus_tag LOCUS_11790 gene thsB 29205 27568 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878948.1 protein_id gnl|my_center|LOCUS_11790 29280 29714 gene locus_tag LOCUS_11800 29280 29714 CDS product DUF61 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876580.1 protein_id gnl|my_center|LOCUS_11800 29722 30594 gene locus_tag LOCUS_11810 gene hemC 29722 30594 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878737.1 protein_id gnl|my_center|LOCUS_11810 <32771 30591 gene locus_tag LOCUS_11820 <32771 30591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021278.1:elongation factor EF-2 >Feature sequence024 3329 3018 gene locus_tag LOCUS_11830 3329 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 6862 4550 gene locus_tag LOCUS_11840 6862 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 7756 7460 gene locus_tag LOCUS_11850 7756 7460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 9132 7753 gene locus_tag LOCUS_11860 9132 7753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 9446 9129 gene locus_tag LOCUS_11870 9446 9129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 9811 9443 gene locus_tag LOCUS_11880 9811 9443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 10602 9946 gene locus_tag LOCUS_11890 10602 9946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 11039 10713 gene locus_tag LOCUS_11900 11039 10713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 11198 11052 gene locus_tag LOCUS_11910 11198 11052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 11449 11204 gene locus_tag LOCUS_11920 11449 11204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 11666 11439 gene locus_tag LOCUS_11930 11666 11439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 12946 11666 gene locus_tag LOCUS_11940 12946 11666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 14468 14253 gene locus_tag LOCUS_11950 14468 14253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 14731 15117 gene locus_tag LOCUS_11960 14731 15117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 15114 15353 gene locus_tag LOCUS_11970 15114 15353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 15356 15772 gene locus_tag LOCUS_11980 15356 15772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 15784 16140 gene locus_tag LOCUS_11990 15784 16140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 16106 16294 gene locus_tag LOCUS_12000 16106 16294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 16297 16728 gene locus_tag LOCUS_12010 16297 16728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 16729 17175 gene locus_tag LOCUS_12020 16729 17175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 17177 17317 gene locus_tag LOCUS_12030 17177 17317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 17359 18066 gene locus_tag LOCUS_12040 17359 18066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 18063 19586 gene locus_tag LOCUS_12050 18063 19586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 19588 20532 gene locus_tag LOCUS_12060 19588 20532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 20612 20971 gene locus_tag LOCUS_12070 20612 20971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 21062 21481 gene locus_tag LOCUS_12080 21062 21481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 21798 22910 gene locus_tag LOCUS_12090 21798 22910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 22903 23106 gene locus_tag LOCUS_12100 22903 23106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 23103 23261 gene locus_tag LOCUS_12110 23103 23261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 23839 25011 gene locus_tag LOCUS_12120 23839 25011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 25250 25645 gene locus_tag LOCUS_12130 25250 25645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 26151 25855 gene locus_tag LOCUS_12140 26151 25855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 27078 26164 gene locus_tag LOCUS_12150 27078 26164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 27533 27111 gene locus_tag LOCUS_12160 27533 27111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 28263 27535 gene locus_tag LOCUS_12170 28263 27535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 30236 28317 gene locus_tag LOCUS_12180 30236 28317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 30580 30233 gene locus_tag LOCUS_12190 30580 30233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 30947 30594 gene locus_tag LOCUS_12200 30947 30594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 31310 30996 gene locus_tag LOCUS_12210 31310 30996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 >Feature sequence025 140 1042 gene locus_tag LOCUS_12220 140 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 1103 2095 gene locus_tag LOCUS_12230 gene cas1b 1103 2095 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545370.1 protein_id gnl|my_center|LOCUS_12230 2096 2359 gene locus_tag LOCUS_12240 gene cas2 2096 2359 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582991.1 protein_id gnl|my_center|LOCUS_12240 2588 4959 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcgtagcctacctataagggattgaaa 5905 5039 gene locus_tag LOCUS_12250 5905 5039 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024306.1 protein_id gnl|my_center|LOCUS_12250 7210 5930 gene locus_tag LOCUS_12260 gene glyA 7210 5930 CDS product bifunctional serine hydroxymethyltransferase/L-allo-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871121.1 protein_id gnl|my_center|LOCUS_12260 8200 7271 gene locus_tag LOCUS_12270 gene pyrB 8200 7271 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064165.1 protein_id gnl|my_center|LOCUS_12270 8628 8350 gene locus_tag LOCUS_12280 gene albA 8628 8350 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879448.1 protein_id gnl|my_center|LOCUS_12280 9067 8684 gene locus_tag LOCUS_12290 gene hisI 9067 8684 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061191.1 protein_id gnl|my_center|LOCUS_12290 9996 9064 gene locus_tag LOCUS_12300 gene aglJ 9996 9064 CDS product S-layer glycoprotein N-glycosyltransferase AglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024210.1 protein_id gnl|my_center|LOCUS_12300 10614 10147 gene locus_tag LOCUS_12310 10614 10147 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065945.1 protein_id gnl|my_center|LOCUS_12310 10812 10618 gene locus_tag LOCUS_12320 10812 10618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 11898 10828 gene locus_tag LOCUS_12330 gene ftsZ 11898 10828 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064630.1 protein_id gnl|my_center|LOCUS_12330 12074 11990 gene locus_tag LOCUS_t00200 12074 11990 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13312 12101 gene locus_tag LOCUS_12340 gene larC 13312 12101 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020481.1 protein_id gnl|my_center|LOCUS_12340 14275 13406 gene locus_tag LOCUS_12350 gene dapF 14275 13406 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870630.1 protein_id gnl|my_center|LOCUS_12350 15299 14361 gene locus_tag LOCUS_12360 15299 14361 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877288.1 protein_id gnl|my_center|LOCUS_12360 16040 15309 gene locus_tag LOCUS_12370 16040 15309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 16663 16040 gene locus_tag LOCUS_12380 16663 16040 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878987.1 protein_id gnl|my_center|LOCUS_12380 17133 16666 gene locus_tag LOCUS_12390 17133 16666 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869872.1 protein_id gnl|my_center|LOCUS_12390 17211 18197 gene locus_tag LOCUS_12400 gene fen 17211 18197 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877775.1 protein_id gnl|my_center|LOCUS_12400 18824 19852 gene locus_tag LOCUS_12410 18824 19852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 19953 20990 gene locus_tag LOCUS_12420 19953 20990 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880716.1 protein_id gnl|my_center|LOCUS_12420 20995 21876 gene locus_tag LOCUS_12430 20995 21876 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082403.1 protein_id gnl|my_center|LOCUS_12430 22040 22114 gene locus_tag LOCUS_t00210 22040 22114 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 22899 22144 gene locus_tag LOCUS_12440 gene hisA 22899 22144 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020276.1 protein_id gnl|my_center|LOCUS_12440 23606 22905 gene locus_tag LOCUS_12450 23606 22905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 23858 23628 gene locus_tag LOCUS_12460 23858 23628 CDS product Gar1/Naf1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020658.1 protein_id gnl|my_center|LOCUS_12460 24039 24428 gene locus_tag LOCUS_12470 24039 24428 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022827.1 protein_id gnl|my_center|LOCUS_12470 24568 25719 gene locus_tag LOCUS_12480 24568 25719 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020259.1 protein_id gnl|my_center|LOCUS_12480 26108 25725 gene locus_tag LOCUS_12490 26108 25725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 26935 26177 gene locus_tag LOCUS_12500 gene udp 26935 26177 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250430.1 protein_id gnl|my_center|LOCUS_12500 27145 27399 gene locus_tag LOCUS_12510 27145 27399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 27415 27750 gene locus_tag LOCUS_12520 27415 27750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 28236 28335 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29041 29140 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29438 29809 gene locus_tag LOCUS_12530 29438 29809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 >Feature sequence026 72 1337 gene locus_tag LOCUS_12540 72 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 1430 1870 gene locus_tag LOCUS_12550 1430 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 1881 4607 gene locus_tag LOCUS_12560 1881 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 4604 5668 gene locus_tag LOCUS_12570 4604 5668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 5867 6754 gene locus_tag LOCUS_12580 5867 6754 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021396.1 protein_id gnl|my_center|LOCUS_12580 6860 7099 gene locus_tag LOCUS_12590 6860 7099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 7235 7438 gene locus_tag LOCUS_12600 7235 7438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 7461 8069 gene locus_tag LOCUS_12610 7461 8069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 8073 8591 gene locus_tag LOCUS_12620 8073 8591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 9957 8773 gene locus_tag LOCUS_12630 9957 8773 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022500.1 protein_id gnl|my_center|LOCUS_12630 10152 10526 gene locus_tag LOCUS_12640 10152 10526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 10660 11145 gene locus_tag LOCUS_12650 gene trmY 10660 11145 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871164.1 protein_id gnl|my_center|LOCUS_12650 11232 11156 gene locus_tag LOCUS_t00220 11232 11156 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 11771 11370 gene locus_tag LOCUS_12660 11771 11370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 11915 13141 gene locus_tag LOCUS_12670 11915 13141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 13300 13228 gene locus_tag LOCUS_t00230 13300 13228 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14168 13326 gene locus_tag LOCUS_12680 gene speB 14168 13326 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869807.1 protein_id gnl|my_center|LOCUS_12680 14924 14187 gene locus_tag LOCUS_12690 14924 14187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 15077 15976 gene locus_tag LOCUS_12700 15077 15976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 16652 16020 gene locus_tag LOCUS_12710 16652 16020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 17092 17838 gene locus_tag LOCUS_12720 17092 17838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12720 17847 18146 gene locus_tag LOCUS_12730 17847 18146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12730 18247 21627 gene locus_tag LOCUS_12740 18247 21627 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053708.1 protein_id gnl|my_center|LOCUS_12740 21799 22596 gene locus_tag LOCUS_12750 21799 22596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 22593 23159 gene locus_tag LOCUS_12760 22593 23159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 23170 24117 gene locus_tag LOCUS_12770 23170 24117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 24114 25133 gene locus_tag LOCUS_12780 24114 25133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 25355 25945 gene locus_tag LOCUS_12790 25355 25945 CDS product DUF3841 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459262.1 protein_id gnl|my_center|LOCUS_12790 25958 26290 gene locus_tag LOCUS_12800 25958 26290 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250024.1 protein_id gnl|my_center|LOCUS_12800 26292 26687 gene locus_tag LOCUS_12810 26292 26687 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140980.1 protein_id gnl|my_center|LOCUS_12810 26840 28225 gene locus_tag LOCUS_12820 26840 28225 CDS product lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679156.1 protein_id gnl|my_center|LOCUS_12820 28333 28539 gene locus_tag LOCUS_12830 28333 28539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 28526 28924 gene locus_tag LOCUS_12840 28526 28924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 29369 29100 gene locus_tag LOCUS_12850 29369 29100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 29490 29299 gene locus_tag LOCUS_12860 29490 29299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 29725 29480 gene locus_tag LOCUS_12870 29725 29480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 29991 29710 gene locus_tag LOCUS_12880 29991 29710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 31238 30006 gene locus_tag LOCUS_12890 31238 30006 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066384.1 protein_id gnl|my_center|LOCUS_12890 >Feature sequence027 684 556 gene locus_tag LOCUS_12900 684 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 1689 850 gene locus_tag LOCUS_12910 1689 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 2359 1700 gene locus_tag LOCUS_12920 2359 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12920 3319 2825 gene locus_tag LOCUS_12930 3319 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 3769 3413 gene locus_tag LOCUS_12940 3769 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 3921 3787 gene locus_tag LOCUS_12950 3921 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 4540 3914 gene locus_tag LOCUS_12960 4540 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 6084 4705 gene locus_tag LOCUS_12970 6084 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 7046 6129 gene locus_tag LOCUS_12980 7046 6129 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583585.1 protein_id gnl|my_center|LOCUS_12980 7126 7905 gene locus_tag LOCUS_12990 7126 7905 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061125.1 protein_id gnl|my_center|LOCUS_12990 8033 9406 gene locus_tag LOCUS_13000 8033 9406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 9219 9318 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9330 9758 gene locus_tag LOCUS_13010 9330 9758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13010 10148 9894 gene locus_tag LOCUS_13020 10148 9894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 10856 10170 gene locus_tag LOCUS_13030 10856 10170 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023984.1 protein_id gnl|my_center|LOCUS_13030 10985 11590 gene locus_tag LOCUS_13040 10985 11590 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879329.1 protein_id gnl|my_center|LOCUS_13040 11843 11658 gene locus_tag LOCUS_13050 11843 11658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 12166 11840 gene locus_tag LOCUS_13060 12166 11840 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141424.1 protein_id gnl|my_center|LOCUS_13060 14178 12244 gene locus_tag LOCUS_13070 14178 12244 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881159.1 protein_id gnl|my_center|LOCUS_13070 14437 14231 gene locus_tag LOCUS_13080 14437 14231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 14727 14398 gene locus_tag LOCUS_13090 14727 14398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 14925 15734 gene locus_tag LOCUS_13100 14925 15734 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546052.1 protein_id gnl|my_center|LOCUS_13100 17540 15759 gene locus_tag LOCUS_13110 gene infB 17540 15759 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065143.1 protein_id gnl|my_center|LOCUS_13110 18842 17610 gene locus_tag LOCUS_13120 gene dnaJ 18842 17610 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_13120 19032 19472 gene locus_tag LOCUS_13130 19032 19472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 20210 19644 gene locus_tag LOCUS_13140 20210 19644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 20629 20183 gene locus_tag LOCUS_13150 20629 20183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 20989 20657 gene locus_tag LOCUS_13160 20989 20657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 21755 20991 gene locus_tag LOCUS_13170 21755 20991 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020130.1 protein_id gnl|my_center|LOCUS_13170 22804 21758 gene locus_tag LOCUS_13180 22804 21758 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065828.1 protein_id gnl|my_center|LOCUS_13180 24322 22982 gene locus_tag LOCUS_13190 24322 22982 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250233.1 protein_id gnl|my_center|LOCUS_13190 25187 24417 gene locus_tag LOCUS_13200 25187 24417 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878917.1 protein_id gnl|my_center|LOCUS_13200 25291 25731 gene locus_tag LOCUS_13210 25291 25731 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583024.1 protein_id gnl|my_center|LOCUS_13210 26634 25699 gene locus_tag LOCUS_13220 26634 25699 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876019.1 protein_id gnl|my_center|LOCUS_13220 28480 26636 gene locus_tag LOCUS_13230 gene glmS 28480 26636 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022962.1 protein_id gnl|my_center|LOCUS_13230 29719 28526 gene locus_tag LOCUS_13240 29719 28526 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022961.1 protein_id gnl|my_center|LOCUS_13240 31102 29891 gene locus_tag LOCUS_13250 31102 29891 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022964.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence028 1621 701 gene locus_tag LOCUS_13260 gene rnz 1621 701 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022970.1 protein_id gnl|my_center|LOCUS_13260 2561 1710 gene locus_tag LOCUS_13270 2561 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 2735 3649 gene locus_tag LOCUS_13280 2735 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875877.1 protein_id gnl|my_center|LOCUS_13280 3898 4194 gene locus_tag LOCUS_13290 3898 4194 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249456.1 protein_id gnl|my_center|LOCUS_13290 4191 4412 gene locus_tag LOCUS_13300 4191 4412 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249455.1 protein_id gnl|my_center|LOCUS_13300 5191 4799 gene locus_tag LOCUS_13310 5191 4799 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867448.1 protein_id gnl|my_center|LOCUS_13310 6454 5456 gene locus_tag LOCUS_13320 gene idsA 6454 5456 CDS product short chain isoprenyl diphosphate synthase IdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875690.1 protein_id gnl|my_center|LOCUS_13320 6831 6538 gene locus_tag LOCUS_13330 6831 6538 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066210.1 protein_id gnl|my_center|LOCUS_13330 7083 7262 gene locus_tag LOCUS_13340 7083 7262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 7584 8924 gene locus_tag LOCUS_13350 7584 8924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064846.1 protein_id gnl|my_center|LOCUS_13350 8975 9631 gene locus_tag LOCUS_13360 8975 9631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 9576 9806 gene locus_tag LOCUS_13370 9576 9806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 9803 11083 gene locus_tag LOCUS_13380 9803 11083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 11085 11750 gene locus_tag LOCUS_13390 11085 11750 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878518.1 protein_id gnl|my_center|LOCUS_13390 11747 12937 gene locus_tag LOCUS_13400 11747 12937 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496851.1 protein_id gnl|my_center|LOCUS_13400 12982 13332 gene locus_tag LOCUS_13410 12982 13332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 13355 13969 gene locus_tag LOCUS_13420 13355 13969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 13999 15054 gene locus_tag LOCUS_13430 13999 15054 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530666.1 protein_id gnl|my_center|LOCUS_13430 16413 16228 gene locus_tag LOCUS_13440 16413 16228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 16993 17175 gene locus_tag LOCUS_13450 16993 17175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 17258 18700 gene locus_tag LOCUS_13460 17258 18700 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965302.1 protein_id gnl|my_center|LOCUS_13460 18911 18762 gene locus_tag LOCUS_13470 18911 18762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 19035 19793 gene locus_tag LOCUS_13480 19035 19793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 19759 19956 gene locus_tag LOCUS_13490 19759 19956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 20069 20989 gene locus_tag LOCUS_13500 20069 20989 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963464.1 protein_id gnl|my_center|LOCUS_13500 20986 21696 gene locus_tag LOCUS_13510 20986 21696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 21714 22592 gene locus_tag LOCUS_13520 21714 22592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 22685 23095 gene locus_tag LOCUS_13530 22685 23095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 23105 23623 gene locus_tag LOCUS_13540 23105 23623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 23888 24160 gene locus_tag LOCUS_13550 23888 24160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 24175 24816 gene locus_tag LOCUS_13560 24175 24816 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065150.1 protein_id gnl|my_center|LOCUS_13560 24817 25962 gene locus_tag LOCUS_13570 24817 25962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 25959 26639 gene locus_tag LOCUS_13580 25959 26639 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_13580 26793 27914 gene locus_tag LOCUS_13590 26793 27914 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064319.1 protein_id gnl|my_center|LOCUS_13590 29132 27942 gene locus_tag LOCUS_13600 gene ahbC 29132 27942 CDS product 12,18-didecarboxysiroheme deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938157.1 protein_id gnl|my_center|LOCUS_13600 29354 29569 gene locus_tag LOCUS_13610 29354 29569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 >Feature sequence029 1943 2614 gene locus_tag LOCUS_13620 1943 2614 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_13620 3184 3753 gene locus_tag LOCUS_13630 3184 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 3777 4061 gene locus_tag LOCUS_13640 3777 4061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 4062 4244 gene locus_tag LOCUS_13650 4062 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 4745 5677 gene locus_tag LOCUS_13660 4745 5677 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113718.1 protein_id gnl|my_center|LOCUS_13660 5778 6800 gene locus_tag LOCUS_13670 5778 6800 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088171.1 protein_id gnl|my_center|LOCUS_13670 6887 7738 gene locus_tag LOCUS_13680 gene rfbD 6887 7738 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868299.1 protein_id gnl|my_center|LOCUS_13680 8346 7804 gene locus_tag LOCUS_13690 gene rfbC 8346 7804 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_13690 9420 10103 gene locus_tag LOCUS_13700 9420 10103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 11618 10653 gene locus_tag LOCUS_13710 11618 10653 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887356.1 protein_id gnl|my_center|LOCUS_13710 12327 11620 gene locus_tag LOCUS_13720 12327 11620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 13252 13052 gene locus_tag LOCUS_13730 13252 13052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 13515 13357 gene locus_tag LOCUS_13740 13515 13357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 14169 15314 gene locus_tag LOCUS_13750 14169 15314 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879224.1 protein_id gnl|my_center|LOCUS_13750 15463 16290 gene locus_tag LOCUS_13760 15463 16290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 16360 16716 gene locus_tag LOCUS_13770 16360 16716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 16812 18431 gene locus_tag LOCUS_13780 16812 18431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 21181 20207 gene locus_tag LOCUS_13790 21181 20207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 21237 21425 gene locus_tag LOCUS_13800 21237 21425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 23374 23601 gene locus_tag LOCUS_13810 23374 23601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 24311 23745 gene locus_tag LOCUS_13820 24311 23745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 24586 24885 gene locus_tag LOCUS_13830 24586 24885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 25165 25413 gene locus_tag LOCUS_13840 25165 25413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 25586 25816 gene locus_tag LOCUS_13850 25586 25816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 26627 26103 gene locus_tag LOCUS_13860 26627 26103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 27634 26951 gene locus_tag LOCUS_13870 27634 26951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 28059 27610 gene locus_tag LOCUS_13880 28059 27610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 28691 28203 gene locus_tag LOCUS_13890 28691 28203 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080594.1 protein_id gnl|my_center|LOCUS_13890 >Feature sequence030 538 2682 gene locus_tag LOCUS_13900 538 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 2857 4947 gene locus_tag LOCUS_13910 2857 4947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 6133 5069 gene locus_tag LOCUS_13920 gene cobT 6133 5069 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258437.1 protein_id gnl|my_center|LOCUS_13920 7433 6135 gene locus_tag LOCUS_13930 gene cbpB 7433 6135 CDS product peptide-modifying radical SAM enzyme CbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879693.1 protein_id gnl|my_center|LOCUS_13930 7718 8665 gene locus_tag LOCUS_13940 7718 8665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460554.1 protein_id gnl|my_center|LOCUS_13940 8896 10062 gene locus_tag LOCUS_13950 8896 10062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 10898 10068 gene locus_tag LOCUS_13960 10898 10068 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066246.1 protein_id gnl|my_center|LOCUS_13960 11066 11605 gene locus_tag LOCUS_13970 11066 11605 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023175.1 protein_id gnl|my_center|LOCUS_13970 11990 11694 gene locus_tag LOCUS_13980 11990 11694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 13132 12062 gene locus_tag LOCUS_13990 13132 12062 CDS product TRM11 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020267.1 protein_id gnl|my_center|LOCUS_13990 13219 14127 gene locus_tag LOCUS_14000 gene pdxS 13219 14127 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065155.1 protein_id gnl|my_center|LOCUS_14000 15121 14180 gene locus_tag LOCUS_14010 15121 14180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 15206 15391 gene locus_tag LOCUS_14020 15206 15391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 16159 15716 gene locus_tag LOCUS_14030 16159 15716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 16566 16378 gene locus_tag LOCUS_14040 16566 16378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 17642 16563 gene locus_tag LOCUS_14050 gene priL 17642 16563 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020168.1 protein_id gnl|my_center|LOCUS_14050 18460 17672 gene locus_tag LOCUS_14060 18460 17672 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020169.1 protein_id gnl|my_center|LOCUS_14060 18539 19693 gene locus_tag LOCUS_14070 gene mfnA 18539 19693 CDS product tyrosine decarboxylase MfnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020065.1 protein_id gnl|my_center|LOCUS_14070 19769 21241 gene locus_tag LOCUS_14080 19769 21241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 21884 21216 gene locus_tag LOCUS_14090 21884 21216 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878079.1 protein_id gnl|my_center|LOCUS_14090 22440 22009 gene locus_tag LOCUS_14100 22440 22009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 22933 25758 gene locus_tag LOCUS_14110 22933 25758 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762372.1 protein_id gnl|my_center|LOCUS_14110 26816 25926 gene locus_tag LOCUS_14120 gene hisG 26816 25926 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545705.1 protein_id gnl|my_center|LOCUS_14120 26968 27192 gene locus_tag LOCUS_14130 26968 27192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 27323 28783 gene locus_tag LOCUS_14140 27323 28783 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021497.1 protein_id gnl|my_center|LOCUS_14140 >Feature sequence031 1380 433 gene locus_tag LOCUS_14150 gene rfbB 1380 433 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_14150 1561 1412 gene locus_tag LOCUS_14160 1561 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 2511 1561 gene locus_tag LOCUS_14170 2511 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14170 3303 2824 gene locus_tag LOCUS_14180 3303 2824 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877830.1 protein_id gnl|my_center|LOCUS_14180 4185 3334 gene locus_tag LOCUS_14190 gene rfbD 4185 3334 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868299.1 protein_id gnl|my_center|LOCUS_14190 5292 4231 gene locus_tag LOCUS_14200 5292 4231 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868292.1 protein_id gnl|my_center|LOCUS_14200 7022 5334 gene locus_tag LOCUS_14210 7022 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 7196 7044 gene locus_tag LOCUS_14220 7196 7044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 8900 7614 gene locus_tag LOCUS_14230 gene fabF 8900 7614 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_14230 9850 8900 gene locus_tag LOCUS_14240 gene fabD 9850 8900 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546099.1 protein_id gnl|my_center|LOCUS_14240 10307 9843 gene locus_tag LOCUS_14250 10307 9843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 11562 10300 gene locus_tag LOCUS_14260 gene fabF 11562 10300 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_14260 12014 11574 gene locus_tag LOCUS_14270 gene fabZ 12014 11574 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931959.1 protein_id gnl|my_center|LOCUS_14270 12430 12011 gene locus_tag LOCUS_14280 12430 12011 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393656.1 protein_id gnl|my_center|LOCUS_14280 12827 12423 gene locus_tag LOCUS_14290 12827 12423 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946108.1 protein_id gnl|my_center|LOCUS_14290 13467 12829 gene locus_tag LOCUS_14300 13467 12829 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454888.1 protein_id gnl|my_center|LOCUS_14300 14242 13469 gene locus_tag LOCUS_14310 gene fabG 14242 13469 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 protein_id gnl|my_center|LOCUS_14310 14691 15707 gene locus_tag LOCUS_14320 14691 15707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 16638 15724 gene locus_tag LOCUS_14330 16638 15724 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319540.1 protein_id gnl|my_center|LOCUS_14330 17221 16652 gene locus_tag LOCUS_14340 17221 16652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 17369 17205 gene locus_tag LOCUS_14350 17369 17205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 18607 17366 gene locus_tag LOCUS_14360 18607 17366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 19008 19232 gene locus_tag LOCUS_14370 19008 19232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 19235 19378 gene locus_tag LOCUS_14380 19235 19378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 19907 20596 gene locus_tag LOCUS_14390 19907 20596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 20803 21996 gene locus_tag LOCUS_14400 20803 21996 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878787.1 protein_id gnl|my_center|LOCUS_14400 22014 22442 gene locus_tag LOCUS_14410 22014 22442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 22474 23334 gene locus_tag LOCUS_14420 22474 23334 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_14420 23371 24165 gene locus_tag LOCUS_14430 23371 24165 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816058.1 protein_id gnl|my_center|LOCUS_14430 24649 24365 gene locus_tag LOCUS_14440 24649 24365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14440 27388 24719 gene locus_tag LOCUS_14450 27388 24719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 27585 28727 gene locus_tag LOCUS_14460 27585 28727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 28853 28926 gene locus_tag LOCUS_t00240 28853 28926 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence032 350 275 gene locus_tag LOCUS_t00250 350 275 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1389 460 gene locus_tag LOCUS_14470 gene nadA 1389 460 CDS product quinolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496486.1 protein_id gnl|my_center|LOCUS_14470 1607 2887 gene locus_tag LOCUS_14480 1607 2887 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053195.1 protein_id gnl|my_center|LOCUS_14480 2871 3005 gene locus_tag LOCUS_14490 2871 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 3162 6146 gene locus_tag LOCUS_14500 3162 6146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 6266 7411 gene locus_tag LOCUS_14510 6266 7411 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065244.1 protein_id gnl|my_center|LOCUS_14510 7679 8149 gene locus_tag LOCUS_14520 7679 8149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 8173 10050 gene locus_tag LOCUS_14530 8173 10050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 11480 10170 gene locus_tag LOCUS_14540 11480 10170 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250416.1 protein_id gnl|my_center|LOCUS_14540 13275 11854 gene locus_tag LOCUS_14550 13275 11854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 19181 13272 gene locus_tag LOCUS_14560 19181 13272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 20433 19468 gene locus_tag LOCUS_14570 gene mch 20433 19468 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021714.1 protein_id gnl|my_center|LOCUS_14570 21764 20523 gene locus_tag LOCUS_14580 21764 20523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 21935 22492 gene locus_tag LOCUS_14590 gene hdrC 21935 22492 CDS product CoB--CoM heterodisulfide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870249.1 protein_id gnl|my_center|LOCUS_14590 22493 23383 gene locus_tag LOCUS_14600 gene hdrB 22493 23383 CDS product CoB--CoM heterodisulfide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877481.1 protein_id gnl|my_center|LOCUS_14600 23678 23454 gene locus_tag LOCUS_14610 23678 23454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 24074 23763 gene locus_tag LOCUS_14620 gene rpsJ 24074 23763 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021276.1 protein_id gnl|my_center|LOCUS_14620 25412 24147 gene locus_tag LOCUS_14630 gene tuf 25412 24147 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021277.1 protein_id gnl|my_center|LOCUS_14630 25587 26495 gene locus_tag LOCUS_14640 25587 26495 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496419.1 protein_id gnl|my_center|LOCUS_14640 26515 27699 gene locus_tag LOCUS_14650 26515 27699 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074554312.1 protein_id gnl|my_center|LOCUS_14650 27647 28546 gene locus_tag LOCUS_14660 27647 28546 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082088944.1 protein_id gnl|my_center|LOCUS_14660 >Feature sequence033 1184 162 gene locus_tag LOCUS_14670 1184 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485789.1 protein_id gnl|my_center|LOCUS_14670 1308 1898 gene locus_tag LOCUS_14680 1308 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 2029 2331 gene locus_tag LOCUS_14690 2029 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 2328 2837 gene locus_tag LOCUS_14700 2328 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 3167 4228 gene locus_tag LOCUS_14710 3167 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 4233 4799 gene locus_tag LOCUS_14720 4233 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 4990 4919 gene locus_tag LOCUS_t00260 4990 4919 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 5056 5784 gene locus_tag LOCUS_14730 gene aroD 5056 5784 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024466.1 protein_id gnl|my_center|LOCUS_14730 6148 5765 gene locus_tag LOCUS_14740 6148 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 6588 7544 gene locus_tag LOCUS_14750 6588 7544 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_14750 8027 7569 gene locus_tag LOCUS_14760 8027 7569 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421374.1 protein_id gnl|my_center|LOCUS_14760 9514 8099 gene locus_tag LOCUS_14770 9514 8099 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870510.1 protein_id gnl|my_center|LOCUS_14770 9584 9657 gene locus_tag LOCUS_t00270 9584 9657 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 9663 10124 gene locus_tag LOCUS_14780 gene pyrI 9663 10124 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060913.1 protein_id gnl|my_center|LOCUS_14780 10124 10196 gene locus_tag LOCUS_t00280 10124 10196 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 10139 11419 gene locus_tag LOCUS_14790 gene coaBC 10139 11419 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065075.1 protein_id gnl|my_center|LOCUS_14790 12573 11548 gene locus_tag LOCUS_14800 gene thiL 12573 11548 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066048.1 protein_id gnl|my_center|LOCUS_14800 12778 13572 gene locus_tag LOCUS_14810 gene larB 12778 13572 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869660.1 protein_id gnl|my_center|LOCUS_14810 13612 14802 gene locus_tag LOCUS_14820 13612 14802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 15448 14903 gene locus_tag LOCUS_14830 15448 14903 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023239.1 protein_id gnl|my_center|LOCUS_14830 15684 16166 gene locus_tag LOCUS_14840 15684 16166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 16718 16326 gene locus_tag LOCUS_14850 16718 16326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 18431 17124 gene locus_tag LOCUS_14860 18431 17124 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591983.1 protein_id gnl|my_center|LOCUS_14860 18477 18701 gene locus_tag LOCUS_14870 18477 18701 CDS product Sm protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021429.1 protein_id gnl|my_center|LOCUS_14870 18698 19546 gene locus_tag LOCUS_14880 gene proC 18698 19546 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_14880 19587 20552 gene locus_tag LOCUS_14890 19587 20552 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023440.1 protein_id gnl|my_center|LOCUS_14890 20570 20965 gene locus_tag LOCUS_14900 20570 20965 CDS product AIR carboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021394.1 protein_id gnl|my_center|LOCUS_14900 21427 21008 gene locus_tag LOCUS_14910 21427 21008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 22449 21880 gene locus_tag LOCUS_14920 22449 21880 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023634.1 protein_id gnl|my_center|LOCUS_14920 23616 22453 gene locus_tag LOCUS_14930 23616 22453 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 protein_id gnl|my_center|LOCUS_14930 24655 23618 gene locus_tag LOCUS_14940 24655 23618 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060900.1 protein_id gnl|my_center|LOCUS_14940 24796 25926 gene locus_tag LOCUS_14950 24796 25926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 27405 26125 gene locus_tag LOCUS_14960 27405 26125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263397.1 protein_id gnl|my_center|LOCUS_14960 28583 27501 gene locus_tag LOCUS_14970 28583 27501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 >Feature sequence034 1500 2552 gene locus_tag LOCUS_14980 1500 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 2672 3469 gene locus_tag LOCUS_14990 2672 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 3577 3966 gene locus_tag LOCUS_15000 3577 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 3963 4625 gene locus_tag LOCUS_15010 3963 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 4965 6029 gene locus_tag LOCUS_15020 gene dcm 4965 6029 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690264.1 protein_id gnl|my_center|LOCUS_15020 6134 7225 gene locus_tag LOCUS_15030 6134 7225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 7807 7382 gene locus_tag LOCUS_15040 7807 7382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 8383 9543 gene locus_tag LOCUS_15050 8383 9543 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760485.1 protein_id gnl|my_center|LOCUS_15050 9914 9663 gene locus_tag LOCUS_15060 9914 9663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 10042 13644 gene locus_tag LOCUS_15070 10042 13644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 14348 14037 gene locus_tag LOCUS_15080 14348 14037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 14518 14838 gene locus_tag LOCUS_15090 14518 14838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 15736 14966 gene locus_tag LOCUS_15100 15736 14966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 17091 15772 gene locus_tag LOCUS_15110 17091 15772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 20861 17604 gene locus_tag LOCUS_15120 20861 17604 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861850.1 protein_id gnl|my_center|LOCUS_15120 22890 20899 gene locus_tag LOCUS_15130 22890 20899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 22919 25420 gene locus_tag LOCUS_15140 22919 25420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 25425 26318 gene locus_tag LOCUS_15150 25425 26318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 26421 26618 gene locus_tag LOCUS_15160 26421 26618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 >Feature sequence035 610 305 gene locus_tag LOCUS_15170 610 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 1254 1481 gene locus_tag LOCUS_15180 1254 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 2373 1846 gene locus_tag LOCUS_15190 2373 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 3903 2491 gene locus_tag LOCUS_15200 gene purD 3903 2491 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249159.1 protein_id gnl|my_center|LOCUS_15200 3982 4353 gene locus_tag LOCUS_15210 3982 4353 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878647.1 protein_id gnl|my_center|LOCUS_15210 4460 5968 gene locus_tag LOCUS_15220 4460 5968 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053651.1 protein_id gnl|my_center|LOCUS_15220 6043 6567 gene locus_tag LOCUS_15230 6043 6567 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879393.1 protein_id gnl|my_center|LOCUS_15230 7102 6698 gene locus_tag LOCUS_15240 7102 6698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 8441 7485 gene locus_tag LOCUS_15250 gene htpX 8441 7485 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022098.1 protein_id gnl|my_center|LOCUS_15250 8597 9343 gene locus_tag LOCUS_15260 8597 9343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 9344 9619 gene locus_tag LOCUS_15270 9344 9619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 10875 9655 gene locus_tag LOCUS_15280 10875 9655 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020191.1 protein_id gnl|my_center|LOCUS_15280 10962 11534 gene locus_tag LOCUS_15290 10962 11534 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876850.1 protein_id gnl|my_center|LOCUS_15290 12521 11574 gene locus_tag LOCUS_15300 gene radA 12521 11574 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023460.1 protein_id gnl|my_center|LOCUS_15300 13107 12607 gene locus_tag LOCUS_15310 13107 12607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 14092 13139 gene locus_tag LOCUS_15320 14092 13139 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466843.1 protein_id gnl|my_center|LOCUS_15320 15454 14177 gene locus_tag LOCUS_15330 15454 14177 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771113.1 protein_id gnl|my_center|LOCUS_15330 15776 15558 gene locus_tag LOCUS_15340 15776 15558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 16069 15761 gene locus_tag LOCUS_15350 16069 15761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 16285 16968 gene locus_tag LOCUS_15360 16285 16968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 17014 17613 gene locus_tag LOCUS_15370 17014 17613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 19031 17682 gene locus_tag LOCUS_15380 19031 17682 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023992.1 protein_id gnl|my_center|LOCUS_15380 19981 19193 gene locus_tag LOCUS_15390 gene sppA 19981 19193 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876441.1 protein_id gnl|my_center|LOCUS_15390 20544 19978 gene locus_tag LOCUS_15400 20544 19978 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023327.1 protein_id gnl|my_center|LOCUS_15400 21518 20568 gene locus_tag LOCUS_15410 21518 20568 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475460.1 protein_id gnl|my_center|LOCUS_15410 21909 22832 gene locus_tag LOCUS_15420 21909 22832 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879317.1 protein_id gnl|my_center|LOCUS_15420 22939 23334 gene locus_tag LOCUS_15430 22939 23334 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870773.1 protein_id gnl|my_center|LOCUS_15430 24467 23466 gene locus_tag LOCUS_15440 gene amrS 24467 23466 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023404.1 protein_id gnl|my_center|LOCUS_15440 25747 24458 gene locus_tag LOCUS_15450 25747 24458 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020758.1 protein_id gnl|my_center|LOCUS_15450 25913 26176 gene locus_tag LOCUS_15460 25913 26176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 26192 26518 gene locus_tag LOCUS_15470 26192 26518 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248961.1 protein_id gnl|my_center|LOCUS_15470 26716 26471 gene locus_tag LOCUS_15480 26716 26471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 28135 26789 gene locus_tag LOCUS_15490 gene thiD 28135 26789 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023132.1 protein_id gnl|my_center|LOCUS_15490 >Feature sequence036 1078 179 gene locus_tag LOCUS_15500 1078 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 1783 1085 gene locus_tag LOCUS_15510 1783 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 2172 1843 gene locus_tag LOCUS_15520 2172 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 4246 2282 gene locus_tag LOCUS_15530 4246 2282 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980092.1 protein_id gnl|my_center|LOCUS_15530 5449 4262 gene locus_tag LOCUS_15540 gene trxB 5449 4262 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272320.1 protein_id gnl|my_center|LOCUS_15540 6532 5465 gene locus_tag LOCUS_15550 6532 5465 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141167.1 protein_id gnl|my_center|LOCUS_15550 7477 6545 gene locus_tag LOCUS_15560 gene gnd 7477 6545 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392797.1 protein_id gnl|my_center|LOCUS_15560 7751 8050 gene locus_tag LOCUS_15570 7751 8050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 8182 8403 gene locus_tag LOCUS_15580 8182 8403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 9376 8741 gene locus_tag LOCUS_15590 9376 8741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 10162 9380 gene locus_tag LOCUS_15600 10162 9380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 10442 11314 gene locus_tag LOCUS_15610 gene amrS 10442 11314 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942373.1 protein_id gnl|my_center|LOCUS_15610 13504 11381 gene locus_tag LOCUS_15620 13504 11381 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948731.1 protein_id gnl|my_center|LOCUS_15620 14306 13611 gene locus_tag LOCUS_15630 14306 13611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 14402 14593 gene locus_tag LOCUS_15640 14402 14593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 15665 15453 gene locus_tag LOCUS_15650 15665 15453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 15779 16114 gene locus_tag LOCUS_15660 15779 16114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 16207 17064 gene locus_tag LOCUS_15670 16207 17064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 17849 17067 gene locus_tag LOCUS_15680 17849 17067 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545091.1 protein_id gnl|my_center|LOCUS_15680 18835 17855 gene locus_tag LOCUS_15690 18835 17855 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018271.1 protein_id gnl|my_center|LOCUS_15690 18978 20024 gene locus_tag LOCUS_15700 18978 20024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 20018 20857 gene locus_tag LOCUS_15710 20018 20857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 21437 21012 gene locus_tag LOCUS_15720 21437 21012 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061150.1 protein_id gnl|my_center|LOCUS_15720 21557 22252 gene locus_tag LOCUS_15730 21557 22252 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444597.1 protein_id gnl|my_center|LOCUS_15730 22288 22491 gene locus_tag LOCUS_15740 22288 22491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 22845 23033 gene locus_tag LOCUS_15750 22845 23033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 23105 24121 gene locus_tag LOCUS_15760 23105 24121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 24713 24399 gene locus_tag LOCUS_15770 24713 24399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 24787 24860 gene locus_tag LOCUS_t00290 24787 24860 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 25019 26227 gene locus_tag LOCUS_15780 gene cysS 25019 26227 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249399.1 protein_id gnl|my_center|LOCUS_15780 26236 26439 gene locus_tag LOCUS_15790 26236 26439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 27509 26658 gene locus_tag LOCUS_15800 27509 26658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 27632 27940 gene locus_tag LOCUS_15810 27632 27940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 >Feature sequence037 1425 202 gene locus_tag LOCUS_15820 1425 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 1814 2158 gene locus_tag LOCUS_15830 1814 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 2158 2925 gene locus_tag LOCUS_15840 2158 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 3394 2966 gene locus_tag LOCUS_15850 gene rimI 3394 2966 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868792.1 protein_id gnl|my_center|LOCUS_15850 4267 3398 gene locus_tag LOCUS_15860 4267 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 4511 4753 gene locus_tag LOCUS_15870 4511 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 4750 5133 gene locus_tag LOCUS_15880 4750 5133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 6379 5198 gene locus_tag LOCUS_15890 6379 5198 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021498.1 protein_id gnl|my_center|LOCUS_15890 6460 7275 gene locus_tag LOCUS_15900 6460 7275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 9068 7299 gene locus_tag LOCUS_15910 9068 7299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 9237 9518 gene locus_tag LOCUS_15920 9237 9518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 9519 10394 gene locus_tag LOCUS_15930 9519 10394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 12208 10391 gene locus_tag LOCUS_15940 12208 10391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 12409 13713 gene locus_tag LOCUS_15950 12409 13713 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867468.1 protein_id gnl|my_center|LOCUS_15950 13717 15177 gene locus_tag LOCUS_15960 13717 15177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 15572 15198 gene locus_tag LOCUS_15970 15572 15198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 15914 15573 gene locus_tag LOCUS_15980 15914 15573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 16262 15918 gene locus_tag LOCUS_15990 16262 15918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 18424 16397 gene locus_tag LOCUS_16000 18424 16397 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870456.1 protein_id gnl|my_center|LOCUS_16000 18684 18475 gene locus_tag LOCUS_16010 18684 18475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 18979 20697 gene locus_tag LOCUS_16020 18979 20697 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_238581565.1 protein_id gnl|my_center|LOCUS_16020 21186 20803 gene locus_tag LOCUS_16030 21186 20803 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869637.1 protein_id gnl|my_center|LOCUS_16030 21512 21183 gene locus_tag LOCUS_16040 21512 21183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 21903 21598 gene locus_tag LOCUS_16050 21903 21598 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546611.1 protein_id gnl|my_center|LOCUS_16050 22773 21949 gene locus_tag LOCUS_16060 gene rsmA 22773 21949 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867501.1 protein_id gnl|my_center|LOCUS_16060 22955 23902 gene locus_tag LOCUS_16070 22955 23902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 23899 24744 gene locus_tag LOCUS_16080 23899 24744 CDS product DUF2099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022219.1 protein_id gnl|my_center|LOCUS_16080 25638 24907 gene locus_tag LOCUS_16090 gene queC 25638 24907 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272362.1 protein_id gnl|my_center|LOCUS_16090 26272 25772 gene locus_tag LOCUS_16100 26272 25772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 27723 26386 gene locus_tag LOCUS_16110 27723 26386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 >Feature sequence038 1733 1074 gene locus_tag LOCUS_16120 1733 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 1800 2378 gene locus_tag LOCUS_16130 1800 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 4351 2396 gene locus_tag LOCUS_16140 4351 2396 CDS product cytochrome c-type biogenesis CcmF C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938349.1 protein_id gnl|my_center|LOCUS_16140 4780 4355 gene locus_tag LOCUS_16150 4780 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 5438 4791 gene locus_tag LOCUS_16160 5438 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 5487 6755 gene locus_tag LOCUS_16170 5487 6755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 6787 9033 gene locus_tag LOCUS_16180 6787 9033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 9043 10131 gene locus_tag LOCUS_16190 9043 10131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 10780 10244 gene locus_tag LOCUS_16200 10780 10244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 11640 10855 gene locus_tag LOCUS_16210 11640 10855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 13097 11808 gene locus_tag LOCUS_16220 13097 11808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 13759 13103 gene locus_tag LOCUS_16230 13759 13103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 14504 13761 gene locus_tag LOCUS_16240 14504 13761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 15043 14585 gene locus_tag LOCUS_16250 15043 14585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 15166 15594 gene locus_tag LOCUS_16260 15166 15594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 15725 16561 gene locus_tag LOCUS_16270 15725 16561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 16925 17242 gene locus_tag LOCUS_16280 16925 17242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 17239 17466 gene locus_tag LOCUS_16290 17239 17466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 18607 17723 gene locus_tag LOCUS_16300 18607 17723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 18846 18631 gene locus_tag LOCUS_16310 18846 18631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 19681 18809 gene locus_tag LOCUS_16320 19681 18809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 20613 19783 gene locus_tag LOCUS_16330 20613 19783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 21602 20820 gene locus_tag LOCUS_16340 21602 20820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 22308 22592 gene locus_tag LOCUS_16350 22308 22592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 22595 23140 gene locus_tag LOCUS_16360 22595 23140 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249167.1 protein_id gnl|my_center|LOCUS_16360 23711 23334 gene locus_tag LOCUS_16370 23711 23334 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259069.1 protein_id gnl|my_center|LOCUS_16370 23998 23786 gene locus_tag LOCUS_16380 23998 23786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 24123 24338 gene locus_tag LOCUS_16390 24123 24338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 24930 24355 gene locus_tag LOCUS_16400 24930 24355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 25213 24944 gene locus_tag LOCUS_16410 25213 24944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 25503 26612 gene locus_tag LOCUS_16420 gene ahbD 25503 26612 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_16420 26649 27140 gene locus_tag LOCUS_16430 26649 27140 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966079.1 protein_id gnl|my_center|LOCUS_16430 27137 27619 gene locus_tag LOCUS_16440 gene ahbB 27137 27619 CDS product siroheme decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064915.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence039 494 593 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2243 1227 gene locus_tag LOCUS_16450 2243 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 3247 2408 gene locus_tag LOCUS_16460 3247 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 4526 3381 gene locus_tag LOCUS_16470 gene ftsZ 4526 3381 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023772.1 protein_id gnl|my_center|LOCUS_16470 4669 5574 gene locus_tag LOCUS_16480 4669 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 5594 6298 gene locus_tag LOCUS_16490 5594 6298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 6413 7564 gene locus_tag LOCUS_16500 6413 7564 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289408.1 protein_id gnl|my_center|LOCUS_16500 7590 8453 gene locus_tag LOCUS_16510 7590 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 8510 8815 gene locus_tag LOCUS_16520 8510 8815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 8882 8967 gene locus_tag LOCUS_t00300 8882 8967 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9021 9668 gene locus_tag LOCUS_16530 9021 9668 CDS product undecaprenyl diphosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024281.1 protein_id gnl|my_center|LOCUS_16530 10468 9674 gene locus_tag LOCUS_16540 10468 9674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879584.1 protein_id gnl|my_center|LOCUS_16540 10591 11712 gene locus_tag LOCUS_16550 10591 11712 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021402.1 protein_id gnl|my_center|LOCUS_16550 12076 11744 gene locus_tag LOCUS_16560 12076 11744 CDS product ribonuclease P protein component 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020348.1 protein_id gnl|my_center|LOCUS_16560 12134 12526 gene locus_tag LOCUS_16570 12134 12526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 12478 12969 gene locus_tag LOCUS_16580 12478 12969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 13092 13592 gene locus_tag LOCUS_16590 13092 13592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 13600 13673 gene locus_tag LOCUS_t00310 13600 13673 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 13687 13929 gene locus_tag LOCUS_16600 13687 13929 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021287.1 protein_id gnl|my_center|LOCUS_16600 14041 17301 gene locus_tag LOCUS_16610 14041 17301 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867738.1 protein_id gnl|my_center|LOCUS_16610 17303 19987 gene locus_tag LOCUS_16620 17303 19987 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021284.1 protein_id gnl|my_center|LOCUS_16620 19994 21349 gene locus_tag LOCUS_16630 gene rpoA2 19994 21349 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879382.1 protein_id gnl|my_center|LOCUS_16630 21359 21745 gene locus_tag LOCUS_16640 21359 21745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 21836 22180 gene locus_tag LOCUS_16650 21836 22180 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021281.1 protein_id gnl|my_center|LOCUS_16650 22264 22692 gene locus_tag LOCUS_16660 22264 22692 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064744.1 protein_id gnl|my_center|LOCUS_16660 22689 23273 gene locus_tag LOCUS_16670 22689 23273 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021279.1 protein_id gnl|my_center|LOCUS_16670 23442 23660 gene locus_tag LOCUS_16680 23442 23660 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876887.1 protein_id gnl|my_center|LOCUS_16680 23888 24964 gene locus_tag LOCUS_16690 23888 24964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 25934 25179 gene locus_tag LOCUS_16700 25934 25179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 26479 25940 gene locus_tag LOCUS_16710 26479 25940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 >Feature sequence040 2237 1401 gene locus_tag LOCUS_16720 gene mcrG 2237 1401 CDS product coenzyme-B sulfoethylthiotransferase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060982.1 protein_id gnl|my_center|LOCUS_16720 3561 2254 gene locus_tag LOCUS_16730 gene mcrB 3561 2254 CDS product coenzyme-B sulfoethylthiotransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061283.1 protein_id gnl|my_center|LOCUS_16730 4306 3758 gene locus_tag LOCUS_16740 4306 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 4382 4735 gene locus_tag LOCUS_16750 4382 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 5365 4973 gene locus_tag LOCUS_16760 5365 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 6684 5425 gene locus_tag LOCUS_16770 6684 5425 CDS product DUF2117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869557.1 protein_id gnl|my_center|LOCUS_16770 6744 7886 gene locus_tag LOCUS_16780 6744 7886 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020271.1 protein_id gnl|my_center|LOCUS_16780 8548 8093 gene locus_tag LOCUS_16790 8548 8093 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879695.1 protein_id gnl|my_center|LOCUS_16790 8955 10472 gene locus_tag LOCUS_16800 8955 10472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 11557 10655 gene locus_tag LOCUS_16810 11557 10655 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274369.1 protein_id gnl|my_center|LOCUS_16810 11775 11703 gene locus_tag LOCUS_t00320 11775 11703 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13030 11828 gene locus_tag LOCUS_16820 gene pgk 13030 11828 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061271.1 protein_id gnl|my_center|LOCUS_16820 14090 13068 gene locus_tag LOCUS_16830 gene gap 14090 13068 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161236.1 protein_id gnl|my_center|LOCUS_16830 14695 14129 gene locus_tag LOCUS_16840 14695 14129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 15240 15509 gene locus_tag LOCUS_16850 15240 15509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 15532 16545 gene locus_tag LOCUS_16860 15532 16545 CDS product DUF1786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892670.1 protein_id gnl|my_center|LOCUS_16860 16542 17345 gene locus_tag LOCUS_16870 gene artA 16542 17345 CDS product archaeosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879538.1 protein_id gnl|my_center|LOCUS_16870 17734 17249 gene locus_tag LOCUS_16880 17734 17249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 19219 17747 gene locus_tag LOCUS_16890 gene tgtA 19219 17747 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024298.1 protein_id gnl|my_center|LOCUS_16890 19379 20179 gene locus_tag LOCUS_16900 19379 20179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811766.1 protein_id gnl|my_center|LOCUS_16900 20268 20879 gene locus_tag LOCUS_16910 20268 20879 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978534.1 protein_id gnl|my_center|LOCUS_16910 21481 20897 gene locus_tag LOCUS_16920 21481 20897 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496506.1 protein_id gnl|my_center|LOCUS_16920 22327 21563 gene locus_tag LOCUS_16930 22327 21563 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_16930 23100 22333 gene locus_tag LOCUS_16940 23100 22333 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020123.1 protein_id gnl|my_center|LOCUS_16940 24285 23152 gene locus_tag LOCUS_16950 24285 23152 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020124.1 protein_id gnl|my_center|LOCUS_16950 >Feature sequence041 3 191 gene locus_tag LOCUS_16960 3 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 542 342 gene locus_tag LOCUS_16970 542 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 608 1390 gene locus_tag LOCUS_16980 608 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 1357 1911 gene locus_tag LOCUS_16990 1357 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 2054 2284 gene locus_tag LOCUS_17000 2054 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 3179 2277 gene locus_tag LOCUS_17010 3179 2277 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066198.1 protein_id gnl|my_center|LOCUS_17010 3262 3843 gene locus_tag LOCUS_17020 3262 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 4176 3922 gene locus_tag LOCUS_17030 4176 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 4461 4186 gene locus_tag LOCUS_17040 4461 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 4687 6951 gene locus_tag LOCUS_17050 4687 6951 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878955.1 protein_id gnl|my_center|LOCUS_17050 8436 7093 gene locus_tag LOCUS_17060 8436 7093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 9618 8563 gene locus_tag LOCUS_17070 9618 8563 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024238.1 protein_id gnl|my_center|LOCUS_17070 10533 9619 gene locus_tag LOCUS_17080 10533 9619 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878632.1 protein_id gnl|my_center|LOCUS_17080 10685 11020 gene locus_tag LOCUS_17090 10685 11020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 11091 11294 gene locus_tag LOCUS_17100 11091 11294 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023878.1 protein_id gnl|my_center|LOCUS_17100 11409 11570 gene locus_tag LOCUS_17110 11409 11570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 13508 11793 gene locus_tag LOCUS_17120 13508 11793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 13613 14650 gene locus_tag LOCUS_17130 13613 14650 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867172.1 protein_id gnl|my_center|LOCUS_17130 14689 15663 gene locus_tag LOCUS_17140 14689 15663 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072012.1 protein_id gnl|my_center|LOCUS_17140 15801 16007 gene locus_tag LOCUS_17150 15801 16007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 16004 16408 gene locus_tag LOCUS_17160 16004 16408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 16483 17580 gene locus_tag LOCUS_17170 16483 17580 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024231.1 protein_id gnl|my_center|LOCUS_17170 17724 18536 gene locus_tag LOCUS_17180 gene dapB 17724 18536 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496490.1 protein_id gnl|my_center|LOCUS_17180 18536 19549 gene locus_tag LOCUS_17190 18536 19549 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_17190 19546 20337 gene locus_tag LOCUS_17200 19546 20337 CDS product archaetidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020175.1 protein_id gnl|my_center|LOCUS_17200 20381 20662 gene locus_tag LOCUS_17210 20381 20662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 20652 23426 gene locus_tag LOCUS_17220 gene ppsA 20652 23426 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838605.1 protein_id gnl|my_center|LOCUS_17220 23432 24013 gene locus_tag LOCUS_17230 23432 24013 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023599.1 protein_id gnl|my_center|LOCUS_17230 24013 24198 gene locus_tag LOCUS_17240 24013 24198 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903509.1 protein_id gnl|my_center|LOCUS_17240 >Feature sequence042 1501 338 gene locus_tag LOCUS_17250 gene comE 1501 338 CDS product sulfopyruvate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023231.1 protein_id gnl|my_center|LOCUS_17250 2441 1566 gene locus_tag LOCUS_17260 2441 1566 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170749.1 protein_id gnl|my_center|LOCUS_17260 3798 2434 gene locus_tag LOCUS_17270 3798 2434 CDS product cysteate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066469.1 protein_id gnl|my_center|LOCUS_17270 5057 3798 gene locus_tag LOCUS_17280 5057 3798 CDS product methanogenesis marker 16 metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023232.1 protein_id gnl|my_center|LOCUS_17280 5839 5054 gene locus_tag LOCUS_17290 5839 5054 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232103.1 protein_id gnl|my_center|LOCUS_17290 5963 6493 gene locus_tag LOCUS_17300 5963 6493 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020126.1 protein_id gnl|my_center|LOCUS_17300 6541 7239 gene locus_tag LOCUS_17310 6541 7239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 7312 8397 gene locus_tag LOCUS_17320 7312 8397 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068322439.1 protein_id gnl|my_center|LOCUS_17320 8447 9787 gene locus_tag LOCUS_17330 gene truD 8447 9787 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065655.1 protein_id gnl|my_center|LOCUS_17330 10261 10842 gene locus_tag LOCUS_17340 10261 10842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 11887 11033 gene locus_tag LOCUS_17350 11887 11033 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023765.1 protein_id gnl|my_center|LOCUS_17350 12230 12021 gene locus_tag LOCUS_17360 12230 12021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 13750 12227 gene locus_tag LOCUS_17370 13750 12227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 14942 13764 gene locus_tag LOCUS_17380 14942 13764 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943325.1 protein_id gnl|my_center|LOCUS_17380 15379 14951 gene locus_tag LOCUS_17390 15379 14951 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876760.1 protein_id gnl|my_center|LOCUS_17390 16339 15470 gene locus_tag LOCUS_17400 gene argB 16339 15470 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024391.1 protein_id gnl|my_center|LOCUS_17400 16755 16345 gene locus_tag LOCUS_17410 16755 16345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 16970 16752 gene locus_tag LOCUS_17420 16970 16752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 18018 17026 gene locus_tag LOCUS_17430 gene hemB 18018 17026 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496568.1 protein_id gnl|my_center|LOCUS_17430 18195 18043 gene locus_tag LOCUS_17440 18195 18043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 18416 18192 gene locus_tag LOCUS_17450 18416 18192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 18702 18427 gene locus_tag LOCUS_17460 18702 18427 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229269.1 protein_id gnl|my_center|LOCUS_17460 19987 18692 gene locus_tag LOCUS_17470 gene hemA 19987 18692 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020626.1 protein_id gnl|my_center|LOCUS_17470 20624 19980 gene locus_tag LOCUS_17480 20624 19980 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020625.1 protein_id gnl|my_center|LOCUS_17480 21702 20656 gene locus_tag LOCUS_17490 21702 20656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 21836 22063 gene locus_tag LOCUS_17500 21836 22063 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146815.1 protein_id gnl|my_center|LOCUS_17500 22330 22254 gene locus_tag LOCUS_t00330 22330 22254 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 <23700 22381 gene locus_tag LOCUS_17510 <23700 22381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060755.1:ABC transporter ATP-binding protein >Feature sequence043 2883 2077 gene locus_tag LOCUS_17520 2883 2077 CDS product bifunctional fructose-bisphosphatase/inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023274.1 protein_id gnl|my_center|LOCUS_17520 3613 3254 gene locus_tag LOCUS_17530 3613 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 4809 3772 gene locus_tag LOCUS_17540 4809 3772 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496803.1 protein_id gnl|my_center|LOCUS_17540 5018 7180 gene locus_tag LOCUS_17550 5018 7180 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589509.1 protein_id gnl|my_center|LOCUS_17550 7789 7199 gene locus_tag LOCUS_17560 7789 7199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 8202 7819 gene locus_tag LOCUS_17570 8202 7819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 8418 8275 gene locus_tag LOCUS_17580 8418 8275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 9331 8561 gene locus_tag LOCUS_17590 9331 8561 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021969.1 protein_id gnl|my_center|LOCUS_17590 9540 11348 gene locus_tag LOCUS_17600 9540 11348 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878912.1 protein_id gnl|my_center|LOCUS_17600 11436 13193 gene locus_tag LOCUS_17610 gene thsB 11436 13193 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870512.1 protein_id gnl|my_center|LOCUS_17610 13626 13276 gene locus_tag LOCUS_17620 13626 13276 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200901620.1 protein_id gnl|my_center|LOCUS_17620 13844 13623 gene locus_tag LOCUS_17630 13844 13623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 14333 13953 gene locus_tag LOCUS_17640 14333 13953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 14586 14347 gene locus_tag LOCUS_17650 14586 14347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 15608 14601 gene locus_tag LOCUS_17660 15608 14601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 16521 15616 gene locus_tag LOCUS_17670 16521 15616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 18335 16680 gene locus_tag LOCUS_17680 gene thsB 18335 16680 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020145.1 protein_id gnl|my_center|LOCUS_17680 18542 19963 gene locus_tag LOCUS_17690 18542 19963 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020190.1 protein_id gnl|my_center|LOCUS_17690 20069 22057 gene locus_tag LOCUS_17700 gene lonB 20069 22057 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023222.1 protein_id gnl|my_center|LOCUS_17700 22135 22878 gene locus_tag LOCUS_17710 22135 22878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 23282 23100 gene locus_tag LOCUS_17720 23282 23100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence044 945 709 gene locus_tag LOCUS_17730 945 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 1869 1018 gene locus_tag LOCUS_17740 1869 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 2633 2109 gene locus_tag LOCUS_17750 2633 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 4165 2630 gene locus_tag LOCUS_17760 gene flaJ 4165 2630 CDS product archaellar assembly protein FlaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023022.1 protein_id gnl|my_center|LOCUS_17760 6016 4226 gene locus_tag LOCUS_17770 6016 4226 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878549.1 protein_id gnl|my_center|LOCUS_17770 6809 6060 gene locus_tag LOCUS_17780 6809 6060 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180546206.1 protein_id gnl|my_center|LOCUS_17780 7897 6977 gene locus_tag LOCUS_17790 7897 6977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 8840 8142 gene locus_tag LOCUS_17800 8840 8142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 10911 8986 gene locus_tag LOCUS_17810 10911 8986 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022845.1 protein_id gnl|my_center|LOCUS_17810 11013 11411 gene locus_tag LOCUS_17820 11013 11411 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868534.1 protein_id gnl|my_center|LOCUS_17820 11418 11492 gene locus_tag LOCUS_t00340 11418 11492 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12358 11573 gene locus_tag LOCUS_17830 12358 11573 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875872.1 protein_id gnl|my_center|LOCUS_17830 12624 12391 gene locus_tag LOCUS_17840 12624 12391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 12720 13466 gene locus_tag LOCUS_17850 gene cas6 12720 13466 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545251.1 protein_id gnl|my_center|LOCUS_17850 13447 13812 gene locus_tag LOCUS_17860 13447 13812 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877770.1 protein_id gnl|my_center|LOCUS_17860 13809 14219 gene locus_tag LOCUS_17870 13809 14219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 14216 14353 gene locus_tag LOCUS_17880 14216 14353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 14451 16190 gene locus_tag LOCUS_17890 14451 16190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 16192 17271 gene locus_tag LOCUS_17900 16192 17271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 17252 18205 gene locus_tag LOCUS_17910 17252 18205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 18300 20699 gene locus_tag LOCUS_17920 gene cas3 18300 20699 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869875.1 protein_id gnl|my_center|LOCUS_17920 20744 21238 gene locus_tag LOCUS_17930 gene cas4 20744 21238 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582993.1 protein_id gnl|my_center|LOCUS_17930 21373 22122 gene locus_tag LOCUS_17940 21373 22122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 22123 22626 gene locus_tag LOCUS_17950 gene cas4 22123 22626 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582993.1 protein_id gnl|my_center|LOCUS_17950 >Feature sequence045 740 273 gene locus_tag LOCUS_17960 740 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 984 742 gene locus_tag LOCUS_17970 984 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 1640 1176 gene locus_tag LOCUS_17980 1640 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 2512 1706 gene locus_tag LOCUS_17990 2512 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 2598 2801 gene locus_tag LOCUS_18000 2598 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 3018 3353 gene locus_tag LOCUS_18010 3018 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 4167 3325 gene locus_tag LOCUS_18020 4167 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 4479 4228 gene locus_tag LOCUS_18030 4479 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 4998 4486 gene locus_tag LOCUS_18040 4998 4486 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875658.1 protein_id gnl|my_center|LOCUS_18040 5762 5040 gene locus_tag LOCUS_18050 5762 5040 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021113.1 protein_id gnl|my_center|LOCUS_18050 9391 5798 gene locus_tag LOCUS_18060 9391 5798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 9511 10674 gene locus_tag LOCUS_18070 9511 10674 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065228.1 protein_id gnl|my_center|LOCUS_18070 10679 10948 gene locus_tag LOCUS_18080 10679 10948 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229269.1 protein_id gnl|my_center|LOCUS_18080 10962 11234 gene locus_tag LOCUS_18090 10962 11234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 11382 12080 gene locus_tag LOCUS_18100 11382 12080 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173254069.1 protein_id gnl|my_center|LOCUS_18100 12898 12077 gene locus_tag LOCUS_18110 12898 12077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 12996 13955 gene locus_tag LOCUS_18120 gene dph2 12996 13955 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020763.1 protein_id gnl|my_center|LOCUS_18120 14098 14346 gene locus_tag LOCUS_18130 14098 14346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 14343 14756 gene locus_tag LOCUS_18140 14343 14756 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979747.1 protein_id gnl|my_center|LOCUS_18140 14816 15031 gene locus_tag LOCUS_18150 14816 15031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 15051 15758 gene locus_tag LOCUS_18160 gene mtnP 15051 15758 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879284.1 protein_id gnl|my_center|LOCUS_18160 16385 15810 gene locus_tag LOCUS_18170 gene cgi121 16385 15810 CDS product KEOPS complex subunit Cgi121 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021174.1 protein_id gnl|my_center|LOCUS_18170 17535 16483 gene locus_tag LOCUS_18180 gene asd 17535 16483 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879003.1 protein_id gnl|my_center|LOCUS_18180 17826 18602 gene locus_tag LOCUS_18190 17826 18602 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870190.1 protein_id gnl|my_center|LOCUS_18190 18638 20875 gene locus_tag LOCUS_18200 gene hypF 18638 20875 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868352.1 protein_id gnl|my_center|LOCUS_18200 >Feature sequence046 436 630 gene locus_tag LOCUS_18210 436 630 CDS product methytransferase partner Trm112 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023214.1 protein_id gnl|my_center|LOCUS_18210 696 1349 gene locus_tag LOCUS_18220 696 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 1382 2974 gene locus_tag LOCUS_18230 gene pyrG 1382 2974 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877763.1 protein_id gnl|my_center|LOCUS_18230 3184 3011 gene locus_tag LOCUS_18240 3184 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 3401 3162 gene locus_tag LOCUS_18250 3401 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 3852 3559 gene locus_tag LOCUS_18260 3852 3559 CDS product 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877331.1 protein_id gnl|my_center|LOCUS_18260 4166 3936 gene locus_tag LOCUS_18270 4166 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 4422 4144 gene locus_tag LOCUS_18280 4422 4144 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391712.1 protein_id gnl|my_center|LOCUS_18280 4483 4962 gene locus_tag LOCUS_18290 4483 4962 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545843.1 protein_id gnl|my_center|LOCUS_18290 5023 6207 gene locus_tag LOCUS_18300 5023 6207 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021498.1 protein_id gnl|my_center|LOCUS_18300 6661 6488 gene locus_tag LOCUS_18310 6661 6488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 8262 6820 gene locus_tag LOCUS_18320 8262 6820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 10097 8265 gene locus_tag LOCUS_18330 10097 8265 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978120.1 protein_id gnl|my_center|LOCUS_18330 11940 10108 gene locus_tag LOCUS_18340 11940 10108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 14612 12255 gene locus_tag LOCUS_18350 14612 12255 CDS product DUF3160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023262.1 protein_id gnl|my_center|LOCUS_18350 14971 14654 gene locus_tag LOCUS_18360 14971 14654 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971035.1 protein_id gnl|my_center|LOCUS_18360 15144 14956 gene locus_tag LOCUS_18370 15144 14956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 15239 16108 gene locus_tag LOCUS_18380 15239 16108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064248.1 protein_id gnl|my_center|LOCUS_18380 16186 16803 gene locus_tag LOCUS_18390 16186 16803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 17825 16836 gene locus_tag LOCUS_18400 17825 16836 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878279.1 protein_id gnl|my_center|LOCUS_18400 17967 17883 gene locus_tag LOCUS_t00350 17967 17883 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 18058 18483 gene locus_tag LOCUS_18410 18058 18483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 18550 20487 gene locus_tag LOCUS_18420 gene gyrB 18550 20487 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021594.1 protein_id gnl|my_center|LOCUS_18420 >Feature sequence047 463 344 gene locus_tag LOCUS_18430 463 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 526 729 gene locus_tag LOCUS_18440 526 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 812 1957 gene locus_tag LOCUS_18450 812 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 1961 2518 gene locus_tag LOCUS_18460 1961 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 2836 2591 gene locus_tag LOCUS_18470 2836 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 2913 3206 gene locus_tag LOCUS_18480 2913 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 3197 3409 gene locus_tag LOCUS_18490 3197 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 3409 3579 gene locus_tag LOCUS_18500 3409 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 3706 4488 gene locus_tag LOCUS_18510 3706 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 4485 5891 gene locus_tag LOCUS_18520 4485 5891 CDS product bifunctional L-myo-inositol-1-phosphate cytidylyltransferase/CDP-L-myo-inositol myo-inositolphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880881.1 protein_id gnl|my_center|LOCUS_18520 7110 5863 gene locus_tag LOCUS_18530 7110 5863 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545541.1 protein_id gnl|my_center|LOCUS_18530 7248 7730 gene locus_tag LOCUS_18540 7248 7730 CDS product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064355.1 protein_id gnl|my_center|LOCUS_18540 7731 8936 gene locus_tag LOCUS_18550 gene khtU 7731 8936 CDS product K(+)/H(+) antiporter subunit KhtU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233272.1 protein_id gnl|my_center|LOCUS_18550 9039 11582 gene locus_tag LOCUS_18560 9039 11582 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878004.1 protein_id gnl|my_center|LOCUS_18560 11653 11853 gene locus_tag LOCUS_18570 11653 11853 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877303.1 protein_id gnl|my_center|LOCUS_18570 12479 11967 gene locus_tag LOCUS_18580 12479 11967 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870045.1 protein_id gnl|my_center|LOCUS_18580 12742 12476 gene locus_tag LOCUS_18590 12742 12476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 13764 12745 gene locus_tag LOCUS_18600 13764 12745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990714.1 protein_id gnl|my_center|LOCUS_18600 13905 14426 gene locus_tag LOCUS_18610 13905 14426 CDS product DJ-1/PfpI/YhbO family deglycase/protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870481.1 protein_id gnl|my_center|LOCUS_18610 14445 14690 gene locus_tag LOCUS_18620 14445 14690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 14687 15013 gene locus_tag LOCUS_18630 14687 15013 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023310.1 protein_id gnl|my_center|LOCUS_18630 15212 15370 gene locus_tag LOCUS_18640 15212 15370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 15519 16379 gene locus_tag LOCUS_18650 15519 16379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021970.1 protein_id gnl|my_center|LOCUS_18650 16621 17139 gene locus_tag LOCUS_18660 16621 17139 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174153.1 protein_id gnl|my_center|LOCUS_18660 17887 17300 gene locus_tag LOCUS_18670 17887 17300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 19222 17948 gene locus_tag LOCUS_18680 19222 17948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 20083 19226 gene locus_tag LOCUS_18690 20083 19226 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020996.1 protein_id gnl|my_center|LOCUS_18690 >Feature sequence048 233 42 gene locus_tag LOCUS_18700 233 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 343 212 gene locus_tag LOCUS_18710 343 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 1364 354 gene locus_tag LOCUS_18720 1364 354 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878344.1 protein_id gnl|my_center|LOCUS_18720 2429 1416 gene locus_tag LOCUS_18730 2429 1416 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876607.1 protein_id gnl|my_center|LOCUS_18730 2524 3621 gene locus_tag LOCUS_18740 2524 3621 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938462.1 protein_id gnl|my_center|LOCUS_18740 4229 4489 gene locus_tag LOCUS_18750 4229 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 5969 4602 gene locus_tag LOCUS_18760 5969 4602 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876966.1 protein_id gnl|my_center|LOCUS_18760 6038 6277 gene locus_tag LOCUS_18770 gene moaD 6038 6277 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251068.1 protein_id gnl|my_center|LOCUS_18770 6282 6638 gene locus_tag LOCUS_18780 6282 6638 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251065.1 protein_id gnl|my_center|LOCUS_18780 7050 6616 gene locus_tag LOCUS_18790 7050 6616 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065894.1 protein_id gnl|my_center|LOCUS_18790 8145 7063 gene locus_tag LOCUS_18800 gene arsB 8145 7063 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118066.1 protein_id gnl|my_center|LOCUS_18800 8389 9150 gene locus_tag LOCUS_18810 gene arsM 8389 9150 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023683.1 protein_id gnl|my_center|LOCUS_18810 10430 9201 gene locus_tag LOCUS_18820 10430 9201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 11559 10528 gene locus_tag LOCUS_18830 11559 10528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 11844 11569 gene locus_tag LOCUS_18840 11844 11569 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021717.1 protein_id gnl|my_center|LOCUS_18840 13780 11969 gene locus_tag LOCUS_18850 gene aor 13780 11969 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868080.1 protein_id gnl|my_center|LOCUS_18850 13984 14880 gene locus_tag LOCUS_18860 13984 14880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 14936 15526 gene locus_tag LOCUS_18870 14936 15526 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029057.1 protein_id gnl|my_center|LOCUS_18870 15514 15939 gene locus_tag LOCUS_18880 15514 15939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 15936 16214 gene locus_tag LOCUS_18890 15936 16214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 16312 16710 gene locus_tag LOCUS_18900 16312 16710 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095677.1 protein_id gnl|my_center|LOCUS_18900 16786 17049 gene locus_tag LOCUS_18910 16786 17049 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878136.1 protein_id gnl|my_center|LOCUS_18910 17078 17917 gene locus_tag LOCUS_18920 17078 17917 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020313.1 protein_id gnl|my_center|LOCUS_18920 17914 18144 gene locus_tag LOCUS_18930 17914 18144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 18141 19373 gene locus_tag LOCUS_18940 18141 19373 CDS product YcaO-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876618.1 protein_id gnl|my_center|LOCUS_18940 19330 19977 gene locus_tag LOCUS_18950 19330 19977 CDS product TfuA-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020222.1 protein_id gnl|my_center|LOCUS_18950 >Feature sequence049 1011 256 gene locus_tag LOCUS_18960 gene fdhD 1011 256 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546799.1 protein_id gnl|my_center|LOCUS_18960 2190 1012 gene locus_tag LOCUS_18970 2190 1012 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020294.1 protein_id gnl|my_center|LOCUS_18970 2984 2193 gene locus_tag LOCUS_18980 gene larE 2984 2193 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080596.1 protein_id gnl|my_center|LOCUS_18980 3379 3011 gene locus_tag LOCUS_18990 3379 3011 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990605.1 protein_id gnl|my_center|LOCUS_18990 3493 4758 gene locus_tag LOCUS_19000 3493 4758 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876486.1 protein_id gnl|my_center|LOCUS_19000 4975 6171 gene locus_tag LOCUS_19010 gene nifS 4975 6171 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_19010 6173 6541 gene locus_tag LOCUS_19020 gene nifU 6173 6541 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_19020 6680 7663 gene locus_tag LOCUS_19030 gene cysK 6680 7663 CDS product O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899275.1 protein_id gnl|my_center|LOCUS_19030 7675 8388 gene locus_tag LOCUS_19040 7675 8388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 8538 9554 gene locus_tag LOCUS_19050 8538 9554 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158098.1 protein_id gnl|my_center|LOCUS_19050 9731 9931 gene locus_tag LOCUS_19060 9731 9931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 10452 10126 gene locus_tag LOCUS_19070 10452 10126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 10824 10675 gene locus_tag LOCUS_19080 10824 10675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 10918 11094 gene locus_tag LOCUS_19090 10918 11094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 11858 11655 gene locus_tag LOCUS_19100 11858 11655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 12190 11855 gene locus_tag LOCUS_19110 12190 11855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 12316 13107 gene locus_tag LOCUS_19120 12316 13107 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061316.1 protein_id gnl|my_center|LOCUS_19120 13193 13417 gene locus_tag LOCUS_19130 13193 13417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 13429 13731 gene locus_tag LOCUS_19140 13429 13731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 14708 13767 gene locus_tag LOCUS_19150 14708 13767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 15304 14705 gene locus_tag LOCUS_19160 15304 14705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066058.1 protein_id gnl|my_center|LOCUS_19160 15899 15297 gene locus_tag LOCUS_19170 gene mcrC 15899 15297 CDS product methyl-coenzyme M reductase I operon protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870358.1 protein_id gnl|my_center|LOCUS_19170 17686 15911 gene locus_tag LOCUS_19180 17686 15911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 16616 16715 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18161 17784 gene locus_tag LOCUS_19190 18161 17784 CDS product DUF5402 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871182.1 protein_id gnl|my_center|LOCUS_19190 19081 18158 gene locus_tag LOCUS_19200 19081 18158 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871181.1 protein_id gnl|my_center|LOCUS_19200 >Feature sequence050 1323 976 gene locus_tag LOCUS_19210 1323 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 1405 1671 gene locus_tag LOCUS_19220 1405 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 1725 2675 gene locus_tag LOCUS_19230 1725 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 2668 5127 gene locus_tag LOCUS_19240 2668 5127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 5611 5162 gene locus_tag LOCUS_19250 5611 5162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 6762 5716 gene locus_tag LOCUS_19260 6762 5716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 6882 7253 gene locus_tag LOCUS_19270 6882 7253 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963769.1 protein_id gnl|my_center|LOCUS_19270 8158 7379 gene locus_tag LOCUS_19280 8158 7379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 10204 8165 gene locus_tag LOCUS_19290 10204 8165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 11805 10495 gene locus_tag LOCUS_19300 11805 10495 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974732.1 protein_id gnl|my_center|LOCUS_19300 12185 11802 gene locus_tag LOCUS_19310 12185 11802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 12807 12358 gene locus_tag LOCUS_19320 12807 12358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 13712 12975 gene locus_tag LOCUS_19330 13712 12975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 13960 13733 gene locus_tag LOCUS_19340 13960 13733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 14324 14025 gene locus_tag LOCUS_19350 14324 14025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 14843 14328 gene locus_tag LOCUS_19360 14843 14328 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_19360 16773 14890 gene locus_tag LOCUS_19370 gene gatE 16773 14890 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022814.1 protein_id gnl|my_center|LOCUS_19370 17351 16980 gene locus_tag LOCUS_19380 17351 16980 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053649.1 protein_id gnl|my_center|LOCUS_19380 17659 17348 gene locus_tag LOCUS_19390 17659 17348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 18677 17775 gene locus_tag LOCUS_19400 18677 17775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 >Feature sequence051 1660 746 gene locus_tag LOCUS_19410 gene argF 1660 746 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878750.1 protein_id gnl|my_center|LOCUS_19410 1985 3424 gene locus_tag LOCUS_19420 1985 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 3464 3844 gene locus_tag LOCUS_19430 3464 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 3852 6104 gene locus_tag LOCUS_19440 3852 6104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 6146 9001 gene locus_tag LOCUS_19450 6146 9001 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020807.1 protein_id gnl|my_center|LOCUS_19450 9487 9014 gene locus_tag LOCUS_19460 9487 9014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867917.1 protein_id gnl|my_center|LOCUS_19460 10455 9484 gene locus_tag LOCUS_19470 10455 9484 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867916.1 protein_id gnl|my_center|LOCUS_19470 10643 10470 gene locus_tag LOCUS_19480 10643 10470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 11091 10699 gene locus_tag LOCUS_19490 11091 10699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 14003 11091 gene locus_tag LOCUS_19500 14003 11091 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393172.1 protein_id gnl|my_center|LOCUS_19500 14408 14007 gene locus_tag LOCUS_19510 14408 14007 CDS product HI0074 family nucleotidyltransferase substrate-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926036.1 protein_id gnl|my_center|LOCUS_19510 14701 14396 gene locus_tag LOCUS_19520 14701 14396 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020158.1 protein_id gnl|my_center|LOCUS_19520 15062 14712 gene locus_tag LOCUS_19530 15062 14712 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546611.1 protein_id gnl|my_center|LOCUS_19530 15544 15254 gene locus_tag LOCUS_19540 15544 15254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 16960 15698 gene locus_tag LOCUS_19550 16960 15698 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393173.1 protein_id gnl|my_center|LOCUS_19550 17396 16947 gene locus_tag LOCUS_19560 17396 16947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 18091 17465 gene locus_tag LOCUS_19570 18091 17465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 <18632 18088 gene locus_tag LOCUS_19580 <18632 18088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393174.1:class I SAM-dependent DNA methyltransferase >Feature sequence052 392 748 gene locus_tag LOCUS_19590 392 748 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546772.1 protein_id gnl|my_center|LOCUS_19590 764 2530 gene locus_tag LOCUS_19600 764 2530 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545652.1 protein_id gnl|my_center|LOCUS_19600 2705 2950 gene locus_tag LOCUS_19610 2705 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 2947 3372 gene locus_tag LOCUS_19620 2947 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 3511 3341 gene locus_tag LOCUS_19630 3511 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 3628 5190 gene locus_tag LOCUS_19640 3628 5190 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020229.1 protein_id gnl|my_center|LOCUS_19640 5940 5200 gene locus_tag LOCUS_19650 5940 5200 CDS product glucose-6-phosphate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020865.1 protein_id gnl|my_center|LOCUS_19650 6995 5988 gene locus_tag LOCUS_19660 6995 5988 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274448.1 protein_id gnl|my_center|LOCUS_19660 8584 6983 gene locus_tag LOCUS_19670 8584 6983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 8762 9577 gene locus_tag LOCUS_19680 8762 9577 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878521.1 protein_id gnl|my_center|LOCUS_19680 10413 9616 gene locus_tag LOCUS_19690 10413 9616 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250729.1 protein_id gnl|my_center|LOCUS_19690 10883 10683 gene locus_tag LOCUS_19700 10883 10683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 12531 10948 gene locus_tag LOCUS_19710 12531 10948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 12709 13116 gene locus_tag LOCUS_19720 12709 13116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 13109 14479 gene locus_tag LOCUS_19730 13109 14479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 14563 14928 gene locus_tag LOCUS_19740 14563 14928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 15712 15338 gene locus_tag LOCUS_19750 15712 15338 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227306.1 protein_id gnl|my_center|LOCUS_19750 16485 15709 gene locus_tag LOCUS_19760 16485 15709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 17157 16579 gene locus_tag LOCUS_19770 17157 16579 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065297.1 protein_id gnl|my_center|LOCUS_19770 17856 17158 gene locus_tag LOCUS_19780 17856 17158 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022003.1 protein_id gnl|my_center|LOCUS_19780 18490 18182 gene locus_tag LOCUS_19790 18490 18182 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257965.1 protein_id gnl|my_center|LOCUS_19790 >Feature sequence053 144 1313 gene locus_tag LOCUS_19800 144 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 3125 2040 gene locus_tag LOCUS_19810 3125 2040 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020662.1 protein_id gnl|my_center|LOCUS_19810 3295 4491 gene locus_tag LOCUS_19820 3295 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 4496 5665 gene locus_tag LOCUS_19830 4496 5665 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963073.1 protein_id gnl|my_center|LOCUS_19830 5658 6350 gene locus_tag LOCUS_19840 5658 6350 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878518.1 protein_id gnl|my_center|LOCUS_19840 7884 6367 gene locus_tag LOCUS_19850 7884 6367 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_19850 10016 7923 gene locus_tag LOCUS_19860 10016 7923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 11353 10013 gene locus_tag LOCUS_19870 11353 10013 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870741.1 protein_id gnl|my_center|LOCUS_19870 11636 11388 gene locus_tag LOCUS_19880 11636 11388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 12213 11641 gene locus_tag LOCUS_19890 12213 11641 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024220.1 protein_id gnl|my_center|LOCUS_19890 14248 12380 gene locus_tag LOCUS_19900 14248 12380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 14407 14631 gene locus_tag LOCUS_19910 14407 14631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 14950 14579 gene locus_tag LOCUS_19920 14950 14579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 15982 14960 gene locus_tag LOCUS_19930 15982 14960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 17253 16033 gene locus_tag LOCUS_19940 17253 16033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 >Feature sequence054 984 424 gene locus_tag LOCUS_19950 984 424 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020756.1 protein_id gnl|my_center|LOCUS_19950 2533 989 gene locus_tag LOCUS_19960 2533 989 CDS product methanogenesis marker 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061161.1 protein_id gnl|my_center|LOCUS_19960 2946 2653 gene locus_tag LOCUS_19970 2946 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 4239 3061 gene locus_tag LOCUS_19980 4239 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 4766 4452 gene locus_tag LOCUS_19990 4766 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 4847 5473 gene locus_tag LOCUS_20000 4847 5473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 5551 5883 gene locus_tag LOCUS_20010 5551 5883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 5864 6232 gene locus_tag LOCUS_20020 5864 6232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 6239 6550 gene locus_tag LOCUS_20030 6239 6550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 6547 6906 gene locus_tag LOCUS_20040 6547 6906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 7838 6969 gene locus_tag LOCUS_20050 gene truA 7838 6969 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020266.1 protein_id gnl|my_center|LOCUS_20050 7944 8723 gene locus_tag LOCUS_20060 7944 8723 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064947.1 protein_id gnl|my_center|LOCUS_20060 8838 10316 gene locus_tag LOCUS_20070 8838 10316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 10536 10850 gene locus_tag LOCUS_20080 10536 10850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 11293 10922 gene locus_tag LOCUS_20090 11293 10922 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878881.1 protein_id gnl|my_center|LOCUS_20090 12401 11280 gene locus_tag LOCUS_20100 12401 11280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 13719 12361 gene locus_tag LOCUS_20110 13719 12361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 14684 13746 gene locus_tag LOCUS_20120 14684 13746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 14908 15354 gene locus_tag LOCUS_20130 14908 15354 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061215.1 protein_id gnl|my_center|LOCUS_20130 15802 15362 gene locus_tag LOCUS_20140 15802 15362 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977989.1 protein_id gnl|my_center|LOCUS_20140 16174 15806 gene locus_tag LOCUS_20150 16174 15806 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359271.1 protein_id gnl|my_center|LOCUS_20150 17676 17311 gene locus_tag LOCUS_20160 17676 17311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 >Feature sequence055 372 1055 gene locus_tag LOCUS_20170 372 1055 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978862.1 protein_id gnl|my_center|LOCUS_20170 1104 2285 gene locus_tag LOCUS_20180 1104 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 2299 3354 gene locus_tag LOCUS_20190 2299 3354 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403392.1 protein_id gnl|my_center|LOCUS_20190 3413 4324 gene locus_tag LOCUS_20200 3413 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 4388 5125 gene locus_tag LOCUS_20210 4388 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 5200 5952 gene locus_tag LOCUS_20220 5200 5952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 6008 6934 gene locus_tag LOCUS_20230 6008 6934 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061298.1 protein_id gnl|my_center|LOCUS_20230 7107 7931 gene locus_tag LOCUS_20240 7107 7931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 9072 7915 gene locus_tag LOCUS_20250 9072 7915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 9854 10024 gene locus_tag LOCUS_20260 9854 10024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 10228 11355 gene locus_tag LOCUS_20270 10228 11355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 11396 11608 gene locus_tag LOCUS_20280 11396 11608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 11952 11758 gene locus_tag LOCUS_20290 11952 11758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 13044 12856 gene locus_tag LOCUS_20300 13044 12856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 13397 13756 gene locus_tag LOCUS_20310 13397 13756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 13811 14116 gene locus_tag LOCUS_20320 13811 14116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 14205 15314 gene locus_tag LOCUS_20330 14205 15314 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022158.1 protein_id gnl|my_center|LOCUS_20330 15575 16471 gene locus_tag LOCUS_20340 15575 16471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 16487 17473 gene locus_tag LOCUS_20350 16487 17473 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705009.1 protein_id gnl|my_center|LOCUS_20350 >Feature sequence056 <1 833 gene locus_tag LOCUS_20360 <1 833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250416.1:ATP-binding protein 1335 895 gene locus_tag LOCUS_20370 1335 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 3255 1489 gene locus_tag LOCUS_20380 3255 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 3580 3341 gene locus_tag LOCUS_20390 3580 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 4086 4385 gene locus_tag LOCUS_20400 4086 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 4366 4515 gene locus_tag LOCUS_20410 4366 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 5116 4886 gene locus_tag LOCUS_20420 5116 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 5259 5885 gene locus_tag LOCUS_20430 5259 5885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 5888 6679 gene locus_tag LOCUS_20440 5888 6679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 7115 6897 gene locus_tag LOCUS_20450 7115 6897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 8129 7188 gene locus_tag LOCUS_20460 8129 7188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 9059 8232 gene locus_tag LOCUS_20470 9059 8232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 10059 9127 gene locus_tag LOCUS_20480 10059 9127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496453.1 protein_id gnl|my_center|LOCUS_20480 10719 10099 gene locus_tag LOCUS_20490 10719 10099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 11233 10721 gene locus_tag LOCUS_20500 11233 10721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 12304 11342 gene locus_tag LOCUS_20510 12304 11342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 14642 12537 gene locus_tag LOCUS_20520 14642 12537 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023776.1 protein_id gnl|my_center|LOCUS_20520 14762 15367 gene locus_tag LOCUS_20530 14762 15367 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020764.1 protein_id gnl|my_center|LOCUS_20530 15398 16276 gene locus_tag LOCUS_20540 15398 16276 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020739.1 protein_id gnl|my_center|LOCUS_20540 16374 16868 gene locus_tag LOCUS_20550 16374 16868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20550 16900 17403 gene locus_tag LOCUS_20560 16900 17403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20560 >Feature sequence057 310 62 gene locus_tag LOCUS_20570 310 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 444 295 gene locus_tag LOCUS_20580 444 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 990 583 gene locus_tag LOCUS_20590 990 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 2054 1086 gene locus_tag LOCUS_20600 2054 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 2894 2064 gene locus_tag LOCUS_20610 2894 2064 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086000.1 protein_id gnl|my_center|LOCUS_20610 4062 3088 gene locus_tag LOCUS_20620 gene mtrH 4062 3088 CDS product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876780.1 protein_id gnl|my_center|LOCUS_20620 4374 4081 gene locus_tag LOCUS_20630 4374 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 4604 4398 gene locus_tag LOCUS_20640 4604 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 5339 4605 gene locus_tag LOCUS_20650 gene mtrA 5339 4605 CDS product tetrahydromethanopterin S-methyltransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876783.1 protein_id gnl|my_center|LOCUS_20650 5641 5342 gene locus_tag LOCUS_20660 5641 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 6493 5663 gene locus_tag LOCUS_20670 gene mtrC 6493 5663 CDS product tetrahydromethanopterin S-methyltransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020332.1 protein_id gnl|my_center|LOCUS_20670 7196 6495 gene locus_tag LOCUS_20680 gene mtrD 7196 6495 CDS product tetrahydromethanopterin S-methyltransferase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870362.1 protein_id gnl|my_center|LOCUS_20680 8147 7200 gene locus_tag LOCUS_20690 gene mtrE 8147 7200 CDS product tetrahydromethanopterin S-methyltransferase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870361.1 protein_id gnl|my_center|LOCUS_20690 8294 9730 gene locus_tag LOCUS_20700 8294 9730 CDS product methanogenesis marker 14 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024395.1 protein_id gnl|my_center|LOCUS_20700 9811 10365 gene locus_tag LOCUS_20710 9811 10365 CDS product methanogenesis marker 17 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870312.1 protein_id gnl|my_center|LOCUS_20710 10358 11251 gene locus_tag LOCUS_20720 10358 11251 CDS product methanogenesis marker 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496388.1 protein_id gnl|my_center|LOCUS_20720 12139 11456 gene locus_tag LOCUS_20730 12139 11456 CDS product phosphoglycerol geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877910.1 protein_id gnl|my_center|LOCUS_20730 12266 12802 gene locus_tag LOCUS_20740 12266 12802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 13480 12833 gene locus_tag LOCUS_20750 13480 12833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 13747 13508 gene locus_tag LOCUS_20760 13747 13508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 14333 13866 gene locus_tag LOCUS_20770 14333 13866 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021122.1 protein_id gnl|my_center|LOCUS_20770 15020 14376 gene locus_tag LOCUS_20780 15020 14376 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021121.1 protein_id gnl|my_center|LOCUS_20780 15550 15005 gene locus_tag LOCUS_20790 15550 15005 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021120.1 protein_id gnl|my_center|LOCUS_20790 16037 15570 gene locus_tag LOCUS_20800 16037 15570 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021119.1 protein_id gnl|my_center|LOCUS_20800 17324 16062 gene locus_tag LOCUS_20810 gene larA 17324 16062 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860456.1 protein_id gnl|my_center|LOCUS_20810 >Feature sequence058 2373 1423 gene locus_tag LOCUS_20820 2373 1423 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225647.1 protein_id gnl|my_center|LOCUS_20820 2670 3086 gene locus_tag LOCUS_20830 gene hypA 2670 3086 CDS product hydrogenase nickel incorporation protein HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582498.1 protein_id gnl|my_center|LOCUS_20830 3115 3867 gene locus_tag LOCUS_20840 3115 3867 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582499.1 protein_id gnl|my_center|LOCUS_20840 5024 3936 gene locus_tag LOCUS_20850 gene hypE 5024 3936 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060768.1 protein_id gnl|my_center|LOCUS_20850 5145 5720 gene locus_tag LOCUS_20860 5145 5720 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023613.1 protein_id gnl|my_center|LOCUS_20860 5828 6595 gene locus_tag LOCUS_20870 5828 6595 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_20870 6595 7614 gene locus_tag LOCUS_20880 6595 7614 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392751.1 protein_id gnl|my_center|LOCUS_20880 7873 8067 gene locus_tag LOCUS_20890 7873 8067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 9265 8054 gene locus_tag LOCUS_20900 9265 8054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 9384 9587 gene locus_tag LOCUS_20910 9384 9587 CDS product DUF2281 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877811.1 protein_id gnl|my_center|LOCUS_20910 9836 11743 gene locus_tag LOCUS_20920 9836 11743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 11773 11964 gene locus_tag LOCUS_20930 11773 11964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 12054 12350 gene locus_tag LOCUS_20940 12054 12350 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583654.1 protein_id gnl|my_center|LOCUS_20940 12347 12499 gene locus_tag LOCUS_20950 12347 12499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 12502 13857 gene locus_tag LOCUS_20960 gene pscS 12502 13857 CDS product O-phospho-L-seryl-tRNA:Cys-tRNA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966499.1 protein_id gnl|my_center|LOCUS_20960 14685 14140 gene locus_tag LOCUS_20970 14685 14140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 15137 14904 gene locus_tag LOCUS_20980 15137 14904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 15518 15231 gene locus_tag LOCUS_20990 15518 15231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 15697 15518 gene locus_tag LOCUS_21000 15697 15518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 16203 15700 gene locus_tag LOCUS_21010 16203 15700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 >Feature sequence059 2606 621 gene locus_tag LOCUS_21020 2606 621 CDS product IGHMBP2 family helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249133.1 protein_id gnl|my_center|LOCUS_21020 2840 4786 gene locus_tag LOCUS_21030 2840 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 4959 5348 gene locus_tag LOCUS_21040 4959 5348 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943385.1 protein_id gnl|my_center|LOCUS_21040 5375 5962 gene locus_tag LOCUS_21050 5375 5962 CDS product CheB methylesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943384.1 protein_id gnl|my_center|LOCUS_21050 6155 6652 gene locus_tag LOCUS_21060 gene nuoE 6155 6652 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_21060 6649 8508 gene locus_tag LOCUS_21070 gene nuoF 6649 8508 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_21070 8519 9241 gene locus_tag LOCUS_21080 8519 9241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 9248 10831 gene locus_tag LOCUS_21090 9248 10831 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582712.1 protein_id gnl|my_center|LOCUS_21090 10898 11929 gene locus_tag LOCUS_21100 10898 11929 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020113.1 protein_id gnl|my_center|LOCUS_21100 11926 12573 gene locus_tag LOCUS_21110 11926 12573 CDS product amino acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021487.1 protein_id gnl|my_center|LOCUS_21110 13183 12767 gene locus_tag LOCUS_21120 13183 12767 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868448.1 protein_id gnl|my_center|LOCUS_21120 13289 13987 gene locus_tag LOCUS_21130 13289 13987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 13999 14685 gene locus_tag LOCUS_21140 gene tpiA 13999 14685 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868855.1 protein_id gnl|my_center|LOCUS_21140 14694 14876 gene locus_tag LOCUS_21150 14694 14876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 14932 15651 gene locus_tag LOCUS_21160 gene pyrF 14932 15651 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868434.1 protein_id gnl|my_center|LOCUS_21160 16214 15870 gene locus_tag LOCUS_21170 16214 15870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 16561 16199 gene locus_tag LOCUS_21180 16561 16199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 >Feature sequence060 741 61 gene locus_tag LOCUS_21190 741 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 1839 985 gene locus_tag LOCUS_21200 1839 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 2726 1971 gene locus_tag LOCUS_21210 2726 1971 CDS product indole-3-glycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022932.1 protein_id gnl|my_center|LOCUS_21210 2943 3446 gene locus_tag LOCUS_21220 2943 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 4561 3554 gene locus_tag LOCUS_21230 gene trpD 4561 3554 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869732.1 protein_id gnl|my_center|LOCUS_21230 5051 4581 gene locus_tag LOCUS_21240 5051 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 5284 5051 gene locus_tag LOCUS_21250 5284 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 5924 5331 gene locus_tag LOCUS_21260 5924 5331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 7443 5932 gene locus_tag LOCUS_21270 gene trpE 7443 5932 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870587.1 protein_id gnl|my_center|LOCUS_21270 7700 11056 gene locus_tag LOCUS_21280 7700 11056 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868880.1 protein_id gnl|my_center|LOCUS_21280 11056 14118 gene locus_tag LOCUS_21290 11056 14118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 14115 14432 gene locus_tag LOCUS_21300 14115 14432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 >Feature sequence061 313 89 gene locus_tag LOCUS_21310 313 89 CDS product DUF6485 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584058.1 protein_id gnl|my_center|LOCUS_21310 901 395 gene locus_tag LOCUS_21320 901 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 1078 2670 gene locus_tag LOCUS_21330 1078 2670 CDS product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467257.1 protein_id gnl|my_center|LOCUS_21330 2679 3410 gene locus_tag LOCUS_21340 2679 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 3954 3400 gene locus_tag LOCUS_21350 3954 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 5609 4143 gene locus_tag LOCUS_21360 5609 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 5759 6850 gene locus_tag LOCUS_21370 5759 6850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 6885 7874 gene locus_tag LOCUS_21380 6885 7874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 8299 8057 gene locus_tag LOCUS_21390 8299 8057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 8574 8317 gene locus_tag LOCUS_21400 8574 8317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 8798 9790 gene locus_tag LOCUS_21410 8798 9790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 9787 10065 gene locus_tag LOCUS_21420 9787 10065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 10102 10332 gene locus_tag LOCUS_21430 10102 10332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 10337 10531 gene locus_tag LOCUS_21440 10337 10531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 10573 11967 gene locus_tag LOCUS_21450 10573 11967 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021751.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21450 12520 12248 gene locus_tag LOCUS_21460 12520 12248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 12909 12685 gene locus_tag LOCUS_21470 12909 12685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 14094 12940 gene locus_tag LOCUS_21480 14094 12940 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21480 14186 14350 gene locus_tag LOCUS_21490 14186 14350 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081114.1 protein_id gnl|my_center|LOCUS_21490 >Feature sequence062 574 882 gene locus_tag LOCUS_21500 574 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 860 1102 gene locus_tag LOCUS_21510 860 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 1304 2470 gene locus_tag LOCUS_21520 1304 2470 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066055.1 protein_id gnl|my_center|LOCUS_21520 3375 2605 gene locus_tag LOCUS_21530 3375 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 4151 3381 gene locus_tag LOCUS_21540 4151 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 4509 4685 gene locus_tag LOCUS_21550 4509 4685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 5323 4709 gene locus_tag LOCUS_21560 5323 4709 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021972.1 protein_id gnl|my_center|LOCUS_21560 5448 5759 gene locus_tag LOCUS_21570 5448 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 5870 6364 gene locus_tag LOCUS_21580 5870 6364 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021413.1 protein_id gnl|my_center|LOCUS_21580 6373 7533 gene locus_tag LOCUS_21590 6373 7533 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878324.1 protein_id gnl|my_center|LOCUS_21590 7621 8355 gene locus_tag LOCUS_21600 7621 8355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 8750 8520 gene locus_tag LOCUS_21610 8750 8520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 9062 9502 gene locus_tag LOCUS_21620 gene cobZ 9062 9502 CDS product alpha-ribazole phosphatase CobZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867170.1 protein_id gnl|my_center|LOCUS_21620 10563 9499 gene locus_tag LOCUS_21630 10563 9499 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250425.1 protein_id gnl|my_center|LOCUS_21630 11473 10664 gene locus_tag LOCUS_21640 11473 10664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 11625 14228 gene locus_tag LOCUS_21650 11625 14228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 >Feature sequence063 219 1031 gene locus_tag LOCUS_21660 gene trpA 219 1031 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496709.1 protein_id gnl|my_center|LOCUS_21660 1103 1669 gene locus_tag LOCUS_21670 1103 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 1788 1862 gene locus_tag LOCUS_t00360 1788 1862 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1892 2485 gene locus_tag LOCUS_21680 1892 2485 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061267.1 protein_id gnl|my_center|LOCUS_21680 3419 2490 gene locus_tag LOCUS_21690 3419 2490 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870394.1 protein_id gnl|my_center|LOCUS_21690 3557 4432 gene locus_tag LOCUS_21700 3557 4432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 4446 4976 gene locus_tag LOCUS_21710 4446 4976 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065425.1 protein_id gnl|my_center|LOCUS_21710 5005 5541 gene locus_tag LOCUS_21720 5005 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 5637 6608 gene locus_tag LOCUS_21730 5637 6608 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066004.1 protein_id gnl|my_center|LOCUS_21730 6736 7176 gene locus_tag LOCUS_21740 6736 7176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 7286 8440 gene locus_tag LOCUS_21750 7286 8440 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258523.1 protein_id gnl|my_center|LOCUS_21750 8443 9174 gene locus_tag LOCUS_21760 8443 9174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 9209 9538 gene locus_tag LOCUS_21770 9209 9538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878056.1 protein_id gnl|my_center|LOCUS_21770 10003 9512 gene locus_tag LOCUS_21780 gene ruvC 10003 9512 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256932.1 protein_id gnl|my_center|LOCUS_21780 10061 10624 gene locus_tag LOCUS_21790 10061 10624 CDS product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867177.1 protein_id gnl|my_center|LOCUS_21790 10669 10959 gene locus_tag LOCUS_21800 10669 10959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 10945 11015 gene locus_tag LOCUS_t00370 10945 11015 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 11066 12169 gene locus_tag LOCUS_21810 gene prf1 11066 12169 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020101.1 protein_id gnl|my_center|LOCUS_21810 12304 13665 gene locus_tag LOCUS_21820 12304 13665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 13681 13980 gene locus_tag LOCUS_21830 13681 13980 CDS product signal recognition particle protein Srp19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066074.1 protein_id gnl|my_center|LOCUS_21830 >Feature sequence064 1242 46 gene locus_tag LOCUS_21840 1242 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 3575 1266 gene locus_tag LOCUS_21850 3575 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 3630 3887 gene locus_tag LOCUS_21860 3630 3887 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023356.1 protein_id gnl|my_center|LOCUS_21860 3892 5397 gene locus_tag LOCUS_21870 gene serS 3892 5397 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876746.1 protein_id gnl|my_center|LOCUS_21870 5487 5984 gene locus_tag LOCUS_21880 5487 5984 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879119.1 protein_id gnl|my_center|LOCUS_21880 6034 7200 gene locus_tag LOCUS_21890 6034 7200 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020963.1 protein_id gnl|my_center|LOCUS_21890 7927 7244 gene locus_tag LOCUS_21900 7927 7244 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877104.1 protein_id gnl|my_center|LOCUS_21900 8049 8120 gene locus_tag LOCUS_t00380 8049 8120 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 8163 8909 gene locus_tag LOCUS_21910 gene psmA 8163 8909 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065214.1 protein_id gnl|my_center|LOCUS_21910 8899 9612 gene locus_tag LOCUS_21920 8899 9612 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021781.1 protein_id gnl|my_center|LOCUS_21920 9623 10285 gene locus_tag LOCUS_21930 gene rrp4 9623 10285 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021780.1 protein_id gnl|my_center|LOCUS_21930 10314 11054 gene locus_tag LOCUS_21940 gene rrp41 10314 11054 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878000.1 protein_id gnl|my_center|LOCUS_21940 11057 11842 gene locus_tag LOCUS_21950 gene rrp42 11057 11842 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878001.1 protein_id gnl|my_center|LOCUS_21950 11935 12216 gene locus_tag LOCUS_21960 gene gatC 11935 12216 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024398.1 protein_id gnl|my_center|LOCUS_21960 12221 13015 gene locus_tag LOCUS_21970 12221 13015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 13648 13157 gene locus_tag LOCUS_21980 13648 13157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 >Feature sequence065 205 798 gene locus_tag LOCUS_21990 205 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 814 1044 gene locus_tag LOCUS_22000 814 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 3901 1517 gene locus_tag LOCUS_22010 3901 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 4120 3944 gene locus_tag LOCUS_22020 4120 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 4313 4167 gene locus_tag LOCUS_22030 4313 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 4732 4310 gene locus_tag LOCUS_22040 4732 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 4865 5272 gene locus_tag LOCUS_22050 4865 5272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 5284 8034 gene locus_tag LOCUS_22060 5284 8034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 8865 8251 gene locus_tag LOCUS_22070 8865 8251 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772090.1 protein_id gnl|my_center|LOCUS_22070 9525 8875 gene locus_tag LOCUS_22080 9525 8875 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902085.1 protein_id gnl|my_center|LOCUS_22080 12355 9566 gene locus_tag LOCUS_22090 gene alaS 12355 9566 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020252.1 protein_id gnl|my_center|LOCUS_22090 12529 12398 gene locus_tag LOCUS_22100 12529 12398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 >Feature sequence066 1134 2450 gene locus_tag LOCUS_22110 1134 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 2467 3405 gene locus_tag LOCUS_22120 2467 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 4125 3421 gene locus_tag LOCUS_22130 4125 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 4218 4394 gene locus_tag LOCUS_22140 4218 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 4408 4551 gene locus_tag LOCUS_22150 4408 4551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 4856 4602 gene locus_tag LOCUS_22160 4856 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 5300 5043 gene locus_tag LOCUS_22170 5300 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 5851 5426 gene locus_tag LOCUS_22180 5851 5426 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978373.1 protein_id gnl|my_center|LOCUS_22180 5998 7605 gene locus_tag LOCUS_22190 5998 7605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 7850 8059 gene locus_tag LOCUS_22200 7850 8059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 8056 8439 gene locus_tag LOCUS_22210 8056 8439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 9361 8390 gene locus_tag LOCUS_22220 9361 8390 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545174.1 protein_id gnl|my_center|LOCUS_22220 9412 10296 gene locus_tag LOCUS_22230 9412 10296 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024245.1 protein_id gnl|my_center|LOCUS_22230 10289 11461 gene locus_tag LOCUS_22240 10289 11461 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990698.1 protein_id gnl|my_center|LOCUS_22240 12139 11675 gene locus_tag LOCUS_22250 12139 11675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 >Feature sequence067 437 249 gene locus_tag LOCUS_22260 437 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 571 422 gene locus_tag LOCUS_22270 571 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 917 543 gene locus_tag LOCUS_22280 917 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 1759 905 gene locus_tag LOCUS_22290 1759 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 2701 1946 gene locus_tag LOCUS_22300 2701 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 2859 3029 gene locus_tag LOCUS_22310 2859 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 4599 3064 gene locus_tag LOCUS_22320 4599 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 4612 4803 gene locus_tag LOCUS_22330 4612 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 5275 5520 gene locus_tag LOCUS_22340 5275 5520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 6887 5652 gene locus_tag LOCUS_22350 6887 5652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22350 8101 7268 gene locus_tag LOCUS_22360 8101 7268 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249930.1 protein_id gnl|my_center|LOCUS_22360 8273 8821 gene locus_tag LOCUS_22370 8273 8821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 9118 8792 gene locus_tag LOCUS_22380 9118 8792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 9379 9164 gene locus_tag LOCUS_22390 9379 9164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 9572 10003 gene locus_tag LOCUS_22400 9572 10003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 10872 10045 gene locus_tag LOCUS_22410 10872 10045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 12181 10874 gene locus_tag LOCUS_22420 12181 10874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 >Feature sequence068 1091 2122 gene locus_tag LOCUS_22430 1091 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 2169 4496 gene locus_tag LOCUS_22440 2169 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 4589 6961 gene locus_tag LOCUS_22450 4589 6961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 6967 9090 gene locus_tag LOCUS_22460 6967 9090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 9097 10179 gene locus_tag LOCUS_22470 9097 10179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 10258 11613 gene locus_tag LOCUS_22480 10258 11613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 >Feature sequence069 1482 202 gene locus_tag LOCUS_22490 1482 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 1824 1489 gene locus_tag LOCUS_22500 1824 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 2057 3523 gene locus_tag LOCUS_22510 2057 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 3592 4050 gene locus_tag LOCUS_22520 3592 4050 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060824.1 protein_id gnl|my_center|LOCUS_22520 4861 4088 gene locus_tag LOCUS_22530 4861 4088 CDS product heparan-alpha-glucosaminide N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065998.1 protein_id gnl|my_center|LOCUS_22530 4977 5513 gene locus_tag LOCUS_22540 4977 5513 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545295.1 protein_id gnl|my_center|LOCUS_22540 6214 5879 gene locus_tag LOCUS_22550 6214 5879 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496878.1 protein_id gnl|my_center|LOCUS_22550 6257 6742 gene locus_tag LOCUS_22560 6257 6742 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583986.1 protein_id gnl|my_center|LOCUS_22560 7055 6801 gene locus_tag LOCUS_22570 7055 6801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 7186 7479 gene locus_tag LOCUS_22580 7186 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 8362 7499 gene locus_tag LOCUS_22590 8362 7499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021970.1 protein_id gnl|my_center|LOCUS_22590 8556 10307 gene locus_tag LOCUS_22600 8556 10307 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023883.1 protein_id gnl|my_center|LOCUS_22600 10467 11756 gene locus_tag LOCUS_22610 10467 11756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 11796 11996 gene locus_tag LOCUS_22620 11796 11996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 11993 12346 gene locus_tag LOCUS_22630 11993 12346 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140130.1 protein_id gnl|my_center|LOCUS_22630 >Feature sequence070 3436 221 gene locus_tag LOCUS_22640 gene carB 3436 221 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_22640 3742 3449 gene locus_tag LOCUS_22650 3742 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 4829 3993 gene locus_tag LOCUS_22660 gene hisF 4829 3993 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878322.1 protein_id gnl|my_center|LOCUS_22660 6243 5227 gene locus_tag LOCUS_22670 6243 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 7107 6427 gene locus_tag LOCUS_22680 7107 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 7905 7351 gene locus_tag LOCUS_22690 7905 7351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 8998 7916 gene locus_tag LOCUS_22700 8998 7916 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141151.1 protein_id gnl|my_center|LOCUS_22700 9263 9123 gene locus_tag LOCUS_22710 9263 9123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 10564 9230 gene locus_tag LOCUS_22720 gene glnA 10564 9230 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545065.1 protein_id gnl|my_center|LOCUS_22720 11437 10691 gene locus_tag LOCUS_22730 11437 10691 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061072.1 protein_id gnl|my_center|LOCUS_22730 >Feature sequence071 927 46 gene locus_tag LOCUS_22740 927 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 2829 2257 gene locus_tag LOCUS_22750 2829 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 3457 2813 gene locus_tag LOCUS_22760 3457 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 4940 5203 gene locus_tag LOCUS_22770 4940 5203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 6813 6235 gene locus_tag LOCUS_22780 6813 6235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 7759 6794 gene locus_tag LOCUS_22790 7759 6794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 9491 8871 gene locus_tag LOCUS_22800 9491 8871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 10495 9542 gene locus_tag LOCUS_22810 10495 9542 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_22810 11520 10783 gene locus_tag LOCUS_22820 11520 10783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22820 >Feature sequence072 197 757 gene locus_tag LOCUS_22830 gene dcd 197 757 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582476.1 protein_id gnl|my_center|LOCUS_22830 1855 2817 gene locus_tag LOCUS_22840 1855 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 3900 4424 gene locus_tag LOCUS_22850 3900 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 4444 4656 gene locus_tag LOCUS_22860 4444 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 4700 5197 gene locus_tag LOCUS_22870 4700 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393268.1 protein_id gnl|my_center|LOCUS_22870 5928 5722 gene locus_tag LOCUS_22880 5928 5722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 6074 6232 gene locus_tag LOCUS_22890 6074 6232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 6210 6572 gene locus_tag LOCUS_22900 6210 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 6580 6738 gene locus_tag LOCUS_22910 6580 6738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 6848 8374 gene locus_tag LOCUS_22920 6848 8374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 8495 9121 gene locus_tag LOCUS_22930 8495 9121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 10139 10294 gene locus_tag LOCUS_22940 10139 10294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 10418 11434 gene locus_tag LOCUS_22950 10418 11434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 >Feature sequence073 1262 240 gene locus_tag LOCUS_22960 1262 240 CDS product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061160.1 protein_id gnl|my_center|LOCUS_22960 2071 1265 gene locus_tag LOCUS_22970 2071 1265 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870482.1 protein_id gnl|my_center|LOCUS_22970 2190 5936 gene locus_tag LOCUS_22980 2190 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 6281 6018 gene locus_tag LOCUS_22990 6281 6018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 6552 6268 gene locus_tag LOCUS_23000 6552 6268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 6659 7819 gene locus_tag LOCUS_23010 6659 7819 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022128.1 protein_id gnl|my_center|LOCUS_23010 7854 9161 gene locus_tag LOCUS_23020 gene aroA 7854 9161 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024417.1 protein_id gnl|my_center|LOCUS_23020 9317 10030 gene locus_tag LOCUS_23030 9317 10030 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879740.1 protein_id gnl|my_center|LOCUS_23030 10067 11302 gene locus_tag LOCUS_23040 10067 11302 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021450.1 protein_id gnl|my_center|LOCUS_23040 11401 11474 gene locus_tag LOCUS_t00390 11401 11474 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence074 202 274 gene locus_tag LOCUS_t00400 202 274 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 294 1070 gene locus_tag LOCUS_23050 294 1070 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249791.1 protein_id gnl|my_center|LOCUS_23050 1074 1865 gene locus_tag LOCUS_23060 gene cobS 1074 1865 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867168.1 protein_id gnl|my_center|LOCUS_23060 1951 1866 gene locus_tag LOCUS_t00410 1951 1866 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2571 1981 gene locus_tag LOCUS_23070 2571 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 2681 3640 gene locus_tag LOCUS_23080 2681 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 3656 4753 gene locus_tag LOCUS_23090 3656 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 5832 4846 gene locus_tag LOCUS_23100 5832 4846 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462159.1 protein_id gnl|my_center|LOCUS_23100 6383 5850 gene locus_tag LOCUS_23110 gene fdh3B 6383 5850 CDS product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812668.1 protein_id gnl|my_center|LOCUS_23110 9173 6399 gene locus_tag LOCUS_23120 9173 6399 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453899.1 protein_id gnl|my_center|LOCUS_23120 10023 9361 gene locus_tag LOCUS_23130 10023 9361 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815827.1 protein_id gnl|my_center|LOCUS_23130 11066 10020 gene locus_tag LOCUS_23140 11066 10020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 >Feature sequence075 2503 176 gene locus_tag LOCUS_23150 2503 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 3511 3017 gene locus_tag LOCUS_23160 3511 3017 CDS product PaREP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763657.1 protein_id gnl|my_center|LOCUS_23160 4328 3723 gene locus_tag LOCUS_23170 4328 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 5388 4429 gene locus_tag LOCUS_23180 5388 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 5636 6853 gene locus_tag LOCUS_23190 5636 6853 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064787.1 protein_id gnl|my_center|LOCUS_23190 6865 7281 gene locus_tag LOCUS_23200 gene rpl7ae 6865 7281 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053845.1 protein_id gnl|my_center|LOCUS_23200 7310 7522 gene locus_tag LOCUS_23210 7310 7522 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065141.1 protein_id gnl|my_center|LOCUS_23210 7563 7763 gene locus_tag LOCUS_23220 7563 7763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 7787 8206 gene locus_tag LOCUS_23230 gene ndk 7787 8206 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_23230 9855 8203 gene locus_tag LOCUS_23240 9855 8203 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544969.1 protein_id gnl|my_center|LOCUS_23240 10317 9922 gene locus_tag LOCUS_23250 10317 9922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 >Feature sequence076 260 433 gene locus_tag LOCUS_23260 260 433 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878609.1 protein_id gnl|my_center|LOCUS_23260 491 1768 gene locus_tag LOCUS_23270 491 1768 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020304.1 protein_id gnl|my_center|LOCUS_23270 1844 2233 gene locus_tag LOCUS_23280 1844 2233 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259070.1 protein_id gnl|my_center|LOCUS_23280 2178 2537 gene locus_tag LOCUS_23290 2178 2537 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228087.1 protein_id gnl|my_center|LOCUS_23290 4263 2629 gene locus_tag LOCUS_23300 gene pheT 4263 2629 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021951.1 protein_id gnl|my_center|LOCUS_23300 5045 4275 gene locus_tag LOCUS_23310 5045 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 7354 5018 gene locus_tag LOCUS_23320 7354 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 8656 7487 gene locus_tag LOCUS_23330 gene endA 8656 7487 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023532.1 protein_id gnl|my_center|LOCUS_23330 9314 8805 gene locus_tag LOCUS_23340 9314 8805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 9752 9321 gene locus_tag LOCUS_23350 9752 9321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 >Feature sequence077 57 239 gene locus_tag LOCUS_23360 57 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 233 1180 gene locus_tag LOCUS_23370 233 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 1329 1817 gene locus_tag LOCUS_23380 1329 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 2990 1947 gene locus_tag LOCUS_23390 2990 1947 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881382.1 protein_id gnl|my_center|LOCUS_23390 3110 3640 gene locus_tag LOCUS_23400 3110 3640 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020095.1 protein_id gnl|my_center|LOCUS_23400 3680 4180 gene locus_tag LOCUS_23410 3680 4180 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020241.1 protein_id gnl|my_center|LOCUS_23410 4648 4199 gene locus_tag LOCUS_23420 4648 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 5441 4797 gene locus_tag LOCUS_23430 5441 4797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 5852 5463 gene locus_tag LOCUS_23440 5852 5463 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021138.1 protein_id gnl|my_center|LOCUS_23440 6406 5855 gene locus_tag LOCUS_23450 gene rpsD 6406 5855 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875676.1 protein_id gnl|my_center|LOCUS_23450 6947 6408 gene locus_tag LOCUS_23460 6947 6408 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066175.1 protein_id gnl|my_center|LOCUS_23460 8062 7061 gene locus_tag LOCUS_23470 8062 7061 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021133.1 protein_id gnl|my_center|LOCUS_23470 9153 8089 gene locus_tag LOCUS_23480 gene cofH 9153 8089 CDS product 5-amino-6-(D-ribitylamino)uracil--L-tyrosine 4-hydroxyphenyl transferase CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878301.1 protein_id gnl|my_center|LOCUS_23480 >Feature sequence078 <1 820 gene locus_tag LOCUS_23490 <1 820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932772.1:DUF87 domain-containing protein 1056 1553 gene locus_tag LOCUS_23500 1056 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 1553 3070 gene locus_tag LOCUS_23510 1553 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 4257 5204 gene locus_tag LOCUS_23520 4257 5204 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987008.1 protein_id gnl|my_center|LOCUS_23520 5898 6449 gene locus_tag LOCUS_23530 5898 6449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 6716 7252 gene locus_tag LOCUS_23540 6716 7252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 7294 7551 gene locus_tag LOCUS_23550 7294 7551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 >Feature sequence079 365 2290 gene locus_tag LOCUS_23560 365 2290 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875919.1 protein_id gnl|my_center|LOCUS_23560 2429 2749 gene locus_tag LOCUS_23570 2429 2749 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545882.1 protein_id gnl|my_center|LOCUS_23570 3602 2739 gene locus_tag LOCUS_23580 3602 2739 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_23580 4474 3599 gene locus_tag LOCUS_23590 4474 3599 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024124.1 protein_id gnl|my_center|LOCUS_23590 4692 4471 gene locus_tag LOCUS_23600 4692 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 5050 4733 gene locus_tag LOCUS_23610 5050 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 5739 5371 gene locus_tag LOCUS_23620 5739 5371 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065940.1 protein_id gnl|my_center|LOCUS_23620 6364 5744 gene locus_tag LOCUS_23630 6364 5744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 6778 6371 gene locus_tag LOCUS_23640 6778 6371 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393157.1 protein_id gnl|my_center|LOCUS_23640 7117 6809 gene locus_tag LOCUS_23650 7117 6809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 7484 7197 gene locus_tag LOCUS_23660 7484 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 8120 7647 gene locus_tag LOCUS_23670 8120 7647 CDS product DUF2124 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876495.1 protein_id gnl|my_center|LOCUS_23670 8782 8528 gene locus_tag LOCUS_23680 8782 8528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 >Feature sequence080 92 349 gene locus_tag LOCUS_23690 92 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 428 1831 gene locus_tag LOCUS_23700 gene glmM 428 1831 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868179.1 protein_id gnl|my_center|LOCUS_23700 1828 2892 gene locus_tag LOCUS_23710 gene moaA 1828 2892 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020164.1 protein_id gnl|my_center|LOCUS_23710 2889 3080 gene locus_tag LOCUS_23720 2889 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 3217 3840 gene locus_tag LOCUS_23730 3217 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139679809.1 protein_id gnl|my_center|LOCUS_23730 3824 4600 gene locus_tag LOCUS_23740 3824 4600 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168188351.1 protein_id gnl|my_center|LOCUS_23740 4618 5256 gene locus_tag LOCUS_23750 4618 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 6499 5366 gene locus_tag LOCUS_23760 6499 5366 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257896.1 protein_id gnl|my_center|LOCUS_23760 7184 6732 gene locus_tag LOCUS_23770 7184 6732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 7380 8144 gene locus_tag LOCUS_23780 7380 8144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 8128 8388 gene locus_tag LOCUS_23790 8128 8388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 8407 8889 gene locus_tag LOCUS_23800 8407 8889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 >Feature sequence081 253 1854 gene locus_tag LOCUS_23810 253 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 2337 2023 gene locus_tag LOCUS_23820 2337 2023 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250944.1 protein_id gnl|my_center|LOCUS_23820 3182 2664 gene locus_tag LOCUS_23830 3182 2664 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948618.1 protein_id gnl|my_center|LOCUS_23830 4384 3521 gene locus_tag LOCUS_23840 4384 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 4617 4420 gene locus_tag LOCUS_23850 4617 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 5254 4667 gene locus_tag LOCUS_23860 5254 4667 CDS product protein-S-isoprenylcysteine O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969325.1 protein_id gnl|my_center|LOCUS_23860 6143 5316 gene locus_tag LOCUS_23870 6143 5316 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876413.1 protein_id gnl|my_center|LOCUS_23870 7273 6137 gene locus_tag LOCUS_23880 7273 6137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 7414 8415 gene locus_tag LOCUS_23890 7414 8415 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871181.1 protein_id gnl|my_center|LOCUS_23890 >Feature sequence082 201 1115 gene locus_tag LOCUS_23900 201 1115 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584059.1 protein_id gnl|my_center|LOCUS_23900 1201 2400 gene locus_tag LOCUS_23910 1201 2400 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181452.1 protein_id gnl|my_center|LOCUS_23910 2382 2678 gene locus_tag LOCUS_23920 2382 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 3159 4598 gene locus_tag LOCUS_23930 3159 4598 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021343.1 protein_id gnl|my_center|LOCUS_23930 4792 6108 gene locus_tag LOCUS_23940 gene ftsA 4792 6108 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755965.1 protein_id gnl|my_center|LOCUS_23940 6355 6678 gene locus_tag LOCUS_23950 6355 6678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 6701 6982 gene locus_tag LOCUS_23960 6701 6982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 6972 7535 gene locus_tag LOCUS_23970 6972 7535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 7958 7539 gene locus_tag LOCUS_23980 7958 7539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 >Feature sequence083 120 1934 gene locus_tag LOCUS_23990 120 1934 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967805.1 protein_id gnl|my_center|LOCUS_23990 2134 4269 gene locus_tag LOCUS_24000 2134 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 4279 4668 gene locus_tag LOCUS_24010 4279 4668 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868673.1 protein_id gnl|my_center|LOCUS_24010 4665 4970 gene locus_tag LOCUS_24020 4665 4970 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870419.1 protein_id gnl|my_center|LOCUS_24020 5100 5294 gene locus_tag LOCUS_24030 5100 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 5287 7113 gene locus_tag LOCUS_24040 5287 7113 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396787.1 protein_id gnl|my_center|LOCUS_24040 >Feature sequence084 1426 947 gene locus_tag LOCUS_24050 1426 947 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867261.1 protein_id gnl|my_center|LOCUS_24050 1552 3444 gene locus_tag LOCUS_24060 1552 3444 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250356.1 protein_id gnl|my_center|LOCUS_24060 4080 3583 gene locus_tag LOCUS_24070 4080 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 4177 4341 gene locus_tag LOCUS_24080 4177 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 4299 4442 gene locus_tag LOCUS_24090 4299 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 4439 5332 gene locus_tag LOCUS_24100 4439 5332 CDS product presenilin family intramembrane aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065870.1 protein_id gnl|my_center|LOCUS_24100 6171 5329 gene locus_tag LOCUS_24110 6171 5329 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066525.1 protein_id gnl|my_center|LOCUS_24110 6752 6264 gene locus_tag LOCUS_24120 6752 6264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 7359 6883 gene locus_tag LOCUS_24130 7359 6883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 >Feature sequence085 480 199 gene locus_tag LOCUS_24140 480 199 CDS product DUF1894 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020188.1 protein_id gnl|my_center|LOCUS_24140 938 462 gene locus_tag LOCUS_24150 938 462 CDS product DUF1890 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020187.1 protein_id gnl|my_center|LOCUS_24150 1518 931 gene locus_tag LOCUS_24160 1518 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 1718 1512 gene locus_tag LOCUS_24170 1718 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 2143 1919 gene locus_tag LOCUS_24180 2143 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 2630 2337 gene locus_tag LOCUS_24190 2630 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 3999 2968 gene locus_tag LOCUS_24200 3999 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 4720 4109 gene locus_tag LOCUS_24210 4720 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 4970 5509 gene locus_tag LOCUS_24220 4970 5509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 5626 6291 gene locus_tag LOCUS_24230 5626 6291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 7105 6380 gene locus_tag LOCUS_24240 7105 6380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 >Feature sequence086 540 4 gene locus_tag LOCUS_24250 540 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 1204 512 gene locus_tag LOCUS_24260 1204 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 1983 1189 gene locus_tag LOCUS_24270 1983 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 2352 2206 gene locus_tag LOCUS_24280 2352 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 2667 2476 gene locus_tag LOCUS_24290 2667 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 3340 2660 gene locus_tag LOCUS_24300 3340 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 4097 3270 gene locus_tag LOCUS_24310 4097 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 4289 5698 gene locus_tag LOCUS_24320 4289 5698 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921547.1 protein_id gnl|my_center|LOCUS_24320 5780 6979 gene locus_tag LOCUS_24330 5780 6979 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706740.1 protein_id gnl|my_center|LOCUS_24330 >Feature sequence087 181 1083 gene locus_tag LOCUS_24340 gene fhcD 181 1083 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020069.1 protein_id gnl|my_center|LOCUS_24340 1220 1855 gene locus_tag LOCUS_24350 1220 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 2142 1996 gene locus_tag LOCUS_24360 2142 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 2385 2152 gene locus_tag LOCUS_24370 2385 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 3127 2513 gene locus_tag LOCUS_24380 3127 2513 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680767.1 protein_id gnl|my_center|LOCUS_24380 4374 3142 gene locus_tag LOCUS_24390 gene pan 4374 3142 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879468.1 protein_id gnl|my_center|LOCUS_24390 4432 4839 gene locus_tag LOCUS_24400 4432 4839 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065943.1 protein_id gnl|my_center|LOCUS_24400 5489 4884 gene locus_tag LOCUS_24410 5489 4884 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503345.1 protein_id gnl|my_center|LOCUS_24410 >Feature sequence088 1283 84 gene locus_tag LOCUS_24420 gene trpB 1283 84 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064422.1 protein_id gnl|my_center|LOCUS_24420 2089 1358 gene locus_tag LOCUS_24430 2089 1358 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082737.1 protein_id gnl|my_center|LOCUS_24430 2974 2420 gene locus_tag LOCUS_24440 2974 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023019.1 protein_id gnl|my_center|LOCUS_24440 3552 3073 gene locus_tag LOCUS_24450 3552 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023018.1 protein_id gnl|my_center|LOCUS_24450 4477 3545 gene locus_tag LOCUS_24460 4477 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 5283 4588 gene locus_tag LOCUS_24470 5283 4588 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042684532.1 protein_id gnl|my_center|LOCUS_24470 5894 5310 gene locus_tag LOCUS_24480 5894 5310 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042684532.1 protein_id gnl|my_center|LOCUS_24480 6563 5907 gene locus_tag LOCUS_24490 6563 5907 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042684532.1 protein_id gnl|my_center|LOCUS_24490 6642 6836 gene locus_tag LOCUS_24500 6642 6836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 >Feature sequence089 1385 87 gene locus_tag LOCUS_24510 1385 87 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393432.1 protein_id gnl|my_center|LOCUS_24510 1562 1407 gene locus_tag LOCUS_24520 1562 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 3180 1675 gene locus_tag LOCUS_24530 3180 1675 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_24530 3400 4143 gene locus_tag LOCUS_24540 3400 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 5427 4171 gene locus_tag LOCUS_24550 5427 4171 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871132.1 protein_id gnl|my_center|LOCUS_24550 <6585 5431 gene locus_tag LOCUS_24560 <6585 5431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010871132.1:glycosyltransferase family 4 protein >Feature sequence090 2177 93 gene locus_tag LOCUS_24570 2177 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 2461 2982 gene locus_tag LOCUS_24580 2461 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 3124 3618 gene locus_tag LOCUS_24590 3124 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 3908 4354 gene locus_tag LOCUS_24600 3908 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 5812 4538 gene locus_tag LOCUS_24610 5812 4538 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878057.1 protein_id gnl|my_center|LOCUS_24610 6172 5999 gene locus_tag LOCUS_24620 6172 5999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 6374 6153 gene locus_tag LOCUS_24630 6374 6153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 >Feature sequence091 2043 967 gene locus_tag LOCUS_24640 2043 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877363.1 protein_id gnl|my_center|LOCUS_24640 2092 3285 gene locus_tag LOCUS_24650 gene priS 2092 3285 CDS product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020695.1 protein_id gnl|my_center|LOCUS_24650 3334 3978 gene locus_tag LOCUS_24660 3334 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 3983 4261 gene locus_tag LOCUS_24670 3983 4261 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878830.1 protein_id gnl|my_center|LOCUS_24670 4309 4494 gene locus_tag LOCUS_24680 4309 4494 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147173.1 protein_id gnl|my_center|LOCUS_24680 4495 5316 gene locus_tag LOCUS_24690 4495 5316 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064935.1 protein_id gnl|my_center|LOCUS_24690 >Feature sequence092 933 418 gene locus_tag LOCUS_24700 933 418 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027607744.1 protein_id gnl|my_center|LOCUS_24700 1182 943 gene locus_tag LOCUS_24710 1182 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 1508 2287 gene locus_tag LOCUS_24720 1508 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 2271 2708 gene locus_tag LOCUS_24730 2271 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 2991 3620 gene locus_tag LOCUS_24740 gene ppaX 2991 3620 CDS product pyrophosphatase PpaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700956.1 protein_id gnl|my_center|LOCUS_24740 4345 3653 gene locus_tag LOCUS_24750 4345 3653 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272276.1 protein_id gnl|my_center|LOCUS_24750 4471 4806 gene locus_tag LOCUS_24760 4471 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 4803 5390 gene locus_tag LOCUS_24770 4803 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 5616 5455 gene locus_tag LOCUS_24780 5616 5455 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877678.1 protein_id gnl|my_center|LOCUS_24780 >Feature sequence093 2576 534 gene locus_tag LOCUS_24790 2576 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 3326 2637 gene locus_tag LOCUS_24800 3326 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 4306 3323 gene locus_tag LOCUS_24810 4306 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 4485 4370 gene locus_tag LOCUS_r00030 4485 4370 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence094 368 201 gene locus_tag LOCUS_24820 368 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 832 365 gene locus_tag LOCUS_24830 832 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 1091 819 gene locus_tag LOCUS_24840 1091 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 1619 1092 gene locus_tag LOCUS_24850 1619 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 2430 1642 gene locus_tag LOCUS_24860 2430 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 2707 2441 gene locus_tag LOCUS_24870 2707 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 3312 2869 gene locus_tag LOCUS_24880 3312 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 3426 3806 gene locus_tag LOCUS_24890 3426 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 4256 4098 gene locus_tag LOCUS_24900 4256 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 4549 4253 gene locus_tag LOCUS_24910 4549 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 >Feature sequence095 395 1495 gene locus_tag LOCUS_24920 395 1495 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881057.1 protein_id gnl|my_center|LOCUS_24920 1610 1924 gene locus_tag LOCUS_24930 1610 1924 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140979.1 protein_id gnl|my_center|LOCUS_24930 1921 2262 gene locus_tag LOCUS_24940 1921 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 2250 2486 gene locus_tag LOCUS_24950 2250 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 2628 3092 gene locus_tag LOCUS_24960 2628 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 3082 3216 gene locus_tag LOCUS_24970 3082 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 3771 5366 gene locus_tag LOCUS_24980 3771 5366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 >Feature sequence096 1356 541 gene locus_tag LOCUS_24990 1356 541 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942362.1 protein_id gnl|my_center|LOCUS_24990 2120 1356 gene locus_tag LOCUS_25000 gene pstB 2120 1356 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_25000 2979 2134 gene locus_tag LOCUS_25010 gene pstA 2979 2134 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049767.1 protein_id gnl|my_center|LOCUS_25010 3879 2980 gene locus_tag LOCUS_25020 gene pstC 3879 2980 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877335.1 protein_id gnl|my_center|LOCUS_25020 4839 3880 gene locus_tag LOCUS_25030 4839 3880 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064991.1 protein_id gnl|my_center|LOCUS_25030 5077 4853 gene locus_tag LOCUS_25040 5077 4853 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146889.1 protein_id gnl|my_center|LOCUS_25040 >Feature sequence097 148 522 gene locus_tag LOCUS_25050 148 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 1068 1520 gene locus_tag LOCUS_25060 1068 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 2422 1817 gene locus_tag LOCUS_25070 2422 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 3017 3841 gene locus_tag LOCUS_25080 3017 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 4359 4039 gene locus_tag LOCUS_25090 4359 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 4639 4391 gene locus_tag LOCUS_25100 4639 4391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 4992 4636 gene locus_tag LOCUS_25110 4992 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 >Feature sequence098 516 1802 gene locus_tag LOCUS_25120 516 1802 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135390550.1 protein_id gnl|my_center|LOCUS_25120 3043 2630 gene locus_tag LOCUS_25130 3043 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 3976 3611 gene locus_tag LOCUS_25140 3976 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 >Feature sequence099 1021 299 gene locus_tag LOCUS_25150 1021 299 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879510.1 protein_id gnl|my_center|LOCUS_25150 2820 1237 gene locus_tag LOCUS_25160 2820 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 3816 3322 gene locus_tag LOCUS_25170 3816 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 4305 3961 gene locus_tag LOCUS_25180 4305 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 >Feature sequence100 181 1635 gene locus_tag LOCUS_25190 181 1635 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871161.1 protein_id gnl|my_center|LOCUS_25190 2171 1656 gene locus_tag LOCUS_25200 2171 1656 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064835.1 protein_id gnl|my_center|LOCUS_25200 2644 2414 gene locus_tag LOCUS_25210 2644 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 2871 2641 gene locus_tag LOCUS_25220 2871 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 3073 4047 gene locus_tag LOCUS_25230 3073 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 >Feature sequence101 352 1911 gene locus_tag LOCUS_25240 352 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 2384 1908 gene locus_tag LOCUS_25250 2384 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 2826 2386 gene locus_tag LOCUS_25260 2826 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 <3725 2928 gene locus_tag LOCUS_25270 <3725 2928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066157.1:AIR synthase-related protein >Feature sequence102 279 43 gene locus_tag LOCUS_25280 279 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 815 1681 gene locus_tag LOCUS_25290 815 1681 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860395.1 protein_id gnl|my_center|LOCUS_25290 3164 2385 gene locus_tag LOCUS_25300 3164 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 >Feature sequence103 991 98 gene locus_tag LOCUS_25310 991 98 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860057.1 protein_id gnl|my_center|LOCUS_25310 1062 2348 gene locus_tag LOCUS_25320 1062 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 2355 2831 gene locus_tag LOCUS_25330 2355 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 >Feature sequence104 <1 696 gene locus_tag LOCUS_25340 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023773.1:dihydropteroate synthase-like protein 2059 680 gene locus_tag LOCUS_25350 gene gvpD 2059 680 CDS product gas vesicle protein GvpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904107.1 protein_id gnl|my_center|LOCUS_25350 2219 2088 gene locus_tag LOCUS_25360 2219 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 2653 2279 gene locus_tag LOCUS_25370 2653 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 3222 2890 gene locus_tag LOCUS_25380 3222 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 >Feature sequence105 <1 1157 gene locus_tag LOCUS_25390 <1 1157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066108.1:lysine--tRNA ligase 1321 1160 gene locus_tag LOCUS_25400 1321 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 2065 1400 gene locus_tag LOCUS_25410 2065 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 2187 2570 gene locus_tag LOCUS_25420 2187 2570 CDS product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876242.1 protein_id gnl|my_center|LOCUS_25420 2816 3187 gene locus_tag LOCUS_25430 gene tnpA 2816 3187 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979110.1 protein_id gnl|my_center|LOCUS_25430 3239 3391 gene locus_tag LOCUS_25440 3239 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 >Feature sequence106 211 92 gene locus_tag LOCUS_25450 211 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 834 415 gene locus_tag LOCUS_25460 834 415 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846620.1 protein_id gnl|my_center|LOCUS_25460 1013 831 gene locus_tag LOCUS_25470 1013 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 1651 1511 gene locus_tag LOCUS_25480 1651 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 2117 1923 gene locus_tag LOCUS_25490 2117 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 2419 2171 gene locus_tag LOCUS_25500 2419 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 3265 2534 gene locus_tag LOCUS_25510 3265 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 >Feature sequence107 245 30 gene locus_tag LOCUS_25520 245 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 510 328 gene locus_tag LOCUS_25530 510 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 1007 603 gene locus_tag LOCUS_25540 1007 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 1555 1202 gene locus_tag LOCUS_25550 1555 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 1691 1530 gene locus_tag LOCUS_25560 1691 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 2156 1707 gene locus_tag LOCUS_25570 2156 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 2535 2167 gene locus_tag LOCUS_25580 2535 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 >Feature sequence108 2941 1589 gene locus_tag LOCUS_25590 2941 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 >Feature sequence109 1268 336 gene locus_tag LOCUS_25600 1268 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 2116 1265 gene locus_tag LOCUS_25610 2116 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 2920 2141 gene locus_tag LOCUS_25620 2920 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 >Feature sequence110 218 397 gene locus_tag LOCUS_25630 218 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 1023 430 gene locus_tag LOCUS_25640 1023 430 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879640.1 protein_id gnl|my_center|LOCUS_25640 1374 1219 gene locus_tag LOCUS_25650 1374 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 2260 1454 gene locus_tag LOCUS_25660 2260 1454 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779169.1 protein_id gnl|my_center|LOCUS_25660 2353 2426 gene locus_tag LOCUS_t00420 2353 2426 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2611 2976 gene locus_tag LOCUS_25670 2611 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 >Feature sequence111 <1 1775 gene locus_tag LOCUS_25680 <1 1775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_138169592.1:FAD-binding and (Fe-S)-binding domain-containing protein >Feature sequence112 212 1021 gene locus_tag LOCUS_25690 212 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 1037 1282 gene locus_tag LOCUS_25700 1037 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 2902 1325 gene locus_tag LOCUS_25710 gene purH 2902 1325 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187564.1 protein_id gnl|my_center|LOCUS_25710 >Feature sequence113 1794 1606 gene locus_tag LOCUS_25720 1794 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 2014 2247 gene locus_tag LOCUS_25730 2014 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 2361 2735 gene locus_tag LOCUS_25740 2361 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 >Feature sequence114 184 1236 gene locus_tag LOCUS_25750 184 1236 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877631.1 protein_id gnl|my_center|LOCUS_25750 <2715 1219 gene locus_tag LOCUS_25760 <2715 1219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437761.1:cobyric acid synthase >Feature sequence115 >Feature sequence116 1667 573 gene locus_tag LOCUS_25770 gene hypE 1667 573 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870181.1 protein_id gnl|my_center|LOCUS_25770 1772 2101 gene locus_tag LOCUS_25780 1772 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 >Feature sequence117 201 1268 gene locus_tag LOCUS_25790 201 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 1345 1593 gene locus_tag LOCUS_25800 1345 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 1562 1993 gene locus_tag LOCUS_25810 1562 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 >Feature sequence118 826 398 gene locus_tag LOCUS_25820 826 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 1294 1593 gene locus_tag LOCUS_25830 1294 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 1766 1488 gene locus_tag LOCUS_25840 1766 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 >Feature sequence119 519 154 gene locus_tag LOCUS_25850 519 154 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_25850 1174 677 gene locus_tag LOCUS_25860 1174 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 1363 1175 gene locus_tag LOCUS_25870 1363 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 1433 1711 gene locus_tag LOCUS_25880 1433 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 1724 1870 gene locus_tag LOCUS_25890 1724 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 >Feature sequence120 3 182 gene locus_tag LOCUS_25900 3 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 182 1591 gene locus_tag LOCUS_25910 182 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 >Feature sequence121 866 465 gene locus_tag LOCUS_25920 866 465 CDS product class II SORL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081116.1 protein_id gnl|my_center|LOCUS_25920 1357 866 gene locus_tag LOCUS_25930 1357 866 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932996.1 protein_id gnl|my_center|LOCUS_25930 >Feature sequence122 893 1066 gene locus_tag LOCUS_25940 893 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 1059 1487 gene locus_tag LOCUS_25950 1059 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 >Feature sequence123 329 1135 gene locus_tag LOCUS_25960 329 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 1132 1395 gene locus_tag LOCUS_25970 1132 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 1450 1653 gene locus_tag LOCUS_25980 1450 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 >Feature sequence124 179 1468 gene locus_tag LOCUS_25990 179 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 >Feature sequence125 <1 1150 gene locus_tag LOCUS_26000 <1 1150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259739.1:M14 family metallopeptidase 1147 1269 gene locus_tag LOCUS_26010 1147 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 >Feature sequence126 717 475 gene locus_tag LOCUS_26020 717 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 1552 1190 gene locus_tag LOCUS_26030 1552 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 >Feature sequence127 1590 817 gene locus_tag LOCUS_26040 1590 817 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064392.1 protein_id gnl|my_center|LOCUS_26040 >Feature sequence128 >Feature sequence129 >Feature sequence130 43 837 gene locus_tag LOCUS_26050 43 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 >Feature sequence131 94 1137 gene locus_tag LOCUS_26060 94 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 >Feature sequence132 >Feature sequence133 816 70 gene locus_tag LOCUS_26070 816 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 >Feature sequence134 >Feature sequence135 328 867 gene locus_tag LOCUS_26080 328 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 >Feature sequence136 213 49 gene locus_tag LOCUS_26090 213 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090