>Feature sequence001 364 921 gene locus_tag LOCUS_00010 364 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1292 915 gene locus_tag LOCUS_00020 1292 915 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459154.1 protein_id gnl|my_center|LOCUS_00020 1490 1780 gene locus_tag LOCUS_00030 1490 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272212.1 protein_id gnl|my_center|LOCUS_00030 2044 1868 gene locus_tag LOCUS_00040 2044 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 2469 3089 gene locus_tag LOCUS_00050 2469 3089 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066132.1 protein_id gnl|my_center|LOCUS_00050 3138 3374 gene locus_tag LOCUS_00060 3138 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 3507 3325 gene locus_tag LOCUS_00070 3507 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 4552 3551 gene locus_tag LOCUS_00080 4552 3551 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_00080 5556 4558 gene locus_tag LOCUS_00090 5556 4558 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582887.1 protein_id gnl|my_center|LOCUS_00090 6596 5643 gene locus_tag LOCUS_00100 gene manA 6596 5643 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379715.1 protein_id gnl|my_center|LOCUS_00100 7978 6593 gene locus_tag LOCUS_00110 7978 6593 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027550.1 protein_id gnl|my_center|LOCUS_00110 9719 7992 gene locus_tag LOCUS_00120 9719 7992 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 protein_id gnl|my_center|LOCUS_00120 10877 9780 gene locus_tag LOCUS_00130 10877 9780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 12461 10992 gene locus_tag LOCUS_00140 12461 10992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 19183 12458 gene locus_tag LOCUS_00150 19183 12458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 20261 19161 gene locus_tag LOCUS_00160 20261 19161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 21444 20263 gene locus_tag LOCUS_00170 21444 20263 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108595.1 protein_id gnl|my_center|LOCUS_00170 22609 21419 gene locus_tag LOCUS_00180 22609 21419 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583022.1 protein_id gnl|my_center|LOCUS_00180 23657 22635 gene locus_tag LOCUS_00190 23657 22635 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080062.1 protein_id gnl|my_center|LOCUS_00190 24549 23695 gene locus_tag LOCUS_00200 24549 23695 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030752.1 protein_id gnl|my_center|LOCUS_00200 25574 24546 gene locus_tag LOCUS_00210 25574 24546 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030753.1 protein_id gnl|my_center|LOCUS_00210 26987 25617 gene locus_tag LOCUS_00220 26987 25617 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030754.1 protein_id gnl|my_center|LOCUS_00220 30073 27287 gene locus_tag LOCUS_00230 30073 27287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 33492 30094 gene locus_tag LOCUS_00240 33492 30094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 34649 33969 gene locus_tag LOCUS_00250 34649 33969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 34828 34652 gene locus_tag LOCUS_00260 34828 34652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 >Feature sequence002 <1 1926 gene locus_tag LOCUS_00270 <1 1926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461077.1:ABC transporter substrate-binding protein 2276 2061 gene locus_tag LOCUS_00280 2276 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 2882 2544 gene locus_tag LOCUS_00290 2882 2544 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279278.1 protein_id gnl|my_center|LOCUS_00290 3076 4005 gene locus_tag LOCUS_00300 3076 4005 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013877237.1 protein_id gnl|my_center|LOCUS_00300 4266 5615 gene locus_tag LOCUS_00310 4266 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 5616 8153 gene locus_tag LOCUS_00320 5616 8153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 8171 8842 gene locus_tag LOCUS_00330 8171 8842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 9258 9055 gene locus_tag LOCUS_00340 9258 9055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 9414 12704 gene locus_tag LOCUS_00350 9414 12704 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263812.1 protein_id gnl|my_center|LOCUS_00350 12701 13657 gene locus_tag LOCUS_00360 12701 13657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 13669 13953 gene locus_tag LOCUS_00370 13669 13953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 15212 14013 gene locus_tag LOCUS_00380 15212 14013 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424103.1 protein_id gnl|my_center|LOCUS_00380 16578 15343 gene locus_tag LOCUS_00390 gene dacF 16578 15343 CDS product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398637.1 protein_id gnl|my_center|LOCUS_00390 16739 18289 gene locus_tag LOCUS_00400 16739 18289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 20978 18369 gene locus_tag LOCUS_00410 20978 18369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 21190 21552 gene locus_tag LOCUS_00420 21190 21552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 22718 21762 gene locus_tag LOCUS_00430 22718 21762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 23783 22725 gene locus_tag LOCUS_00440 23783 22725 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815048.1 protein_id gnl|my_center|LOCUS_00440 24451 23801 gene locus_tag LOCUS_00450 24451 23801 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809652.1 protein_id gnl|my_center|LOCUS_00450 25854 24475 gene locus_tag LOCUS_00460 25854 24475 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_00460 26673 25858 gene locus_tag LOCUS_00470 26673 25858 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_00470 27383 26670 gene locus_tag LOCUS_00480 27383 26670 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059649.1 protein_id gnl|my_center|LOCUS_00480 28384 27380 gene locus_tag LOCUS_00490 28384 27380 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943615.1 protein_id gnl|my_center|LOCUS_00490 29043 28381 gene locus_tag LOCUS_00500 29043 28381 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680765.1 protein_id gnl|my_center|LOCUS_00500 <31172 29092 gene locus_tag LOCUS_00510 <31172 29092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949155.1:homocysteine S-methyltransferase family protein >Feature sequence003 1614 1390 gene locus_tag LOCUS_00520 1614 1390 CDS product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903516.1 protein_id gnl|my_center|LOCUS_00520 2013 1642 gene locus_tag LOCUS_00530 2013 1642 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_00530 3014 2112 gene locus_tag LOCUS_00540 3014 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 3950 3030 gene locus_tag LOCUS_00550 3950 3030 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722212.1 protein_id gnl|my_center|LOCUS_00550 4116 5387 gene locus_tag LOCUS_00560 4116 5387 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879947.1 protein_id gnl|my_center|LOCUS_00560 5422 6573 gene locus_tag LOCUS_00570 5422 6573 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973629.1 protein_id gnl|my_center|LOCUS_00570 6570 7952 gene locus_tag LOCUS_00580 6570 7952 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023355052.1 protein_id gnl|my_center|LOCUS_00580 8930 8082 gene locus_tag LOCUS_00590 8930 8082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 10272 8992 gene locus_tag LOCUS_00600 10272 8992 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177663.1 protein_id gnl|my_center|LOCUS_00600 11295 10321 gene locus_tag LOCUS_00610 11295 10321 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974020.1 protein_id gnl|my_center|LOCUS_00610 12621 11344 gene locus_tag LOCUS_00620 12621 11344 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368318.1 protein_id gnl|my_center|LOCUS_00620 12849 14756 gene locus_tag LOCUS_00630 12849 14756 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392246.1 protein_id gnl|my_center|LOCUS_00630 15165 14881 gene locus_tag LOCUS_00640 15165 14881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 16532 15171 gene locus_tag LOCUS_00650 16532 15171 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_00650 17675 16548 gene locus_tag LOCUS_00660 17675 16548 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430436.1 protein_id gnl|my_center|LOCUS_00660 19087 17897 gene locus_tag LOCUS_00670 19087 17897 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459580.1 protein_id gnl|my_center|LOCUS_00670 20524 19172 gene locus_tag LOCUS_00680 20524 19172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 20790 20527 gene locus_tag LOCUS_00690 20790 20527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 22124 20799 gene locus_tag LOCUS_00700 22124 20799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 22977 22102 gene locus_tag LOCUS_00710 gene cdaA 22977 22102 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_00710 23961 22999 gene locus_tag LOCUS_00720 23961 22999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 24385 23939 gene locus_tag LOCUS_00730 24385 23939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 25383 24499 gene locus_tag LOCUS_00740 25383 24499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 26990 25770 gene locus_tag LOCUS_00750 26990 25770 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404919.1 protein_id gnl|my_center|LOCUS_00750 27759 26980 gene locus_tag LOCUS_00760 27759 26980 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_00760 29102 27771 gene locus_tag LOCUS_00770 29102 27771 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393804.1 protein_id gnl|my_center|LOCUS_00770 29200 29048 gene locus_tag LOCUS_00780 29200 29048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 29711 29361 gene locus_tag LOCUS_00790 29711 29361 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760124.1 protein_id gnl|my_center|LOCUS_00790 30126 29743 gene locus_tag LOCUS_00800 30126 29743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 >Feature sequence004 <1 1365 gene locus_tag LOCUS_00810 <1 1365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000333979.1:asparagine synthase (glutamine-hydrolyzing) 1452 2912 gene locus_tag LOCUS_00820 1452 2912 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096862.1 protein_id gnl|my_center|LOCUS_00820 4062 2887 gene locus_tag LOCUS_00830 4062 2887 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966034.1 protein_id gnl|my_center|LOCUS_00830 4283 5416 gene locus_tag LOCUS_00840 4283 5416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 7082 5622 gene locus_tag LOCUS_00850 7082 5622 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033065833.1 protein_id gnl|my_center|LOCUS_00850 8799 7294 gene locus_tag LOCUS_00860 8799 7294 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141432.1 protein_id gnl|my_center|LOCUS_00860 10846 8864 gene locus_tag LOCUS_00870 10846 8864 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475494.1 protein_id gnl|my_center|LOCUS_00870 12331 11327 gene locus_tag LOCUS_00880 12331 11327 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896952.1 protein_id gnl|my_center|LOCUS_00880 13010 14347 gene locus_tag LOCUS_00890 13010 14347 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_00890 14718 15626 gene locus_tag LOCUS_00900 14718 15626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 15648 16700 gene locus_tag LOCUS_00910 15648 16700 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079343.1 protein_id gnl|my_center|LOCUS_00910 16704 17048 gene locus_tag LOCUS_00920 16704 17048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 17045 17710 gene locus_tag LOCUS_00930 17045 17710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 17707 18108 gene locus_tag LOCUS_00940 17707 18108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 18117 18512 gene locus_tag LOCUS_00950 18117 18512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 18509 19597 gene locus_tag LOCUS_00960 18509 19597 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386380.1 protein_id gnl|my_center|LOCUS_00960 22978 19841 gene locus_tag LOCUS_00970 22978 19841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 23749 22982 gene locus_tag LOCUS_00980 gene srtB 23749 22982 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242427.1 protein_id gnl|my_center|LOCUS_00980 >Feature sequence005 2 1297 gene locus_tag LOCUS_00990 2 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 1308 3533 gene locus_tag LOCUS_01000 1308 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 3740 4321 gene locus_tag LOCUS_01010 3740 4321 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358515.1 protein_id gnl|my_center|LOCUS_01010 4318 5271 gene locus_tag LOCUS_01020 gene miaA 4318 5271 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_01020 5262 6542 gene locus_tag LOCUS_01030 5262 6542 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_01030 6610 6861 gene locus_tag LOCUS_01040 6610 6861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 6954 7643 gene locus_tag LOCUS_01050 gene radC 6954 7643 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360029.1 protein_id gnl|my_center|LOCUS_01050 7644 8654 gene locus_tag LOCUS_01060 gene mreC 7644 8654 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964556.1 protein_id gnl|my_center|LOCUS_01060 8651 9172 gene locus_tag LOCUS_01070 8651 9172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 9162 12038 gene locus_tag LOCUS_01080 9162 12038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 12140 12808 gene locus_tag LOCUS_01090 12140 12808 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902702.1 protein_id gnl|my_center|LOCUS_01090 12877 13668 gene locus_tag LOCUS_01100 gene minD 12877 13668 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816779.1 protein_id gnl|my_center|LOCUS_01100 13681 13956 gene locus_tag LOCUS_01110 gene minE 13681 13956 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869948.1 protein_id gnl|my_center|LOCUS_01110 13959 15083 gene locus_tag LOCUS_01120 gene rodA 13959 15083 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_01120 15102 15497 gene locus_tag LOCUS_01130 gene mgsA 15102 15497 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_01130 15476 16459 gene locus_tag LOCUS_01140 15476 16459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 16549 16968 gene locus_tag LOCUS_01150 16549 16968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_01150 17209 18660 gene locus_tag LOCUS_01160 17209 18660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 18699 19379 gene locus_tag LOCUS_01170 18699 19379 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_01170 19392 19916 gene locus_tag LOCUS_01180 19392 19916 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213920.1 protein_id gnl|my_center|LOCUS_01180 19916 20692 gene locus_tag LOCUS_01190 19916 20692 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897805.1 protein_id gnl|my_center|LOCUS_01190 20963 22048 gene locus_tag LOCUS_01200 gene aroB 20963 22048 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207828.1 protein_id gnl|my_center|LOCUS_01200 22065 22586 gene locus_tag LOCUS_01210 gene lspA 22065 22586 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454916.1 protein_id gnl|my_center|LOCUS_01210 22583 23494 gene locus_tag LOCUS_01220 22583 23494 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245307.1 protein_id gnl|my_center|LOCUS_01220 23584 24219 gene locus_tag LOCUS_01230 23584 24219 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_01230 24689 26869 gene locus_tag LOCUS_01240 24689 26869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 26887 28389 gene locus_tag LOCUS_01250 26887 28389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 >Feature sequence006 1137 1886 gene locus_tag LOCUS_01260 1137 1886 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887278.1 protein_id gnl|my_center|LOCUS_01260 1883 2188 gene locus_tag LOCUS_01270 1883 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 2338 2411 gene locus_tag LOCUS_t00010 2338 2411 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4906 3407 gene locus_tag LOCUS_01280 4906 3407 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069266.1 protein_id gnl|my_center|LOCUS_01280 5719 4910 gene locus_tag LOCUS_01290 gene phnE 5719 4910 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905273.1 protein_id gnl|my_center|LOCUS_01290 6536 5733 gene locus_tag LOCUS_01300 gene phnE 6536 5733 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131699.1 protein_id gnl|my_center|LOCUS_01300 7297 6533 gene locus_tag LOCUS_01310 gene phnC 7297 6533 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905272.1 protein_id gnl|my_center|LOCUS_01310 8548 7457 gene locus_tag LOCUS_01320 8548 7457 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905271.1 protein_id gnl|my_center|LOCUS_01320 9581 8616 gene locus_tag LOCUS_01330 9581 8616 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836854.1 protein_id gnl|my_center|LOCUS_01330 11077 9881 gene locus_tag LOCUS_01340 11077 9881 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016536.1 protein_id gnl|my_center|LOCUS_01340 11840 11103 gene locus_tag LOCUS_01350 11840 11103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01350 12319 11840 gene locus_tag LOCUS_01360 12319 11840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01360 12541 12329 gene locus_tag LOCUS_01370 12541 12329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01370 13729 12545 gene locus_tag LOCUS_01380 13729 12545 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682078.1 protein_id gnl|my_center|LOCUS_01380 14971 13745 gene locus_tag LOCUS_01390 14971 13745 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455004.1 protein_id gnl|my_center|LOCUS_01390 15317 16021 gene locus_tag LOCUS_01400 15317 16021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 16951 16169 gene locus_tag LOCUS_01410 16951 16169 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680889.1 protein_id gnl|my_center|LOCUS_01410 17729 17025 gene locus_tag LOCUS_01420 17729 17025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673400.1 protein_id gnl|my_center|LOCUS_01420 18576 17860 gene locus_tag LOCUS_01430 18576 17860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 20032 18599 gene locus_tag LOCUS_01440 20032 18599 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965348.1 protein_id gnl|my_center|LOCUS_01440 20239 21210 gene locus_tag LOCUS_01450 20239 21210 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966633.1 protein_id gnl|my_center|LOCUS_01450 23054 21846 gene locus_tag LOCUS_01460 gene ilvA 23054 21846 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_01460 23149 24330 gene locus_tag LOCUS_01470 23149 24330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 25416 24418 gene locus_tag LOCUS_01480 gene ilvC 25416 24418 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081338.1 protein_id gnl|my_center|LOCUS_01480 26058 25546 gene locus_tag LOCUS_01490 gene ilvN 26058 25546 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_01490 27356 26085 gene locus_tag LOCUS_01500 gene ilvB 27356 26085 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_01500 >Feature sequence007 1778 381 gene locus_tag LOCUS_01510 1778 381 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_01510 3561 1816 gene locus_tag LOCUS_01520 3561 1816 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_01520 5320 3563 gene locus_tag LOCUS_01530 5320 3563 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_01530 5560 6387 gene locus_tag LOCUS_01540 5560 6387 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048320.1 protein_id gnl|my_center|LOCUS_01540 7954 6464 gene locus_tag LOCUS_01550 7954 6464 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016113.1 protein_id gnl|my_center|LOCUS_01550 8250 7951 gene locus_tag LOCUS_01560 8250 7951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 8574 8260 gene locus_tag LOCUS_01570 8574 8260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 10358 8892 gene locus_tag LOCUS_01580 gene nagE 10358 8892 CDS product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705424.1 protein_id gnl|my_center|LOCUS_01580 10933 10448 gene locus_tag LOCUS_01590 10933 10448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 11799 10960 gene locus_tag LOCUS_01600 gene licT 11799 10960 CDS product transcriptional antiterminator LicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242598.1 protein_id gnl|my_center|LOCUS_01600 12777 12325 gene locus_tag LOCUS_01610 12777 12325 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416968.1 protein_id gnl|my_center|LOCUS_01610 15205 12917 gene locus_tag LOCUS_01620 15205 12917 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897245.1 protein_id gnl|my_center|LOCUS_01620 15665 15189 gene locus_tag LOCUS_01630 15665 15189 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434060.1 protein_id gnl|my_center|LOCUS_01630 16440 15667 gene locus_tag LOCUS_01640 16440 15667 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434058.1 protein_id gnl|my_center|LOCUS_01640 17903 16473 gene locus_tag LOCUS_01650 17903 16473 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963828.1 protein_id gnl|my_center|LOCUS_01650 19173 17890 gene locus_tag LOCUS_01660 19173 17890 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726618.1 protein_id gnl|my_center|LOCUS_01660 21459 19246 gene locus_tag LOCUS_01670 21459 19246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 22119 21772 gene locus_tag LOCUS_01680 22119 21772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 23395 22400 gene locus_tag LOCUS_01690 gene ruvB 23395 22400 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_01690 24040 23426 gene locus_tag LOCUS_01700 gene ruvA 24040 23426 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707372.1 protein_id gnl|my_center|LOCUS_01700 24197 25306 gene locus_tag LOCUS_01710 24197 25306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 25944 25396 gene locus_tag LOCUS_01720 25944 25396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 26183 26746 gene locus_tag LOCUS_01730 26183 26746 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458839.1 protein_id gnl|my_center|LOCUS_01730 26831 27028 gene locus_tag LOCUS_01740 26831 27028 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563620.1 protein_id gnl|my_center|LOCUS_01740 >Feature sequence008 703 404 gene locus_tag LOCUS_01750 703 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01750 1962 748 gene locus_tag LOCUS_01760 1962 748 CDS product DHHW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138263010.1 protein_id gnl|my_center|LOCUS_01760 3615 1987 gene locus_tag LOCUS_01770 3615 1987 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_01770 4249 3641 gene locus_tag LOCUS_01780 4249 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 4370 5401 gene locus_tag LOCUS_01790 4370 5401 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_01790 6259 5552 gene locus_tag LOCUS_01800 6259 5552 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853290.1 protein_id gnl|my_center|LOCUS_01800 6950 6252 gene locus_tag LOCUS_01810 6950 6252 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461724.1 protein_id gnl|my_center|LOCUS_01810 7840 7010 gene locus_tag LOCUS_01820 7840 7010 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461725.1 protein_id gnl|my_center|LOCUS_01820 8610 7879 gene locus_tag LOCUS_01830 8610 7879 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943166.1 protein_id gnl|my_center|LOCUS_01830 9658 9026 gene locus_tag LOCUS_01840 9658 9026 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_01840 9879 10397 gene locus_tag LOCUS_01850 9879 10397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 12697 10364 gene locus_tag LOCUS_01860 12697 10364 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738105.1 protein_id gnl|my_center|LOCUS_01860 14212 12815 gene locus_tag LOCUS_01870 14212 12815 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037254.1 protein_id gnl|my_center|LOCUS_01870 14856 14209 gene locus_tag LOCUS_01880 14856 14209 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865977.1 protein_id gnl|my_center|LOCUS_01880 17017 15500 gene locus_tag LOCUS_01890 gene garD 17017 15500 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246362.1 protein_id gnl|my_center|LOCUS_01890 18784 17453 gene locus_tag LOCUS_01900 gene gudD 18784 17453 CDS product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098237.1 protein_id gnl|my_center|LOCUS_01900 19644 18937 gene locus_tag LOCUS_01910 19644 18937 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869446.1 protein_id gnl|my_center|LOCUS_01910 20021 19692 gene locus_tag LOCUS_01920 20021 19692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 21414 20026 gene locus_tag LOCUS_01930 21414 20026 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_01930 21836 21414 gene locus_tag LOCUS_01940 21836 21414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 22183 21836 gene locus_tag LOCUS_01950 22183 21836 CDS product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583275.1 protein_id gnl|my_center|LOCUS_01950 22405 22899 gene locus_tag LOCUS_01960 gene nuoE 22405 22899 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_01960 22903 23460 gene locus_tag LOCUS_01970 22903 23460 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869297.1 protein_id gnl|my_center|LOCUS_01970 23485 23862 gene locus_tag LOCUS_01980 23485 23862 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_01980 23877 25664 gene locus_tag LOCUS_01990 gene nuoF 23877 25664 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_01990 >Feature sequence009 93 263 gene locus_tag LOCUS_02000 93 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 348 1019 gene locus_tag LOCUS_02010 348 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 1050 3542 gene locus_tag LOCUS_02020 1050 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 3544 4653 gene locus_tag LOCUS_02030 3544 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 4916 5338 gene locus_tag LOCUS_02040 4916 5338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 5434 7509 gene locus_tag LOCUS_02050 5434 7509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 7522 8292 gene locus_tag LOCUS_02060 7522 8292 CDS product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963364.1 protein_id gnl|my_center|LOCUS_02060 8289 8807 gene locus_tag LOCUS_02070 8289 8807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 8822 8971 gene locus_tag LOCUS_02080 8822 8971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 8996 11899 gene locus_tag LOCUS_02090 8996 11899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 11920 15717 gene locus_tag LOCUS_02100 11920 15717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 15959 16972 gene locus_tag LOCUS_02110 15959 16972 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949075.1 protein_id gnl|my_center|LOCUS_02110 17558 18208 gene locus_tag LOCUS_02120 17558 18208 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389733.1 protein_id gnl|my_center|LOCUS_02120 18452 21049 gene locus_tag LOCUS_02130 18452 21049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 21051 23585 gene locus_tag LOCUS_02140 21051 23585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 23610 25379 gene locus_tag LOCUS_02150 23610 25379 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_02150 >Feature sequence010 1048 599 gene locus_tag LOCUS_02160 1048 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 2535 1159 gene locus_tag LOCUS_02170 gene gmuD 2535 1159 CDS product 6-phospho-beta-glucosidase GmuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243625.1 protein_id gnl|my_center|LOCUS_02170 2711 2529 gene locus_tag LOCUS_02180 2711 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 3037 2714 gene locus_tag LOCUS_02190 3037 2714 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722125.1 protein_id gnl|my_center|LOCUS_02190 4575 3172 gene locus_tag LOCUS_02200 4575 3172 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775705.1 protein_id gnl|my_center|LOCUS_02200 4926 4624 gene locus_tag LOCUS_02210 4926 4624 CDS product lactose/cellobiose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990040.1 protein_id gnl|my_center|LOCUS_02210 5266 6594 gene locus_tag LOCUS_02220 gene celF 5266 6594 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145749.1 protein_id gnl|my_center|LOCUS_02220 8748 6688 gene locus_tag LOCUS_02230 8748 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 10922 9099 gene locus_tag LOCUS_02240 gene ftsH 10922 9099 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966478.1 protein_id gnl|my_center|LOCUS_02240 11458 10934 gene locus_tag LOCUS_02250 gene hpt 11458 10934 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 protein_id gnl|my_center|LOCUS_02250 12834 11458 gene locus_tag LOCUS_02260 gene tilS 12834 11458 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546068.1 protein_id gnl|my_center|LOCUS_02260 14330 12921 gene locus_tag LOCUS_02270 14330 12921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 14659 14393 gene locus_tag LOCUS_02280 14659 14393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 15063 14710 gene locus_tag LOCUS_02290 15063 14710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 15359 15078 gene locus_tag LOCUS_02300 15359 15078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 15665 15426 gene locus_tag LOCUS_02310 15665 15426 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 protein_id gnl|my_center|LOCUS_02310 15945 15670 gene locus_tag LOCUS_02320 15945 15670 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391633.1 protein_id gnl|my_center|LOCUS_02320 16404 16009 gene locus_tag LOCUS_02330 16404 16009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 17683 16553 gene locus_tag LOCUS_02340 gene nspC 17683 16553 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764364.1 protein_id gnl|my_center|LOCUS_02340 18885 17683 gene locus_tag LOCUS_02350 18885 17683 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088780.1 protein_id gnl|my_center|LOCUS_02350 19773 18919 gene locus_tag LOCUS_02360 gene speB 19773 18919 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888724.1 protein_id gnl|my_center|LOCUS_02360 20614 19763 gene locus_tag LOCUS_02370 gene speE 20614 19763 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808145.1 protein_id gnl|my_center|LOCUS_02370 22079 20631 gene locus_tag LOCUS_02380 22079 20631 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661024.1 protein_id gnl|my_center|LOCUS_02380 22848 22090 gene locus_tag LOCUS_02390 gene speD 22848 22090 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965890.1 protein_id gnl|my_center|LOCUS_02390 >Feature sequence011 254 610 gene locus_tag LOCUS_02400 254 610 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021109.1 protein_id gnl|my_center|LOCUS_02400 626 2317 gene locus_tag LOCUS_02410 626 2317 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440884.1 protein_id gnl|my_center|LOCUS_02410 2452 4503 gene locus_tag LOCUS_02420 gene recG 2452 4503 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_02420 4597 5667 gene locus_tag LOCUS_02430 4597 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 5977 5768 gene locus_tag LOCUS_02440 5977 5768 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416009.1 protein_id gnl|my_center|LOCUS_02440 6261 6827 gene locus_tag LOCUS_02450 gene rsmD 6261 6827 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_02450 6824 7309 gene locus_tag LOCUS_02460 gene coaD 6824 7309 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728846.1 protein_id gnl|my_center|LOCUS_02460 7338 7934 gene locus_tag LOCUS_02470 7338 7934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 9096 7879 gene locus_tag LOCUS_02480 9096 7879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 9148 9954 gene locus_tag LOCUS_02490 9148 9954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 10221 11657 gene locus_tag LOCUS_02500 gene rsmF 10221 11657 CDS product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228642.1 protein_id gnl|my_center|LOCUS_02500 11680 12405 gene locus_tag LOCUS_02510 11680 12405 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234916.1 protein_id gnl|my_center|LOCUS_02510 12402 13100 gene locus_tag LOCUS_02520 12402 13100 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_02520 13097 15136 gene locus_tag LOCUS_02530 13097 15136 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459965.1 protein_id gnl|my_center|LOCUS_02530 15183 15950 gene locus_tag LOCUS_02540 15183 15950 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_02540 15952 16524 gene locus_tag LOCUS_02550 15952 16524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 16552 17520 gene locus_tag LOCUS_02560 16552 17520 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_02560 17520 18050 gene locus_tag LOCUS_02570 gene recU 17520 18050 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460152.1 protein_id gnl|my_center|LOCUS_02570 18175 19404 gene locus_tag LOCUS_02580 gene pepT 18175 19404 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460034.1 protein_id gnl|my_center|LOCUS_02580 20321 19605 gene locus_tag LOCUS_02590 20321 19605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 21091 20429 gene locus_tag LOCUS_02600 21091 20429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 >Feature sequence012 1574 525 gene locus_tag LOCUS_02610 1574 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 2056 1577 gene locus_tag LOCUS_02620 2056 1577 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811528.1 protein_id gnl|my_center|LOCUS_02620 2625 2104 gene locus_tag LOCUS_02630 2625 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 2780 2640 gene locus_tag LOCUS_02640 2780 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 3726 2806 gene locus_tag LOCUS_02650 3726 2806 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545190.1 protein_id gnl|my_center|LOCUS_02650 5653 3731 gene locus_tag LOCUS_02660 gene ilvB 5653 3731 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012310511.1 protein_id gnl|my_center|LOCUS_02660 6080 5820 gene locus_tag LOCUS_02670 6080 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 6363 6061 gene locus_tag LOCUS_02680 6363 6061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 6724 8016 gene locus_tag LOCUS_02690 6724 8016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 9660 8383 gene locus_tag LOCUS_02700 9660 8383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 10518 9682 gene locus_tag LOCUS_02710 gene blaBJP 10518 9682 CDS product subclass B3 metallo-beta-lactamase BJP-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088970.1 protein_id gnl|my_center|LOCUS_02710 10870 11799 gene locus_tag LOCUS_02720 10870 11799 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966633.1 protein_id gnl|my_center|LOCUS_02720 13191 12052 gene locus_tag LOCUS_02730 gene nagA 13191 12052 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386286.1 protein_id gnl|my_center|LOCUS_02730 13370 13188 gene locus_tag LOCUS_02740 13370 13188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 14389 13469 gene locus_tag LOCUS_02750 14389 13469 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002023111.1 protein_id gnl|my_center|LOCUS_02750 14596 15090 gene locus_tag LOCUS_02760 14596 15090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 15053 16822 gene locus_tag LOCUS_02770 15053 16822 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_02770 16825 18759 gene locus_tag LOCUS_02780 16825 18759 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_02780 20456 18756 gene locus_tag LOCUS_02790 20456 18756 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_02790 21447 20872 gene locus_tag LOCUS_02800 21447 20872 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891255.1 protein_id gnl|my_center|LOCUS_02800 22087 21713 gene locus_tag LOCUS_02810 gene rplL 22087 21713 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421186.1 protein_id gnl|my_center|LOCUS_02810 >Feature sequence013 <1 1452 gene locus_tag LOCUS_02820 <1 1452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812354.1:glutamine synthetase III 1926 2183 gene locus_tag LOCUS_02830 1926 2183 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666876.1 protein_id gnl|my_center|LOCUS_02830 2185 2583 gene locus_tag LOCUS_02840 2185 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956671.1 protein_id gnl|my_center|LOCUS_02840 4813 2783 gene locus_tag LOCUS_02850 4813 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 6006 4834 gene locus_tag LOCUS_02860 6006 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 7983 6145 gene locus_tag LOCUS_02870 7983 6145 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678765.1 protein_id gnl|my_center|LOCUS_02870 8376 10049 gene locus_tag LOCUS_02880 8376 10049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 10194 11771 gene locus_tag LOCUS_02890 10194 11771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 12623 11889 gene locus_tag LOCUS_02900 12623 11889 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861813.1 protein_id gnl|my_center|LOCUS_02900 12626 12814 gene locus_tag LOCUS_02910 12626 12814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 12795 14780 gene locus_tag LOCUS_02920 gene treP 12795 14780 CDS product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262352.1 protein_id gnl|my_center|LOCUS_02920 14800 16452 gene locus_tag LOCUS_02930 gene treC 14800 16452 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986524.1 protein_id gnl|my_center|LOCUS_02930 16638 17351 gene locus_tag LOCUS_02940 16638 17351 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078474.1 protein_id gnl|my_center|LOCUS_02940 17348 18229 gene locus_tag LOCUS_02950 17348 18229 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017180.1 protein_id gnl|my_center|LOCUS_02950 19315 18458 gene locus_tag LOCUS_02960 19315 18458 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584123.1 protein_id gnl|my_center|LOCUS_02960 19707 21320 gene locus_tag LOCUS_02970 19707 21320 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724915.1 protein_id gnl|my_center|LOCUS_02970 >Feature sequence014 3 848 gene locus_tag LOCUS_02980 3 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 862 1494 gene locus_tag LOCUS_02990 862 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 1608 2351 gene locus_tag LOCUS_03000 1608 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 2494 2676 gene locus_tag LOCUS_03010 2494 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 2748 3707 gene locus_tag LOCUS_03020 gene spoIIIAA 2748 3707 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393045.1 protein_id gnl|my_center|LOCUS_03020 3695 4222 gene locus_tag LOCUS_03030 3695 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 4232 4426 gene locus_tag LOCUS_03040 4232 4426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 4439 4825 gene locus_tag LOCUS_03050 gene spoIIIAD 4439 4825 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230228.1 protein_id gnl|my_center|LOCUS_03050 4835 6097 gene locus_tag LOCUS_03060 4835 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 6109 7020 gene locus_tag LOCUS_03070 6109 7020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 6992 7558 gene locus_tag LOCUS_03080 6992 7558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 7575 8351 gene locus_tag LOCUS_03090 7575 8351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 8459 8839 gene locus_tag LOCUS_03100 8459 8839 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_03100 9283 11283 gene locus_tag LOCUS_03110 gene htpG 9283 11283 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435963.1 protein_id gnl|my_center|LOCUS_03110 11510 11848 gene locus_tag LOCUS_03120 11510 11848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 11951 12646 gene locus_tag LOCUS_03130 11951 12646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 12656 13198 gene locus_tag LOCUS_03140 12656 13198 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948534.1 protein_id gnl|my_center|LOCUS_03140 13170 14048 gene locus_tag LOCUS_03150 13170 14048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 14709 14068 gene locus_tag LOCUS_03160 14709 14068 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108273.1 protein_id gnl|my_center|LOCUS_03160 15692 14994 gene locus_tag LOCUS_03170 15692 14994 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861910.1 protein_id gnl|my_center|LOCUS_03170 16354 16082 gene locus_tag LOCUS_03180 16354 16082 CDS product CD3324 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986726.1 protein_id gnl|my_center|LOCUS_03180 16607 16891 gene locus_tag LOCUS_03190 16607 16891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 16941 19982 gene locus_tag LOCUS_03200 16941 19982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 20028 20696 gene locus_tag LOCUS_03210 20028 20696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 >Feature sequence015 109 255 gene locus_tag LOCUS_03220 109 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 537 454 gene locus_tag LOCUS_t00020 537 454 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1880 834 gene locus_tag LOCUS_03230 1880 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 2261 3058 gene locus_tag LOCUS_03240 2261 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 3080 3709 gene locus_tag LOCUS_03250 gene upp 3080 3709 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048712.1 protein_id gnl|my_center|LOCUS_03250 5459 4227 gene locus_tag LOCUS_03260 gene hydF 5459 4227 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433974.1 protein_id gnl|my_center|LOCUS_03260 6528 5479 gene locus_tag LOCUS_03270 gene hydE 6528 5479 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108014.1 protein_id gnl|my_center|LOCUS_03270 7332 6661 gene locus_tag LOCUS_03280 7332 6661 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_03280 9552 7384 gene locus_tag LOCUS_03290 9552 7384 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966830.1 protein_id gnl|my_center|LOCUS_03290 9847 10320 gene locus_tag LOCUS_03300 9847 10320 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_03300 10336 11133 gene locus_tag LOCUS_03310 gene proC 10336 11133 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363628.1 protein_id gnl|my_center|LOCUS_03310 13032 11224 gene locus_tag LOCUS_03320 13032 11224 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873616.1 protein_id gnl|my_center|LOCUS_03320 15950 13296 gene locus_tag LOCUS_03330 15950 13296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 16152 15967 gene locus_tag LOCUS_03340 16152 15967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 16637 16455 gene locus_tag LOCUS_03350 gene rpmF 16637 16455 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545520.1 protein_id gnl|my_center|LOCUS_03350 17168 16641 gene locus_tag LOCUS_03360 17168 16641 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545391.1 protein_id gnl|my_center|LOCUS_03360 18433 17240 gene locus_tag LOCUS_03370 18433 17240 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956840.1 protein_id gnl|my_center|LOCUS_03370 19545 18547 gene locus_tag LOCUS_03380 gene pta 19545 18547 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023515.1 protein_id gnl|my_center|LOCUS_03380 20009 19677 gene locus_tag LOCUS_03390 20009 19677 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963622.1 protein_id gnl|my_center|LOCUS_03390 >Feature sequence016 146 58 gene locus_tag LOCUS_t00030 146 58 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1145 432 gene locus_tag LOCUS_03400 1145 432 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964283.1 protein_id gnl|my_center|LOCUS_03400 1706 1155 gene locus_tag LOCUS_03410 1706 1155 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099538.1 protein_id gnl|my_center|LOCUS_03410 2584 1745 gene locus_tag LOCUS_03420 2584 1745 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519031.1 protein_id gnl|my_center|LOCUS_03420 5226 2710 gene locus_tag LOCUS_03430 gene gyrA 5226 2710 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_03430 7149 5239 gene locus_tag LOCUS_03440 gene gyrB 7149 5239 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815132.1 protein_id gnl|my_center|LOCUS_03440 8257 7172 gene locus_tag LOCUS_03450 gene recF 8257 7172 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359456.1 protein_id gnl|my_center|LOCUS_03450 8478 8269 gene locus_tag LOCUS_03460 8478 8269 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480037.1 protein_id gnl|my_center|LOCUS_03460 9618 8503 gene locus_tag LOCUS_03470 gene dnaN 9618 8503 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947896.1 protein_id gnl|my_center|LOCUS_03470 11236 9866 gene locus_tag LOCUS_03480 gene dnaA 11236 9866 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_03480 11664 12296 gene locus_tag LOCUS_03490 11664 12296 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287046.1 protein_id gnl|my_center|LOCUS_03490 12945 13214 gene locus_tag LOCUS_03500 12945 13214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 13444 14703 gene locus_tag LOCUS_03510 13444 14703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 14718 15398 gene locus_tag LOCUS_03520 14718 15398 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398827.1 protein_id gnl|my_center|LOCUS_03520 15682 17058 gene locus_tag LOCUS_03530 gene mnmE 15682 17058 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359423.1 protein_id gnl|my_center|LOCUS_03530 17200 19086 gene locus_tag LOCUS_03540 gene mnmG 17200 19086 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_03540 19096 19821 gene locus_tag LOCUS_03550 gene rsmG 19096 19821 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131091.1 protein_id gnl|my_center|LOCUS_03550 >Feature sequence017 <1 575 gene locus_tag LOCUS_03560 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789619.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase 875 1033 gene locus_tag LOCUS_03570 875 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 1232 1023 gene locus_tag LOCUS_03580 1232 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 1895 2104 gene locus_tag LOCUS_03590 1895 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 2267 2815 gene locus_tag LOCUS_03600 2267 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 3140 3346 gene locus_tag LOCUS_03610 3140 3346 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002927075.1 protein_id gnl|my_center|LOCUS_03610 3343 3831 gene locus_tag LOCUS_03620 3343 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 4122 4529 gene locus_tag LOCUS_03630 4122 4529 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987070.1 protein_id gnl|my_center|LOCUS_03630 4495 5388 gene locus_tag LOCUS_03640 4495 5388 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_03640 5363 7612 gene locus_tag LOCUS_03650 5363 7612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 8003 8269 gene locus_tag LOCUS_03660 8003 8269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 9416 8532 gene locus_tag LOCUS_03670 9416 8532 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680113.1 protein_id gnl|my_center|LOCUS_03670 10545 9436 gene locus_tag LOCUS_03680 10545 9436 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_03680 10902 12455 gene locus_tag LOCUS_03690 gene cls 10902 12455 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262851.1 protein_id gnl|my_center|LOCUS_03690 12590 13690 gene locus_tag LOCUS_03700 12590 13690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 13707 15389 gene locus_tag LOCUS_03710 13707 15389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 15401 16108 gene locus_tag LOCUS_03720 15401 16108 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722723.1 protein_id gnl|my_center|LOCUS_03720 16092 17270 gene locus_tag LOCUS_03730 16092 17270 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931069.1 protein_id gnl|my_center|LOCUS_03730 17346 18314 gene locus_tag LOCUS_03740 17346 18314 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 protein_id gnl|my_center|LOCUS_03740 18798 19439 gene locus_tag LOCUS_03750 18798 19439 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_03750 >Feature sequence018 4934 1149 gene locus_tag LOCUS_03760 gene rpoB 4934 1149 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048357.1 protein_id gnl|my_center|LOCUS_03760 5215 5661 gene locus_tag LOCUS_03770 5215 5661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 7458 5947 gene locus_tag LOCUS_03780 gene yfcC 7458 5947 CDS product putative basic amino acid antiporter YfcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868954.1 protein_id gnl|my_center|LOCUS_03780 8097 7657 gene locus_tag LOCUS_03790 8097 7657 CDS product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393888.1 protein_id gnl|my_center|LOCUS_03790 8911 8102 gene locus_tag LOCUS_03800 gene murI 8911 8102 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_03800 9997 8936 gene locus_tag LOCUS_03810 9997 8936 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966178.1 protein_id gnl|my_center|LOCUS_03810 10108 10782 gene locus_tag LOCUS_03820 gene spoIIR 10108 10782 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425996.1 protein_id gnl|my_center|LOCUS_03820 10879 11187 gene locus_tag LOCUS_03830 10879 11187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 11806 11273 gene locus_tag LOCUS_03840 11806 11273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 13420 11849 gene locus_tag LOCUS_03850 13420 11849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 15290 13404 gene locus_tag LOCUS_03860 15290 13404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 15895 15287 gene locus_tag LOCUS_03870 15895 15287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 16161 15988 gene locus_tag LOCUS_03880 16161 15988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 17765 16314 gene locus_tag LOCUS_03890 17765 16314 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096862.1 protein_id gnl|my_center|LOCUS_03890 18524 17784 gene locus_tag LOCUS_03900 18524 17784 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986547.1 protein_id gnl|my_center|LOCUS_03900 19197 18517 gene locus_tag LOCUS_03910 19197 18517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03910 >Feature sequence019 1032 571 gene locus_tag LOCUS_03920 1032 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 2290 1259 gene locus_tag LOCUS_03930 2290 1259 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_03930 2996 2352 gene locus_tag LOCUS_03940 2996 2352 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966256.1 protein_id gnl|my_center|LOCUS_03940 3690 3055 gene locus_tag LOCUS_03950 3690 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 5683 3683 gene locus_tag LOCUS_03960 5683 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 6765 6037 gene locus_tag LOCUS_03970 6765 6037 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_03970 8160 6832 gene locus_tag LOCUS_03980 8160 6832 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963782.1 protein_id gnl|my_center|LOCUS_03980 8683 8318 gene locus_tag LOCUS_03990 8683 8318 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421356.1 protein_id gnl|my_center|LOCUS_03990 10107 8917 gene locus_tag LOCUS_04000 gene alr 10107 8917 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_04000 11751 10273 gene locus_tag LOCUS_04010 11751 10273 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_04010 12116 11748 gene locus_tag LOCUS_04020 gene acpS 12116 11748 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861979.1 protein_id gnl|my_center|LOCUS_04020 12778 12113 gene locus_tag LOCUS_04030 12778 12113 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_04030 14393 12909 gene locus_tag LOCUS_04040 14393 12909 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895854.1 protein_id gnl|my_center|LOCUS_04040 14657 16570 gene locus_tag LOCUS_04050 14657 16570 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966001.1 protein_id gnl|my_center|LOCUS_04050 17986 16673 gene locus_tag LOCUS_04060 17986 16673 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986686.1 protein_id gnl|my_center|LOCUS_04060 18201 18437 gene locus_tag LOCUS_04070 18201 18437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 19342 18440 gene locus_tag LOCUS_04080 19342 18440 CDS product choloylglycine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771532.1 protein_id gnl|my_center|LOCUS_04080 >Feature sequence020 2805 2239 gene locus_tag LOCUS_04090 gene pth 2805 2239 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048384.1 protein_id gnl|my_center|LOCUS_04090 4344 3148 gene locus_tag LOCUS_04100 4344 3148 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682078.1 protein_id gnl|my_center|LOCUS_04100 5281 4631 gene locus_tag LOCUS_04110 5281 4631 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680289.1 protein_id gnl|my_center|LOCUS_04110 6334 5384 gene locus_tag LOCUS_04120 6334 5384 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837554.1 protein_id gnl|my_center|LOCUS_04120 7809 6367 gene locus_tag LOCUS_04130 7809 6367 CDS product Sapep family Mn(2+)-dependent dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537832.1 protein_id gnl|my_center|LOCUS_04130 8798 7806 gene locus_tag LOCUS_04140 8798 7806 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_04140 9795 8785 gene locus_tag LOCUS_04150 9795 8785 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345583.1 protein_id gnl|my_center|LOCUS_04150 11514 9841 gene locus_tag LOCUS_04160 11514 9841 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678775.1 protein_id gnl|my_center|LOCUS_04160 12417 11539 gene locus_tag LOCUS_04170 12417 11539 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678776.1 protein_id gnl|my_center|LOCUS_04170 13382 12429 gene locus_tag LOCUS_04180 13382 12429 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678777.1 protein_id gnl|my_center|LOCUS_04180 15402 13900 gene locus_tag LOCUS_04190 gene cls 15402 13900 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243311.1 protein_id gnl|my_center|LOCUS_04190 16316 15627 gene locus_tag LOCUS_04200 16316 15627 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_04200 17806 16313 gene locus_tag LOCUS_04210 17806 16313 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963640.1 protein_id gnl|my_center|LOCUS_04210 >Feature sequence021 1390 389 gene locus_tag LOCUS_04220 1390 389 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_04220 1701 2060 gene locus_tag LOCUS_04230 1701 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018213024.1 protein_id gnl|my_center|LOCUS_04230 2239 3861 gene locus_tag LOCUS_04240 2239 3861 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_04240 3980 5773 gene locus_tag LOCUS_04250 3980 5773 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_04250 5770 6744 gene locus_tag LOCUS_04260 5770 6744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 6760 7803 gene locus_tag LOCUS_04270 gene mglB 6760 7803 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881084.1 protein_id gnl|my_center|LOCUS_04270 7950 9116 gene locus_tag LOCUS_04280 gene mglB 7950 9116 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365711.1 protein_id gnl|my_center|LOCUS_04280 9242 10756 gene locus_tag LOCUS_04290 gene mglA 9242 10756 CDS product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883073.1 protein_id gnl|my_center|LOCUS_04290 10772 11833 gene locus_tag LOCUS_04300 gene mglC 10772 11833 CDS product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652434.1 protein_id gnl|my_center|LOCUS_04300 11896 12243 gene locus_tag LOCUS_04310 11896 12243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 13773 12376 gene locus_tag LOCUS_04320 13773 12376 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_04320 14280 13840 gene locus_tag LOCUS_04330 14280 13840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 14430 17834 gene locus_tag LOCUS_04340 gene addB 14430 17834 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151864400.1 protein_id gnl|my_center|LOCUS_04340 >Feature sequence022 60 245 gene locus_tag LOCUS_04350 gene rpmB 60 245 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_04350 1174 404 gene locus_tag LOCUS_04360 1174 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 1487 1350 gene locus_tag LOCUS_04370 1487 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 1970 1542 gene locus_tag LOCUS_04380 1970 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 3009 1984 gene locus_tag LOCUS_04390 3009 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 3335 3006 gene locus_tag LOCUS_04400 3335 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 4877 3630 gene locus_tag LOCUS_04410 4877 3630 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_04410 5422 4880 gene locus_tag LOCUS_04420 gene pgsA 5422 4880 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052965.1 protein_id gnl|my_center|LOCUS_04420 6746 5406 gene locus_tag LOCUS_04430 gene rimO 6746 5406 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_04430 7083 6850 gene locus_tag LOCUS_04440 7083 6850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 7407 7159 gene locus_tag LOCUS_04450 7407 7159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 8056 7430 gene locus_tag LOCUS_04460 gene gmk 8056 7430 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131468.1 protein_id gnl|my_center|LOCUS_04460 8983 8105 gene locus_tag LOCUS_04470 8983 8105 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_04470 10027 9203 gene locus_tag LOCUS_04480 10027 9203 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583026.1 protein_id gnl|my_center|LOCUS_04480 11055 10138 gene locus_tag LOCUS_04490 11055 10138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 13485 11200 gene locus_tag LOCUS_04500 13485 11200 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593936.1 protein_id gnl|my_center|LOCUS_04500 13627 14562 gene locus_tag LOCUS_04510 13627 14562 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966633.1 protein_id gnl|my_center|LOCUS_04510 15243 14722 gene locus_tag LOCUS_04520 15243 14722 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023189990.1 protein_id gnl|my_center|LOCUS_04520 16106 17206 gene locus_tag LOCUS_04530 16106 17206 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948809.1 protein_id gnl|my_center|LOCUS_04530 17228 18109 gene locus_tag LOCUS_04540 17228 18109 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948810.1 protein_id gnl|my_center|LOCUS_04540 >Feature sequence023 <1 1437 gene locus_tag LOCUS_04550 <1 1437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460031.1:ABC-F family ATP-binding cassette domain-containing protein 1448 3298 gene locus_tag LOCUS_04560 1448 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 3799 3320 gene locus_tag LOCUS_04570 3799 3320 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_04570 3913 4098 gene locus_tag LOCUS_04580 3913 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 4996 7623 gene locus_tag LOCUS_04590 4996 7623 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949094.1 protein_id gnl|my_center|LOCUS_04590 7726 8535 gene locus_tag LOCUS_04600 7726 8535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 8833 9201 gene locus_tag LOCUS_04610 8833 9201 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385301.1 protein_id gnl|my_center|LOCUS_04610 9315 10721 gene locus_tag LOCUS_04620 9315 10721 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298077.1 protein_id gnl|my_center|LOCUS_04620 10734 11915 gene locus_tag LOCUS_04630 10734 11915 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373411.1 protein_id gnl|my_center|LOCUS_04630 11978 12868 gene locus_tag LOCUS_04640 11978 12868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 12878 13162 gene locus_tag LOCUS_04650 12878 13162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 13284 14222 gene locus_tag LOCUS_04660 gene xerC 13284 14222 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002079116.1 protein_id gnl|my_center|LOCUS_04660 14463 14257 gene locus_tag LOCUS_04670 14463 14257 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214020.1 protein_id gnl|my_center|LOCUS_04670 14570 14971 gene locus_tag LOCUS_04680 14570 14971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 15207 16931 gene locus_tag LOCUS_04690 15207 16931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 17208 17894 gene locus_tag LOCUS_04700 17208 17894 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426023.1 protein_id gnl|my_center|LOCUS_04700 18486 18268 gene locus_tag LOCUS_04710 18486 18268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 >Feature sequence024 3 79 gene locus_tag LOCUS_t00040 3 79 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 150 1364 gene locus_tag LOCUS_04720 150 1364 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_04720 1681 3066 gene locus_tag LOCUS_04730 1681 3066 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_04730 4137 3145 gene locus_tag LOCUS_04740 4137 3145 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272230.1 protein_id gnl|my_center|LOCUS_04740 5781 4384 gene locus_tag LOCUS_04750 5781 4384 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869179.1 protein_id gnl|my_center|LOCUS_04750 6311 5778 gene locus_tag LOCUS_04760 6311 5778 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_04760 6882 6316 gene locus_tag LOCUS_04770 6882 6316 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840898.1 protein_id gnl|my_center|LOCUS_04770 8730 7072 gene locus_tag LOCUS_04780 8730 7072 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047904.1 protein_id gnl|my_center|LOCUS_04780 10129 9185 gene locus_tag LOCUS_04790 10129 9185 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_04790 11420 10161 gene locus_tag LOCUS_04800 11420 10161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 13104 11500 gene locus_tag LOCUS_04810 13104 11500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 13765 13166 gene locus_tag LOCUS_04820 13765 13166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 15015 13918 gene locus_tag LOCUS_04830 15015 13918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 15180 15446 gene locus_tag LOCUS_04840 15180 15446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 15521 16438 gene locus_tag LOCUS_04850 15521 16438 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812829.1 protein_id gnl|my_center|LOCUS_04850 18401 16542 gene locus_tag LOCUS_04860 18401 16542 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_04860 >Feature sequence025 29 649 gene locus_tag LOCUS_04870 29 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 881 1624 gene locus_tag LOCUS_04880 gene tepA 881 1624 CDS product translocation-enhancing protein TepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245712.1 protein_id gnl|my_center|LOCUS_04880 1732 4893 gene locus_tag LOCUS_04890 1732 4893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 4924 6594 gene locus_tag LOCUS_04900 4924 6594 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_04900 6930 8417 gene locus_tag LOCUS_04910 6930 8417 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_04910 8435 9817 gene locus_tag LOCUS_04920 8435 9817 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272578.1 protein_id gnl|my_center|LOCUS_04920 10070 12295 gene locus_tag LOCUS_04930 gene priA 10070 12295 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_04930 12422 12916 gene locus_tag LOCUS_04940 gene def 12422 12916 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_04940 12919 13863 gene locus_tag LOCUS_04950 gene fmt 12919 13863 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861609.1 protein_id gnl|my_center|LOCUS_04950 13860 14609 gene locus_tag LOCUS_04960 13860 14609 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416253.1 protein_id gnl|my_center|LOCUS_04960 14596 15957 gene locus_tag LOCUS_04970 gene rsmB 14596 15957 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861607.1 protein_id gnl|my_center|LOCUS_04970 15964 17007 gene locus_tag LOCUS_04980 gene rlmN 15964 17007 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986842.1 protein_id gnl|my_center|LOCUS_04980 17013 17753 gene locus_tag LOCUS_04990 17013 17753 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_04990 >Feature sequence026 102 1004 gene locus_tag LOCUS_05000 102 1004 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893591.1 protein_id gnl|my_center|LOCUS_05000 1133 2197 gene locus_tag LOCUS_05010 1133 2197 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039520.1 protein_id gnl|my_center|LOCUS_05010 2211 2999 gene locus_tag LOCUS_05020 2211 2999 CDS product DUF3100 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016874.1 protein_id gnl|my_center|LOCUS_05020 3010 3474 gene locus_tag LOCUS_05030 3010 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492212.1 protein_id gnl|my_center|LOCUS_05030 3502 4587 gene locus_tag LOCUS_05040 3502 4587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 5326 4790 gene locus_tag LOCUS_05050 5326 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 6660 5371 gene locus_tag LOCUS_05060 6660 5371 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458888.1 protein_id gnl|my_center|LOCUS_05060 7348 6653 gene locus_tag LOCUS_05070 7348 6653 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426384.1 protein_id gnl|my_center|LOCUS_05070 8906 7545 gene locus_tag LOCUS_05080 8906 7545 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459130.1 protein_id gnl|my_center|LOCUS_05080 11289 8896 gene locus_tag LOCUS_05090 11289 8896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 12023 11328 gene locus_tag LOCUS_05100 12023 11328 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051244.1 protein_id gnl|my_center|LOCUS_05100 12294 13058 gene locus_tag LOCUS_05110 12294 13058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 13172 14584 gene locus_tag LOCUS_05120 13172 14584 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810317.1 protein_id gnl|my_center|LOCUS_05120 14719 15429 gene locus_tag LOCUS_05130 14719 15429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 16014 16318 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtctcccttcgtgagaagggagtggattgaaat 17018 18055 gene locus_tag LOCUS_05140 17018 18055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 >Feature sequence027 343 83 gene locus_tag LOCUS_05150 343 83 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054876196.1 protein_id gnl|my_center|LOCUS_05150 476 655 gene locus_tag LOCUS_05160 476 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 646 768 gene locus_tag LOCUS_05170 646 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 1042 1359 gene locus_tag LOCUS_05180 1042 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05180 1751 2428 gene locus_tag LOCUS_05190 1751 2428 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393497.1 protein_id gnl|my_center|LOCUS_05190 2454 3476 gene locus_tag LOCUS_05200 2454 3476 CDS product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938008.1 protein_id gnl|my_center|LOCUS_05200 3492 3974 gene locus_tag LOCUS_05210 3492 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 3976 5250 gene locus_tag LOCUS_05220 3976 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 5341 6075 gene locus_tag LOCUS_05230 5341 6075 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438086.1 protein_id gnl|my_center|LOCUS_05230 6088 6312 gene locus_tag LOCUS_05240 6088 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 6309 6662 gene locus_tag LOCUS_05250 6309 6662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 6689 7501 gene locus_tag LOCUS_05260 6689 7501 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494032.1 protein_id gnl|my_center|LOCUS_05260 7514 8938 gene locus_tag LOCUS_05270 7514 8938 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861696.1 protein_id gnl|my_center|LOCUS_05270 10477 9122 gene locus_tag LOCUS_05280 10477 9122 CDS product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005970668.1 protein_id gnl|my_center|LOCUS_05280 11542 10499 gene locus_tag LOCUS_05290 11542 10499 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210882.1 protein_id gnl|my_center|LOCUS_05290 12865 11567 gene locus_tag LOCUS_05300 12865 11567 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210884.1 protein_id gnl|my_center|LOCUS_05300 13189 13995 gene locus_tag LOCUS_05310 gene rhaR 13189 13995 CDS product rhamnose catabolism operon transcriptional regulator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968057.1 protein_id gnl|my_center|LOCUS_05310 14957 14202 gene locus_tag LOCUS_05320 14957 14202 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021359211.1 protein_id gnl|my_center|LOCUS_05320 15910 14945 gene locus_tag LOCUS_05330 15910 14945 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902652.1 protein_id gnl|my_center|LOCUS_05330 16959 16069 gene locus_tag LOCUS_05340 16959 16069 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902813.1 protein_id gnl|my_center|LOCUS_05340 >Feature sequence028 754 14 gene locus_tag LOCUS_05350 754 14 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792492.1 protein_id gnl|my_center|LOCUS_05350 1638 772 gene locus_tag LOCUS_05360 1638 772 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064218.1 protein_id gnl|my_center|LOCUS_05360 1722 2609 gene locus_tag LOCUS_05370 gene yieE 1722 2609 CDS product DNA-binding transcriptional regulator YeiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365699.1 protein_id gnl|my_center|LOCUS_05370 2603 3310 gene locus_tag LOCUS_05380 2603 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 4301 3339 gene locus_tag LOCUS_05390 gene rihA 4301 3339 CDS product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207526.1 protein_id gnl|my_center|LOCUS_05390 5245 4298 gene locus_tag LOCUS_05400 5245 4298 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537587.1 protein_id gnl|my_center|LOCUS_05400 6320 5250 gene locus_tag LOCUS_05410 6320 5250 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383862.1 protein_id gnl|my_center|LOCUS_05410 7884 6313 gene locus_tag LOCUS_05420 7884 6313 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383861.1 protein_id gnl|my_center|LOCUS_05420 9153 8011 gene locus_tag LOCUS_05430 9153 8011 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383860.1 protein_id gnl|my_center|LOCUS_05430 9274 9071 gene locus_tag LOCUS_05440 9274 9071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 11060 9459 gene locus_tag LOCUS_05450 11060 9459 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986277.1 protein_id gnl|my_center|LOCUS_05450 12205 11057 gene locus_tag LOCUS_05460 12205 11057 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021106579.1 protein_id gnl|my_center|LOCUS_05460 14724 12826 gene locus_tag LOCUS_05470 14724 12826 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_05470 16450 14717 gene locus_tag LOCUS_05480 16450 14717 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_05480 16943 16470 gene locus_tag LOCUS_05490 16943 16470 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966683.1 protein_id gnl|my_center|LOCUS_05490 17187 16948 gene locus_tag LOCUS_05500 17187 16948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 >Feature sequence029 559 89 gene locus_tag LOCUS_05510 gene dtd 559 89 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460350.1 protein_id gnl|my_center|LOCUS_05510 2226 616 gene locus_tag LOCUS_05520 2226 616 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_05520 2536 3210 gene locus_tag LOCUS_05530 gene phoB 2536 3210 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388361.1 protein_id gnl|my_center|LOCUS_05530 3207 4586 gene locus_tag LOCUS_05540 3207 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 4780 6243 gene locus_tag LOCUS_05550 4780 6243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 7013 6225 gene locus_tag LOCUS_05560 7013 6225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 7283 7053 gene locus_tag LOCUS_05570 7283 7053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 8028 7522 gene locus_tag LOCUS_05580 8028 7522 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986565.1 protein_id gnl|my_center|LOCUS_05580 8980 8321 gene locus_tag LOCUS_05590 8980 8321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 10094 9069 gene locus_tag LOCUS_05600 10094 9069 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942020.1 protein_id gnl|my_center|LOCUS_05600 10382 10555 gene locus_tag LOCUS_05610 10382 10555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 11754 10672 gene locus_tag LOCUS_05620 11754 10672 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861704.1 protein_id gnl|my_center|LOCUS_05620 12777 11935 gene locus_tag LOCUS_05630 12777 11935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 13398 12820 gene locus_tag LOCUS_05640 13398 12820 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255233.1 protein_id gnl|my_center|LOCUS_05640 14189 13395 gene locus_tag LOCUS_05650 14189 13395 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963877.1 protein_id gnl|my_center|LOCUS_05650 14699 14220 gene locus_tag LOCUS_05660 gene rlmH 14699 14220 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811533.1 protein_id gnl|my_center|LOCUS_05660 15193 14696 gene locus_tag LOCUS_05670 15193 14696 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890795.1 protein_id gnl|my_center|LOCUS_05670 15908 15210 gene locus_tag LOCUS_05680 15908 15210 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_05680 16513 15923 gene locus_tag LOCUS_05690 16513 15923 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989944.1 protein_id gnl|my_center|LOCUS_05690 17021 16593 gene locus_tag LOCUS_05700 17021 16593 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966812.1 protein_id gnl|my_center|LOCUS_05700 17318 17133 gene locus_tag LOCUS_05710 17318 17133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 >Feature sequence030 1802 1395 gene locus_tag LOCUS_05720 1802 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 1943 2140 gene locus_tag LOCUS_05730 1943 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 2311 2502 gene locus_tag LOCUS_05740 2311 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 2490 2699 gene locus_tag LOCUS_05750 2490 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 2686 3042 gene locus_tag LOCUS_05760 2686 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 3327 4220 gene locus_tag LOCUS_05770 3327 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 4470 4646 gene locus_tag LOCUS_05780 4470 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 4766 4954 gene locus_tag LOCUS_05790 4766 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 5095 5241 gene locus_tag LOCUS_05800 5095 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 5607 6059 gene locus_tag LOCUS_05810 5607 6059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 6072 6920 gene locus_tag LOCUS_05820 6072 6920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 6983 7189 gene locus_tag LOCUS_05830 6983 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 7176 7394 gene locus_tag LOCUS_05840 7176 7394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 7511 8398 gene locus_tag LOCUS_05850 7511 8398 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256722.1 protein_id gnl|my_center|LOCUS_05850 9787 8915 gene locus_tag LOCUS_05860 9787 8915 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421907.1 protein_id gnl|my_center|LOCUS_05860 9963 10616 gene locus_tag LOCUS_05870 9963 10616 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966155.1 protein_id gnl|my_center|LOCUS_05870 10661 10879 gene locus_tag LOCUS_05880 gene atpE 10661 10879 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356112.1 protein_id gnl|my_center|LOCUS_05880 10907 11428 gene locus_tag LOCUS_05890 10907 11428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 11490 11993 gene locus_tag LOCUS_05900 11490 11993 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425856.1 protein_id gnl|my_center|LOCUS_05900 11999 13507 gene locus_tag LOCUS_05910 gene atpA 11999 13507 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356056.1 protein_id gnl|my_center|LOCUS_05910 13512 14414 gene locus_tag LOCUS_05920 gene atpG 13512 14414 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_05920 14418 15809 gene locus_tag LOCUS_05930 gene atpD 14418 15809 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_05930 15813 16226 gene locus_tag LOCUS_05940 15813 16226 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258892.1 protein_id gnl|my_center|LOCUS_05940 16516 17346 gene locus_tag LOCUS_05950 16516 17346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_05950 17337 17459 gene locus_tag LOCUS_05960 17337 17459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 >Feature sequence031 1900 1673 gene locus_tag LOCUS_05970 1900 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 3236 1968 gene locus_tag LOCUS_05980 gene eno 3236 1968 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_05980 3619 3356 gene locus_tag LOCUS_05990 3619 3356 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 protein_id gnl|my_center|LOCUS_05990 3878 3612 gene locus_tag LOCUS_06000 3878 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 5271 4159 gene locus_tag LOCUS_06010 gene ugpC 5271 4159 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_06010 7160 5328 gene locus_tag LOCUS_06020 7160 5328 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258398.1 protein_id gnl|my_center|LOCUS_06020 7629 7162 gene locus_tag LOCUS_06030 7629 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 9839 7644 gene locus_tag LOCUS_06040 9839 7644 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019639497.1 protein_id gnl|my_center|LOCUS_06040 10700 9864 gene locus_tag LOCUS_06050 10700 9864 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921761.1 protein_id gnl|my_center|LOCUS_06050 11610 10714 gene locus_tag LOCUS_06060 11610 10714 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939305.1 protein_id gnl|my_center|LOCUS_06060 12914 11622 gene locus_tag LOCUS_06070 12914 11622 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774915.1 protein_id gnl|my_center|LOCUS_06070 13087 14004 gene locus_tag LOCUS_06080 13087 14004 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909131.1 protein_id gnl|my_center|LOCUS_06080 14006 15934 gene locus_tag LOCUS_06090 14006 15934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 15931 16530 gene locus_tag LOCUS_06100 15931 16530 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583630.1 protein_id gnl|my_center|LOCUS_06100 <17251 16709 gene locus_tag LOCUS_06110 <17251 16709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948706.1:ferrous iron transport protein B >Feature sequence032 1274 717 gene locus_tag LOCUS_06120 gene efp 1274 717 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_06120 1673 1368 gene locus_tag LOCUS_06130 1673 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 2202 1774 gene locus_tag LOCUS_06140 gene aroQ 2202 1774 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083137.1 protein_id gnl|my_center|LOCUS_06140 3587 2199 gene locus_tag LOCUS_06150 3587 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 4095 3580 gene locus_tag LOCUS_06160 4095 3580 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460298.1 protein_id gnl|my_center|LOCUS_06160 4551 4099 gene locus_tag LOCUS_06170 gene nrdR 4551 4099 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_06170 5359 4724 gene locus_tag LOCUS_06180 5359 4724 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476288.1 protein_id gnl|my_center|LOCUS_06180 5565 5356 gene locus_tag LOCUS_06190 5565 5356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 5813 5553 gene locus_tag LOCUS_06200 5813 5553 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236745.1 protein_id gnl|my_center|LOCUS_06200 6003 6911 gene locus_tag LOCUS_06210 6003 6911 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937958.1 protein_id gnl|my_center|LOCUS_06210 7227 8465 gene locus_tag LOCUS_06220 7227 8465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 9434 8637 gene locus_tag LOCUS_06230 9434 8637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 9767 9447 gene locus_tag LOCUS_06240 9767 9447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 10475 9882 gene locus_tag LOCUS_06250 10475 9882 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764887.1 protein_id gnl|my_center|LOCUS_06250 11608 10709 gene locus_tag LOCUS_06260 11608 10709 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112601.1 protein_id gnl|my_center|LOCUS_06260 12342 11677 gene locus_tag LOCUS_06270 12342 11677 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817223.1 protein_id gnl|my_center|LOCUS_06270 13348 12332 gene locus_tag LOCUS_06280 gene metN 13348 12332 CDS product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173141.1 protein_id gnl|my_center|LOCUS_06280 13799 13662 gene locus_tag LOCUS_06290 13799 13662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 15410 13983 gene locus_tag LOCUS_06300 gene pepV 15410 13983 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371462.1 protein_id gnl|my_center|LOCUS_06300 15894 15448 gene locus_tag LOCUS_06310 15894 15448 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356741.1 protein_id gnl|my_center|LOCUS_06310 <17172 16048 gene locus_tag LOCUS_06320 <17172 16048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048268.1:peptide chain release factor 3 >Feature sequence033 3953 570 gene locus_tag LOCUS_06330 3953 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 4092 4406 gene locus_tag LOCUS_06340 4092 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 5029 4586 gene locus_tag LOCUS_06350 gene rpiB 5029 4586 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721856.1 protein_id gnl|my_center|LOCUS_06350 6196 5078 gene locus_tag LOCUS_06360 gene aroC 6196 5078 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258378.1 protein_id gnl|my_center|LOCUS_06360 7330 6275 gene locus_tag LOCUS_06370 7330 6275 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769135.1 protein_id gnl|my_center|LOCUS_06370 7664 8197 gene locus_tag LOCUS_06380 7664 8197 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418769.1 protein_id gnl|my_center|LOCUS_06380 8226 9302 gene locus_tag LOCUS_06390 8226 9302 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437017.1 protein_id gnl|my_center|LOCUS_06390 9295 10116 gene locus_tag LOCUS_06400 9295 10116 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808911.1 protein_id gnl|my_center|LOCUS_06400 10116 12038 gene locus_tag LOCUS_06410 10116 12038 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948299.1 protein_id gnl|my_center|LOCUS_06410 13477 12275 gene locus_tag LOCUS_06420 13477 12275 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818556.1 protein_id gnl|my_center|LOCUS_06420 14180 13482 gene locus_tag LOCUS_06430 gene bioD 14180 13482 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986727.1 protein_id gnl|my_center|LOCUS_06430 15135 14173 gene locus_tag LOCUS_06440 gene bioB 15135 14173 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986728.1 protein_id gnl|my_center|LOCUS_06440 15358 16380 gene locus_tag LOCUS_06450 15358 16380 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461701.1 protein_id gnl|my_center|LOCUS_06450 <17132 16555 gene locus_tag LOCUS_06460 <17132 16555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391791.1:S41 family peptidase >Feature sequence034 <1 1068 gene locus_tag LOCUS_06470 <1 1068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020472.1:alpha/beta hydrolase 2097 1282 gene locus_tag LOCUS_06480 2097 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 2329 3507 gene locus_tag LOCUS_06490 2329 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 3790 5004 gene locus_tag LOCUS_06500 3790 5004 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014902978.1 protein_id gnl|my_center|LOCUS_06500 5001 6287 gene locus_tag LOCUS_06510 5001 6287 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861243.1 protein_id gnl|my_center|LOCUS_06510 6277 6489 gene locus_tag LOCUS_06520 6277 6489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 6486 7934 gene locus_tag LOCUS_06530 6486 7934 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870173.1 protein_id gnl|my_center|LOCUS_06530 7945 8658 gene locus_tag LOCUS_06540 7945 8658 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434506.1 protein_id gnl|my_center|LOCUS_06540 8645 9556 gene locus_tag LOCUS_06550 8645 9556 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860662.1 protein_id gnl|my_center|LOCUS_06550 9570 11006 gene locus_tag LOCUS_06560 9570 11006 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963597.1 protein_id gnl|my_center|LOCUS_06560 11008 12372 gene locus_tag LOCUS_06570 gene fumC 11008 12372 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857888.1 protein_id gnl|my_center|LOCUS_06570 12391 13566 gene locus_tag LOCUS_06580 12391 13566 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_06580 14524 13697 gene locus_tag LOCUS_06590 gene mutM 14524 13697 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_06590 15497 14607 gene locus_tag LOCUS_06600 15497 14607 CDS product radical SAM mobile pair protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679438.1 protein_id gnl|my_center|LOCUS_06600 16413 15490 gene locus_tag LOCUS_06610 16413 15490 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814554.1 protein_id gnl|my_center|LOCUS_06610 16770 16474 gene locus_tag LOCUS_06620 16770 16474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 >Feature sequence035 659 6 gene locus_tag LOCUS_06630 gene fsa 659 6 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964656.1 protein_id gnl|my_center|LOCUS_06630 1901 714 gene locus_tag LOCUS_06640 gene metK 1901 714 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163127.1 protein_id gnl|my_center|LOCUS_06640 3524 2232 gene locus_tag LOCUS_06650 3524 2232 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966804.1 protein_id gnl|my_center|LOCUS_06650 6233 3759 gene locus_tag LOCUS_06660 6233 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 7180 6251 gene locus_tag LOCUS_06670 7180 6251 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_06670 8250 7852 gene locus_tag LOCUS_06680 8250 7852 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773532.1 protein_id gnl|my_center|LOCUS_06680 9653 8262 gene locus_tag LOCUS_06690 gene atpD 9653 8262 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425850.1 protein_id gnl|my_center|LOCUS_06690 10529 9672 gene locus_tag LOCUS_06700 gene atpG 10529 9672 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_06700 12046 10544 gene locus_tag LOCUS_06710 gene atpA 12046 10544 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462231.1 protein_id gnl|my_center|LOCUS_06710 12663 12115 gene locus_tag LOCUS_06720 12663 12115 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815471.1 protein_id gnl|my_center|LOCUS_06720 13166 12651 gene locus_tag LOCUS_06730 gene atpF 13166 12651 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183008.1 protein_id gnl|my_center|LOCUS_06730 13479 13222 gene locus_tag LOCUS_06740 gene atpE 13479 13222 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902609.1 protein_id gnl|my_center|LOCUS_06740 14238 13534 gene locus_tag LOCUS_06750 gene atpB 14238 13534 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437836.1 protein_id gnl|my_center|LOCUS_06750 14644 14255 gene locus_tag LOCUS_06760 14644 14255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 14837 14613 gene locus_tag LOCUS_06770 14837 14613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 16176 15298 gene locus_tag LOCUS_06780 gene sdaAA 16176 15298 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963993.1 protein_id gnl|my_center|LOCUS_06780 >Feature sequence036 2832 193 gene locus_tag LOCUS_06790 gene alaS 2832 193 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964985.1 protein_id gnl|my_center|LOCUS_06790 2986 2855 gene locus_tag LOCUS_06800 2986 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 4227 3304 gene locus_tag LOCUS_06810 4227 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 4803 4345 gene locus_tag LOCUS_06820 gene lrpA 4803 4345 CDS product HTH-type transcriptional regulator LrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867694.1 protein_id gnl|my_center|LOCUS_06820 5082 6422 gene locus_tag LOCUS_06830 5082 6422 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_06830 6933 6451 gene locus_tag LOCUS_06840 gene rnhA 6933 6451 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705464.1 protein_id gnl|my_center|LOCUS_06840 7742 6963 gene locus_tag LOCUS_06850 7742 6963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06850 8570 7743 gene locus_tag LOCUS_06860 8570 7743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06860 10289 8814 gene locus_tag LOCUS_06870 gene spoIVA 10289 8814 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392832.1 protein_id gnl|my_center|LOCUS_06870 11064 10354 gene locus_tag LOCUS_06880 11064 10354 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052444.1 protein_id gnl|my_center|LOCUS_06880 11835 11077 gene locus_tag LOCUS_06890 11835 11077 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017145.1 protein_id gnl|my_center|LOCUS_06890 12813 11839 gene locus_tag LOCUS_06900 12813 11839 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797307.1 protein_id gnl|my_center|LOCUS_06900 13704 12823 gene locus_tag LOCUS_06910 13704 12823 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_06910 15133 13934 gene locus_tag LOCUS_06920 15133 13934 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902269.1 protein_id gnl|my_center|LOCUS_06920 16238 15234 gene locus_tag LOCUS_06930 16238 15234 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016741.1 protein_id gnl|my_center|LOCUS_06930 >Feature sequence037 396 148 gene locus_tag LOCUS_06940 396 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 1361 453 gene locus_tag LOCUS_06950 1361 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 1497 1315 gene locus_tag LOCUS_06960 1497 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 1842 2765 gene locus_tag LOCUS_06970 1842 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 3020 2778 gene locus_tag LOCUS_06980 3020 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 3006 3260 gene locus_tag LOCUS_06990 3006 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 4026 3157 gene locus_tag LOCUS_07000 4026 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 4336 7872 gene locus_tag LOCUS_07010 4336 7872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 7900 8421 gene locus_tag LOCUS_07020 7900 8421 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767792.1 protein_id gnl|my_center|LOCUS_07020 8414 9061 gene locus_tag LOCUS_07030 8414 9061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 9200 9898 gene locus_tag LOCUS_07040 9200 9898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 10161 11063 gene locus_tag LOCUS_07050 10161 11063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 11339 12049 gene locus_tag LOCUS_07060 11339 12049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 12532 12110 gene locus_tag LOCUS_07070 12532 12110 CDS product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889078.1 protein_id gnl|my_center|LOCUS_07070 13440 12532 gene locus_tag LOCUS_07080 13440 12532 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438284.1 protein_id gnl|my_center|LOCUS_07080 13954 13601 gene locus_tag LOCUS_07090 13954 13601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 14370 13930 gene locus_tag LOCUS_07100 14370 13930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07100 15158 14724 gene locus_tag LOCUS_07110 15158 14724 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033125641.1 protein_id gnl|my_center|LOCUS_07110 15299 15595 gene locus_tag LOCUS_07120 15299 15595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 >Feature sequence038 255 1649 gene locus_tag LOCUS_07130 255 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 2283 1765 gene locus_tag LOCUS_07140 2283 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 2416 3405 gene locus_tag LOCUS_07150 2416 3405 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774964.1 protein_id gnl|my_center|LOCUS_07150 4298 3582 gene locus_tag LOCUS_07160 4298 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673400.1 protein_id gnl|my_center|LOCUS_07160 5042 4320 gene locus_tag LOCUS_07170 5042 4320 CDS product DUF5058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680854.1 protein_id gnl|my_center|LOCUS_07170 6496 5066 gene locus_tag LOCUS_07180 6496 5066 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965348.1 protein_id gnl|my_center|LOCUS_07180 6710 7867 gene locus_tag LOCUS_07190 6710 7867 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434490.1 protein_id gnl|my_center|LOCUS_07190 9185 7854 gene locus_tag LOCUS_07200 9185 7854 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562821.1 protein_id gnl|my_center|LOCUS_07200 9339 9413 gene locus_tag LOCUS_t00050 9339 9413 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 9449 9519 gene locus_tag LOCUS_t00060 9449 9519 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9766 10764 gene locus_tag LOCUS_07210 9766 10764 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774414.1 protein_id gnl|my_center|LOCUS_07210 11230 11158 gene locus_tag LOCUS_t00070 11230 11158 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 11346 11537 gene locus_tag LOCUS_07220 11346 11537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 12834 11566 gene locus_tag LOCUS_07230 12834 11566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 15080 13263 gene locus_tag LOCUS_07240 gene glmS 15080 13263 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393728.1 protein_id gnl|my_center|LOCUS_07240 <16144 15427 gene locus_tag LOCUS_07250 <16144 15427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002338467.1:phospho-sugar mutase >Feature sequence039 456 1775 gene locus_tag LOCUS_07260 456 1775 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_07260 1992 3224 gene locus_tag LOCUS_07270 1992 3224 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_07270 3271 3906 gene locus_tag LOCUS_07280 3271 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 3882 4898 gene locus_tag LOCUS_07290 3882 4898 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964805.1 protein_id gnl|my_center|LOCUS_07290 4901 5686 gene locus_tag LOCUS_07300 4901 5686 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964806.1 protein_id gnl|my_center|LOCUS_07300 5683 5970 gene locus_tag LOCUS_07310 5683 5970 CDS product DUF503 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964058.1 protein_id gnl|my_center|LOCUS_07310 7494 6091 gene locus_tag LOCUS_07320 gene mgtE 7494 6091 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362548.1 protein_id gnl|my_center|LOCUS_07320 8092 8937 gene locus_tag LOCUS_07330 8092 8937 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546238.1 protein_id gnl|my_center|LOCUS_07330 8928 9659 gene locus_tag LOCUS_07340 8928 9659 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211328137.1 protein_id gnl|my_center|LOCUS_07340 9815 10189 gene locus_tag LOCUS_07350 9815 10189 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459154.1 protein_id gnl|my_center|LOCUS_07350 10289 10882 gene locus_tag LOCUS_07360 10289 10882 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426696.1 protein_id gnl|my_center|LOCUS_07360 10894 11733 gene locus_tag LOCUS_07370 10894 11733 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888897.1 protein_id gnl|my_center|LOCUS_07370 11836 12630 gene locus_tag LOCUS_07380 11836 12630 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965361.1 protein_id gnl|my_center|LOCUS_07380 12664 13878 gene locus_tag LOCUS_07390 12664 13878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 >Feature sequence040 350 1057 gene locus_tag LOCUS_07400 350 1057 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582696.1 protein_id gnl|my_center|LOCUS_07400 1074 1547 gene locus_tag LOCUS_07410 1074 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 1869 1696 gene locus_tag LOCUS_07420 1869 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 2053 1862 gene locus_tag LOCUS_07430 2053 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 2324 2950 gene locus_tag LOCUS_07440 2324 2950 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966689.1 protein_id gnl|my_center|LOCUS_07440 3124 3684 gene locus_tag LOCUS_07450 3124 3684 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582751.1 protein_id gnl|my_center|LOCUS_07450 3920 5245 gene locus_tag LOCUS_07460 3920 5245 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263484.1 protein_id gnl|my_center|LOCUS_07460 6273 5425 gene locus_tag LOCUS_07470 6273 5425 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902122.1 protein_id gnl|my_center|LOCUS_07470 6895 6275 gene locus_tag LOCUS_07480 6895 6275 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432265.1 protein_id gnl|my_center|LOCUS_07480 10188 6883 gene locus_tag LOCUS_07490 10188 6883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 10615 10190 gene locus_tag LOCUS_07500 10615 10190 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861681.1 protein_id gnl|my_center|LOCUS_07500 11698 10694 gene locus_tag LOCUS_07510 11698 10694 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897671.1 protein_id gnl|my_center|LOCUS_07510 12014 12892 gene locus_tag LOCUS_07520 12014 12892 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261332.1 protein_id gnl|my_center|LOCUS_07520 14593 13262 gene locus_tag LOCUS_07530 14593 13262 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731178.1 protein_id gnl|my_center|LOCUS_07530 14807 15325 gene locus_tag LOCUS_07540 14807 15325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 >Feature sequence041 2363 594 gene locus_tag LOCUS_07550 2363 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 3490 2393 gene locus_tag LOCUS_07560 3490 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 3929 4603 gene locus_tag LOCUS_07570 3929 4603 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_07570 4600 6015 gene locus_tag LOCUS_07580 4600 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 6164 6754 gene locus_tag LOCUS_07590 6164 6754 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435286.1 protein_id gnl|my_center|LOCUS_07590 6751 7542 gene locus_tag LOCUS_07600 6751 7542 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861405.1 protein_id gnl|my_center|LOCUS_07600 8910 8290 gene locus_tag LOCUS_07610 8910 8290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 10051 8900 gene locus_tag LOCUS_07620 10051 8900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 10368 10048 gene locus_tag LOCUS_07630 10368 10048 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889116.1 protein_id gnl|my_center|LOCUS_07630 10666 12096 gene locus_tag LOCUS_07640 10666 12096 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546599.1 protein_id gnl|my_center|LOCUS_07640 12314 13630 gene locus_tag LOCUS_07650 12314 13630 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048276.1 protein_id gnl|my_center|LOCUS_07650 13679 14722 gene locus_tag LOCUS_07660 13679 14722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 >Feature sequence042 358 1131 gene locus_tag LOCUS_07670 358 1131 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_07670 2146 1415 gene locus_tag LOCUS_07680 2146 1415 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297012.1 protein_id gnl|my_center|LOCUS_07680 2928 2143 gene locus_tag LOCUS_07690 2928 2143 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297010.1 protein_id gnl|my_center|LOCUS_07690 4057 2957 gene locus_tag LOCUS_07700 4057 2957 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861411.1 protein_id gnl|my_center|LOCUS_07700 4830 4054 gene locus_tag LOCUS_07710 4830 4054 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461832.1 protein_id gnl|my_center|LOCUS_07710 5228 6004 gene locus_tag LOCUS_07720 gene sigG 5228 6004 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_07720 6100 6372 gene locus_tag LOCUS_07730 6100 6372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 6754 7686 gene locus_tag LOCUS_07740 gene manA 6754 7686 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232833.1 protein_id gnl|my_center|LOCUS_07740 7724 8596 gene locus_tag LOCUS_07750 7724 8596 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726366.1 protein_id gnl|my_center|LOCUS_07750 13491 8683 gene locus_tag LOCUS_07760 13491 8683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 15107 13806 gene locus_tag LOCUS_07770 15107 13806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 >Feature sequence043 1925 228 gene locus_tag LOCUS_07780 1925 228 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810050.1 protein_id gnl|my_center|LOCUS_07780 2485 1922 gene locus_tag LOCUS_07790 gene ahpC 2485 1922 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817384.1 protein_id gnl|my_center|LOCUS_07790 3822 2821 gene locus_tag LOCUS_07800 3822 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458925.1 protein_id gnl|my_center|LOCUS_07800 5304 4006 gene locus_tag LOCUS_07810 gene eno 5304 4006 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948030.1 protein_id gnl|my_center|LOCUS_07810 6885 5533 gene locus_tag LOCUS_07820 6885 5533 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964201.1 protein_id gnl|my_center|LOCUS_07820 7384 6956 gene locus_tag LOCUS_07830 7384 6956 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966683.1 protein_id gnl|my_center|LOCUS_07830 8879 7572 gene locus_tag LOCUS_07840 gene thiC 8879 7572 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047970.1 protein_id gnl|my_center|LOCUS_07840 10236 9418 gene locus_tag LOCUS_07850 10236 9418 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670448.1 protein_id gnl|my_center|LOCUS_07850 11761 10283 gene locus_tag LOCUS_07860 11761 10283 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528380.1 protein_id gnl|my_center|LOCUS_07860 12804 11758 gene locus_tag LOCUS_07870 12804 11758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 14418 12832 gene locus_tag LOCUS_07880 14418 12832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 >Feature sequence044 <1 960 gene locus_tag LOCUS_07890 <1 960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966501.1:UDP-N-acetylmuramate--L-alanine ligase 1243 2274 gene locus_tag LOCUS_07900 1243 2274 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132280311.1 protein_id gnl|my_center|LOCUS_07900 2288 3283 gene locus_tag LOCUS_07910 2288 3283 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435695.1 protein_id gnl|my_center|LOCUS_07910 3360 4541 gene locus_tag LOCUS_07920 3360 4541 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_07920 6466 4619 gene locus_tag LOCUS_07930 6466 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 7539 6463 gene locus_tag LOCUS_07940 7539 6463 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545188.1 protein_id gnl|my_center|LOCUS_07940 9079 7688 gene locus_tag LOCUS_07950 gene asnS 9079 7688 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462263.1 protein_id gnl|my_center|LOCUS_07950 9424 10698 gene locus_tag LOCUS_07960 9424 10698 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082942.1 protein_id gnl|my_center|LOCUS_07960 10695 11816 gene locus_tag LOCUS_07970 gene glgD 10695 11816 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082940.1 protein_id gnl|my_center|LOCUS_07970 11854 12132 gene locus_tag LOCUS_07980 gene spoVG 11854 12132 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966499.1 protein_id gnl|my_center|LOCUS_07980 12254 12913 gene locus_tag LOCUS_07990 12254 12913 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_07990 13221 12916 gene locus_tag LOCUS_08000 gene trxA 13221 12916 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329897.1 protein_id gnl|my_center|LOCUS_08000 13867 13310 gene locus_tag LOCUS_08010 13867 13310 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947937.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence045 <1 1937 gene locus_tag LOCUS_08020 <1 1937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003246072.1:leucine--tRNA ligase 2172 3278 gene locus_tag LOCUS_08030 2172 3278 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113569.1 protein_id gnl|my_center|LOCUS_08030 3529 4434 gene locus_tag LOCUS_08040 3529 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 4725 4444 gene locus_tag LOCUS_08050 4725 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 5154 4738 gene locus_tag LOCUS_08060 5154 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 5251 5400 gene locus_tag LOCUS_08070 5251 5400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 5686 5450 gene locus_tag LOCUS_08080 5686 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 5840 7006 gene locus_tag LOCUS_08090 5840 7006 CDS product serine-tRNA(Ala) deacylase AlaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435901.1 protein_id gnl|my_center|LOCUS_08090 7003 8145 gene locus_tag LOCUS_08100 7003 8145 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964048.1 protein_id gnl|my_center|LOCUS_08100 8109 8312 gene locus_tag LOCUS_08110 8109 8312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 8523 8287 gene locus_tag LOCUS_08120 8523 8287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 9508 8669 gene locus_tag LOCUS_08130 9508 8669 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937958.1 protein_id gnl|my_center|LOCUS_08130 10112 9945 gene locus_tag LOCUS_08140 10112 9945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 10189 11808 gene locus_tag LOCUS_08150 10189 11808 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896350.1 protein_id gnl|my_center|LOCUS_08150 12091 12501 gene locus_tag LOCUS_08160 12091 12501 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765511.1 protein_id gnl|my_center|LOCUS_08160 >Feature sequence046 2692 1190 gene locus_tag LOCUS_08170 gene araA 2692 1190 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229499.1 protein_id gnl|my_center|LOCUS_08170 3822 2740 gene locus_tag LOCUS_08180 gene araR 3822 2740 CDS product arabinose utilization transcriptional regulator AraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243070.1 protein_id gnl|my_center|LOCUS_08180 5064 3895 gene locus_tag LOCUS_08190 gene gguB 5064 3895 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061408.1 protein_id gnl|my_center|LOCUS_08190 6623 5064 gene locus_tag LOCUS_08200 gene gguA 6623 5064 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287995.1 protein_id gnl|my_center|LOCUS_08200 8074 6905 gene locus_tag LOCUS_08210 gene chvE 8074 6905 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976402.1 protein_id gnl|my_center|LOCUS_08210 9913 8855 gene locus_tag LOCUS_08220 9913 8855 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326127.1 protein_id gnl|my_center|LOCUS_08220 11014 9929 gene locus_tag LOCUS_08230 gene asd 11014 9929 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699652.1 protein_id gnl|my_center|LOCUS_08230 11850 11131 gene locus_tag LOCUS_08240 gene deoD 11850 11131 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843292.1 protein_id gnl|my_center|LOCUS_08240 14119 11885 gene locus_tag LOCUS_08250 gene gyrA 14119 11885 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_08250 <14912 14154 gene locus_tag LOCUS_08260 <14912 14154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868886.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence047 296 2059 gene locus_tag LOCUS_08270 296 2059 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964921.1 protein_id gnl|my_center|LOCUS_08270 2983 2054 gene locus_tag LOCUS_08280 2983 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 3184 4128 gene locus_tag LOCUS_08290 3184 4128 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974020.1 protein_id gnl|my_center|LOCUS_08290 4125 5390 gene locus_tag LOCUS_08300 4125 5390 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368318.1 protein_id gnl|my_center|LOCUS_08300 5644 6363 gene locus_tag LOCUS_08310 5644 6363 CDS product acyl-[acyl-carrier-protein] thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966854.1 protein_id gnl|my_center|LOCUS_08310 6366 7199 gene locus_tag LOCUS_08320 6366 7199 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986367.1 protein_id gnl|my_center|LOCUS_08320 7210 7800 gene locus_tag LOCUS_08330 7210 7800 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976089.1 protein_id gnl|my_center|LOCUS_08330 7843 8688 gene locus_tag LOCUS_08340 7843 8688 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430304.1 protein_id gnl|my_center|LOCUS_08340 8875 9981 gene locus_tag LOCUS_08350 gene ugpC 8875 9981 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_08350 10097 11185 gene locus_tag LOCUS_08360 10097 11185 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966511.1 protein_id gnl|my_center|LOCUS_08360 11198 11896 gene locus_tag LOCUS_08370 gene ftsE 11198 11896 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963819.1 protein_id gnl|my_center|LOCUS_08370 11871 12791 gene locus_tag LOCUS_08380 gene ftsX 11871 12791 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645021.1 protein_id gnl|my_center|LOCUS_08380 12801 14009 gene locus_tag LOCUS_08390 12801 14009 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_08390 >Feature sequence048 3080 1623 gene locus_tag LOCUS_08400 gene miaB 3080 1623 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435252.1 protein_id gnl|my_center|LOCUS_08400 4683 3559 gene locus_tag LOCUS_08410 4683 3559 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257313.1 protein_id gnl|my_center|LOCUS_08410 6481 4835 gene locus_tag LOCUS_08420 6481 4835 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459110.1 protein_id gnl|my_center|LOCUS_08420 6756 6577 gene locus_tag LOCUS_08430 6756 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 7754 6771 gene locus_tag LOCUS_08440 7754 6771 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459112.1 protein_id gnl|my_center|LOCUS_08440 8738 7755 gene locus_tag LOCUS_08450 8738 7755 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345583.1 protein_id gnl|my_center|LOCUS_08450 9644 8751 gene locus_tag LOCUS_08460 9644 8751 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810093.1 protein_id gnl|my_center|LOCUS_08460 10664 9648 gene locus_tag LOCUS_08470 10664 9648 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810095.1 protein_id gnl|my_center|LOCUS_08470 12503 10857 gene locus_tag LOCUS_08480 12503 10857 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459110.1 protein_id gnl|my_center|LOCUS_08480 14578 13334 gene locus_tag LOCUS_08490 14578 13334 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_08490 >Feature sequence049 865 23 gene locus_tag LOCUS_08500 865 23 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_08500 1435 1073 gene locus_tag LOCUS_08510 1435 1073 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214419.1 protein_id gnl|my_center|LOCUS_08510 1583 2125 gene locus_tag LOCUS_08520 1583 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 3265 2234 gene locus_tag LOCUS_08530 3265 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 4720 3302 gene locus_tag LOCUS_08540 4720 3302 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_08540 6458 4950 gene locus_tag LOCUS_08550 6458 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 8624 6780 gene locus_tag LOCUS_08560 gene ftsH 8624 6780 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272613.1 protein_id gnl|my_center|LOCUS_08560 9071 8628 gene locus_tag LOCUS_08570 9071 8628 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461554.1 protein_id gnl|my_center|LOCUS_08570 9682 9368 gene locus_tag LOCUS_08580 9682 9368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 10225 9734 gene locus_tag LOCUS_08590 10225 9734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 11046 10246 gene locus_tag LOCUS_08600 11046 10246 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_08600 11143 11808 gene locus_tag LOCUS_08610 11143 11808 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_08610 13223 11844 gene locus_tag LOCUS_08620 13223 11844 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891654.1 protein_id gnl|my_center|LOCUS_08620 13703 13230 gene locus_tag LOCUS_08630 13703 13230 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861879.1 protein_id gnl|my_center|LOCUS_08630 >Feature sequence050 1336 689 gene locus_tag LOCUS_08640 1336 689 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964931.1 protein_id gnl|my_center|LOCUS_08640 2302 1355 gene locus_tag LOCUS_08650 2302 1355 CDS product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057563589.1 protein_id gnl|my_center|LOCUS_08650 2993 2319 gene locus_tag LOCUS_08660 2993 2319 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018010902.1 protein_id gnl|my_center|LOCUS_08660 4059 3091 gene locus_tag LOCUS_08670 4059 3091 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491187.1 protein_id gnl|my_center|LOCUS_08670 5019 4087 gene locus_tag LOCUS_08680 5019 4087 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537587.1 protein_id gnl|my_center|LOCUS_08680 6151 5021 gene locus_tag LOCUS_08690 6151 5021 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082660.1 protein_id gnl|my_center|LOCUS_08690 7698 6148 gene locus_tag LOCUS_08700 7698 6148 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732280.1 protein_id gnl|my_center|LOCUS_08700 8942 7803 gene locus_tag LOCUS_08710 8942 7803 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383860.1 protein_id gnl|my_center|LOCUS_08710 10365 8983 gene locus_tag LOCUS_08720 10365 8983 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_08720 11297 10362 gene locus_tag LOCUS_08730 gene rihC 11297 10362 CDS product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052500.1 protein_id gnl|my_center|LOCUS_08730 11532 13478 gene locus_tag LOCUS_08740 11532 13478 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819456.1 protein_id gnl|my_center|LOCUS_08740 <14518 13727 gene locus_tag LOCUS_08750 <14518 13727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003435635.1:glucose-6-phosphate isomerase >Feature sequence051 727 506 gene locus_tag LOCUS_08760 727 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 787 1014 gene locus_tag LOCUS_08770 787 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 2414 1155 gene locus_tag LOCUS_08780 2414 1155 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462038.1 protein_id gnl|my_center|LOCUS_08780 3604 2444 gene locus_tag LOCUS_08790 3604 2444 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_08790 4686 3604 gene locus_tag LOCUS_08800 gene serC 4686 3604 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_08800 5836 4802 gene locus_tag LOCUS_08810 5836 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 6176 7522 gene locus_tag LOCUS_08820 6176 7522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 9055 7619 gene locus_tag LOCUS_08830 9055 7619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198142920.1 protein_id gnl|my_center|LOCUS_08830 10054 9137 gene locus_tag LOCUS_08840 10054 9137 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281520.1 protein_id gnl|my_center|LOCUS_08840 10565 10116 gene locus_tag LOCUS_08850 10565 10116 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492147.1 protein_id gnl|my_center|LOCUS_08850 11572 10562 gene locus_tag LOCUS_08860 gene appF 11572 10562 CDS product oligopeptide ABC transporter ATP-binding protein AppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232964.1 protein_id gnl|my_center|LOCUS_08860 12601 11573 gene locus_tag LOCUS_08870 12601 11573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08870 13505 12612 gene locus_tag LOCUS_08880 13505 12612 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803875.1 protein_id gnl|my_center|LOCUS_08880 <14207 13525 gene locus_tag LOCUS_08890 <14207 13525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001856206.1:ABC transporter permease >Feature sequence052 255 1127 gene locus_tag LOCUS_08900 255 1127 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948436.1 protein_id gnl|my_center|LOCUS_08900 2096 1131 gene locus_tag LOCUS_08910 2096 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 3308 2115 gene locus_tag LOCUS_08920 3308 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 4139 3405 gene locus_tag LOCUS_08930 4139 3405 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_08930 4840 4448 gene locus_tag LOCUS_08940 4840 4448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 5246 5782 gene locus_tag LOCUS_08950 5246 5782 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966606.1 protein_id gnl|my_center|LOCUS_08950 5815 6846 gene locus_tag LOCUS_08960 5815 6846 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200459.1 protein_id gnl|my_center|LOCUS_08960 7776 7264 gene locus_tag LOCUS_08970 7776 7264 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965803.1 protein_id gnl|my_center|LOCUS_08970 8813 7926 gene locus_tag LOCUS_08980 8813 7926 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_08980 9437 8868 gene locus_tag LOCUS_08990 9437 8868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 10934 9561 gene locus_tag LOCUS_09000 10934 9561 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272456.1 protein_id gnl|my_center|LOCUS_09000 11632 10931 gene locus_tag LOCUS_09010 11632 10931 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003024592.1 protein_id gnl|my_center|LOCUS_09010 11779 12702 gene locus_tag LOCUS_09020 11779 12702 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861095.1 protein_id gnl|my_center|LOCUS_09020 12695 13525 gene locus_tag LOCUS_09030 12695 13525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 >Feature sequence053 2241 892 gene locus_tag LOCUS_09040 2241 892 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110230.1 protein_id gnl|my_center|LOCUS_09040 2912 2238 gene locus_tag LOCUS_09050 2912 2238 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264517.1 protein_id gnl|my_center|LOCUS_09050 4464 3112 gene locus_tag LOCUS_09060 4464 3112 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807812.1 protein_id gnl|my_center|LOCUS_09060 4813 4457 gene locus_tag LOCUS_09070 4813 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 5044 6054 gene locus_tag LOCUS_09080 5044 6054 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860719.1 protein_id gnl|my_center|LOCUS_09080 6182 7324 gene locus_tag LOCUS_09090 6182 7324 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383860.1 protein_id gnl|my_center|LOCUS_09090 7387 8940 gene locus_tag LOCUS_09100 7387 8940 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732280.1 protein_id gnl|my_center|LOCUS_09100 8933 10027 gene locus_tag LOCUS_09110 8933 10027 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383862.1 protein_id gnl|my_center|LOCUS_09110 10029 10943 gene locus_tag LOCUS_09120 10029 10943 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537587.1 protein_id gnl|my_center|LOCUS_09120 10960 11952 gene locus_tag LOCUS_09130 10960 11952 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529592.1 protein_id gnl|my_center|LOCUS_09130 11968 12963 gene locus_tag LOCUS_09140 gene rihB 11968 12963 CDS product ribosylpyrimidine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415422.1 protein_id gnl|my_center|LOCUS_09140 12976 13935 gene locus_tag LOCUS_09150 12976 13935 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271954.1 protein_id gnl|my_center|LOCUS_09150 >Feature sequence054 <1 678 gene locus_tag LOCUS_09160 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016559.1:Na+/H+ antiporter NhaC 2249 873 gene locus_tag LOCUS_09170 2249 873 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047747.1 protein_id gnl|my_center|LOCUS_09170 3711 2425 gene locus_tag LOCUS_09180 3711 2425 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_09180 4434 5714 gene locus_tag LOCUS_09190 4434 5714 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896806.1 protein_id gnl|my_center|LOCUS_09190 5851 6864 gene locus_tag LOCUS_09200 5851 6864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 7147 6980 gene locus_tag LOCUS_09210 7147 6980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 9153 7162 gene locus_tag LOCUS_09220 9153 7162 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966642.1 protein_id gnl|my_center|LOCUS_09220 10108 9224 gene locus_tag LOCUS_09230 10108 9224 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945976.1 protein_id gnl|my_center|LOCUS_09230 10830 10240 gene locus_tag LOCUS_09240 10830 10240 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765392.1 protein_id gnl|my_center|LOCUS_09240 12088 10832 gene locus_tag LOCUS_09250 12088 10832 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693348.1 protein_id gnl|my_center|LOCUS_09250 >Feature sequence055 296 1168 gene locus_tag LOCUS_09260 296 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09260 1206 2003 gene locus_tag LOCUS_09270 1206 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09270 2000 2743 gene locus_tag LOCUS_09280 2000 2743 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294240.1 protein_id gnl|my_center|LOCUS_09280 2900 3700 gene locus_tag LOCUS_09290 2900 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 3772 4140 gene locus_tag LOCUS_09300 3772 4140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 4237 5106 gene locus_tag LOCUS_09310 4237 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 5404 5616 gene locus_tag LOCUS_09320 5404 5616 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809912.1 protein_id gnl|my_center|LOCUS_09320 5603 6043 gene locus_tag LOCUS_09330 5603 6043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861121.1 protein_id gnl|my_center|LOCUS_09330 6276 7409 gene locus_tag LOCUS_09340 6276 7409 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964085.1 protein_id gnl|my_center|LOCUS_09340 7413 8510 gene locus_tag LOCUS_09350 7413 8510 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048169508.1 protein_id gnl|my_center|LOCUS_09350 8618 9256 gene locus_tag LOCUS_09360 8618 9256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 9710 10924 gene locus_tag LOCUS_09370 9710 10924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427320.1 protein_id gnl|my_center|LOCUS_09370 11151 12365 gene locus_tag LOCUS_09380 11151 12365 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_09380 12382 13596 gene locus_tag LOCUS_09390 12382 13596 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_09390 >Feature sequence056 1307 102 gene locus_tag LOCUS_09400 gene xseA 1307 102 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358983.1 protein_id gnl|my_center|LOCUS_09400 1755 1312 gene locus_tag LOCUS_09410 gene nusB 1755 1312 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358828.1 protein_id gnl|my_center|LOCUS_09410 2787 1936 gene locus_tag LOCUS_09420 gene pfkA 2787 1936 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_09420 6443 2961 gene locus_tag LOCUS_09430 6443 2961 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_09430 7616 6579 gene locus_tag LOCUS_09440 7616 6579 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869089.1 protein_id gnl|my_center|LOCUS_09440 9832 7613 gene locus_tag LOCUS_09450 9832 7613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 10106 9843 gene locus_tag LOCUS_09460 10106 9843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 10616 10350 gene locus_tag LOCUS_09470 10616 10350 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956441.1 protein_id gnl|my_center|LOCUS_09470 11638 11006 gene locus_tag LOCUS_09480 11638 11006 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_09480 12961 11825 gene locus_tag LOCUS_09490 gene rpoD 12961 11825 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_09490 <13836 13277 gene locus_tag LOCUS_09500 <13836 13277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002484891.1:diacylglycerol kinase >Feature sequence057 156 2090 gene locus_tag LOCUS_09510 156 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 2102 2713 gene locus_tag LOCUS_09520 2102 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 2785 3122 gene locus_tag LOCUS_tm00010 2785 3122 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 3542 3264 gene locus_tag LOCUS_09530 3542 3264 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613391.1 protein_id gnl|my_center|LOCUS_09530 3798 3526 gene locus_tag LOCUS_09540 3798 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 4071 5897 gene locus_tag LOCUS_09550 4071 5897 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873616.1 protein_id gnl|my_center|LOCUS_09550 6192 7568 gene locus_tag LOCUS_09560 6192 7568 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_09560 7565 9184 gene locus_tag LOCUS_09570 7565 9184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 9664 10029 gene locus_tag LOCUS_09580 9664 10029 CDS product YlxM family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460448.1 protein_id gnl|my_center|LOCUS_09580 10050 11414 gene locus_tag LOCUS_09590 gene ffh 10050 11414 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_09590 11480 11722 gene locus_tag LOCUS_09600 gene rpsP 11480 11722 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_09600 11759 11986 gene locus_tag LOCUS_09610 11759 11986 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362589.1 protein_id gnl|my_center|LOCUS_09610 12215 12727 gene locus_tag LOCUS_09620 gene rimM 12215 12727 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889030.1 protein_id gnl|my_center|LOCUS_09620 12743 13564 gene locus_tag LOCUS_09630 gene trmD 12743 13564 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438222.1 protein_id gnl|my_center|LOCUS_09630 >Feature sequence058 638 1001 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatccacgctccctcaccgggagcgac 2062 1304 gene locus_tag LOCUS_09640 2062 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 3033 2059 gene locus_tag LOCUS_09650 3033 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 3754 3020 gene locus_tag LOCUS_09660 3754 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 5793 3772 gene locus_tag LOCUS_09670 5793 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 6664 5786 gene locus_tag LOCUS_09680 6664 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 7831 6944 gene locus_tag LOCUS_09690 gene cas6 7831 6944 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259217.1 protein_id gnl|my_center|LOCUS_09690 8486 8965 gene locus_tag LOCUS_09700 8486 8965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 9866 9234 gene locus_tag LOCUS_09710 9866 9234 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065091.1 protein_id gnl|my_center|LOCUS_09710 9958 10632 gene locus_tag LOCUS_09720 9958 10632 CDS product transcriptional regulator YeiL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658608.1 protein_id gnl|my_center|LOCUS_09720 12032 10809 gene locus_tag LOCUS_09730 12032 10809 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458812.1 protein_id gnl|my_center|LOCUS_09730 12894 12010 gene locus_tag LOCUS_09740 12894 12010 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860817.1 protein_id gnl|my_center|LOCUS_09740 >Feature sequence059 1424 561 gene locus_tag LOCUS_09750 1424 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 2394 1435 gene locus_tag LOCUS_09760 2394 1435 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256383.1 protein_id gnl|my_center|LOCUS_09760 4844 2394 gene locus_tag LOCUS_09770 4844 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 5986 4841 gene locus_tag LOCUS_09780 5986 4841 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369660.1 protein_id gnl|my_center|LOCUS_09780 6677 5976 gene locus_tag LOCUS_09790 6677 5976 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435805.1 protein_id gnl|my_center|LOCUS_09790 8960 6807 gene locus_tag LOCUS_09800 8960 6807 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_09800 10483 8960 gene locus_tag LOCUS_09810 10483 8960 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641096.1 protein_id gnl|my_center|LOCUS_09810 11757 10633 gene locus_tag LOCUS_09820 gene pheA 11757 10633 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_09820 12515 11763 gene locus_tag LOCUS_09830 12515 11763 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948182.1 protein_id gnl|my_center|LOCUS_09830 13237 12803 gene locus_tag LOCUS_09840 13237 12803 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966031.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence060 610 86 gene locus_tag LOCUS_09850 610 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 1723 752 gene locus_tag LOCUS_09860 1723 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 2537 1746 gene locus_tag LOCUS_09870 2537 1746 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861671.1 protein_id gnl|my_center|LOCUS_09870 3121 2534 gene locus_tag LOCUS_09880 3121 2534 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_09880 3662 3201 gene locus_tag LOCUS_09890 3662 3201 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810945.1 protein_id gnl|my_center|LOCUS_09890 4206 3706 gene locus_tag LOCUS_09900 4206 3706 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459433.1 protein_id gnl|my_center|LOCUS_09900 5671 4226 gene locus_tag LOCUS_09910 gene glgA 5671 4226 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_09910 6738 5929 gene locus_tag LOCUS_09920 gene spo0A 6738 5929 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226427.1 protein_id gnl|my_center|LOCUS_09920 7116 8393 gene locus_tag LOCUS_09930 gene spoIVB 7116 8393 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986434.1 protein_id gnl|my_center|LOCUS_09930 8822 12427 gene locus_tag LOCUS_09940 8822 12427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 12474 13022 gene locus_tag LOCUS_09950 12474 13022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 13605 13339 gene locus_tag LOCUS_09960 13605 13339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 >Feature sequence061 1256 147 gene locus_tag LOCUS_09970 1256 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 2097 1444 gene locus_tag LOCUS_09980 2097 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 2131 2406 gene locus_tag LOCUS_09990 2131 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 2664 2422 gene locus_tag LOCUS_10000 2664 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 3181 2654 gene locus_tag LOCUS_10010 3181 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 3862 3224 gene locus_tag LOCUS_10020 3862 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 4015 4209 gene locus_tag LOCUS_10030 4015 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 4253 4540 gene locus_tag LOCUS_10040 4253 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 4546 4722 gene locus_tag LOCUS_10050 4546 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 4736 4960 gene locus_tag LOCUS_10060 4736 4960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 4971 5114 gene locus_tag LOCUS_10070 4971 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 5152 5469 gene locus_tag LOCUS_10080 5152 5469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 5469 6749 gene locus_tag LOCUS_10090 5469 6749 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922059.1 protein_id gnl|my_center|LOCUS_10090 6749 7930 gene locus_tag LOCUS_10100 6749 7930 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922060.1 protein_id gnl|my_center|LOCUS_10100 7945 8403 gene locus_tag LOCUS_10110 7945 8403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 8403 9986 gene locus_tag LOCUS_10120 8403 9986 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922064.1 protein_id gnl|my_center|LOCUS_10120 10012 12222 gene locus_tag LOCUS_10130 10012 12222 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922066.1 protein_id gnl|my_center|LOCUS_10130 12599 12991 gene locus_tag LOCUS_10140 12599 12991 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922068.1 protein_id gnl|my_center|LOCUS_10140 12988 13224 gene locus_tag LOCUS_10150 12988 13224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 >Feature sequence062 <1 718 gene locus_tag LOCUS_10160 <1 718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949033.1:16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH 736 1224 gene locus_tag LOCUS_10170 736 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 1265 3457 gene locus_tag LOCUS_10180 1265 3457 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_10180 3715 4257 gene locus_tag LOCUS_10190 3715 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 4419 6158 gene locus_tag LOCUS_10200 4419 6158 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_10200 6390 7358 gene locus_tag LOCUS_10210 gene mraY 6390 7358 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358738.1 protein_id gnl|my_center|LOCUS_10210 7369 8721 gene locus_tag LOCUS_10220 gene murD 7369 8721 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_10220 8740 9927 gene locus_tag LOCUS_10230 gene spoVE 8740 9927 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426995.1 protein_id gnl|my_center|LOCUS_10230 10147 11265 gene locus_tag LOCUS_10240 gene murA 10147 11265 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392365.1 protein_id gnl|my_center|LOCUS_10240 11229 11966 gene locus_tag LOCUS_10250 11229 11966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence063 <1 1259 gene locus_tag LOCUS_10260 <1 1259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886636.1:sucrose-6-phosphate hydrolase 1443 2558 gene locus_tag LOCUS_10270 1443 2558 CDS product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390206.1 protein_id gnl|my_center|LOCUS_10270 2555 4309 gene locus_tag LOCUS_10280 2555 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 4306 5793 gene locus_tag LOCUS_10290 4306 5793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 5943 7025 gene locus_tag LOCUS_10300 5943 7025 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583513.1 protein_id gnl|my_center|LOCUS_10300 7062 8576 gene locus_tag LOCUS_10310 7062 8576 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865052.1 protein_id gnl|my_center|LOCUS_10310 8573 9634 gene locus_tag LOCUS_10320 8573 9634 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878388.1 protein_id gnl|my_center|LOCUS_10320 9631 10494 gene locus_tag LOCUS_10330 9631 10494 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583516.1 protein_id gnl|my_center|LOCUS_10330 10527 12017 gene locus_tag LOCUS_10340 10527 12017 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202887107.1 protein_id gnl|my_center|LOCUS_10340 <13416 12142 gene locus_tag LOCUS_10350 <13416 12142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005795565.1:amidophosphoribosyltransferase >Feature sequence064 1727 222 gene locus_tag LOCUS_10360 1727 222 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459464.1 protein_id gnl|my_center|LOCUS_10360 2261 1740 gene locus_tag LOCUS_10370 2261 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 3336 2275 gene locus_tag LOCUS_10380 3336 2275 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039422.1 protein_id gnl|my_center|LOCUS_10380 3526 4233 gene locus_tag LOCUS_10390 3526 4233 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963612.1 protein_id gnl|my_center|LOCUS_10390 4655 4401 gene locus_tag LOCUS_10400 4655 4401 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219835.1 protein_id gnl|my_center|LOCUS_10400 5641 4682 gene locus_tag LOCUS_10410 gene whiA 5641 4682 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963835.1 protein_id gnl|my_center|LOCUS_10410 6525 5650 gene locus_tag LOCUS_10420 gene rapZ 6525 5650 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_10420 7681 6710 gene locus_tag LOCUS_10430 gene murB 7681 6710 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_10430 8629 7703 gene locus_tag LOCUS_10440 gene hprK 8629 7703 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_10440 10565 8709 gene locus_tag LOCUS_10450 gene uvrC 10565 8709 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_10450 11273 10569 gene locus_tag LOCUS_10460 11273 10569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 13076 11310 gene locus_tag LOCUS_10470 13076 11310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 >Feature sequence065 1594 167 gene locus_tag LOCUS_10480 1594 167 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392886.1 protein_id gnl|my_center|LOCUS_10480 2527 1796 gene locus_tag LOCUS_10490 2527 1796 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_10490 2964 2524 gene locus_tag LOCUS_10500 2964 2524 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_10500 3216 3494 gene locus_tag LOCUS_10510 3216 3494 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262697.1 protein_id gnl|my_center|LOCUS_10510 3484 4146 gene locus_tag LOCUS_10520 3484 4146 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393576.1 protein_id gnl|my_center|LOCUS_10520 4236 5606 gene locus_tag LOCUS_10530 4236 5606 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_10530 5719 7632 gene locus_tag LOCUS_10540 5719 7632 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_10540 7629 8399 gene locus_tag LOCUS_10550 7629 8399 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227823.1 protein_id gnl|my_center|LOCUS_10550 8526 8972 gene locus_tag LOCUS_10560 8526 8972 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060880.1 protein_id gnl|my_center|LOCUS_10560 8974 9912 gene locus_tag LOCUS_10570 8974 9912 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_10570 10210 10515 gene locus_tag LOCUS_10580 10210 10515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 10518 11498 gene locus_tag LOCUS_10590 10518 11498 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768282.1 protein_id gnl|my_center|LOCUS_10590 11498 12607 gene locus_tag LOCUS_10600 gene mutY 11498 12607 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132598.1 protein_id gnl|my_center|LOCUS_10600 >Feature sequence066 1375 392 gene locus_tag LOCUS_10610 1375 392 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966903.1 protein_id gnl|my_center|LOCUS_10610 2367 1372 gene locus_tag LOCUS_10620 2367 1372 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966899.1 protein_id gnl|my_center|LOCUS_10620 3253 2360 gene locus_tag LOCUS_10630 3253 2360 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989353.1 protein_id gnl|my_center|LOCUS_10630 4220 3270 gene locus_tag LOCUS_10640 4220 3270 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278786.1 protein_id gnl|my_center|LOCUS_10640 6017 4413 gene locus_tag LOCUS_10650 6017 4413 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727704.1 protein_id gnl|my_center|LOCUS_10650 6216 8729 gene locus_tag LOCUS_10660 6216 8729 CDS product excinuclease ABC subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389901.1 protein_id gnl|my_center|LOCUS_10660 9777 8734 gene locus_tag LOCUS_10670 gene citC 9777 8734 CDS product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263235.1 protein_id gnl|my_center|LOCUS_10670 11139 9784 gene locus_tag LOCUS_10680 gene citG 11139 9784 CDS product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668027.1 protein_id gnl|my_center|LOCUS_10680 12004 11105 gene locus_tag LOCUS_10690 12004 11105 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984809.1 protein_id gnl|my_center|LOCUS_10690 12333 12635 gene locus_tag LOCUS_10700 gene citD 12333 12635 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017111.1 protein_id gnl|my_center|LOCUS_10700 >Feature sequence067 136 63 gene locus_tag LOCUS_t00080 136 63 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 693 175 gene locus_tag LOCUS_10710 693 175 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359469.1 protein_id gnl|my_center|LOCUS_10710 857 678 gene locus_tag LOCUS_10720 857 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 1806 829 gene locus_tag LOCUS_10730 1806 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 2219 1803 gene locus_tag LOCUS_10740 2219 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 2840 2568 gene locus_tag LOCUS_10750 2840 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 3051 4025 gene locus_tag LOCUS_10760 3051 4025 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613410.1 protein_id gnl|my_center|LOCUS_10760 6451 4199 gene locus_tag LOCUS_10770 6451 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 7729 6452 gene locus_tag LOCUS_10780 7729 6452 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 protein_id gnl|my_center|LOCUS_10780 8411 8151 gene locus_tag LOCUS_10790 8411 8151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 8611 9090 gene locus_tag LOCUS_10800 8611 9090 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986765.1 protein_id gnl|my_center|LOCUS_10800 9090 9554 gene locus_tag LOCUS_10810 9090 9554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 9535 10122 gene locus_tag LOCUS_10820 9535 10122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986764.1 protein_id gnl|my_center|LOCUS_10820 10646 10864 gene locus_tag LOCUS_10830 10646 10864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 10865 11182 gene locus_tag LOCUS_10840 10865 11182 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454698.1 protein_id gnl|my_center|LOCUS_10840 11134 11286 gene locus_tag LOCUS_10850 11134 11286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 12095 11325 gene locus_tag LOCUS_10860 12095 11325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 12721 12512 gene locus_tag LOCUS_10870 12721 12512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 >Feature sequence068 3521 591 gene locus_tag LOCUS_10880 3521 591 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048254.1 protein_id gnl|my_center|LOCUS_10880 4450 3563 gene locus_tag LOCUS_10890 4450 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 4608 4447 gene locus_tag LOCUS_10900 4608 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 6087 4852 gene locus_tag LOCUS_10910 6087 4852 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_10910 6747 6103 gene locus_tag LOCUS_10920 6747 6103 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438166.1 protein_id gnl|my_center|LOCUS_10920 7136 6744 gene locus_tag LOCUS_10930 7136 6744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 8828 7149 gene locus_tag LOCUS_10940 8828 7149 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_10940 9300 8848 gene locus_tag LOCUS_10950 9300 8848 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385810.1 protein_id gnl|my_center|LOCUS_10950 9579 9316 gene locus_tag LOCUS_10960 9579 9316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 10154 9732 gene locus_tag LOCUS_10970 gene ruvX 10154 9732 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730148.1 protein_id gnl|my_center|LOCUS_10970 10687 10424 gene locus_tag LOCUS_10980 10687 10424 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025772973.1 protein_id gnl|my_center|LOCUS_10980 12084 10726 gene locus_tag LOCUS_10990 gene mtaB 12084 10726 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048000.1 protein_id gnl|my_center|LOCUS_10990 12219 12452 gene locus_tag LOCUS_11000 12219 12452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 >Feature sequence069 3477 2206 gene locus_tag LOCUS_11010 gene hemL 3477 2206 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941005.1 protein_id gnl|my_center|LOCUS_11010 4127 3507 gene locus_tag LOCUS_11020 4127 3507 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943629.1 protein_id gnl|my_center|LOCUS_11020 5986 4340 gene locus_tag LOCUS_11030 gene treC 5986 4340 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986524.1 protein_id gnl|my_center|LOCUS_11030 7524 6091 gene locus_tag LOCUS_11040 gene treP 7524 6091 CDS product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723556.1 protein_id gnl|my_center|LOCUS_11040 8404 7688 gene locus_tag LOCUS_11050 gene treR 8404 7688 CDS product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405408.1 protein_id gnl|my_center|LOCUS_11050 9926 8394 gene locus_tag LOCUS_11060 9926 8394 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437761.1 protein_id gnl|my_center|LOCUS_11060 10822 10070 gene locus_tag LOCUS_11070 gene cobM 10822 10070 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016784.1 protein_id gnl|my_center|LOCUS_11070 11699 10932 gene locus_tag LOCUS_11080 gene cobJ 11699 10932 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016778.1 protein_id gnl|my_center|LOCUS_11080 12384 11692 gene locus_tag LOCUS_11090 gene cobI 12384 11692 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392605.1 protein_id gnl|my_center|LOCUS_11090 >Feature sequence070 3393 2260 gene locus_tag LOCUS_11100 3393 2260 CDS product 2-methylaconitate cis-trans isomerase PrpF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967865.1 protein_id gnl|my_center|LOCUS_11100 4712 3414 gene locus_tag LOCUS_11110 gene citS 4712 3414 CDS product citrate/sodium symporter CitS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183602.1 protein_id gnl|my_center|LOCUS_11110 5577 4723 gene locus_tag LOCUS_11120 5577 4723 CDS product DUF6282 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877507.1 protein_id gnl|my_center|LOCUS_11120 6951 5986 gene locus_tag LOCUS_11130 6951 5986 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105742760.1 protein_id gnl|my_center|LOCUS_11130 8594 7290 gene locus_tag LOCUS_11140 8594 7290 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891864.1 protein_id gnl|my_center|LOCUS_11140 9463 8588 gene locus_tag LOCUS_11150 9463 8588 CDS product DUF6282 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007717423.1 protein_id gnl|my_center|LOCUS_11150 9744 10643 gene locus_tag LOCUS_11160 9744 10643 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966633.1 protein_id gnl|my_center|LOCUS_11160 11800 11024 gene locus_tag LOCUS_11170 11800 11024 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_11170 >Feature sequence071 288 1181 gene locus_tag LOCUS_11180 288 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1565 2041 gene locus_tag LOCUS_11190 1565 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 2047 3882 gene locus_tag LOCUS_11200 2047 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 4098 4014 gene locus_tag LOCUS_t00090 4098 4014 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4274 4357 gene locus_tag LOCUS_t00100 4274 4357 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4552 5538 gene locus_tag LOCUS_11210 4552 5538 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_11210 5641 6378 gene locus_tag LOCUS_11220 5641 6378 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429190.1 protein_id gnl|my_center|LOCUS_11220 6381 7298 gene locus_tag LOCUS_11230 6381 7298 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435793.1 protein_id gnl|my_center|LOCUS_11230 7375 8547 gene locus_tag LOCUS_11240 7375 8547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 8695 9042 gene locus_tag LOCUS_11250 gene rplS 8695 9042 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362586.1 protein_id gnl|my_center|LOCUS_11250 9123 9668 gene locus_tag LOCUS_11260 gene lepB 9123 9668 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425129.1 protein_id gnl|my_center|LOCUS_11260 9745 10710 gene locus_tag LOCUS_11270 gene ylqF 9745 10710 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236706.1 protein_id gnl|my_center|LOCUS_11270 10710 11351 gene locus_tag LOCUS_11280 10710 11351 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_11280 11369 11710 gene locus_tag LOCUS_11290 11369 11710 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024665649.1 protein_id gnl|my_center|LOCUS_11290 >Feature sequence072 233 1975 gene locus_tag LOCUS_11300 233 1975 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_11300 3264 2203 gene locus_tag LOCUS_11310 3264 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 3657 3298 gene locus_tag LOCUS_11320 3657 3298 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016333.1 protein_id gnl|my_center|LOCUS_11320 5665 3827 gene locus_tag LOCUS_11330 5665 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 6992 5703 gene locus_tag LOCUS_11340 gene serS 6992 5703 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_11340 7835 7239 gene locus_tag LOCUS_11350 7835 7239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 8586 7924 gene locus_tag LOCUS_11360 8586 7924 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025388434.1 protein_id gnl|my_center|LOCUS_11360 9281 8583 gene locus_tag LOCUS_11370 gene rpe 9281 8583 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431138.1 protein_id gnl|my_center|LOCUS_11370 10176 9298 gene locus_tag LOCUS_11380 gene rsgA 10176 9298 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893669.1 protein_id gnl|my_center|LOCUS_11380 <11993 10183 gene locus_tag LOCUS_11390 <11993 10183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003232062.1:serine/threonine protein kinase PrkC >Feature sequence073 442 615 gene locus_tag LOCUS_11400 442 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 742 1038 gene locus_tag LOCUS_11410 742 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 1463 1047 gene locus_tag LOCUS_11420 1463 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 3764 1710 gene locus_tag LOCUS_11430 3764 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 3722 4198 gene locus_tag LOCUS_11440 3722 4198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 5979 4567 gene locus_tag LOCUS_11450 5979 4567 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_11450 7087 6095 gene locus_tag LOCUS_11460 7087 6095 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875811.1 protein_id gnl|my_center|LOCUS_11460 9275 7089 gene locus_tag LOCUS_11470 9275 7089 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378512.1 protein_id gnl|my_center|LOCUS_11470 10240 9272 gene locus_tag LOCUS_11480 10240 9272 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088722.1 protein_id gnl|my_center|LOCUS_11480 11317 10244 gene locus_tag LOCUS_11490 11317 10244 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065256.1 protein_id gnl|my_center|LOCUS_11490 11933 11334 gene locus_tag LOCUS_11500 11933 11334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 >Feature sequence074 825 947 gene locus_tag LOCUS_11510 825 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 956 1129 gene locus_tag LOCUS_11520 956 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 1217 1966 gene locus_tag LOCUS_11530 1217 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 2043 2543 gene locus_tag LOCUS_11540 2043 2543 CDS product terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816478.1 protein_id gnl|my_center|LOCUS_11540 2543 3910 gene locus_tag LOCUS_11550 2543 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 3907 5496 gene locus_tag LOCUS_11560 3907 5496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 5420 5695 gene locus_tag LOCUS_11570 5420 5695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 5685 7367 gene locus_tag LOCUS_11580 5685 7367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 7364 7546 gene locus_tag LOCUS_11590 7364 7546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 7720 8406 gene locus_tag LOCUS_11600 7720 8406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 8425 9408 gene locus_tag LOCUS_11610 8425 9408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 9422 9811 gene locus_tag LOCUS_11620 9422 9811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 9808 10146 gene locus_tag LOCUS_11630 9808 10146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 10146 10526 gene locus_tag LOCUS_11640 10146 10526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 10526 10945 gene locus_tag LOCUS_11650 10526 10945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 10942 11394 gene locus_tag LOCUS_11660 10942 11394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 11413 11709 gene locus_tag LOCUS_11670 11413 11709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 >Feature sequence075 986 66 gene locus_tag LOCUS_11680 gene hemC 986 66 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930577.1 protein_id gnl|my_center|LOCUS_11680 1630 983 gene locus_tag LOCUS_11690 1630 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 2800 1634 gene locus_tag LOCUS_11700 2800 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 4007 2940 gene locus_tag LOCUS_11710 gene asrC 4007 2940 CDS product sulfite reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020685.1 protein_id gnl|my_center|LOCUS_11710 4816 4025 gene locus_tag LOCUS_11720 gene asrB 4816 4025 CDS product anaerobic sulfite reductase subunit AsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392683.1 protein_id gnl|my_center|LOCUS_11720 5869 4835 gene locus_tag LOCUS_11730 gene asrA 5869 4835 CDS product anaerobic sulfite reductase subunit AsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964821.1 protein_id gnl|my_center|LOCUS_11730 7813 5930 gene locus_tag LOCUS_11740 7813 5930 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813245.1 protein_id gnl|my_center|LOCUS_11740 9842 7971 gene locus_tag LOCUS_11750 9842 7971 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813245.1 protein_id gnl|my_center|LOCUS_11750 10184 9873 gene locus_tag LOCUS_11760 gene trxA 10184 9873 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723853.1 protein_id gnl|my_center|LOCUS_11760 11163 10237 gene locus_tag LOCUS_11770 gene trxB 11163 10237 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564228.1 protein_id gnl|my_center|LOCUS_11770 <11832 11197 gene locus_tag LOCUS_11780 <11832 11197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813244.1:SLC13 family permease >Feature sequence076 889 287 gene locus_tag LOCUS_11790 889 287 CDS product dihydroxyacetone kinase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680280.1 protein_id gnl|my_center|LOCUS_11790 1910 903 gene locus_tag LOCUS_11800 1910 903 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674237.1 protein_id gnl|my_center|LOCUS_11800 2660 1932 gene locus_tag LOCUS_11810 2660 1932 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680283.1 protein_id gnl|my_center|LOCUS_11810 3474 2653 gene locus_tag LOCUS_11820 3474 2653 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680286.1 protein_id gnl|my_center|LOCUS_11820 4466 3471 gene locus_tag LOCUS_11830 4466 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 5353 4466 gene locus_tag LOCUS_11840 5353 4466 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938014.1 protein_id gnl|my_center|LOCUS_11840 6632 5463 gene locus_tag LOCUS_11850 6632 5463 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089637.1 protein_id gnl|my_center|LOCUS_11850 7202 6711 gene locus_tag LOCUS_11860 7202 6711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 7520 8158 gene locus_tag LOCUS_11870 7520 8158 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680289.1 protein_id gnl|my_center|LOCUS_11870 8224 9177 gene locus_tag LOCUS_11880 8224 9177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 9423 9495 gene locus_tag LOCUS_t00110 9423 9495 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 9869 11467 gene locus_tag LOCUS_11890 9869 11467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 >Feature sequence077 360 2261 gene locus_tag LOCUS_11900 360 2261 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861809.1 protein_id gnl|my_center|LOCUS_11900 2272 2871 gene locus_tag LOCUS_11910 2272 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 2978 3301 gene locus_tag LOCUS_11920 2978 3301 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722125.1 protein_id gnl|my_center|LOCUS_11920 3339 3659 gene locus_tag LOCUS_11930 3339 3659 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425440.1 protein_id gnl|my_center|LOCUS_11930 3714 5087 gene locus_tag LOCUS_11940 gene celB 3714 5087 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901597.1 protein_id gnl|my_center|LOCUS_11940 5116 5652 gene locus_tag LOCUS_11950 5116 5652 CDS product GrdB-related putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860643.1 protein_id gnl|my_center|LOCUS_11950 5818 6774 gene locus_tag LOCUS_11960 5818 6774 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895213.1 protein_id gnl|my_center|LOCUS_11960 6796 7905 gene locus_tag LOCUS_11970 6796 7905 CDS product Sapep family Mn(2+)-dependent dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860644.1 protein_id gnl|my_center|LOCUS_11970 7932 8666 gene locus_tag LOCUS_11980 7932 8666 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674428.1 protein_id gnl|my_center|LOCUS_11980 8663 9526 gene locus_tag LOCUS_11990 8663 9526 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357090.1 protein_id gnl|my_center|LOCUS_11990 9605 10696 gene locus_tag LOCUS_12000 9605 10696 CDS product DUF871 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253349.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence078 110 757 gene locus_tag LOCUS_12010 110 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 796 2052 gene locus_tag LOCUS_12020 796 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 2387 2468 gene locus_tag LOCUS_t00120 2387 2468 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3595 2717 gene locus_tag LOCUS_12030 3595 2717 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941867.1 protein_id gnl|my_center|LOCUS_12030 4074 3583 gene locus_tag LOCUS_12040 4074 3583 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948661.1 protein_id gnl|my_center|LOCUS_12040 4460 6760 gene locus_tag LOCUS_12050 4460 6760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 6867 9287 gene locus_tag LOCUS_12060 6867 9287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 9473 10276 gene locus_tag LOCUS_12070 9473 10276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 10273 11010 gene locus_tag LOCUS_12080 10273 11010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 11033 11617 gene locus_tag LOCUS_12090 11033 11617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence079 439 645 gene locus_tag LOCUS_12100 439 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 652 1182 gene locus_tag LOCUS_12110 gene nusG 652 1182 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_12110 1263 1688 gene locus_tag LOCUS_12120 gene rplK 1263 1688 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421189.1 protein_id gnl|my_center|LOCUS_12120 1768 2463 gene locus_tag LOCUS_12130 gene rplA 1768 2463 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421188.1 protein_id gnl|my_center|LOCUS_12130 2822 5413 gene locus_tag LOCUS_12140 gene clpB 2822 5413 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_12140 5712 5942 gene locus_tag LOCUS_12150 5712 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 6378 7442 gene locus_tag LOCUS_12160 gene recA 6378 7442 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965121.1 protein_id gnl|my_center|LOCUS_12160 7462 8061 gene locus_tag LOCUS_12170 7462 8061 CDS product RecX family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404862.1 protein_id gnl|my_center|LOCUS_12170 8115 9656 gene locus_tag LOCUS_12180 gene rny 8115 9656 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_12180 10075 11040 gene locus_tag LOCUS_12190 10075 11040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 >Feature sequence080 2259 1084 gene locus_tag LOCUS_12200 2259 1084 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986500.1 protein_id gnl|my_center|LOCUS_12200 4829 2709 gene locus_tag LOCUS_12210 4829 2709 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986498.1 protein_id gnl|my_center|LOCUS_12210 5113 4913 gene locus_tag LOCUS_12220 5113 4913 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359346.1 protein_id gnl|my_center|LOCUS_12220 5408 7516 gene locus_tag LOCUS_12230 gene pflB 5408 7516 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195485.1 protein_id gnl|my_center|LOCUS_12230 7575 7820 gene locus_tag LOCUS_12240 7575 7820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 7875 8633 gene locus_tag LOCUS_12250 gene pflA 7875 8633 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027587.1 protein_id gnl|my_center|LOCUS_12250 8711 8878 gene locus_tag LOCUS_12260 8711 8878 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809805.1 protein_id gnl|my_center|LOCUS_12260 8939 9655 gene locus_tag LOCUS_12270 8939 9655 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100889.1 protein_id gnl|my_center|LOCUS_12270 9954 10541 gene locus_tag LOCUS_12280 9954 10541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 11265 10678 gene locus_tag LOCUS_12290 11265 10678 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836233.1 protein_id gnl|my_center|LOCUS_12290 >Feature sequence081 1687 464 gene locus_tag LOCUS_12300 gene thrC 1687 464 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870985.1 protein_id gnl|my_center|LOCUS_12300 3209 1701 gene locus_tag LOCUS_12310 3209 1701 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 protein_id gnl|my_center|LOCUS_12310 4379 3222 gene locus_tag LOCUS_12320 4379 3222 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974707.1 protein_id gnl|my_center|LOCUS_12320 4639 5106 gene locus_tag LOCUS_12330 4639 5106 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_12330 6460 5267 gene locus_tag LOCUS_12340 6460 5267 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014128488.1 protein_id gnl|my_center|LOCUS_12340 6616 7521 gene locus_tag LOCUS_12350 6616 7521 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705248.1 protein_id gnl|my_center|LOCUS_12350 8655 7531 gene locus_tag LOCUS_12360 8655 7531 CDS product 2-methylaconitate cis-trans isomerase PrpF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967865.1 protein_id gnl|my_center|LOCUS_12360 10021 8729 gene locus_tag LOCUS_12370 10021 8729 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703620.1 protein_id gnl|my_center|LOCUS_12370 11325 10057 gene locus_tag LOCUS_12380 gene larA 11325 10057 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860456.1 protein_id gnl|my_center|LOCUS_12380 >Feature sequence082 1233 487 gene locus_tag LOCUS_12390 1233 487 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942799.1 protein_id gnl|my_center|LOCUS_12390 1908 2831 gene locus_tag LOCUS_12400 gene pyrB 1908 2831 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_12400 2825 3259 gene locus_tag LOCUS_12410 2825 3259 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 protein_id gnl|my_center|LOCUS_12410 3294 3611 gene locus_tag LOCUS_12420 3294 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 4789 3938 gene locus_tag LOCUS_12430 4789 3938 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953624.1 protein_id gnl|my_center|LOCUS_12430 5691 4804 gene locus_tag LOCUS_12440 5691 4804 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089248.1 protein_id gnl|my_center|LOCUS_12440 6813 5704 gene locus_tag LOCUS_12450 6813 5704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 9101 7443 gene locus_tag LOCUS_12460 9101 7443 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080960.1 protein_id gnl|my_center|LOCUS_12460 9941 9135 gene locus_tag LOCUS_12470 9941 9135 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902529.1 protein_id gnl|my_center|LOCUS_12470 10629 9895 gene locus_tag LOCUS_12480 10629 9895 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047989.1 protein_id gnl|my_center|LOCUS_12480 11329 10643 gene locus_tag LOCUS_12490 11329 10643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence083 <1 3133 gene locus_tag LOCUS_12500 <1 3133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017143219.1:VWA domain-containing protein 3153 3389 gene locus_tag LOCUS_12510 3153 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 3382 3951 gene locus_tag LOCUS_12520 gene lepB 3382 3951 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014635236.1 protein_id gnl|my_center|LOCUS_12520 4062 5159 gene locus_tag LOCUS_12530 4062 5159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 5288 6025 gene locus_tag LOCUS_12540 gene srtC1 5288 6025 CDS product FCT-2 pilus polymerization class B sortase SrtC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921812.1 protein_id gnl|my_center|LOCUS_12540 6052 6813 gene locus_tag LOCUS_12550 6052 6813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 7086 6823 gene locus_tag LOCUS_12560 7086 6823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 6986 7792 gene locus_tag LOCUS_12570 6986 7792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 8037 9089 gene locus_tag LOCUS_12580 gene selD 8037 9089 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q9L4E1 protein_id gnl|my_center|LOCUS_12580 9065 10237 gene locus_tag LOCUS_12590 9065 10237 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943290.1 protein_id gnl|my_center|LOCUS_12590 10247 10483 gene locus_tag LOCUS_12600 10247 10483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence084 682 443 gene locus_tag LOCUS_12610 682 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12610 1831 713 gene locus_tag LOCUS_12620 gene rlmD 1831 713 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105059.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12620 2783 1839 gene locus_tag LOCUS_12630 2783 1839 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_12630 4170 2866 gene locus_tag LOCUS_12640 4170 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 4460 6835 gene locus_tag LOCUS_12650 4460 6835 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860930.1 protein_id gnl|my_center|LOCUS_12650 6860 7570 gene locus_tag LOCUS_12660 6860 7570 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_12660 7570 8976 gene locus_tag LOCUS_12670 7570 8976 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048386.1 protein_id gnl|my_center|LOCUS_12670 9177 9524 gene locus_tag LOCUS_12680 9177 9524 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461784.1 protein_id gnl|my_center|LOCUS_12680 9511 10866 gene locus_tag LOCUS_12690 9511 10866 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272656.1 protein_id gnl|my_center|LOCUS_12690 >Feature sequence085 <1 1354 gene locus_tag LOCUS_12700 <1 1354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965572.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase 1445 1606 gene locus_tag LOCUS_12710 1445 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 1611 2255 gene locus_tag LOCUS_12720 1611 2255 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460349.1 protein_id gnl|my_center|LOCUS_12720 2258 3676 gene locus_tag LOCUS_12730 2258 3676 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_12730 4366 3857 gene locus_tag LOCUS_12740 4366 3857 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890791.1 protein_id gnl|my_center|LOCUS_12740 4590 5855 gene locus_tag LOCUS_12750 gene hisS 4590 5855 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964121.1 protein_id gnl|my_center|LOCUS_12750 5877 7676 gene locus_tag LOCUS_12760 gene aspS 5877 7676 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965567.1 protein_id gnl|my_center|LOCUS_12760 7677 8213 gene locus_tag LOCUS_12770 7677 8213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 8437 9114 gene locus_tag LOCUS_12780 8437 9114 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044679.1 protein_id gnl|my_center|LOCUS_12780 9111 10646 gene locus_tag LOCUS_12790 9111 10646 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965729.1 protein_id gnl|my_center|LOCUS_12790 >Feature sequence086 <1 1077 gene locus_tag LOCUS_12800 <1 1077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016873.1:M20 family metallopeptidase 2117 1128 gene locus_tag LOCUS_12810 2117 1128 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083086.1 protein_id gnl|my_center|LOCUS_12810 3199 2114 gene locus_tag LOCUS_12820 gene pdxA 3199 2114 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392248.1 protein_id gnl|my_center|LOCUS_12820 4117 3218 gene locus_tag LOCUS_12830 4117 3218 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705319.1 protein_id gnl|my_center|LOCUS_12830 4629 4135 gene locus_tag LOCUS_12840 4629 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 6515 5289 gene locus_tag LOCUS_12850 6515 5289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 6727 8496 gene locus_tag LOCUS_12860 6727 8496 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392246.1 protein_id gnl|my_center|LOCUS_12860 8890 9897 gene locus_tag LOCUS_12870 8890 9897 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966142.1 protein_id gnl|my_center|LOCUS_12870 >Feature sequence087 562 2082 gene locus_tag LOCUS_12880 gene cobA 562 2082 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_12880 2255 3238 gene locus_tag LOCUS_12890 gene hemB 2255 3238 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963427.1 protein_id gnl|my_center|LOCUS_12890 3275 4768 gene locus_tag LOCUS_12900 gene glpK 3275 4768 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987067.1 protein_id gnl|my_center|LOCUS_12900 5770 4973 gene locus_tag LOCUS_12910 5770 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 6483 5842 gene locus_tag LOCUS_12920 6483 5842 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809017.1 protein_id gnl|my_center|LOCUS_12920 7143 9011 gene locus_tag LOCUS_12930 7143 9011 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_12930 8995 9696 gene locus_tag LOCUS_12940 8995 9696 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460898.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence088 1546 1274 gene locus_tag LOCUS_12950 1546 1274 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812009.1 protein_id gnl|my_center|LOCUS_12950 2374 1577 gene locus_tag LOCUS_12960 2374 1577 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_12960 2982 2371 gene locus_tag LOCUS_12970 gene coaE 2982 2371 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941181.1 protein_id gnl|my_center|LOCUS_12970 5739 3025 gene locus_tag LOCUS_12980 gene polA 5739 3025 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260947.1 protein_id gnl|my_center|LOCUS_12980 6176 5826 gene locus_tag LOCUS_12990 6176 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 6425 6201 gene locus_tag LOCUS_13000 6425 6201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 7633 6464 gene locus_tag LOCUS_13010 7633 6464 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861090.1 protein_id gnl|my_center|LOCUS_13010 8823 7630 gene locus_tag LOCUS_13020 8823 7630 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861090.1 protein_id gnl|my_center|LOCUS_13020 10487 8943 gene locus_tag LOCUS_13030 10487 8943 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891132.1 protein_id gnl|my_center|LOCUS_13030 >Feature sequence089 385 1506 gene locus_tag LOCUS_13040 385 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 1742 2401 gene locus_tag LOCUS_13050 1742 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 4227 2572 gene locus_tag LOCUS_13060 gene ptsP 4227 2572 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051542.1 protein_id gnl|my_center|LOCUS_13060 4635 4378 gene locus_tag LOCUS_13070 4635 4378 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051543.1 protein_id gnl|my_center|LOCUS_13070 5845 4826 gene locus_tag LOCUS_13080 5845 4826 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964797.1 protein_id gnl|my_center|LOCUS_13080 6662 5859 gene locus_tag LOCUS_13090 6662 5859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 6785 7723 gene locus_tag LOCUS_13100 gene arcC 6785 7723 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680441.1 protein_id gnl|my_center|LOCUS_13100 9278 7854 gene locus_tag LOCUS_13110 9278 7854 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682077.1 protein_id gnl|my_center|LOCUS_13110 10521 9355 gene locus_tag LOCUS_13120 10521 9355 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948752.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence090 2078 1035 gene locus_tag LOCUS_13130 2078 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 3393 2089 gene locus_tag LOCUS_13140 3393 2089 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986501.1 protein_id gnl|my_center|LOCUS_13140 5066 3405 gene locus_tag LOCUS_13150 5066 3405 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814052.1 protein_id gnl|my_center|LOCUS_13150 5310 5059 gene locus_tag LOCUS_13160 5310 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 6798 5344 gene locus_tag LOCUS_13170 6798 5344 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306203.1 protein_id gnl|my_center|LOCUS_13170 8415 7111 gene locus_tag LOCUS_13180 8415 7111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 9522 8506 gene locus_tag LOCUS_13190 9522 8506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 10483 9737 gene locus_tag LOCUS_13200 10483 9737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence091 440 748 gene locus_tag LOCUS_13210 gene rplU 440 748 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229668.1 protein_id gnl|my_center|LOCUS_13210 757 1086 gene locus_tag LOCUS_13220 757 1086 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816543.1 protein_id gnl|my_center|LOCUS_13220 1090 1380 gene locus_tag LOCUS_13230 gene rpmA 1090 1380 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357774.1 protein_id gnl|my_center|LOCUS_13230 1461 2747 gene locus_tag LOCUS_13240 gene obgE 1461 2747 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724114.1 protein_id gnl|my_center|LOCUS_13240 2763 3056 gene locus_tag LOCUS_13250 gene yhbY 2763 3056 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955235.1 protein_id gnl|my_center|LOCUS_13250 3084 3701 gene locus_tag LOCUS_13260 gene nadD 3084 3701 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392101.1 protein_id gnl|my_center|LOCUS_13260 3708 4292 gene locus_tag LOCUS_13270 gene yqeK 3708 4292 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964575.1 protein_id gnl|my_center|LOCUS_13270 4313 4666 gene locus_tag LOCUS_13280 gene rsfS 4313 4666 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645187.1 protein_id gnl|my_center|LOCUS_13280 5706 5089 gene locus_tag LOCUS_13290 gene lexA 5706 5089 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_13290 5971 6186 gene locus_tag LOCUS_13300 5971 6186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 6284 8221 gene locus_tag LOCUS_13310 6284 8221 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986616.1 protein_id gnl|my_center|LOCUS_13310 9412 8321 gene locus_tag LOCUS_13320 9412 8321 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811557.1 protein_id gnl|my_center|LOCUS_13320 10142 9417 gene locus_tag LOCUS_13330 10142 9417 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_13330 >Feature sequence092 628 1395 gene locus_tag LOCUS_13340 628 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 2550 1657 gene locus_tag LOCUS_13350 2550 1657 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956794.1 protein_id gnl|my_center|LOCUS_13350 4546 2882 gene locus_tag LOCUS_13360 gene recN 4546 2882 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230267.1 protein_id gnl|my_center|LOCUS_13360 5013 4567 gene locus_tag LOCUS_13370 5013 4567 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_13370 5895 5029 gene locus_tag LOCUS_13380 5895 5029 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_13380 6808 5903 gene locus_tag LOCUS_13390 6808 5903 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438136.1 protein_id gnl|my_center|LOCUS_13390 8749 6887 gene locus_tag LOCUS_13400 gene dxs 8749 6887 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_13400 9667 8783 gene locus_tag LOCUS_13410 9667 8783 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_13410 9903 9667 gene locus_tag LOCUS_13420 9903 9667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 >Feature sequence093 2581 416 gene locus_tag LOCUS_13430 2581 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 2940 3623 gene locus_tag LOCUS_13440 2940 3623 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640997.1 protein_id gnl|my_center|LOCUS_13440 4684 3875 gene locus_tag LOCUS_13450 4684 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 5662 4757 gene locus_tag LOCUS_13460 5662 4757 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020423.1 protein_id gnl|my_center|LOCUS_13460 6772 5678 gene locus_tag LOCUS_13470 6772 5678 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_13470 7570 6794 gene locus_tag LOCUS_13480 7570 6794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 8271 7567 gene locus_tag LOCUS_13490 8271 7567 CDS product DUF4405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211250.1 protein_id gnl|my_center|LOCUS_13490 9309 8341 gene locus_tag LOCUS_13500 9309 8341 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854796.1 protein_id gnl|my_center|LOCUS_13500 10093 9419 gene locus_tag LOCUS_13510 10093 9419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 >Feature sequence094 1292 12 gene locus_tag LOCUS_13520 1292 12 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461660.1 protein_id gnl|my_center|LOCUS_13520 1587 2828 gene locus_tag LOCUS_13530 1587 2828 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_13530 2998 3882 gene locus_tag LOCUS_13540 2998 3882 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258871.1 protein_id gnl|my_center|LOCUS_13540 4074 5462 gene locus_tag LOCUS_13550 4074 5462 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763364.1 protein_id gnl|my_center|LOCUS_13550 5481 6251 gene locus_tag LOCUS_13560 5481 6251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 6271 6642 gene locus_tag LOCUS_13570 6271 6642 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_13570 6693 7844 gene locus_tag LOCUS_13580 6693 7844 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_13580 7891 9303 gene locus_tag LOCUS_13590 7891 9303 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 protein_id gnl|my_center|LOCUS_13590 >Feature sequence095 2066 78 gene locus_tag LOCUS_13600 2066 78 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138304587.1 protein_id gnl|my_center|LOCUS_13600 3114 2182 gene locus_tag LOCUS_13610 3114 2182 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963352.1 protein_id gnl|my_center|LOCUS_13610 3332 4609 gene locus_tag LOCUS_13620 3332 4609 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_13620 4614 5810 gene locus_tag LOCUS_13630 4614 5810 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948034.1 protein_id gnl|my_center|LOCUS_13630 6713 5970 gene locus_tag LOCUS_13640 6713 5970 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125581.1 protein_id gnl|my_center|LOCUS_13640 6929 7714 gene locus_tag LOCUS_13650 gene udp 6929 7714 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_13650 7721 8911 gene locus_tag LOCUS_13660 gene deoB 7721 8911 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046067.1 protein_id gnl|my_center|LOCUS_13660 8925 9575 gene locus_tag LOCUS_13670 gene deoC 8925 9575 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453154.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence096 190 456 gene locus_tag LOCUS_13680 190 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 1355 453 gene locus_tag LOCUS_13690 gene trxB 1355 453 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_13690 2792 1851 gene locus_tag LOCUS_13700 gene metA 2792 1851 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462040.1 protein_id gnl|my_center|LOCUS_13700 2990 4273 gene locus_tag LOCUS_13710 2990 4273 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_13710 6366 4384 gene locus_tag LOCUS_13720 gene ligA 6366 4384 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_13720 7348 6410 gene locus_tag LOCUS_13730 gene rluF 7348 6410 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162891890.1 protein_id gnl|my_center|LOCUS_13730 8479 7433 gene locus_tag LOCUS_13740 gene queA 8479 7433 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_13740 9478 8567 gene locus_tag LOCUS_13750 9478 8567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 9789 9718 gene locus_tag LOCUS_t00130 9789 9718 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence097 1785 232 gene locus_tag LOCUS_13760 1785 232 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233752.1 protein_id gnl|my_center|LOCUS_13760 1991 4681 gene locus_tag LOCUS_13770 1991 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 4738 5238 gene locus_tag LOCUS_13780 4738 5238 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_13780 6336 5473 gene locus_tag LOCUS_13790 6336 5473 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529173.1 protein_id gnl|my_center|LOCUS_13790 7090 6338 gene locus_tag LOCUS_13800 7090 6338 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027946.1 protein_id gnl|my_center|LOCUS_13800 7772 7095 gene locus_tag LOCUS_13810 7772 7095 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027947.1 protein_id gnl|my_center|LOCUS_13810 8061 8507 gene locus_tag LOCUS_13820 8061 8507 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243293.1 protein_id gnl|my_center|LOCUS_13820 9709 8504 gene locus_tag LOCUS_13830 9709 8504 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860903.1 protein_id gnl|my_center|LOCUS_13830 >Feature sequence098 1223 291 gene locus_tag LOCUS_13840 gene rfbN 1223 291 CDS product O antigen biosynthesis rhamnosyltransferase RfbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705149.1 protein_id gnl|my_center|LOCUS_13840 2530 1220 gene locus_tag LOCUS_13850 2530 1220 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922136.1 protein_id gnl|my_center|LOCUS_13850 3224 2535 gene locus_tag LOCUS_13860 3224 2535 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985169.1 protein_id gnl|my_center|LOCUS_13860 4206 3247 gene locus_tag LOCUS_13870 4206 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 5215 4199 gene locus_tag LOCUS_13880 5215 4199 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775198.1 protein_id gnl|my_center|LOCUS_13880 5360 6898 gene locus_tag LOCUS_13890 5360 6898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 9263 7086 gene locus_tag LOCUS_13900 9263 7086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 <10023 9260 gene locus_tag LOCUS_13910 <10023 9260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930970.1:MMPL family transporter >Feature sequence099 2231 972 gene locus_tag LOCUS_13920 2231 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 3195 2221 gene locus_tag LOCUS_13930 3195 2221 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965621.1 protein_id gnl|my_center|LOCUS_13930 4591 3206 gene locus_tag LOCUS_13940 gene gltA 4591 3206 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986285.1 protein_id gnl|my_center|LOCUS_13940 5481 4591 gene locus_tag LOCUS_13950 5481 4591 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896496.1 protein_id gnl|my_center|LOCUS_13950 6416 5526 gene locus_tag LOCUS_13960 6416 5526 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767778.1 protein_id gnl|my_center|LOCUS_13960 7009 6506 gene locus_tag LOCUS_13970 gene dfrA 7009 6506 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637205.1 protein_id gnl|my_center|LOCUS_13970 7764 7135 gene locus_tag LOCUS_13980 7764 7135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021681.1 protein_id gnl|my_center|LOCUS_13980 8624 8031 gene locus_tag LOCUS_13990 8624 8031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 9442 8621 gene locus_tag LOCUS_14000 gene yqeB 9442 8621 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393498.1 protein_id gnl|my_center|LOCUS_14000 <10012 9468 gene locus_tag LOCUS_14010 <10012 9468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393499.1:molybdenum cofactor cytidylyltransferase >Feature sequence100 79 1941 gene locus_tag LOCUS_14020 79 1941 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193735789.1 protein_id gnl|my_center|LOCUS_14020 2005 2526 gene locus_tag LOCUS_14030 2005 2526 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947935.1 protein_id gnl|my_center|LOCUS_14030 2710 3156 gene locus_tag LOCUS_14040 2710 3156 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048431.1 protein_id gnl|my_center|LOCUS_14040 3174 3740 gene locus_tag LOCUS_14050 3174 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 4153 3980 gene locus_tag LOCUS_14060 4153 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 5342 4155 gene locus_tag LOCUS_14070 5342 4155 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861090.1 protein_id gnl|my_center|LOCUS_14070 6736 5483 gene locus_tag LOCUS_14080 6736 5483 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861089.1 protein_id gnl|my_center|LOCUS_14080 7104 7712 gene locus_tag LOCUS_14090 7104 7712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14090 7749 8282 gene locus_tag LOCUS_14100 7749 8282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14100 9979 8594 gene locus_tag LOCUS_14110 9979 8594 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949006.1 protein_id gnl|my_center|LOCUS_14110 >Feature sequence101 <1 861 gene locus_tag LOCUS_14120 <1 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015943626.1:aryl-sulfate sulfotransferase 1068 1388 gene locus_tag LOCUS_14130 1068 1388 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214503.1 protein_id gnl|my_center|LOCUS_14130 2955 1525 gene locus_tag LOCUS_14140 2955 1525 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533356.1 protein_id gnl|my_center|LOCUS_14140 3142 4026 gene locus_tag LOCUS_14150 3142 4026 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948703.1 protein_id gnl|my_center|LOCUS_14150 4159 6696 gene locus_tag LOCUS_14160 4159 6696 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861274.1 protein_id gnl|my_center|LOCUS_14160 6920 8377 gene locus_tag LOCUS_14170 6920 8377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 8514 8732 gene locus_tag LOCUS_14180 8514 8732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 8850 9467 gene locus_tag LOCUS_14190 8850 9467 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305518.1 protein_id gnl|my_center|LOCUS_14190 >Feature sequence102 1988 810 gene locus_tag LOCUS_14200 1988 810 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095789.1 protein_id gnl|my_center|LOCUS_14200 2662 2054 gene locus_tag LOCUS_14210 2662 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 3973 2756 gene locus_tag LOCUS_14220 3973 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 4184 5410 gene locus_tag LOCUS_14230 4184 5410 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682078.1 protein_id gnl|my_center|LOCUS_14230 5440 6633 gene locus_tag LOCUS_14240 5440 6633 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356229.1 protein_id gnl|my_center|LOCUS_14240 6649 7827 gene locus_tag LOCUS_14250 6649 7827 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068831.1 protein_id gnl|my_center|LOCUS_14250 8017 8637 gene locus_tag LOCUS_14260 8017 8637 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831568.1 protein_id gnl|my_center|LOCUS_14260 >Feature sequence103 <1 677 gene locus_tag LOCUS_14270 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943991.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB 738 1373 gene locus_tag LOCUS_14280 gene sigK 738 1373 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047887.1 protein_id gnl|my_center|LOCUS_14280 1370 2323 gene locus_tag LOCUS_14290 1370 2323 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814288.1 protein_id gnl|my_center|LOCUS_14290 2992 2426 gene locus_tag LOCUS_14300 2992 2426 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860666.1 protein_id gnl|my_center|LOCUS_14300 3723 2989 gene locus_tag LOCUS_14310 3723 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 4137 5015 gene locus_tag LOCUS_14320 4137 5015 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943443.1 protein_id gnl|my_center|LOCUS_14320 5216 6178 gene locus_tag LOCUS_14330 5216 6178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 6178 6966 gene locus_tag LOCUS_14340 6178 6966 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016780.1 protein_id gnl|my_center|LOCUS_14340 7348 8298 gene locus_tag LOCUS_14350 7348 8298 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_14350 >Feature sequence104 5 374 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tcttcaatccactcccctctcacgaggggagac 1077 763 gene locus_tag LOCUS_14360 1077 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 2992 1835 gene locus_tag LOCUS_14370 gene rlmD 2992 1835 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105059.1 protein_id gnl|my_center|LOCUS_14370 3135 2989 gene locus_tag LOCUS_14380 3135 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 3244 3831 gene locus_tag LOCUS_14390 3244 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 6059 4038 gene locus_tag LOCUS_14400 6059 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 7115 6096 gene locus_tag LOCUS_14410 7115 6096 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387687.1 protein_id gnl|my_center|LOCUS_14410 8280 7366 gene locus_tag LOCUS_14420 gene murQ 8280 7366 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355340.1 protein_id gnl|my_center|LOCUS_14420 9157 8294 gene locus_tag LOCUS_14430 9157 8294 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003585938.1 protein_id gnl|my_center|LOCUS_14430 <9853 9195 gene locus_tag LOCUS_14440 <9853 9195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002355337.1:PTS sugar transporter subunit IIB >Feature sequence105 1864 326 gene locus_tag LOCUS_14450 gene gatA 1864 326 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_14450 2169 1876 gene locus_tag LOCUS_14460 gene gatC 2169 1876 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_14460 3510 2182 gene locus_tag LOCUS_14470 gene aspS 3510 2182 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948698.1 protein_id gnl|my_center|LOCUS_14470 5384 4176 gene locus_tag LOCUS_14480 5384 4176 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_14480 6049 5396 gene locus_tag LOCUS_14490 6049 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 7357 6074 gene locus_tag LOCUS_14500 gene glnA 7357 6074 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807771.1 protein_id gnl|my_center|LOCUS_14500 9107 7347 gene locus_tag LOCUS_14510 9107 7347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 <9853 9111 gene locus_tag LOCUS_14520 <9853 9111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005807931.1:glutamate synthase large subunit >Feature sequence106 162 1067 gene locus_tag LOCUS_14530 gene ispE 162 1067 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772094.1 protein_id gnl|my_center|LOCUS_14530 1057 1737 gene locus_tag LOCUS_14540 1057 1737 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_14540 1734 1931 gene locus_tag LOCUS_14550 1734 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 2281 2859 gene locus_tag LOCUS_14560 2281 2859 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287269.1 protein_id gnl|my_center|LOCUS_14560 2871 3968 gene locus_tag LOCUS_14570 2871 3968 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531050.1 protein_id gnl|my_center|LOCUS_14570 3984 7025 gene locus_tag LOCUS_14580 3984 7025 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861545.1 protein_id gnl|my_center|LOCUS_14580 7038 8210 gene locus_tag LOCUS_14590 7038 8210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 8225 9400 gene locus_tag LOCUS_14600 8225 9400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 >Feature sequence107 1047 1277 gene locus_tag LOCUS_14610 1047 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 2561 1524 gene locus_tag LOCUS_14620 gene yjfF 2561 1524 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226243.1 protein_id gnl|my_center|LOCUS_14620 3606 2563 gene locus_tag LOCUS_14630 3606 2563 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226242.1 protein_id gnl|my_center|LOCUS_14630 5120 3603 gene locus_tag LOCUS_14640 5120 3603 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467107.1 protein_id gnl|my_center|LOCUS_14640 6322 5255 gene locus_tag LOCUS_14650 6322 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 6727 7809 gene locus_tag LOCUS_14660 6727 7809 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102220.1 protein_id gnl|my_center|LOCUS_14660 9440 7824 gene locus_tag LOCUS_14670 9440 7824 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288004.1 protein_id gnl|my_center|LOCUS_14670 9788 9456 gene locus_tag LOCUS_14680 9788 9456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 >Feature sequence108 481 553 gene locus_tag LOCUS_t00140 481 553 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 693 1625 gene locus_tag LOCUS_14690 693 1625 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674999.1 protein_id gnl|my_center|LOCUS_14690 2031 2744 gene locus_tag LOCUS_14700 2031 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 3131 3430 gene locus_tag LOCUS_14710 3131 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 3512 5695 gene locus_tag LOCUS_14720 3512 5695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 6262 6573 gene locus_tag LOCUS_14730 6262 6573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 6578 7642 gene locus_tag LOCUS_14740 6578 7642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 7639 9585 gene locus_tag LOCUS_14750 7639 9585 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_14750 >Feature sequence109 680 2077 gene locus_tag LOCUS_14760 680 2077 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966488.1 protein_id gnl|my_center|LOCUS_14760 2112 3299 gene locus_tag LOCUS_14770 2112 3299 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066054433.1 protein_id gnl|my_center|LOCUS_14770 4793 3393 gene locus_tag LOCUS_14780 gene nhaC 4793 3393 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903314.1 protein_id gnl|my_center|LOCUS_14780 5020 4790 gene locus_tag LOCUS_14790 5020 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 5927 5175 gene locus_tag LOCUS_14800 5927 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 8567 5955 gene locus_tag LOCUS_14810 gene adhE 8567 5955 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861762.1 protein_id gnl|my_center|LOCUS_14810 8943 9134 gene locus_tag LOCUS_14820 8943 9134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 9176 9655 gene locus_tag LOCUS_14830 9176 9655 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_14830 >Feature sequence110 1070 240 gene locus_tag LOCUS_14840 1070 240 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815800.1 protein_id gnl|my_center|LOCUS_14840 1827 1051 gene locus_tag LOCUS_14850 1827 1051 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461079.1 protein_id gnl|my_center|LOCUS_14850 2370 3278 gene locus_tag LOCUS_14860 2370 3278 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754393.1 protein_id gnl|my_center|LOCUS_14860 3417 4355 gene locus_tag LOCUS_14870 gene pstC 3417 4355 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454007.1 protein_id gnl|my_center|LOCUS_14870 4471 5373 gene locus_tag LOCUS_14880 gene pstA 4471 5373 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001912363.1 protein_id gnl|my_center|LOCUS_14880 5488 6243 gene locus_tag LOCUS_14890 gene pstB 5488 6243 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965015.1 protein_id gnl|my_center|LOCUS_14890 6255 6917 gene locus_tag LOCUS_14900 gene phoU 6255 6917 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965016.1 protein_id gnl|my_center|LOCUS_14900 6946 7620 gene locus_tag LOCUS_14910 6946 7620 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_14910 7617 8972 gene locus_tag LOCUS_14920 7617 8972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 >Feature sequence111 41 886 gene locus_tag LOCUS_14930 gene larE 41 886 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584116.1 protein_id gnl|my_center|LOCUS_14930 930 1424 gene locus_tag LOCUS_14940 930 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 2078 2344 gene locus_tag LOCUS_14950 gene rpsO 2078 2344 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419491.1 protein_id gnl|my_center|LOCUS_14950 2588 4693 gene locus_tag LOCUS_14960 gene pnp 2588 4693 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_14960 4876 5991 gene locus_tag LOCUS_14970 4876 5991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 5988 6800 gene locus_tag LOCUS_14980 5988 6800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 6778 7704 gene locus_tag LOCUS_14990 6778 7704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 >Feature sequence112 4231 3161 gene locus_tag LOCUS_15000 gene ispG 4231 3161 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861462.1 protein_id gnl|my_center|LOCUS_15000 5335 4277 gene locus_tag LOCUS_15010 gene rseP 5335 4277 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965102.1 protein_id gnl|my_center|LOCUS_15010 6479 5337 gene locus_tag LOCUS_15020 gene dxr 6479 5337 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790373.1 protein_id gnl|my_center|LOCUS_15020 7333 6521 gene locus_tag LOCUS_15030 7333 6521 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384675.1 protein_id gnl|my_center|LOCUS_15030 8078 7353 gene locus_tag LOCUS_15040 8078 7353 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_15040 8721 8164 gene locus_tag LOCUS_15050 gene frr 8721 8164 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986799.1 protein_id gnl|my_center|LOCUS_15050 9435 8734 gene locus_tag LOCUS_15060 gene pyrH 9435 8734 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence113 1444 1130 gene locus_tag LOCUS_15070 1444 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 3615 1681 gene locus_tag LOCUS_15080 gene thrS 3615 1681 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888359.1 protein_id gnl|my_center|LOCUS_15080 5091 4162 gene locus_tag LOCUS_15090 5091 4162 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644751.1 protein_id gnl|my_center|LOCUS_15090 6086 5325 gene locus_tag LOCUS_15100 6086 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 6375 6199 gene locus_tag LOCUS_15110 6375 6199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 7472 6489 gene locus_tag LOCUS_15120 7472 6489 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042144000.1 protein_id gnl|my_center|LOCUS_15120 8957 8196 gene locus_tag LOCUS_15130 gene yaaA 8957 8196 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458998.1 protein_id gnl|my_center|LOCUS_15130 >Feature sequence114 236 4000 gene locus_tag LOCUS_15140 236 4000 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_15140 4279 4596 gene locus_tag LOCUS_15150 4279 4596 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669619.1 protein_id gnl|my_center|LOCUS_15150 4596 5345 gene locus_tag LOCUS_15160 4596 5345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 5342 6217 gene locus_tag LOCUS_15170 5342 6217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 6231 6416 gene locus_tag LOCUS_15180 6231 6416 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965947.1 protein_id gnl|my_center|LOCUS_15180 6579 6797 gene locus_tag LOCUS_15190 6579 6797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 7327 6914 gene locus_tag LOCUS_15200 7327 6914 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814887.1 protein_id gnl|my_center|LOCUS_15200 7538 7311 gene locus_tag LOCUS_15210 7538 7311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 8597 7899 gene locus_tag LOCUS_15220 8597 7899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 >Feature sequence115 3122 1029 gene locus_tag LOCUS_15230 3122 1029 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461804.1 protein_id gnl|my_center|LOCUS_15230 3863 5494 gene locus_tag LOCUS_15240 3863 5494 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947977.1 protein_id gnl|my_center|LOCUS_15240 >Feature sequence116 <1 941 gene locus_tag LOCUS_15250 <1 941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051462.1:type II CAAX endopeptidase family protein 951 1511 gene locus_tag LOCUS_15260 951 1511 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816608.1 protein_id gnl|my_center|LOCUS_15260 1524 2219 gene locus_tag LOCUS_15270 1524 2219 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080979.1 protein_id gnl|my_center|LOCUS_15270 2582 3730 gene locus_tag LOCUS_15280 gene fucO 2582 3730 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766959.1 protein_id gnl|my_center|LOCUS_15280 4593 3820 gene locus_tag LOCUS_15290 4593 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 4859 5872 gene locus_tag LOCUS_15300 4859 5872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 5945 6349 gene locus_tag LOCUS_15310 5945 6349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 6431 7831 gene locus_tag LOCUS_15320 6431 7831 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964065.1 protein_id gnl|my_center|LOCUS_15320 7871 9115 gene locus_tag LOCUS_15330 7871 9115 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_15330 >Feature sequence117 492 731 gene locus_tag LOCUS_15340 492 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 2737 797 gene locus_tag LOCUS_15350 2737 797 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458920.1 protein_id gnl|my_center|LOCUS_15350 3274 2999 gene locus_tag LOCUS_15360 3274 2999 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458924.1 protein_id gnl|my_center|LOCUS_15360 3906 3430 gene locus_tag LOCUS_15370 3906 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 4919 3996 gene locus_tag LOCUS_15380 gene pfkB 4919 3996 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986316.1 protein_id gnl|my_center|LOCUS_15380 6463 5060 gene locus_tag LOCUS_15390 6463 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 7577 6453 gene locus_tag LOCUS_15400 7577 6453 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233927.1 protein_id gnl|my_center|LOCUS_15400 8071 7574 gene locus_tag LOCUS_15410 gene ybeY 8071 7574 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964605.1 protein_id gnl|my_center|LOCUS_15410 9071 8055 gene locus_tag LOCUS_15420 9071 8055 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_15420 >Feature sequence118 830 4393 gene locus_tag LOCUS_15430 830 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 4416 5639 gene locus_tag LOCUS_15440 4416 5639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 5636 6451 gene locus_tag LOCUS_15450 5636 6451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 6892 7053 gene locus_tag LOCUS_15460 6892 7053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 7191 8849 gene locus_tag LOCUS_15470 gene ilvD 7191 8849 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_15470 >Feature sequence119 1595 237 gene locus_tag LOCUS_15480 1595 237 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_15480 1995 1819 gene locus_tag LOCUS_15490 1995 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 2141 4246 gene locus_tag LOCUS_15500 gene ftsH 2141 4246 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963922.1 protein_id gnl|my_center|LOCUS_15500 4423 5517 gene locus_tag LOCUS_15510 4423 5517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 7277 5799 gene locus_tag LOCUS_15520 7277 5799 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_15520 7588 8295 gene locus_tag LOCUS_15530 7588 8295 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814285.1 protein_id gnl|my_center|LOCUS_15530 8315 9067 gene locus_tag LOCUS_15540 8315 9067 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048407.1 protein_id gnl|my_center|LOCUS_15540 >Feature sequence120 183 1172 gene locus_tag LOCUS_15550 183 1172 CDS product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435878.1 protein_id gnl|my_center|LOCUS_15550 1176 2081 gene locus_tag LOCUS_15560 1176 2081 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963624.1 protein_id gnl|my_center|LOCUS_15560 2078 2815 gene locus_tag LOCUS_15570 2078 2815 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_15570 2864 3718 gene locus_tag LOCUS_15580 gene rsmI 2864 3718 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435873.1 protein_id gnl|my_center|LOCUS_15580 4155 6347 gene locus_tag LOCUS_15590 gene ptsG 4155 6347 CDS product PTS glucose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473200.1 protein_id gnl|my_center|LOCUS_15590 6370 7194 gene locus_tag LOCUS_15600 6370 7194 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987040.1 protein_id gnl|my_center|LOCUS_15600 7536 7288 gene locus_tag LOCUS_15610 7536 7288 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428433.1 protein_id gnl|my_center|LOCUS_15610 7892 8584 gene locus_tag LOCUS_15620 7892 8584 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965416.1 protein_id gnl|my_center|LOCUS_15620 9160 8651 gene locus_tag LOCUS_15630 9160 8651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence121 757 2502 gene locus_tag LOCUS_15640 757 2502 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082593.1 protein_id gnl|my_center|LOCUS_15640 3195 2707 gene locus_tag LOCUS_15650 3195 2707 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357508.1 protein_id gnl|my_center|LOCUS_15650 3426 3611 gene locus_tag LOCUS_15660 3426 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 4107 3916 gene locus_tag LOCUS_15670 4107 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 4328 5905 gene locus_tag LOCUS_15680 4328 5905 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001793440.1 protein_id gnl|my_center|LOCUS_15680 5915 7282 gene locus_tag LOCUS_15690 5915 7282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 7969 7418 gene locus_tag LOCUS_15700 7969 7418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 8955 8158 gene locus_tag LOCUS_15710 8955 8158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 9162 9090 gene locus_tag LOCUS_t00150 9162 9090 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence122 1935 1165 gene locus_tag LOCUS_15720 1935 1165 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_15720 2048 2698 gene locus_tag LOCUS_15730 2048 2698 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964200.1 protein_id gnl|my_center|LOCUS_15730 3822 2752 gene locus_tag LOCUS_15740 3822 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 5687 4122 gene locus_tag LOCUS_15750 5687 4122 CDS product DUF3794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966186.1 protein_id gnl|my_center|LOCUS_15750 6620 5745 gene locus_tag LOCUS_15760 6620 5745 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416734.1 protein_id gnl|my_center|LOCUS_15760 6981 7133 gene locus_tag LOCUS_15770 6981 7133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 7617 7189 gene locus_tag LOCUS_15780 7617 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 8979 8047 gene locus_tag LOCUS_15790 8979 8047 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767297.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence123 228 425 gene locus_tag LOCUS_15800 228 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 451 3426 gene locus_tag LOCUS_15810 451 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 3440 3817 gene locus_tag LOCUS_15820 3440 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 3817 6072 gene locus_tag LOCUS_15830 3817 6072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 6032 6433 gene locus_tag LOCUS_15840 6032 6433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 6433 6882 gene locus_tag LOCUS_15850 6433 6882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 6886 7770 gene locus_tag LOCUS_15860 6886 7770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 7786 8544 gene locus_tag LOCUS_15870 7786 8544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 8546 8830 gene locus_tag LOCUS_15880 8546 8830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 >Feature sequence124 2058 391 gene locus_tag LOCUS_15890 2058 391 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_15890 2516 3220 gene locus_tag LOCUS_15900 2516 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 3828 3382 gene locus_tag LOCUS_15910 3828 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 5709 3850 gene locus_tag LOCUS_15920 5709 3850 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459544.1 protein_id gnl|my_center|LOCUS_15920 7436 5709 gene locus_tag LOCUS_15930 7436 5709 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_15930 7611 7696 gene locus_tag LOCUS_t00160 7611 7696 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7701 7786 gene locus_tag LOCUS_t00170 7701 7786 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8834 7962 gene locus_tag LOCUS_15940 8834 7962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 >Feature sequence125 699 424 gene locus_tag LOCUS_15950 gene spoIIID 699 424 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420727.1 protein_id gnl|my_center|LOCUS_15950 1551 796 gene locus_tag LOCUS_15960 1551 796 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681808.1 protein_id gnl|my_center|LOCUS_15960 2407 1691 gene locus_tag LOCUS_15970 2407 1691 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016357.1 protein_id gnl|my_center|LOCUS_15970 2772 3134 gene locus_tag LOCUS_15980 2772 3134 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391916.1 protein_id gnl|my_center|LOCUS_15980 4522 3281 gene locus_tag LOCUS_15990 4522 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 4446 4838 gene locus_tag LOCUS_16000 4446 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 5168 4809 gene locus_tag LOCUS_16010 5168 4809 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888340.1 protein_id gnl|my_center|LOCUS_16010 5925 5383 gene locus_tag LOCUS_16020 5925 5383 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948277.1 protein_id gnl|my_center|LOCUS_16020 6484 5906 gene locus_tag LOCUS_16030 6484 5906 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016599.1 protein_id gnl|my_center|LOCUS_16030 6807 6989 gene locus_tag LOCUS_16040 6807 6989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 7545 8933 gene locus_tag LOCUS_16050 7545 8933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 >Feature sequence126 1389 295 gene locus_tag LOCUS_16060 1389 295 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947980.1 protein_id gnl|my_center|LOCUS_16060 1857 1648 gene locus_tag LOCUS_16070 gene rpmE 1857 1648 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_16070 3648 1984 gene locus_tag LOCUS_16080 gene rho 3648 1984 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898714.1 protein_id gnl|my_center|LOCUS_16080 5033 3726 gene locus_tag LOCUS_16090 5033 3726 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356440.1 protein_id gnl|my_center|LOCUS_16090 6364 5030 gene locus_tag LOCUS_16100 6364 5030 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403748.1 protein_id gnl|my_center|LOCUS_16100 7059 6379 gene locus_tag LOCUS_16110 7059 6379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 7279 8151 gene locus_tag LOCUS_16120 7279 8151 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438030.1 protein_id gnl|my_center|LOCUS_16120 8380 8293 gene locus_tag LOCUS_t00180 8380 8293 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8500 8417 gene locus_tag LOCUS_t00190 8500 8417 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 8879 8685 gene locus_tag LOCUS_16130 8879 8685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 >Feature sequence127 541 1929 gene locus_tag LOCUS_16140 gene radA 541 1929 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_16140 1945 2850 gene locus_tag LOCUS_16150 1945 2850 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920971.1 protein_id gnl|my_center|LOCUS_16150 3294 4211 gene locus_tag LOCUS_16160 3294 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 4231 5529 gene locus_tag LOCUS_16170 4231 5529 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433394.1 protein_id gnl|my_center|LOCUS_16170 6155 6472 gene locus_tag LOCUS_16180 6155 6472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 6498 7865 gene locus_tag LOCUS_16190 6498 7865 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107748.1 protein_id gnl|my_center|LOCUS_16190 7843 8532 gene locus_tag LOCUS_16200 7843 8532 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358908.1 protein_id gnl|my_center|LOCUS_16200 >Feature sequence128 2170 1190 gene locus_tag LOCUS_16210 2170 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 3614 2646 gene locus_tag LOCUS_16220 3614 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 5519 3651 gene locus_tag LOCUS_16230 5519 3651 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957058.1 protein_id gnl|my_center|LOCUS_16230 6489 5563 gene locus_tag LOCUS_16240 6489 5563 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_16240 7325 6675 gene locus_tag LOCUS_16250 7325 6675 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577796.1 protein_id gnl|my_center|LOCUS_16250 <8791 7861 gene locus_tag LOCUS_16260 <8791 7861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460082.1:glycerate kinase >Feature sequence129 315 1013 gene locus_tag LOCUS_16270 315 1013 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906063.1 protein_id gnl|my_center|LOCUS_16270 1066 2502 gene locus_tag LOCUS_16280 1066 2502 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948739.1 protein_id gnl|my_center|LOCUS_16280 2514 3785 gene locus_tag LOCUS_16290 2514 3785 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948740.1 protein_id gnl|my_center|LOCUS_16290 3787 4155 gene locus_tag LOCUS_16300 3787 4155 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399582.1 protein_id gnl|my_center|LOCUS_16300 4278 5006 gene locus_tag LOCUS_16310 4278 5006 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682266.1 protein_id gnl|my_center|LOCUS_16310 5039 5566 gene locus_tag LOCUS_16320 5039 5566 CDS product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130256.1 protein_id gnl|my_center|LOCUS_16320 5942 7759 gene locus_tag LOCUS_16330 5942 7759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 >Feature sequence130 1836 745 gene locus_tag LOCUS_16340 gene phnW 1836 745 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002326249.1 protein_id gnl|my_center|LOCUS_16340 2915 1923 gene locus_tag LOCUS_16350 2915 1923 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974157.1 protein_id gnl|my_center|LOCUS_16350 4545 2827 gene locus_tag LOCUS_16360 4545 2827 CDS product putative 2-aminoethylphosphonate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861730.1 protein_id gnl|my_center|LOCUS_16360 5319 4549 gene locus_tag LOCUS_16370 5319 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 7161 5566 gene locus_tag LOCUS_16380 7161 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 7411 8058 gene locus_tag LOCUS_16390 gene trmB 7411 8058 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239380.1 protein_id gnl|my_center|LOCUS_16390 8283 8603 gene locus_tag LOCUS_16400 gene trxA 8283 8603 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393175.1 protein_id gnl|my_center|LOCUS_16400 >Feature sequence131 4648 383 gene locus_tag LOCUS_16410 4648 383 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484061.1 protein_id gnl|my_center|LOCUS_16410 4764 5018 gene locus_tag LOCUS_16420 4764 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 5076 6017 gene locus_tag LOCUS_16430 5076 6017 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054371.1 protein_id gnl|my_center|LOCUS_16430 6056 6880 gene locus_tag LOCUS_16440 6056 6880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 6994 8433 gene locus_tag LOCUS_16450 gene pyk 6994 8433 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence132 1291 170 gene locus_tag LOCUS_16460 1291 170 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891610.1 protein_id gnl|my_center|LOCUS_16460 1753 1316 gene locus_tag LOCUS_16470 1753 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 2721 2083 gene locus_tag LOCUS_16480 gene yihA 2721 2083 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891775.1 protein_id gnl|my_center|LOCUS_16480 5053 2741 gene locus_tag LOCUS_16490 gene lon 5053 2741 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435613.1 protein_id gnl|my_center|LOCUS_16490 6484 5186 gene locus_tag LOCUS_16500 gene clpX 6484 5186 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_16500 7100 6519 gene locus_tag LOCUS_16510 gene clpP 7100 6519 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965928.1 protein_id gnl|my_center|LOCUS_16510 8453 7167 gene locus_tag LOCUS_16520 gene tig 8453 7167 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105215.1 protein_id gnl|my_center|LOCUS_16520 >Feature sequence133 343 68 gene locus_tag LOCUS_16530 343 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 1530 388 gene locus_tag LOCUS_16540 gene tgt 1530 388 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_16540 3701 1530 gene locus_tag LOCUS_16550 gene secDF 3701 1530 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245970.1 protein_id gnl|my_center|LOCUS_16550 5330 3930 gene locus_tag LOCUS_16560 gene scfB 5330 3930 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_16560 5652 5506 gene locus_tag LOCUS_16570 gene scfA 5652 5506 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_16570 5799 6158 gene locus_tag LOCUS_16580 5799 6158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 7660 6368 gene locus_tag LOCUS_16590 7660 6368 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_16590 8192 7770 gene locus_tag LOCUS_16600 8192 7770 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086294.1 protein_id gnl|my_center|LOCUS_16600 >Feature sequence134 <1 632 gene locus_tag LOCUS_16610 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009930809.1:HAD family hydrolase 890 1228 gene locus_tag LOCUS_16620 890 1228 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943036.1 protein_id gnl|my_center|LOCUS_16620 1269 2444 gene locus_tag LOCUS_16630 1269 2444 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436463.1 protein_id gnl|my_center|LOCUS_16630 2485 2877 gene locus_tag LOCUS_16640 2485 2877 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948047.1 protein_id gnl|my_center|LOCUS_16640 3419 3006 gene locus_tag LOCUS_16650 3419 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 4641 3421 gene locus_tag LOCUS_16660 4641 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 4714 5412 gene locus_tag LOCUS_16670 4714 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 6350 5460 gene locus_tag LOCUS_16680 6350 5460 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869315.1 protein_id gnl|my_center|LOCUS_16680 7389 6352 gene locus_tag LOCUS_16690 7389 6352 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969292.1 protein_id gnl|my_center|LOCUS_16690 <8628 7374 gene locus_tag LOCUS_16700 <8628 7374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010865052.1:ABC transporter ATP-binding protein >Feature sequence135 1353 13 gene locus_tag LOCUS_16710 1353 13 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861590.1 protein_id gnl|my_center|LOCUS_16710 2663 1350 gene locus_tag LOCUS_16720 2663 1350 CDS product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861591.1 protein_id gnl|my_center|LOCUS_16720 3620 2952 gene locus_tag LOCUS_16730 3620 2952 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939481.1 protein_id gnl|my_center|LOCUS_16730 4133 3651 gene locus_tag LOCUS_16740 gene greA 4133 3651 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966474.1 protein_id gnl|my_center|LOCUS_16740 5299 4316 gene locus_tag LOCUS_16750 gene dusB 5299 4316 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_16750 5653 5303 gene locus_tag LOCUS_16760 5653 5303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 6622 5864 gene locus_tag LOCUS_16770 6622 5864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 6864 6610 gene locus_tag LOCUS_16780 6864 6610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 7589 6861 gene locus_tag LOCUS_16790 7589 6861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 7943 7665 gene locus_tag LOCUS_16800 7943 7665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 8243 7971 gene locus_tag LOCUS_16810 8243 7971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 8555 8265 gene locus_tag LOCUS_16820 8555 8265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 >Feature sequence136 <1 575 gene locus_tag LOCUS_16830 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760641.1:FGGY-family carbohydrate kinase 590 1282 gene locus_tag LOCUS_16840 590 1282 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262722.1 protein_id gnl|my_center|LOCUS_16840 1298 1951 gene locus_tag LOCUS_16850 gene fsa 1298 1951 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722103.1 protein_id gnl|my_center|LOCUS_16850 2196 3104 gene locus_tag LOCUS_16860 2196 3104 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946804.1 protein_id gnl|my_center|LOCUS_16860 4788 3457 gene locus_tag LOCUS_16870 4788 3457 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902958.1 protein_id gnl|my_center|LOCUS_16870 5327 4824 gene locus_tag LOCUS_16880 5327 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 5484 5714 gene locus_tag LOCUS_16890 5484 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 5743 6264 gene locus_tag LOCUS_16900 5743 6264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 7249 6233 gene locus_tag LOCUS_16910 7249 6233 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966656.1 protein_id gnl|my_center|LOCUS_16910 <8512 7261 gene locus_tag LOCUS_16920 <8512 7261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966655.1:WYL domain-containing protein >Feature sequence137 88 1038 gene locus_tag LOCUS_16930 88 1038 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922785.1 protein_id gnl|my_center|LOCUS_16930 2378 1170 gene locus_tag LOCUS_16940 2378 1170 CDS product DUF401 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941677.1 protein_id gnl|my_center|LOCUS_16940 2745 3368 gene locus_tag LOCUS_16950 gene dhaL 2745 3368 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015008606.1 protein_id gnl|my_center|LOCUS_16950 3449 4447 gene locus_tag LOCUS_16960 gene dhaK 3449 4447 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728174.1 protein_id gnl|my_center|LOCUS_16960 4484 4804 gene locus_tag LOCUS_16970 4484 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 4817 5659 gene locus_tag LOCUS_16980 4817 5659 CDS product ketose 1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418474.1 protein_id gnl|my_center|LOCUS_16980 5904 7181 gene locus_tag LOCUS_16990 5904 7181 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439092.1 protein_id gnl|my_center|LOCUS_16990 7178 7864 gene locus_tag LOCUS_17000 7178 7864 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760196.1 protein_id gnl|my_center|LOCUS_17000 >Feature sequence138 921 2354 gene locus_tag LOCUS_17010 gene proS 921 2354 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450718.1 protein_id gnl|my_center|LOCUS_17010 2354 3562 gene locus_tag LOCUS_17020 2354 3562 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_17020 3647 4627 gene locus_tag LOCUS_17030 3647 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 4820 6556 gene locus_tag LOCUS_17040 4820 6556 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396540.1 protein_id gnl|my_center|LOCUS_17040 6738 7766 gene locus_tag LOCUS_17050 6738 7766 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245573.1 protein_id gnl|my_center|LOCUS_17050 8031 8396 gene locus_tag LOCUS_17060 8031 8396 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814133.1 protein_id gnl|my_center|LOCUS_17060 >Feature sequence139 1105 182 gene locus_tag LOCUS_17070 1105 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 1446 2105 gene locus_tag LOCUS_17080 1446 2105 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211145.1 protein_id gnl|my_center|LOCUS_17080 2139 2672 gene locus_tag LOCUS_17090 2139 2672 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_17090 3834 2857 gene locus_tag LOCUS_17100 3834 2857 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227377.1 protein_id gnl|my_center|LOCUS_17100 5107 3851 gene locus_tag LOCUS_17110 5107 3851 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888596.1 protein_id gnl|my_center|LOCUS_17110 5526 6575 gene locus_tag LOCUS_17120 5526 6575 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194770.1 protein_id gnl|my_center|LOCUS_17120 7446 6718 gene locus_tag LOCUS_17130 7446 6718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 8426 7473 gene locus_tag LOCUS_17140 8426 7473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 >Feature sequence140 2604 1783 gene locus_tag LOCUS_17150 2604 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 3821 2793 gene locus_tag LOCUS_17160 3821 2793 CDS product NrtA/SsuA/CpmA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429089.1 protein_id gnl|my_center|LOCUS_17160 4600 3818 gene locus_tag LOCUS_17170 4600 3818 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893083.1 protein_id gnl|my_center|LOCUS_17170 5354 4587 gene locus_tag LOCUS_17180 5354 4587 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896415.1 protein_id gnl|my_center|LOCUS_17180 6340 5351 gene locus_tag LOCUS_17190 6340 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 5739 5835 gene locus_tag LOCUS_t00200 5739 5835 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8024 6564 gene locus_tag LOCUS_17200 8024 6564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence141 1042 80 gene locus_tag LOCUS_17210 1042 80 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573417.1 protein_id gnl|my_center|LOCUS_17210 2531 1029 gene locus_tag LOCUS_17220 2531 1029 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582804.1 protein_id gnl|my_center|LOCUS_17220 3617 2607 gene locus_tag LOCUS_17230 3617 2607 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765644.1 protein_id gnl|my_center|LOCUS_17230 4617 3709 gene locus_tag LOCUS_17240 gene araH 4617 3709 CDS product L-arabinose ABC transporter permease AraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096046.1 protein_id gnl|my_center|LOCUS_17240 6029 4614 gene locus_tag LOCUS_17250 6029 4614 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082693.1 protein_id gnl|my_center|LOCUS_17250 6835 6026 gene locus_tag LOCUS_17260 6835 6026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 <8315 6848 gene locus_tag LOCUS_17270 <8315 6848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002304851.1:response regulator transcription factor >Feature sequence142 207 455 gene locus_tag LOCUS_17280 207 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 605 2260 gene locus_tag LOCUS_17290 605 2260 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461751.1 protein_id gnl|my_center|LOCUS_17290 2287 3546 gene locus_tag LOCUS_17300 gene leuC 2287 3546 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895941.1 protein_id gnl|my_center|LOCUS_17300 3584 4066 gene locus_tag LOCUS_17310 gene leuD 3584 4066 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_17310 4080 5150 gene locus_tag LOCUS_17320 gene leuB 4080 5150 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057439.1 protein_id gnl|my_center|LOCUS_17320 5272 6651 gene locus_tag LOCUS_17330 gene htrA 5272 6651 CDS product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967069.1 protein_id gnl|my_center|LOCUS_17330 7058 7576 gene locus_tag LOCUS_17340 gene thiW 7058 7576 CDS product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829480.1 protein_id gnl|my_center|LOCUS_17340 >Feature sequence143 3 200 gene locus_tag LOCUS_17350 3 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 2321 399 gene locus_tag LOCUS_17360 2321 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 3070 2336 gene locus_tag LOCUS_17370 3070 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 3320 3051 gene locus_tag LOCUS_17380 3320 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 4661 3396 gene locus_tag LOCUS_17390 4661 3396 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888596.1 protein_id gnl|my_center|LOCUS_17390 5859 4705 gene locus_tag LOCUS_17400 5859 4705 CDS product 2-methylaconitate cis-trans isomerase PrpF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967865.1 protein_id gnl|my_center|LOCUS_17400 6342 7307 gene locus_tag LOCUS_17410 6342 7307 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964364.1 protein_id gnl|my_center|LOCUS_17410 >Feature sequence144 1412 579 gene locus_tag LOCUS_17420 1412 579 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860782.1 protein_id gnl|my_center|LOCUS_17420 2113 1409 gene locus_tag LOCUS_17430 2113 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 2880 3473 gene locus_tag LOCUS_17440 2880 3473 CDS product Abortive infection protein AbiEi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072726816.1 protein_id gnl|my_center|LOCUS_17440 3470 4294 gene locus_tag LOCUS_17450 3470 4294 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287519.1 protein_id gnl|my_center|LOCUS_17450 4393 4974 gene locus_tag LOCUS_17460 4393 4974 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016017.1 protein_id gnl|my_center|LOCUS_17460 5102 5752 gene locus_tag LOCUS_17470 5102 5752 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227979.1 protein_id gnl|my_center|LOCUS_17470 5799 6218 gene locus_tag LOCUS_17480 gene mscL 5799 6218 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814614.1 protein_id gnl|my_center|LOCUS_17480 >Feature sequence145 275 1348 gene locus_tag LOCUS_17490 275 1348 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723080.1 protein_id gnl|my_center|LOCUS_17490 1348 4557 gene locus_tag LOCUS_17500 gene carB 1348 4557 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_17500 5044 5679 gene locus_tag LOCUS_17510 gene nth 5044 5679 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198142832.1 protein_id gnl|my_center|LOCUS_17510 5658 5795 gene locus_tag LOCUS_17520 5658 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 5852 7786 gene locus_tag LOCUS_17530 gene lysS 5852 7786 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048371.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence146 542 6 gene locus_tag LOCUS_17540 542 6 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_17540 1264 722 gene locus_tag LOCUS_17550 1264 722 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419930.1 protein_id gnl|my_center|LOCUS_17550 1782 1387 gene locus_tag LOCUS_17560 1782 1387 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392341.1 protein_id gnl|my_center|LOCUS_17560 2803 1865 gene locus_tag LOCUS_17570 2803 1865 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614448.1 protein_id gnl|my_center|LOCUS_17570 3539 2796 gene locus_tag LOCUS_17580 3539 2796 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895939.1 protein_id gnl|my_center|LOCUS_17580 3760 4506 gene locus_tag LOCUS_17590 3760 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 4542 5189 gene locus_tag LOCUS_17600 4542 5189 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966612.1 protein_id gnl|my_center|LOCUS_17600 5416 6807 gene locus_tag LOCUS_17610 5416 6807 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391671.1 protein_id gnl|my_center|LOCUS_17610 6909 7964 gene locus_tag LOCUS_17620 6909 7964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 >Feature sequence147 1067 2836 gene locus_tag LOCUS_17630 gene argS 1067 2836 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020254.1 protein_id gnl|my_center|LOCUS_17630 2893 6057 gene locus_tag LOCUS_17640 2893 6057 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272308.1 protein_id gnl|my_center|LOCUS_17640 6059 6775 gene locus_tag LOCUS_17650 6059 6775 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113632.1 protein_id gnl|my_center|LOCUS_17650 >Feature sequence148 1433 33 gene locus_tag LOCUS_17660 1433 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 2108 1641 gene locus_tag LOCUS_17670 2108 1641 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101189.1 protein_id gnl|my_center|LOCUS_17670 2936 2109 gene locus_tag LOCUS_17680 2936 2109 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644019.1 protein_id gnl|my_center|LOCUS_17680 4604 3408 gene locus_tag LOCUS_17690 gene brnQ 4604 3408 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389948.1 protein_id gnl|my_center|LOCUS_17690 4821 6455 gene locus_tag LOCUS_17700 4821 6455 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_17700 6731 7336 gene locus_tag LOCUS_17710 6731 7336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 >Feature sequence149 482 904 gene locus_tag LOCUS_17720 482 904 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071854935.1 protein_id gnl|my_center|LOCUS_17720 901 1368 gene locus_tag LOCUS_17730 901 1368 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298375.1 protein_id gnl|my_center|LOCUS_17730 1433 2236 gene locus_tag LOCUS_17740 1433 2236 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071854933.1 protein_id gnl|my_center|LOCUS_17740 2251 3093 gene locus_tag LOCUS_17750 2251 3093 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298371.1 protein_id gnl|my_center|LOCUS_17750 3149 4132 gene locus_tag LOCUS_17760 3149 4132 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002322451.1 protein_id gnl|my_center|LOCUS_17760 4169 4795 gene locus_tag LOCUS_17770 4169 4795 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262529.1 protein_id gnl|my_center|LOCUS_17770 5506 6690 gene locus_tag LOCUS_17780 5506 6690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 6677 7981 gene locus_tag LOCUS_17790 6677 7981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 >Feature sequence150 <1 617 gene locus_tag LOCUS_17800 <1 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964346.1:triacylglycerol lipase 632 1363 gene locus_tag LOCUS_17810 632 1363 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922646.1 protein_id gnl|my_center|LOCUS_17810 1534 2889 gene locus_tag LOCUS_17820 1534 2889 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112416.1 protein_id gnl|my_center|LOCUS_17820 2998 3774 gene locus_tag LOCUS_17830 gene udp 2998 3774 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_17830 4067 4921 gene locus_tag LOCUS_17840 4067 4921 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811618.1 protein_id gnl|my_center|LOCUS_17840 4924 5457 gene locus_tag LOCUS_17850 4924 5457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 5454 7091 gene locus_tag LOCUS_17860 5454 7091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 >Feature sequence151 1639 548 gene locus_tag LOCUS_17870 1639 548 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897664.1 protein_id gnl|my_center|LOCUS_17870 2559 1648 gene locus_tag LOCUS_17880 2559 1648 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454768.1 protein_id gnl|my_center|LOCUS_17880 3850 2834 gene locus_tag LOCUS_17890 gene galE 3850 2834 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_17890 4888 4004 gene locus_tag LOCUS_17900 gene rsmA 4888 4004 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837565.1 protein_id gnl|my_center|LOCUS_17900 5671 4898 gene locus_tag LOCUS_17910 5671 4898 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_17910 6169 5828 gene locus_tag LOCUS_17920 6169 5828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 6606 6214 gene locus_tag LOCUS_17930 6606 6214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17930 <8037 6863 gene locus_tag LOCUS_17940 <8037 6863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002289277.1:MATE family efflux transporter >Feature sequence152 297 728 gene locus_tag LOCUS_17950 297 728 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_17950 2225 894 gene locus_tag LOCUS_17960 2225 894 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386645.1 protein_id gnl|my_center|LOCUS_17960 3277 2585 gene locus_tag LOCUS_17970 3277 2585 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963931.1 protein_id gnl|my_center|LOCUS_17970 3633 3274 gene locus_tag LOCUS_17980 3633 3274 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781331.1 protein_id gnl|my_center|LOCUS_17980 4109 4792 gene locus_tag LOCUS_17990 4109 4792 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243015.1 protein_id gnl|my_center|LOCUS_17990 4795 5844 gene locus_tag LOCUS_18000 4795 5844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337357.1 protein_id gnl|my_center|LOCUS_18000 5870 6913 gene locus_tag LOCUS_18010 5870 6913 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244029.1 protein_id gnl|my_center|LOCUS_18010 6962 7687 gene locus_tag LOCUS_18020 6962 7687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 >Feature sequence153 901 683 gene locus_tag LOCUS_18030 901 683 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948188.1 protein_id gnl|my_center|LOCUS_18030 2084 1218 gene locus_tag LOCUS_18040 2084 1218 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865064.1 protein_id gnl|my_center|LOCUS_18040 2772 2119 gene locus_tag LOCUS_18050 2772 2119 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905540.1 protein_id gnl|my_center|LOCUS_18050 3695 2910 gene locus_tag LOCUS_18060 3695 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 4667 3768 gene locus_tag LOCUS_18070 gene dapF 4667 3768 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_18070 5224 4679 gene locus_tag LOCUS_18080 5224 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 6595 5258 gene locus_tag LOCUS_18090 gene glnA 6595 5258 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135328.1 protein_id gnl|my_center|LOCUS_18090 <7939 6875 gene locus_tag LOCUS_18100 <7939 6875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000796568.1:heavy metal translocating P-type ATPase >Feature sequence154 796 1032 gene locus_tag LOCUS_18110 796 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 1322 1143 gene locus_tag LOCUS_18120 1322 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 1270 1518 gene locus_tag LOCUS_18130 1270 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 2287 1544 gene locus_tag LOCUS_18140 gene larB 2287 1544 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435015.1 protein_id gnl|my_center|LOCUS_18140 2909 2304 gene locus_tag LOCUS_18150 2909 2304 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461185.1 protein_id gnl|my_center|LOCUS_18150 3880 2906 gene locus_tag LOCUS_18160 3880 2906 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461569.1 protein_id gnl|my_center|LOCUS_18160 4717 3893 gene locus_tag LOCUS_18170 4717 3893 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461187.1 protein_id gnl|my_center|LOCUS_18170 5703 4714 gene locus_tag LOCUS_18180 5703 4714 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021910.1 protein_id gnl|my_center|LOCUS_18180 7706 5883 gene locus_tag LOCUS_18190 7706 5883 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461189.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence155 78 1673 gene locus_tag LOCUS_18200 78 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 3603 2122 gene locus_tag LOCUS_18210 3603 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 3831 5591 gene locus_tag LOCUS_18220 3831 5591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 7081 5615 gene locus_tag LOCUS_18230 7081 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 >Feature sequence156 474 1613 gene locus_tag LOCUS_18240 474 1613 CDS product 2-methylaconitate cis-trans isomerase PrpF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967865.1 protein_id gnl|my_center|LOCUS_18240 1909 4206 gene locus_tag LOCUS_18250 1909 4206 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593936.1 protein_id gnl|my_center|LOCUS_18250 5107 4169 gene locus_tag LOCUS_18260 5107 4169 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964364.1 protein_id gnl|my_center|LOCUS_18260 5371 7332 gene locus_tag LOCUS_18270 5371 7332 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393382.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence157 100 1041 gene locus_tag LOCUS_18280 100 1041 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886481.1 protein_id gnl|my_center|LOCUS_18280 2428 1001 gene locus_tag LOCUS_18290 2428 1001 CDS product RsmF rRNA methyltransferase first C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287145.1 protein_id gnl|my_center|LOCUS_18290 2524 3072 gene locus_tag LOCUS_18300 2524 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 3555 3142 gene locus_tag LOCUS_18310 3555 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 4279 3758 gene locus_tag LOCUS_18320 4279 3758 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_18320 5388 4276 gene locus_tag LOCUS_18330 5388 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 5611 6726 gene locus_tag LOCUS_18340 5611 6726 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891610.1 protein_id gnl|my_center|LOCUS_18340 <7827 6742 gene locus_tag LOCUS_18350 <7827 6742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686827.1:patatin-like phospholipase family protein >Feature sequence158 12 674 gene locus_tag LOCUS_18360 12 674 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238594.1 protein_id gnl|my_center|LOCUS_18360 679 1902 gene locus_tag LOCUS_18370 679 1902 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461202.1 protein_id gnl|my_center|LOCUS_18370 2051 3187 gene locus_tag LOCUS_18380 2051 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 4109 3195 gene locus_tag LOCUS_18390 4109 3195 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705050.1 protein_id gnl|my_center|LOCUS_18390 4379 5728 gene locus_tag LOCUS_18400 gene gudD 4379 5728 CDS product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268234.1 protein_id gnl|my_center|LOCUS_18400 6181 6990 gene locus_tag LOCUS_18410 6181 6990 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201882.1 protein_id gnl|my_center|LOCUS_18410 7081 7392 gene locus_tag LOCUS_18420 7081 7392 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720075.1 protein_id gnl|my_center|LOCUS_18420 >Feature sequence159 1744 245 gene locus_tag LOCUS_18430 gene galT 1744 245 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_18430 1862 1734 gene locus_tag LOCUS_18440 1862 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 3564 2083 gene locus_tag LOCUS_18450 3564 2083 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_18450 4932 3577 gene locus_tag LOCUS_18460 gene trkA 4932 3577 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_18460 5663 5145 gene locus_tag LOCUS_18470 5663 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 5868 6242 gene locus_tag LOCUS_18480 5868 6242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 7585 6239 gene locus_tag LOCUS_18490 7585 6239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 >Feature sequence160 645 1598 gene locus_tag LOCUS_18500 645 1598 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_18500 1607 2518 gene locus_tag LOCUS_18510 gene truB 1607 2518 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986789.1 protein_id gnl|my_center|LOCUS_18510 2520 3461 gene locus_tag LOCUS_18520 2520 3461 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438310.1 protein_id gnl|my_center|LOCUS_18520 3505 4431 gene locus_tag LOCUS_18530 3505 4431 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964913.1 protein_id gnl|my_center|LOCUS_18530 4531 5577 gene locus_tag LOCUS_18540 gene hrcA 4531 5577 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357960.1 protein_id gnl|my_center|LOCUS_18540 5581 6261 gene locus_tag LOCUS_18550 5581 6261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 >Feature sequence161 2047 503 gene locus_tag LOCUS_18560 2047 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 2805 2044 gene locus_tag LOCUS_18570 2805 2044 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286278.1 protein_id gnl|my_center|LOCUS_18570 3020 4204 gene locus_tag LOCUS_18580 3020 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 4191 4343 gene locus_tag LOCUS_18590 4191 4343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 4355 5218 gene locus_tag LOCUS_18600 4355 5218 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861239.1 protein_id gnl|my_center|LOCUS_18600 5220 6320 gene locus_tag LOCUS_18610 5220 6320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 6990 6400 gene locus_tag LOCUS_18620 6990 6400 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021358897.1 protein_id gnl|my_center|LOCUS_18620 7392 7033 gene locus_tag LOCUS_18630 7392 7033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 >Feature sequence162 490 98 gene locus_tag LOCUS_18640 gene rpsI 490 98 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357662.1 protein_id gnl|my_center|LOCUS_18640 946 518 gene locus_tag LOCUS_18650 gene rplM 946 518 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650450.1 protein_id gnl|my_center|LOCUS_18650 2176 1121 gene locus_tag LOCUS_18660 2176 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 2973 2173 gene locus_tag LOCUS_18670 2973 2173 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860635.1 protein_id gnl|my_center|LOCUS_18670 3845 2967 gene locus_tag LOCUS_18680 3845 2967 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_18680 4708 3836 gene locus_tag LOCUS_18690 4708 3836 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435660.1 protein_id gnl|my_center|LOCUS_18690 6263 4971 gene locus_tag LOCUS_18700 6263 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 7146 6610 gene locus_tag LOCUS_18710 gene rplQ 7146 6610 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723675.1 protein_id gnl|my_center|LOCUS_18710 >Feature sequence163 1584 604 gene locus_tag LOCUS_18720 1584 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 2961 2224 gene locus_tag LOCUS_18730 2961 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 3855 3061 gene locus_tag LOCUS_18740 gene phnE 3855 3061 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548762.1 protein_id gnl|my_center|LOCUS_18740 4634 3855 gene locus_tag LOCUS_18750 gene phnE 4634 3855 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576383.1 protein_id gnl|my_center|LOCUS_18750 5397 4624 gene locus_tag LOCUS_18760 gene phnC 5397 4624 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078092.1 protein_id gnl|my_center|LOCUS_18760 6334 5411 gene locus_tag LOCUS_18770 6334 5411 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915065.1 protein_id gnl|my_center|LOCUS_18770 6589 7278 gene locus_tag LOCUS_18780 6589 7278 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754845.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence164 <1 977 gene locus_tag LOCUS_18790 <1 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009931069.1:ABC transporter permease 1301 1170 gene locus_tag LOCUS_18800 1301 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 1481 2320 gene locus_tag LOCUS_18810 1481 2320 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219921.1 protein_id gnl|my_center|LOCUS_18810 3245 2307 gene locus_tag LOCUS_18820 3245 2307 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048393.1 protein_id gnl|my_center|LOCUS_18820 3558 4847 gene locus_tag LOCUS_18830 gene galK 3558 4847 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263235.1 protein_id gnl|my_center|LOCUS_18830 5551 4907 gene locus_tag LOCUS_18840 5551 4907 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459526.1 protein_id gnl|my_center|LOCUS_18840 5738 5896 gene locus_tag LOCUS_18850 5738 5896 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence165 1005 394 gene locus_tag LOCUS_18860 1005 394 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879640.1 protein_id gnl|my_center|LOCUS_18860 1917 1096 gene locus_tag LOCUS_18870 1917 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 2178 2807 gene locus_tag LOCUS_18880 2178 2807 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066132.1 protein_id gnl|my_center|LOCUS_18880 2860 2932 gene locus_tag LOCUS_t00210 2860 2932 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2982 3056 gene locus_tag LOCUS_t00220 2982 3056 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3402 3187 gene locus_tag LOCUS_18890 3402 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 4478 3375 gene locus_tag LOCUS_18900 4478 3375 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682004.1 protein_id gnl|my_center|LOCUS_18900 5513 4494 gene locus_tag LOCUS_18910 5513 4494 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682008.1 protein_id gnl|my_center|LOCUS_18910 6833 5541 gene locus_tag LOCUS_18920 6833 5541 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682009.1 protein_id gnl|my_center|LOCUS_18920 >Feature sequence166 204 1373 gene locus_tag LOCUS_18930 204 1373 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014128488.1 protein_id gnl|my_center|LOCUS_18930 3287 1434 gene locus_tag LOCUS_18940 gene prpR 3287 1434 CDS product propionate catabolism operon regulatory protein PrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063902.1 protein_id gnl|my_center|LOCUS_18940 3467 4663 gene locus_tag LOCUS_18950 3467 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 4765 6042 gene locus_tag LOCUS_18960 4765 6042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 6087 6926 gene locus_tag LOCUS_18970 6087 6926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 >Feature sequence167 459 1928 gene locus_tag LOCUS_18980 gene pap 459 1928 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065389.1 protein_id gnl|my_center|LOCUS_18980 2006 2638 gene locus_tag LOCUS_18990 gene cwlD 2006 2638 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048347.1 protein_id gnl|my_center|LOCUS_18990 4431 2830 gene locus_tag LOCUS_19000 4431 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 5846 4398 gene locus_tag LOCUS_19010 5846 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 <7303 5944 gene locus_tag LOCUS_19020 <7303 5944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_163066848.1:recombinase family protein >Feature sequence168 82 819 gene locus_tag LOCUS_19030 82 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 835 1464 gene locus_tag LOCUS_19040 835 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 1577 3631 gene locus_tag LOCUS_19050 1577 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 3771 6200 gene locus_tag LOCUS_19060 3771 6200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 >Feature sequence169 447 1544 gene locus_tag LOCUS_19070 gene dprA 447 1544 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392539.1 protein_id gnl|my_center|LOCUS_19070 1556 3631 gene locus_tag LOCUS_19080 gene topA 1556 3631 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965091.1 protein_id gnl|my_center|LOCUS_19080 3759 4541 gene locus_tag LOCUS_19090 gene codY 3759 4541 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362579.1 protein_id gnl|my_center|LOCUS_19090 4908 5660 gene locus_tag LOCUS_19100 gene rpsB 4908 5660 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111485.1 protein_id gnl|my_center|LOCUS_19100 5745 6680 gene locus_tag LOCUS_19110 gene tsf 5745 6680 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_19110 >Feature sequence170 1673 327 gene locus_tag LOCUS_19120 1673 327 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289079.1 protein_id gnl|my_center|LOCUS_19120 2058 2522 gene locus_tag LOCUS_19130 2058 2522 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964912.1 protein_id gnl|my_center|LOCUS_19130 2773 4743 gene locus_tag LOCUS_19140 2773 4743 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861661.1 protein_id gnl|my_center|LOCUS_19140 4936 6291 gene locus_tag LOCUS_19150 4936 6291 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679363.1 protein_id gnl|my_center|LOCUS_19150 >Feature sequence171 655 236 gene locus_tag LOCUS_19160 gene rpsL 655 236 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_19160 946 1890 gene locus_tag LOCUS_19170 946 1890 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963416.1 protein_id gnl|my_center|LOCUS_19170 2628 2455 gene locus_tag LOCUS_19180 2628 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 5624 2853 gene locus_tag LOCUS_19190 gene rpoC 5624 2853 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048356.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19190 6503 5673 gene locus_tag LOCUS_19200 6503 5673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19200 <7128 6522 gene locus_tag LOCUS_19210 <7128 6522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966421.1:DNA-directed RNA polymerase subunit beta >Feature sequence172 162 518 gene locus_tag LOCUS_19220 gene rplT 162 518 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429730.1 protein_id gnl|my_center|LOCUS_19220 884 1801 gene locus_tag LOCUS_19230 884 1801 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811999.1 protein_id gnl|my_center|LOCUS_19230 1818 2969 gene locus_tag LOCUS_19240 1818 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 2980 4011 gene locus_tag LOCUS_19250 2980 4011 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966899.1 protein_id gnl|my_center|LOCUS_19250 4004 4966 gene locus_tag LOCUS_19260 4004 4966 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966903.1 protein_id gnl|my_center|LOCUS_19260 5088 6773 gene locus_tag LOCUS_19270 5088 6773 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966897.1 protein_id gnl|my_center|LOCUS_19270 >Feature sequence173 <1 1472 gene locus_tag LOCUS_19280 <1 1472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_101534157.1:LytS/YhcK type 5TM receptor domain-containing protein 1466 2245 gene locus_tag LOCUS_19290 1466 2245 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002455962.1 protein_id gnl|my_center|LOCUS_19290 3834 2368 gene locus_tag LOCUS_19300 3834 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 5441 3945 gene locus_tag LOCUS_19310 5441 3945 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023877.1 protein_id gnl|my_center|LOCUS_19310 6167 5472 gene locus_tag LOCUS_19320 6167 5472 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001993852.1 protein_id gnl|my_center|LOCUS_19320 6579 6764 gene locus_tag LOCUS_19330 6579 6764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 >Feature sequence174 181 94 gene locus_tag LOCUS_t00230 181 94 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1118 381 gene locus_tag LOCUS_19340 gene ispD 1118 381 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943979.1 protein_id gnl|my_center|LOCUS_19340 2144 1122 gene locus_tag LOCUS_19350 gene tsaD 2144 1122 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_19350 3061 2141 gene locus_tag LOCUS_19360 3061 2141 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518928.1 protein_id gnl|my_center|LOCUS_19360 3722 3480 gene locus_tag LOCUS_19370 3722 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 4572 4018 gene locus_tag LOCUS_19380 4572 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 5267 4569 gene locus_tag LOCUS_19390 gene tsaB 5267 4569 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_19390 5692 5264 gene locus_tag LOCUS_19400 gene tsaE 5692 5264 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048261.1 protein_id gnl|my_center|LOCUS_19400 6182 5694 gene locus_tag LOCUS_19410 6182 5694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 <7027 6220 gene locus_tag LOCUS_19420 <7027 6220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966127.1:Tex family protein >Feature sequence175 1291 53 gene locus_tag LOCUS_19430 gene fabF 1291 53 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099549.1 protein_id gnl|my_center|LOCUS_19430 2093 1353 gene locus_tag LOCUS_19440 gene fabG 2093 1353 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830161.1 protein_id gnl|my_center|LOCUS_19440 3056 2130 gene locus_tag LOCUS_19450 gene fabD 3056 2130 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_19450 3989 3060 gene locus_tag LOCUS_19460 gene fabK 3989 3060 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966839.1 protein_id gnl|my_center|LOCUS_19460 4222 3989 gene locus_tag LOCUS_19470 gene acpP 4222 3989 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_19470 5365 4403 gene locus_tag LOCUS_19480 5365 4403 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_19480 5667 6500 gene locus_tag LOCUS_19490 5667 6500 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679949.1 protein_id gnl|my_center|LOCUS_19490 7026 6652 gene locus_tag LOCUS_19500 7026 6652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 >Feature sequence176 <1 603 gene locus_tag LOCUS_19510 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000854536.1:CapA family protein 635 1354 gene locus_tag LOCUS_19520 635 1354 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232924.1 protein_id gnl|my_center|LOCUS_19520 2006 1320 gene locus_tag LOCUS_19530 2006 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19530 2294 2061 gene locus_tag LOCUS_19540 2294 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 3759 2419 gene locus_tag LOCUS_19550 gene dsdA 3759 2419 CDS product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658347.1 protein_id gnl|my_center|LOCUS_19550 4562 3786 gene locus_tag LOCUS_19560 4562 3786 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966927.1 protein_id gnl|my_center|LOCUS_19560 6031 4583 gene locus_tag LOCUS_19570 6031 4583 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462118.1 protein_id gnl|my_center|LOCUS_19570 6759 6208 gene locus_tag LOCUS_19580 6759 6208 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427634.1 protein_id gnl|my_center|LOCUS_19580 >Feature sequence177 1469 573 gene locus_tag LOCUS_19590 1469 573 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966633.1 protein_id gnl|my_center|LOCUS_19590 1796 2095 gene locus_tag LOCUS_19600 gene citD 1796 2095 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684015.1 protein_id gnl|my_center|LOCUS_19600 2092 2994 gene locus_tag LOCUS_19610 gene citE 2092 2994 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898727.1 protein_id gnl|my_center|LOCUS_19610 2996 4552 gene locus_tag LOCUS_19620 gene citF 2996 4552 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355996.1 protein_id gnl|my_center|LOCUS_19620 4713 5348 gene locus_tag LOCUS_19630 4713 5348 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727134.1 protein_id gnl|my_center|LOCUS_19630 5663 6826 gene locus_tag LOCUS_19640 5663 6826 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014128488.1 protein_id gnl|my_center|LOCUS_19640 6850 7005 gene locus_tag LOCUS_19650 6850 7005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 >Feature sequence178 1058 492 gene locus_tag LOCUS_19660 gene lepB 1058 492 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811571.1 protein_id gnl|my_center|LOCUS_19660 1273 2406 gene locus_tag LOCUS_19670 1273 2406 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861460.1 protein_id gnl|my_center|LOCUS_19670 2492 3592 gene locus_tag LOCUS_19680 2492 3592 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073726.1 protein_id gnl|my_center|LOCUS_19680 3593 3946 gene locus_tag LOCUS_19690 3593 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 3953 6484 gene locus_tag LOCUS_19700 3953 6484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 >Feature sequence179 294 1238 gene locus_tag LOCUS_19710 gene nikB 294 1238 CDS product nickel ABC transporter permease subunit NikB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703735.1 protein_id gnl|my_center|LOCUS_19710 1242 2066 gene locus_tag LOCUS_19720 1242 2066 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437750.1 protein_id gnl|my_center|LOCUS_19720 2063 2893 gene locus_tag LOCUS_19730 2063 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19730 2886 3722 gene locus_tag LOCUS_19740 2886 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19740 3719 4651 gene locus_tag LOCUS_19750 3719 4651 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836550.1 protein_id gnl|my_center|LOCUS_19750 4782 6428 gene locus_tag LOCUS_19760 gene hcp 4782 6428 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966037.1 protein_id gnl|my_center|LOCUS_19760 6565 6777 gene locus_tag LOCUS_19770 6565 6777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 >Feature sequence180 1 324 gene locus_tag LOCUS_19780 1 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 460 1491 gene locus_tag LOCUS_19790 460 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 1573 2694 gene locus_tag LOCUS_19800 1573 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19800 2713 3960 gene locus_tag LOCUS_19810 2713 3960 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732668.1 protein_id gnl|my_center|LOCUS_19810 5377 4103 gene locus_tag LOCUS_19820 gene aroA 5377 4103 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246068.1 protein_id gnl|my_center|LOCUS_19820 6489 5395 gene locus_tag LOCUS_19830 gene tyrA 6489 5395 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228123.1 protein_id gnl|my_center|LOCUS_19830 >Feature sequence181 3917 2643 gene locus_tag LOCUS_19840 3917 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 4555 3917 gene locus_tag LOCUS_19850 4555 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 5302 4574 gene locus_tag LOCUS_19860 5302 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 5931 5377 gene locus_tag LOCUS_19870 5931 5377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 6353 6063 gene locus_tag LOCUS_19880 6353 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 6591 6519 gene locus_tag LOCUS_t00240 6591 6519 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence182 621 776 gene locus_tag LOCUS_19890 621 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 2041 767 gene locus_tag LOCUS_19900 2041 767 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401829.1 protein_id gnl|my_center|LOCUS_19900 3062 2139 gene locus_tag LOCUS_19910 3062 2139 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435316.1 protein_id gnl|my_center|LOCUS_19910 3841 3059 gene locus_tag LOCUS_19920 3841 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 4734 3838 gene locus_tag LOCUS_19930 4734 3838 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023177.1 protein_id gnl|my_center|LOCUS_19930 6631 5201 gene locus_tag LOCUS_19940 gene purB 6631 5201 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_19940 >Feature sequence183 <1 568 gene locus_tag LOCUS_19950 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680347.1:glycogen/starch/alpha-glucan phosphorylase 626 1540 gene locus_tag LOCUS_19960 gene spoIID 626 1540 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393851.1 protein_id gnl|my_center|LOCUS_19960 1581 2405 gene locus_tag LOCUS_19970 1581 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 2608 3162 gene locus_tag LOCUS_19980 2608 3162 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641962.1 protein_id gnl|my_center|LOCUS_19980 3270 3737 gene locus_tag LOCUS_19990 3270 3737 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889129.1 protein_id gnl|my_center|LOCUS_19990 5301 3925 gene locus_tag LOCUS_20000 5301 3925 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047747.1 protein_id gnl|my_center|LOCUS_20000 5555 6484 gene locus_tag LOCUS_20010 5555 6484 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026892922.1 protein_id gnl|my_center|LOCUS_20010 >Feature sequence184 937 23 gene locus_tag LOCUS_20020 937 23 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246430.1 protein_id gnl|my_center|LOCUS_20020 1911 928 gene locus_tag LOCUS_20030 gene cynR 1911 928 CDS product transcriptional regulator CynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952503.1 protein_id gnl|my_center|LOCUS_20030 1910 2065 gene locus_tag LOCUS_20040 1910 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 2077 3363 gene locus_tag LOCUS_20050 2077 3363 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827961.1 protein_id gnl|my_center|LOCUS_20050 3418 5217 gene locus_tag LOCUS_20060 3418 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 5510 6466 gene locus_tag LOCUS_20070 5510 6466 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938705.1 protein_id gnl|my_center|LOCUS_20070 >Feature sequence185 1111 53 gene locus_tag LOCUS_20080 gene cobT 1111 53 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 protein_id gnl|my_center|LOCUS_20080 2742 1108 gene locus_tag LOCUS_20090 2742 1108 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205066.1 protein_id gnl|my_center|LOCUS_20090 3302 2724 gene locus_tag LOCUS_20100 3302 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 4921 3299 gene locus_tag LOCUS_20110 4921 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 6027 4918 gene locus_tag LOCUS_20120 gene cbiG 6027 4918 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721596.1 protein_id gnl|my_center|LOCUS_20120 <6637 6024 gene locus_tag LOCUS_20130 <6637 6024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003721592.1:cobalt-precorrin-5B (C(1))-methyltransferase CbiD >Feature sequence186 118 28 gene locus_tag LOCUS_t00250 118 28 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1413 334 gene locus_tag LOCUS_20140 gene mnmA 1413 334 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_20140 2052 1615 gene locus_tag LOCUS_20150 gene nifU 2052 1615 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438275.1 protein_id gnl|my_center|LOCUS_20150 3283 2090 gene locus_tag LOCUS_20160 gene nifS 3283 2090 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_20160 3605 3459 gene locus_tag LOCUS_20170 3605 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 3562 5163 gene locus_tag LOCUS_20180 3562 5163 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392657.1 protein_id gnl|my_center|LOCUS_20180 <6632 5386 gene locus_tag LOCUS_20190 <6632 5386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462176.1:RNA polymerase factor sigma-54 >Feature sequence187 2686 422 gene locus_tag LOCUS_20200 2686 422 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537441.1 protein_id gnl|my_center|LOCUS_20200 3741 2788 gene locus_tag LOCUS_20210 gene add 3741 2788 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548323.1 protein_id gnl|my_center|LOCUS_20210 4292 3957 gene locus_tag LOCUS_20220 4292 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 4729 4265 gene locus_tag LOCUS_20230 4729 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 5213 4788 gene locus_tag LOCUS_20240 5213 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 5645 5271 gene locus_tag LOCUS_20250 5645 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 5936 6145 gene locus_tag LOCUS_20260 5936 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 6562 6233 gene locus_tag LOCUS_20270 6562 6233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 >Feature sequence188 86 982 gene locus_tag LOCUS_20280 86 982 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969295.1 protein_id gnl|my_center|LOCUS_20280 1077 2231 gene locus_tag LOCUS_20290 1077 2231 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383860.1 protein_id gnl|my_center|LOCUS_20290 2253 3803 gene locus_tag LOCUS_20300 2253 3803 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383861.1 protein_id gnl|my_center|LOCUS_20300 3800 4843 gene locus_tag LOCUS_20310 3800 4843 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975045.1 protein_id gnl|my_center|LOCUS_20310 4840 5757 gene locus_tag LOCUS_20320 4840 5757 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537587.1 protein_id gnl|my_center|LOCUS_20320 >Feature sequence189 1910 387 gene locus_tag LOCUS_20330 1910 387 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_20330 3159 2242 gene locus_tag LOCUS_20340 3159 2242 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436788.1 protein_id gnl|my_center|LOCUS_20340 4419 3172 gene locus_tag LOCUS_20350 4419 3172 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_20350 6225 4474 gene locus_tag LOCUS_20360 gene recJ 6225 4474 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943623.1 protein_id gnl|my_center|LOCUS_20360 6471 6546 gene locus_tag LOCUS_t00260 6471 6546 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence190 1644 460 gene locus_tag LOCUS_20370 1644 460 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893427.1 protein_id gnl|my_center|LOCUS_20370 2844 1660 gene locus_tag LOCUS_20380 gene dpaL 2844 1660 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812104.1 protein_id gnl|my_center|LOCUS_20380 4957 3116 gene locus_tag LOCUS_20390 4957 3116 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812102.1 protein_id gnl|my_center|LOCUS_20390 5642 5154 gene locus_tag LOCUS_20400 5642 5154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 >Feature sequence191 813 106 gene locus_tag LOCUS_20410 813 106 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047943.1 protein_id gnl|my_center|LOCUS_20410 1351 950 gene locus_tag LOCUS_20420 1351 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 2683 1577 gene locus_tag LOCUS_20430 2683 1577 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861987.1 protein_id gnl|my_center|LOCUS_20430 3569 2739 gene locus_tag LOCUS_20440 3569 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 3995 3693 gene locus_tag LOCUS_20450 3995 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 4818 4063 gene locus_tag LOCUS_20460 gene dapB 4818 4063 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048150.1 protein_id gnl|my_center|LOCUS_20460 5721 4834 gene locus_tag LOCUS_20470 gene dapA 5721 4834 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_20470 >Feature sequence192 1161 1715 gene locus_tag LOCUS_20480 gene rfbC 1161 1715 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_20480 1739 2548 gene locus_tag LOCUS_20490 1739 2548 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289081.1 protein_id gnl|my_center|LOCUS_20490 2564 3166 gene locus_tag LOCUS_20500 2564 3166 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810266.1 protein_id gnl|my_center|LOCUS_20500 3192 3749 gene locus_tag LOCUS_20510 3192 3749 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809975.1 protein_id gnl|my_center|LOCUS_20510 4082 4588 gene locus_tag LOCUS_20520 4082 4588 CDS product Panacea domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013556.1 protein_id gnl|my_center|LOCUS_20520 4569 5462 gene locus_tag LOCUS_20530 4569 5462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 5673 5837 gene locus_tag LOCUS_20540 5673 5837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 >Feature sequence193 488 416 gene locus_tag LOCUS_t00270 488 416 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1937 753 gene locus_tag LOCUS_20550 1937 753 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426667.1 protein_id gnl|my_center|LOCUS_20550 2689 1934 gene locus_tag LOCUS_20560 gene truA 2689 1934 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294728.1 protein_id gnl|my_center|LOCUS_20560 4097 2955 gene locus_tag LOCUS_20570 gene glgD 4097 2955 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183792.1 protein_id gnl|my_center|LOCUS_20570 5299 4091 gene locus_tag LOCUS_20580 5299 4091 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965535.1 protein_id gnl|my_center|LOCUS_20580 <6404 5539 gene locus_tag LOCUS_20590 <6404 5539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727819.1:M20 family metallopeptidase >Feature sequence194 754 338 gene locus_tag LOCUS_20600 754 338 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810723.1 protein_id gnl|my_center|LOCUS_20600 934 1779 gene locus_tag LOCUS_20610 934 1779 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005915025.1 protein_id gnl|my_center|LOCUS_20610 1794 2567 gene locus_tag LOCUS_20620 1794 2567 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 protein_id gnl|my_center|LOCUS_20620 2557 3303 gene locus_tag LOCUS_20630 2557 3303 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986547.1 protein_id gnl|my_center|LOCUS_20630 3318 3962 gene locus_tag LOCUS_20640 3318 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 3980 4969 gene locus_tag LOCUS_20650 3980 4969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 4973 5731 gene locus_tag LOCUS_20660 4973 5731 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438780.1 protein_id gnl|my_center|LOCUS_20660 5853 6368 gene locus_tag LOCUS_20670 5853 6368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 >Feature sequence195 232 525 gene locus_tag LOCUS_20680 232 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 1665 742 gene locus_tag LOCUS_20690 1665 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 3008 1776 gene locus_tag LOCUS_20700 3008 1776 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703620.1 protein_id gnl|my_center|LOCUS_20700 3239 4225 gene locus_tag LOCUS_20710 gene cynR 3239 4225 CDS product transcriptional regulator CynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237346.1 protein_id gnl|my_center|LOCUS_20710 4222 5112 gene locus_tag LOCUS_20720 4222 5112 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142979.1 protein_id gnl|my_center|LOCUS_20720 >Feature sequence196 1936 482 gene locus_tag LOCUS_20730 1936 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 2444 2253 gene locus_tag LOCUS_20740 2444 2253 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461361.1 protein_id gnl|my_center|LOCUS_20740 2769 2446 gene locus_tag LOCUS_20750 2769 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 3965 2841 gene locus_tag LOCUS_20760 3965 2841 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966652.1 protein_id gnl|my_center|LOCUS_20760 5738 4503 gene locus_tag LOCUS_20770 5738 4503 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913616.1 protein_id gnl|my_center|LOCUS_20770 >Feature sequence197 1145 1921 gene locus_tag LOCUS_20780 gene rfbF 1145 1921 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088721.1 protein_id gnl|my_center|LOCUS_20780 1934 2992 gene locus_tag LOCUS_20790 gene rfbG 1934 2992 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 protein_id gnl|my_center|LOCUS_20790 3185 4525 gene locus_tag LOCUS_20800 gene rfbH 3185 4525 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208596.1 protein_id gnl|my_center|LOCUS_20800 4563 5402 gene locus_tag LOCUS_20810 4563 5402 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379605.1 protein_id gnl|my_center|LOCUS_20810 >Feature sequence198 555 1952 gene locus_tag LOCUS_20820 555 1952 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229640.1 protein_id gnl|my_center|LOCUS_20820 1939 2076 gene locus_tag LOCUS_20830 1939 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 2086 3390 gene locus_tag LOCUS_20840 2086 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 3583 3924 gene locus_tag LOCUS_20850 gene spoIIAA 3583 3924 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418414.1 protein_id gnl|my_center|LOCUS_20850 3940 4371 gene locus_tag LOCUS_20860 gene spoIIAB 3940 4371 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_20860 4376 5089 gene locus_tag LOCUS_20870 gene sigF 4376 5089 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230458.1 protein_id gnl|my_center|LOCUS_20870 5295 5450 gene locus_tag LOCUS_20880 5295 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 5447 6076 gene locus_tag LOCUS_20890 5447 6076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 >Feature sequence199 60 923 gene locus_tag LOCUS_20900 60 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 1010 1726 gene locus_tag LOCUS_20910 1010 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 2041 2436 gene locus_tag LOCUS_20920 2041 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 2457 2753 gene locus_tag LOCUS_20930 2457 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 2874 4385 gene locus_tag LOCUS_20940 2874 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 4398 5114 gene locus_tag LOCUS_20950 4398 5114 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832763.1 protein_id gnl|my_center|LOCUS_20950 5111 5965 gene locus_tag LOCUS_20960 5111 5965 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_20960 >Feature sequence200 1339 548 gene locus_tag LOCUS_20970 1339 548 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869100.1 protein_id gnl|my_center|LOCUS_20970 1930 1355 gene locus_tag LOCUS_20980 gene rsxA 1930 1355 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_20980 2631 1951 gene locus_tag LOCUS_20990 2631 1951 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948148.1 protein_id gnl|my_center|LOCUS_20990 3264 2647 gene locus_tag LOCUS_21000 3264 2647 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869097.1 protein_id gnl|my_center|LOCUS_21000 4202 3261 gene locus_tag LOCUS_21010 4202 3261 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_21010 5538 4216 gene locus_tag LOCUS_21020 gene rsxC 5538 4216 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_21020 >Feature sequence201 1189 149 gene locus_tag LOCUS_21030 1189 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 1327 2202 gene locus_tag LOCUS_21040 1327 2202 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289172.1 protein_id gnl|my_center|LOCUS_21040 2293 3162 gene locus_tag LOCUS_21050 gene dinD 2293 3162 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 protein_id gnl|my_center|LOCUS_21050 4944 3340 gene locus_tag LOCUS_21060 4944 3340 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812114.1 protein_id gnl|my_center|LOCUS_21060 <6158 4978 gene locus_tag LOCUS_21070 <6158 4978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003433878.1:sodium:solute symporter family protein >Feature sequence202 <1 684 gene locus_tag LOCUS_21080 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462247.1:peptide chain release factor N(5)-glutamine methyltransferase 704 1780 gene locus_tag LOCUS_21090 gene prfA 704 1780 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_21090 1954 2289 gene locus_tag LOCUS_21100 1954 2289 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967147.1 protein_id gnl|my_center|LOCUS_21100 2307 3245 gene locus_tag LOCUS_21110 2307 3245 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966633.1 protein_id gnl|my_center|LOCUS_21110 3540 4847 gene locus_tag LOCUS_21120 3540 4847 CDS product 2-hydroxycarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902179.1 protein_id gnl|my_center|LOCUS_21120 4874 5716 gene locus_tag LOCUS_21130 4874 5716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227200.1 protein_id gnl|my_center|LOCUS_21130 >Feature sequence203 <1 827 gene locus_tag LOCUS_21140 <1 827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009897032.1:bifunctional diguanylate cyclase/phosphodiesterase 1287 1027 gene locus_tag LOCUS_21150 1287 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 2119 1274 gene locus_tag LOCUS_21160 2119 1274 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797836.1 protein_id gnl|my_center|LOCUS_21160 2410 2246 gene locus_tag LOCUS_21170 2410 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 4276 2531 gene locus_tag LOCUS_21180 4276 2531 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065725.1 protein_id gnl|my_center|LOCUS_21180 6079 4277 gene locus_tag LOCUS_21190 6079 4277 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460630.1 protein_id gnl|my_center|LOCUS_21190 >Feature sequence204 120 1535 gene locus_tag LOCUS_21200 gene lpdA 120 1535 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679315.1 protein_id gnl|my_center|LOCUS_21200 1538 3322 gene locus_tag LOCUS_21210 1538 3322 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897431.1 protein_id gnl|my_center|LOCUS_21210 4007 4819 gene locus_tag LOCUS_21220 4007 4819 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377923.1 protein_id gnl|my_center|LOCUS_21220 4812 5645 gene locus_tag LOCUS_21230 4812 5645 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196782459.1 protein_id gnl|my_center|LOCUS_21230 >Feature sequence205 101 172 gene locus_tag LOCUS_t00280 101 172 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1873 383 gene locus_tag LOCUS_21240 1873 383 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965898.1 protein_id gnl|my_center|LOCUS_21240 3491 2010 gene locus_tag LOCUS_21250 gene xylB 3491 2010 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_21250 3747 4778 gene locus_tag LOCUS_21260 3747 4778 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255246.1 protein_id gnl|my_center|LOCUS_21260 5423 5091 gene locus_tag LOCUS_21270 5423 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 >Feature sequence206 1 498 gene locus_tag LOCUS_21280 1 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 821 2146 gene locus_tag LOCUS_21290 821 2146 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047747.1 protein_id gnl|my_center|LOCUS_21290 2286 3275 gene locus_tag LOCUS_21300 2286 3275 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454628.1 protein_id gnl|my_center|LOCUS_21300 3392 4759 gene locus_tag LOCUS_21310 3392 4759 CDS product NAD-binding homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390889.1 protein_id gnl|my_center|LOCUS_21310 5532 4984 gene locus_tag LOCUS_21320 5532 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 >Feature sequence207 <1 661 gene locus_tag LOCUS_21330 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000607031.1:excinuclease ABC subunit UvrB 814 1044 gene locus_tag LOCUS_21340 814 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 1037 3037 gene locus_tag LOCUS_21350 gene feoB 1037 3037 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722364.1 protein_id gnl|my_center|LOCUS_21350 3984 3034 gene locus_tag LOCUS_21360 3984 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 4119 4391 gene locus_tag LOCUS_21370 4119 4391 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054380.1 protein_id gnl|my_center|LOCUS_21370 >Feature sequence208 1330 359 gene locus_tag LOCUS_21380 1330 359 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810614.1 protein_id gnl|my_center|LOCUS_21380 2510 1614 gene locus_tag LOCUS_21390 2510 1614 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861239.1 protein_id gnl|my_center|LOCUS_21390 2712 2503 gene locus_tag LOCUS_21400 2712 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 3353 2709 gene locus_tag LOCUS_21410 3353 2709 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439354.1 protein_id gnl|my_center|LOCUS_21410 4351 3350 gene locus_tag LOCUS_21420 4351 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 5321 4374 gene locus_tag LOCUS_21430 5321 4374 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964728.1 protein_id gnl|my_center|LOCUS_21430 5845 5318 gene locus_tag LOCUS_21440 5845 5318 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461633.1 protein_id gnl|my_center|LOCUS_21440 >Feature sequence209 1140 235 gene locus_tag LOCUS_21450 1140 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 1283 2458 gene locus_tag LOCUS_21460 1283 2458 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966253.1 protein_id gnl|my_center|LOCUS_21460 2477 3649 gene locus_tag LOCUS_21470 2477 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124794627.1 protein_id gnl|my_center|LOCUS_21470 3667 4854 gene locus_tag LOCUS_21480 3667 4854 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382128.1 protein_id gnl|my_center|LOCUS_21480 >Feature sequence210 1 897 gene locus_tag LOCUS_21490 1 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 1032 2843 gene locus_tag LOCUS_21500 gene lepA 1032 2843 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416556.1 protein_id gnl|my_center|LOCUS_21500 2836 4002 gene locus_tag LOCUS_21510 gene hemW 2836 4002 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099423.1 protein_id gnl|my_center|LOCUS_21510 5561 4185 gene locus_tag LOCUS_21520 5561 4185 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100875.1 protein_id gnl|my_center|LOCUS_21520 >Feature sequence211 46 1974 gene locus_tag LOCUS_21530 46 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 1971 2639 gene locus_tag LOCUS_21540 1971 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 2646 4052 gene locus_tag LOCUS_21550 2646 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 >Feature sequence212 <1 903 gene locus_tag LOCUS_21560 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393767.1:argininosuccinate lyase 945 1886 gene locus_tag LOCUS_21570 gene argC 945 1886 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197909.1 protein_id gnl|my_center|LOCUS_21570 1940 3154 gene locus_tag LOCUS_21580 gene argJ 1940 3154 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_21580 3168 4046 gene locus_tag LOCUS_21590 gene argB 3168 4046 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_21590 4188 5381 gene locus_tag LOCUS_21600 4188 5381 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861434.1 protein_id gnl|my_center|LOCUS_21600 >Feature sequence213 409 1359 gene locus_tag LOCUS_21610 409 1359 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029030.1 protein_id gnl|my_center|LOCUS_21610 1356 2000 gene locus_tag LOCUS_21620 1356 2000 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082560.1 protein_id gnl|my_center|LOCUS_21620 2181 2645 gene locus_tag LOCUS_21630 2181 2645 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810593.1 protein_id gnl|my_center|LOCUS_21630 2642 3352 gene locus_tag LOCUS_21640 2642 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 3343 4212 gene locus_tag LOCUS_21650 3343 4212 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810599.1 protein_id gnl|my_center|LOCUS_21650 4205 5482 gene locus_tag LOCUS_21660 4205 5482 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810601.1 protein_id gnl|my_center|LOCUS_21660 >Feature sequence214 1431 337 gene locus_tag LOCUS_21670 1431 337 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430617.1 protein_id gnl|my_center|LOCUS_21670 3128 1431 gene locus_tag LOCUS_21680 3128 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 4508 3153 gene locus_tag LOCUS_21690 4508 3153 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966833.1 protein_id gnl|my_center|LOCUS_21690 4941 4519 gene locus_tag LOCUS_21700 gene fabZ 4941 4519 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048424.1 protein_id gnl|my_center|LOCUS_21700 5503 5051 gene locus_tag LOCUS_21710 gene accB 5503 5051 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194067.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence215 967 686 gene locus_tag LOCUS_21720 967 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 2931 1717 gene locus_tag LOCUS_21730 2931 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 3864 2947 gene locus_tag LOCUS_21740 gene trxB 3864 2947 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434033.1 protein_id gnl|my_center|LOCUS_21740 4040 4771 gene locus_tag LOCUS_21750 4040 4771 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_21750 4907 5548 gene locus_tag LOCUS_21760 4907 5548 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897384.1 protein_id gnl|my_center|LOCUS_21760 >Feature sequence216 429 1679 gene locus_tag LOCUS_21770 429 1679 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016211.1 protein_id gnl|my_center|LOCUS_21770 1673 2041 gene locus_tag LOCUS_21780 1673 2041 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680676.1 protein_id gnl|my_center|LOCUS_21780 2262 2606 gene locus_tag LOCUS_21790 2262 2606 CDS product phenylpyruvate tautomerase MIF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101886618.1 protein_id gnl|my_center|LOCUS_21790 3126 2848 gene locus_tag LOCUS_21800 3126 2848 CDS product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944457.1 protein_id gnl|my_center|LOCUS_21800 3413 3135 gene locus_tag LOCUS_21810 3413 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 4972 4202 gene locus_tag LOCUS_21820 4972 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 5084 5353 gene locus_tag LOCUS_21830 5084 5353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 >Feature sequence217 984 544 gene locus_tag LOCUS_21840 984 544 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902929.1 protein_id gnl|my_center|LOCUS_21840 2343 1366 gene locus_tag LOCUS_21850 gene holA 2343 1366 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942847.1 protein_id gnl|my_center|LOCUS_21850 4579 2327 gene locus_tag LOCUS_21860 4579 2327 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392112.1 protein_id gnl|my_center|LOCUS_21860 >Feature sequence218 358 795 gene locus_tag LOCUS_21870 358 795 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272575.1 protein_id gnl|my_center|LOCUS_21870 792 1988 gene locus_tag LOCUS_21880 792 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 3520 2090 gene locus_tag LOCUS_21890 3520 2090 CDS product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016013.1 protein_id gnl|my_center|LOCUS_21890 3794 4156 gene locus_tag LOCUS_21900 3794 4156 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948333.1 protein_id gnl|my_center|LOCUS_21900 4214 4861 gene locus_tag LOCUS_21910 4214 4861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 >Feature sequence219 <1 711 gene locus_tag LOCUS_21920 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964327.1:peptidoglycan-binding protein 1038 802 gene locus_tag LOCUS_21930 1038 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 1920 1219 gene locus_tag LOCUS_21940 gene sfsA 1920 1219 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461735.1 protein_id gnl|my_center|LOCUS_21940 2048 3544 gene locus_tag LOCUS_21950 gene thrC 2048 3544 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_21950 3727 4590 gene locus_tag LOCUS_21960 gene fba 3727 4590 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_21960 >Feature sequence220 311 42 gene locus_tag LOCUS_21970 311 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 1261 317 gene locus_tag LOCUS_21980 1261 317 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144034111.1 protein_id gnl|my_center|LOCUS_21980 2582 1527 gene locus_tag LOCUS_21990 gene cobD 2582 1527 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392618.1 protein_id gnl|my_center|LOCUS_21990 3594 2632 gene locus_tag LOCUS_22000 gene cbiB 3594 2632 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943620.1 protein_id gnl|my_center|LOCUS_22000 4181 3744 gene locus_tag LOCUS_22010 4181 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 4960 4178 gene locus_tag LOCUS_22020 gene cobS 4960 4178 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016745.1 protein_id gnl|my_center|LOCUS_22020 <5527 4957 gene locus_tag LOCUS_22030 <5527 4957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000261572.1:bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase >Feature sequence221 74 289 gene locus_tag LOCUS_22040 74 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 408 788 gene locus_tag LOCUS_22050 408 788 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963919.1 protein_id gnl|my_center|LOCUS_22050 840 1382 gene locus_tag LOCUS_22060 840 1382 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421255.1 protein_id gnl|my_center|LOCUS_22060 1375 2415 gene locus_tag LOCUS_22070 1375 2415 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235007.1 protein_id gnl|my_center|LOCUS_22070 2662 5118 gene locus_tag LOCUS_22080 gene clpC 2662 5118 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971183.1 protein_id gnl|my_center|LOCUS_22080 >Feature sequence222 1637 186 gene locus_tag LOCUS_22090 1637 186 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_22090 2903 1722 gene locus_tag LOCUS_22100 2903 1722 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_22100 4634 2904 gene locus_tag LOCUS_22110 4634 2904 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396717.1 protein_id gnl|my_center|LOCUS_22110 4878 4636 gene locus_tag LOCUS_22120 4878 4636 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986396.1 protein_id gnl|my_center|LOCUS_22120 >Feature sequence223 3 431 gene locus_tag LOCUS_22130 3 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 458 715 gene locus_tag LOCUS_22140 458 715 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385299.1 protein_id gnl|my_center|LOCUS_22140 986 1516 gene locus_tag LOCUS_22150 986 1516 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965782.1 protein_id gnl|my_center|LOCUS_22150 1528 1968 gene locus_tag LOCUS_22160 1528 1968 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816014.1 protein_id gnl|my_center|LOCUS_22160 3367 2135 gene locus_tag LOCUS_22170 3367 2135 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948301.1 protein_id gnl|my_center|LOCUS_22170 4601 3414 gene locus_tag LOCUS_22180 4601 3414 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966253.1 protein_id gnl|my_center|LOCUS_22180 >Feature sequence224 1435 722 gene locus_tag LOCUS_22190 1435 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 2412 1699 gene locus_tag LOCUS_22200 2412 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 3809 2445 gene locus_tag LOCUS_22210 3809 2445 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459130.1 protein_id gnl|my_center|LOCUS_22210 >Feature sequence225 1834 536 gene locus_tag LOCUS_22220 1834 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 3692 1848 gene locus_tag LOCUS_22230 3692 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 5004 3904 gene locus_tag LOCUS_22240 5004 3904 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106909.1 protein_id gnl|my_center|LOCUS_22240 >Feature sequence226 2020 3720 gene locus_tag LOCUS_22250 2020 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 3917 4921 gene locus_tag LOCUS_22260 3917 4921 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_22260 >Feature sequence227 3199 1769 gene locus_tag LOCUS_22270 3199 1769 CDS product cyclic nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990029.1 protein_id gnl|my_center|LOCUS_22270 4872 3196 gene locus_tag LOCUS_22280 4872 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 >Feature sequence228 <1 1066 gene locus_tag LOCUS_22290 <1 1066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011947996.1:preprotein translocase subunit SecA 1317 2348 gene locus_tag LOCUS_22300 gene prfB 1317 2348 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886623.1 protein_id gnl|my_center|LOCUS_22300 2516 2959 gene locus_tag LOCUS_22310 2516 2959 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964547.1 protein_id gnl|my_center|LOCUS_22310 2964 3308 gene locus_tag LOCUS_22320 2964 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 3773 3423 gene locus_tag LOCUS_22330 3773 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 >Feature sequence229 514 888 gene locus_tag LOCUS_22340 514 888 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440181.1 protein_id gnl|my_center|LOCUS_22340 892 1761 gene locus_tag LOCUS_22350 892 1761 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986585.1 protein_id gnl|my_center|LOCUS_22350 1763 2404 gene locus_tag LOCUS_22360 1763 2404 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440185.1 protein_id gnl|my_center|LOCUS_22360 2434 2820 gene locus_tag LOCUS_22370 2434 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 3480 2947 gene locus_tag LOCUS_22380 3480 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 >Feature sequence230 <1 2643 gene locus_tag LOCUS_22390 <1 2643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056426.1:1,4-alpha-glucan branching enzyme 2670 3506 gene locus_tag LOCUS_22400 2670 3506 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902661.1 protein_id gnl|my_center|LOCUS_22400 3503 5002 gene locus_tag LOCUS_22410 gene malQ 3503 5002 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747274.1 protein_id gnl|my_center|LOCUS_22410 >Feature sequence231 974 660 gene locus_tag LOCUS_22420 974 660 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810532.1 protein_id gnl|my_center|LOCUS_22420 1136 2299 gene locus_tag LOCUS_22430 1136 2299 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461849.1 protein_id gnl|my_center|LOCUS_22430 2598 3323 gene locus_tag LOCUS_22440 gene sigI 2598 3323 CDS product RNA polymerase sigma factor SigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498572.1 protein_id gnl|my_center|LOCUS_22440 3320 4270 gene locus_tag LOCUS_22450 3320 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 >Feature sequence232 61 195 gene locus_tag LOCUS_22460 61 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 316 389 gene locus_tag LOCUS_t00290 316 389 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1495 581 gene locus_tag LOCUS_22470 1495 581 CDS product DUF4261 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681717.1 protein_id gnl|my_center|LOCUS_22470 3875 1551 gene locus_tag LOCUS_22480 3875 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 <5265 3937 gene locus_tag LOCUS_22490 <5265 3937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107996.1:DUF4132 domain-containing protein >Feature sequence233 <1 657 gene locus_tag LOCUS_22500 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948416.1:DUF4317 domain-containing protein 1601 654 gene locus_tag LOCUS_22510 1601 654 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898522.1 protein_id gnl|my_center|LOCUS_22510 2723 1716 gene locus_tag LOCUS_22520 gene asnA 2723 1716 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476128.1 protein_id gnl|my_center|LOCUS_22520 2839 3021 gene locus_tag LOCUS_22530 2839 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 2997 4067 gene locus_tag LOCUS_22540 2997 4067 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557353.1 protein_id gnl|my_center|LOCUS_22540 4114 4608 gene locus_tag LOCUS_22550 4114 4608 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_22550 >Feature sequence234 193 1053 gene locus_tag LOCUS_22560 193 1053 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986643.1 protein_id gnl|my_center|LOCUS_22560 1050 3062 gene locus_tag LOCUS_22570 1050 3062 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986642.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22570 2947 3249 gene locus_tag LOCUS_22580 2947 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 3227 3958 gene locus_tag LOCUS_22590 3227 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 4448 4083 gene locus_tag LOCUS_22600 4448 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 5171 4476 gene locus_tag LOCUS_22610 5171 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 >Feature sequence235 1873 929 gene locus_tag LOCUS_22620 1873 929 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_22620 2697 1861 gene locus_tag LOCUS_22630 2697 1861 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_22630 3534 2794 gene locus_tag LOCUS_22640 gene sigE 3534 2794 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774280.1 protein_id gnl|my_center|LOCUS_22640 4434 3589 gene locus_tag LOCUS_22650 gene spoIIGA 4434 3589 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170291042.1 protein_id gnl|my_center|LOCUS_22650 >Feature sequence236 1284 1715 gene locus_tag LOCUS_22660 1284 1715 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681082.1 protein_id gnl|my_center|LOCUS_22660 1995 2564 gene locus_tag LOCUS_22670 1995 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 2685 3746 gene locus_tag LOCUS_22680 2685 3746 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812249.1 protein_id gnl|my_center|LOCUS_22680 3994 4758 gene locus_tag LOCUS_22690 3994 4758 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_22690 >Feature sequence237 650 1783 gene locus_tag LOCUS_22700 650 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146490.1 protein_id gnl|my_center|LOCUS_22700 1835 3013 gene locus_tag LOCUS_22710 1835 3013 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459641.1 protein_id gnl|my_center|LOCUS_22710 4611 3124 gene locus_tag LOCUS_22720 4611 3124 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890565.1 protein_id gnl|my_center|LOCUS_22720 >Feature sequence238 1154 303 gene locus_tag LOCUS_22730 1154 303 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964110.1 protein_id gnl|my_center|LOCUS_22730 2307 1147 gene locus_tag LOCUS_22740 gene iadA 2307 1147 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113054.1 protein_id gnl|my_center|LOCUS_22740 3761 2319 gene locus_tag LOCUS_22750 gene nhaC 3761 2319 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261868.1 protein_id gnl|my_center|LOCUS_22750 4961 4248 gene locus_tag LOCUS_22760 4961 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 >Feature sequence239 1452 775 gene locus_tag LOCUS_22770 1452 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 1602 2429 gene locus_tag LOCUS_22780 gene pdaB 1602 2429 CDS product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965679.1 protein_id gnl|my_center|LOCUS_22780 3196 2426 gene locus_tag LOCUS_22790 3196 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 3959 3408 gene locus_tag LOCUS_22800 3959 3408 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180154.1 protein_id gnl|my_center|LOCUS_22800 4209 4895 gene locus_tag LOCUS_22810 4209 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 >Feature sequence240 245 919 gene locus_tag LOCUS_22820 gene pyrE 245 919 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_22820 930 1079 gene locus_tag LOCUS_22830 930 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 1091 1690 gene locus_tag LOCUS_22840 1091 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 1671 1994 gene locus_tag LOCUS_22850 1671 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 2017 4131 gene locus_tag LOCUS_22860 2017 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 4406 4924 gene locus_tag LOCUS_22870 gene purE 4406 4924 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081520.1 protein_id gnl|my_center|LOCUS_22870 >Feature sequence241 1169 387 gene locus_tag LOCUS_22880 1169 387 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917001.1 protein_id gnl|my_center|LOCUS_22880 4367 1257 gene locus_tag LOCUS_22890 4367 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 >Feature sequence242 218 820 gene locus_tag LOCUS_22900 218 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 832 1833 gene locus_tag LOCUS_22910 832 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 2986 2006 gene locus_tag LOCUS_22920 2986 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 3082 4488 gene locus_tag LOCUS_22930 3082 4488 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930859.1 protein_id gnl|my_center|LOCUS_22930 >Feature sequence243 645 824 gene locus_tag LOCUS_22940 645 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 1141 1069 gene locus_tag LOCUS_t00300 1141 1069 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2158 1427 gene locus_tag LOCUS_22950 2158 1427 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724779.1 protein_id gnl|my_center|LOCUS_22950 2831 2148 gene locus_tag LOCUS_22960 2831 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 3843 2992 gene locus_tag LOCUS_22970 3843 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 5061 4159 gene locus_tag LOCUS_22980 5061 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 >Feature sequence244 1173 1436 gene locus_tag LOCUS_22990 1173 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 1900 1355 gene locus_tag LOCUS_23000 1900 1355 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909489.1 protein_id gnl|my_center|LOCUS_23000 2260 2751 gene locus_tag LOCUS_23010 2260 2751 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813613.1 protein_id gnl|my_center|LOCUS_23010 2748 4223 gene locus_tag LOCUS_23020 2748 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 4932 4513 gene locus_tag LOCUS_23030 gene tnpA 4932 4513 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966797.1 protein_id gnl|my_center|LOCUS_23030 >Feature sequence245 36 695 gene locus_tag LOCUS_23040 36 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 680 1426 gene locus_tag LOCUS_23050 680 1426 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662263.1 protein_id gnl|my_center|LOCUS_23050 1435 1692 gene locus_tag LOCUS_23060 1435 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 1689 2666 gene locus_tag LOCUS_23070 1689 2666 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948398.1 protein_id gnl|my_center|LOCUS_23070 2861 4408 gene locus_tag LOCUS_23080 2861 4408 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288002.1 protein_id gnl|my_center|LOCUS_23080 >Feature sequence246 1123 308 gene locus_tag LOCUS_23090 1123 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 1673 1104 gene locus_tag LOCUS_23100 1673 1104 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141737.1 protein_id gnl|my_center|LOCUS_23100 2614 2117 gene locus_tag LOCUS_23110 2614 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 4092 2611 gene locus_tag LOCUS_23120 4092 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 4797 4183 gene locus_tag LOCUS_23130 4797 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 5003 4845 gene locus_tag LOCUS_23140 5003 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 >Feature sequence247 <1 1140 gene locus_tag LOCUS_23150 <1 1140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965990.1:chaperonin GroEL 1353 1850 gene locus_tag LOCUS_23160 1353 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 2073 3527 gene locus_tag LOCUS_23170 gene guaB 2073 3527 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965988.1 protein_id gnl|my_center|LOCUS_23170 4838 3810 gene locus_tag LOCUS_23180 4838 3810 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435007.1 protein_id gnl|my_center|LOCUS_23180 >Feature sequence248 540 43 gene locus_tag LOCUS_23190 gene ybaK 540 43 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788187.1 protein_id gnl|my_center|LOCUS_23190 1352 537 gene locus_tag LOCUS_23200 1352 537 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027122.1 protein_id gnl|my_center|LOCUS_23200 2679 1465 gene locus_tag LOCUS_23210 2679 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 3385 2864 gene locus_tag LOCUS_23220 3385 2864 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836897.1 protein_id gnl|my_center|LOCUS_23220 3573 4373 gene locus_tag LOCUS_23230 3573 4373 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836613.1 protein_id gnl|my_center|LOCUS_23230 >Feature sequence249 801 286 gene locus_tag LOCUS_23240 801 286 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681932.1 protein_id gnl|my_center|LOCUS_23240 961 2019 gene locus_tag LOCUS_23250 961 2019 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966323.1 protein_id gnl|my_center|LOCUS_23250 3117 2074 gene locus_tag LOCUS_23260 3117 2074 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681302.1 protein_id gnl|my_center|LOCUS_23260 <4923 3128 gene locus_tag LOCUS_23270 <4923 3128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788368.1:ribonucleoside-diphosphate reductase subunit alpha >Feature sequence250 1502 294 gene locus_tag LOCUS_23280 1502 294 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_23280 1676 3064 gene locus_tag LOCUS_23290 1676 3064 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965017.1 protein_id gnl|my_center|LOCUS_23290 3066 4394 gene locus_tag LOCUS_23300 gene der 3066 4394 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986848.1 protein_id gnl|my_center|LOCUS_23300 >Feature sequence251 393 1100 gene locus_tag LOCUS_23310 gene rnc 393 1100 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_23310 1112 4672 gene locus_tag LOCUS_23320 gene smc 1112 4672 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047863.1 protein_id gnl|my_center|LOCUS_23320 >Feature sequence252 967 149 gene locus_tag LOCUS_23330 967 149 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061891.1 protein_id gnl|my_center|LOCUS_23330 1872 964 gene locus_tag LOCUS_23340 1872 964 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727392.1 protein_id gnl|my_center|LOCUS_23340 2124 3023 gene locus_tag LOCUS_23350 2124 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23350 3105 3713 gene locus_tag LOCUS_23360 gene artQ 3105 3713 CDS product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230340.1 protein_id gnl|my_center|LOCUS_23360 3697 4419 gene locus_tag LOCUS_23370 3697 4419 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590206.1 protein_id gnl|my_center|LOCUS_23370 >Feature sequence253 2125 260 gene locus_tag LOCUS_23380 2125 260 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813245.1 protein_id gnl|my_center|LOCUS_23380 3033 2347 gene locus_tag LOCUS_23390 3033 2347 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461732.1 protein_id gnl|my_center|LOCUS_23390 3187 4653 gene locus_tag LOCUS_23400 3187 4653 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306203.1 protein_id gnl|my_center|LOCUS_23400 >Feature sequence254 <1 698 gene locus_tag LOCUS_23410 <1 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808885.1:DMT family transporter 1048 3615 gene locus_tag LOCUS_23420 1048 3615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 >Feature sequence255 629 1720 gene locus_tag LOCUS_23430 gene trpS 629 1720 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_23430 1887 2846 gene locus_tag LOCUS_23440 1887 2846 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867187.1 protein_id gnl|my_center|LOCUS_23440 2956 3564 gene locus_tag LOCUS_23450 2956 3564 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_23450 4069 4491 gene locus_tag LOCUS_23460 gene mraZ 4069 4491 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625480.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence256 600 2645 gene locus_tag LOCUS_23470 600 2645 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_23470 2645 3091 gene locus_tag LOCUS_23480 gene rplI 2645 3091 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_23480 3102 4445 gene locus_tag LOCUS_23490 gene dnaB 3102 4445 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_23490 >Feature sequence257 1854 622 gene locus_tag LOCUS_23500 1854 622 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 protein_id gnl|my_center|LOCUS_23500 2068 2997 gene locus_tag LOCUS_23510 2068 2997 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234240.1 protein_id gnl|my_center|LOCUS_23510 3469 3143 gene locus_tag LOCUS_23520 3469 3143 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583235.1 protein_id gnl|my_center|LOCUS_23520 4115 3591 gene locus_tag LOCUS_23530 gene cobO 4115 3591 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392864.1 protein_id gnl|my_center|LOCUS_23530 <4755 4112 gene locus_tag LOCUS_23540 <4755 4112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860946.1:ATP-dependent helicase >Feature sequence258 293 910 gene locus_tag LOCUS_23550 293 910 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964199.1 protein_id gnl|my_center|LOCUS_23550 2348 1050 gene locus_tag LOCUS_23560 2348 1050 CDS product CitMHS family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222940.1 protein_id gnl|my_center|LOCUS_23560 4136 2367 gene locus_tag LOCUS_23570 4136 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 >Feature sequence259 801 1295 gene locus_tag LOCUS_23580 801 1295 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948566.1 protein_id gnl|my_center|LOCUS_23580 1566 1303 gene locus_tag LOCUS_23590 1566 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23590 2008 1574 gene locus_tag LOCUS_23600 2008 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23600 3095 1998 gene locus_tag LOCUS_23610 3095 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 4682 3138 gene locus_tag LOCUS_23620 4682 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 >Feature sequence260 919 497 gene locus_tag LOCUS_23630 919 497 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943560.1 protein_id gnl|my_center|LOCUS_23630 2520 1132 gene locus_tag LOCUS_23640 2520 1132 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_23640 3147 2542 gene locus_tag LOCUS_23650 3147 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 3932 3276 gene locus_tag LOCUS_23660 3932 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 <4645 3952 gene locus_tag LOCUS_23670 <4645 3952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047995.1:GTPase Era >Feature sequence261 102 755 gene locus_tag LOCUS_23680 102 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 765 1304 gene locus_tag LOCUS_23690 765 1304 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_23690 1311 1814 gene locus_tag LOCUS_23700 gene greA 1311 1814 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391698.1 protein_id gnl|my_center|LOCUS_23700 2550 1930 gene locus_tag LOCUS_23710 2550 1930 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986538.1 protein_id gnl|my_center|LOCUS_23710 2928 4226 gene locus_tag LOCUS_23720 2928 4226 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986389.1 protein_id gnl|my_center|LOCUS_23720 >Feature sequence262 2219 1542 gene locus_tag LOCUS_23730 2219 1542 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_23730 2979 2212 gene locus_tag LOCUS_23740 2979 2212 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 protein_id gnl|my_center|LOCUS_23740 >Feature sequence263 544 128 gene locus_tag LOCUS_23750 544 128 CDS product DUF3788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022471380.1 protein_id gnl|my_center|LOCUS_23750 1233 568 gene locus_tag LOCUS_23760 1233 568 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267179.1 protein_id gnl|my_center|LOCUS_23760 2210 1341 gene locus_tag LOCUS_23770 2210 1341 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059810.1 protein_id gnl|my_center|LOCUS_23770 2365 2895 gene locus_tag LOCUS_23780 2365 2895 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964325.1 protein_id gnl|my_center|LOCUS_23780 2892 3593 gene locus_tag LOCUS_23790 2892 3593 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440228.1 protein_id gnl|my_center|LOCUS_23790 <4571 3565 gene locus_tag LOCUS_23800 <4571 3565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003231837.1:glycine C-acetyltransferase >Feature sequence264 819 508 gene locus_tag LOCUS_23810 819 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 963 1127 gene locus_tag LOCUS_23820 963 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 1208 1465 gene locus_tag LOCUS_23830 1208 1465 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885335.1 protein_id gnl|my_center|LOCUS_23830 1681 1535 gene locus_tag LOCUS_23840 1681 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 2122 2445 gene locus_tag LOCUS_23850 2122 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 2824 2672 gene locus_tag LOCUS_23860 2824 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 3416 2889 gene locus_tag LOCUS_23870 3416 2889 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682427.1 protein_id gnl|my_center|LOCUS_23870 3831 3406 gene locus_tag LOCUS_23880 3831 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 >Feature sequence265 29 104 gene locus_tag LOCUS_t00310 29 104 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 111 184 gene locus_tag LOCUS_t00320 111 184 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 204 278 gene locus_tag LOCUS_t00330 204 278 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 428 2086 gene locus_tag LOCUS_23890 428 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 2347 2117 gene locus_tag LOCUS_23900 2347 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 2534 3991 gene locus_tag LOCUS_23910 2534 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 >Feature sequence266 314 81 gene locus_tag LOCUS_23920 314 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 904 377 gene locus_tag LOCUS_23930 904 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 2340 928 gene locus_tag LOCUS_23940 2340 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 2562 3290 gene locus_tag LOCUS_23950 2562 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 3485 4102 gene locus_tag LOCUS_23960 3485 4102 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_23960 4556 4314 gene locus_tag LOCUS_23970 4556 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 >Feature sequence267 664 1674 gene locus_tag LOCUS_23980 664 1674 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549977.1 protein_id gnl|my_center|LOCUS_23980 1684 2535 gene locus_tag LOCUS_23990 1684 2535 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965563.1 protein_id gnl|my_center|LOCUS_23990 2532 2969 gene locus_tag LOCUS_24000 2532 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 3162 4379 gene locus_tag LOCUS_24010 3162 4379 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861646.1 protein_id gnl|my_center|LOCUS_24010 >Feature sequence268 2174 1266 gene locus_tag LOCUS_24020 2174 1266 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064724.1 protein_id gnl|my_center|LOCUS_24020 3490 2198 gene locus_tag LOCUS_24030 3490 2198 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368318.1 protein_id gnl|my_center|LOCUS_24030 >Feature sequence269 1412 339 gene locus_tag LOCUS_24040 1412 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 1909 1418 gene locus_tag LOCUS_24050 gene trmL 1909 1418 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016664.1 protein_id gnl|my_center|LOCUS_24050 3094 1916 gene locus_tag LOCUS_24060 3094 1916 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_24060 3573 3091 gene locus_tag LOCUS_24070 3573 3091 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_24070 4275 3691 gene locus_tag LOCUS_24080 4275 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 >Feature sequence270 955 320 gene locus_tag LOCUS_24090 955 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 1976 936 gene locus_tag LOCUS_24100 1976 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 2842 1967 gene locus_tag LOCUS_24110 2842 1967 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837256.1 protein_id gnl|my_center|LOCUS_24110 4411 2927 gene locus_tag LOCUS_24120 4411 2927 CDS product isopeptide-forming domain-containing fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837257.1 protein_id gnl|my_center|LOCUS_24120 >Feature sequence271 795 316 gene locus_tag LOCUS_24130 795 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 1104 2459 gene locus_tag LOCUS_24140 1104 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 2472 2768 gene locus_tag LOCUS_24150 2472 2768 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385299.1 protein_id gnl|my_center|LOCUS_24150 2836 4026 gene locus_tag LOCUS_24160 2836 4026 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898600.1 protein_id gnl|my_center|LOCUS_24160 >Feature sequence272 186 809 gene locus_tag LOCUS_24170 186 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 964 836 gene locus_tag LOCUS_24180 964 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 1917 967 gene locus_tag LOCUS_24190 1917 967 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715339.1 protein_id gnl|my_center|LOCUS_24190 2863 2123 gene locus_tag LOCUS_24200 gene rlmB 2863 2123 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093759.1 protein_id gnl|my_center|LOCUS_24200 3282 2863 gene locus_tag LOCUS_24210 3282 2863 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356056.1 protein_id gnl|my_center|LOCUS_24210 <4445 3279 gene locus_tag LOCUS_24220 <4445 3279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009895184.1:cysteine--tRNA ligase >Feature sequence273 2079 922 gene locus_tag LOCUS_24230 2079 922 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944494.1 protein_id gnl|my_center|LOCUS_24230 2658 2092 gene locus_tag LOCUS_24240 gene yfcE 2658 2092 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_24240 3254 2886 gene locus_tag LOCUS_24250 3254 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 3530 3339 gene locus_tag LOCUS_24260 3530 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 4273 3596 gene locus_tag LOCUS_24270 4273 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 >Feature sequence274 3 158 gene locus_tag LOCUS_24280 3 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 430 1200 gene locus_tag LOCUS_24290 430 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 1355 2008 gene locus_tag LOCUS_24300 1355 2008 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263190.1 protein_id gnl|my_center|LOCUS_24300 2021 2797 gene locus_tag LOCUS_24310 2021 2797 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_24310 2794 3672 gene locus_tag LOCUS_24320 gene hslO 2794 3672 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_24320 3686 4120 gene locus_tag LOCUS_24330 3686 4120 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289317.1 protein_id gnl|my_center|LOCUS_24330 >Feature sequence275 2808 436 gene locus_tag LOCUS_24340 2808 436 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678883.1 protein_id gnl|my_center|LOCUS_24340 4238 2985 gene locus_tag LOCUS_24350 gene hflX 4238 2985 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030461.1 protein_id gnl|my_center|LOCUS_24350 >Feature sequence276 992 396 gene locus_tag LOCUS_24360 gene recR 992 396 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359478.1 protein_id gnl|my_center|LOCUS_24360 1347 994 gene locus_tag LOCUS_24370 1347 994 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_24370 3080 1359 gene locus_tag LOCUS_24380 3080 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 4166 3099 gene locus_tag LOCUS_24390 4166 3099 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_24390 >Feature sequence277 57 488 gene locus_tag LOCUS_24400 57 488 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666607.1 protein_id gnl|my_center|LOCUS_24400 813 1769 gene locus_tag LOCUS_24410 813 1769 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994130.1 protein_id gnl|my_center|LOCUS_24410 1766 2569 gene locus_tag LOCUS_24420 1766 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 3072 2605 gene locus_tag LOCUS_24430 3072 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 3202 3900 gene locus_tag LOCUS_24440 3202 3900 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234514.1 protein_id gnl|my_center|LOCUS_24440 >Feature sequence278 <1 1350 gene locus_tag LOCUS_24450 <1 1350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436266.1:excinuclease ABC subunit UvrA 1354 2496 gene locus_tag LOCUS_24460 gene iadA 1354 2496 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568397.1 protein_id gnl|my_center|LOCUS_24460 2586 4127 gene locus_tag LOCUS_24470 gene guaA 2586 4127 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_24470 >Feature sequence279 1 321 gene locus_tag LOCUS_24480 1 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 919 1524 gene locus_tag LOCUS_24490 919 1524 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_24490 1731 2243 gene locus_tag LOCUS_24500 1731 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 2240 2836 gene locus_tag LOCUS_24510 gene lepB 2240 2836 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014917214.1 protein_id gnl|my_center|LOCUS_24510 >Feature sequence280 1059 3158 gene locus_tag LOCUS_24520 gene fusA 1059 3158 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 protein_id gnl|my_center|LOCUS_24520 3514 4104 gene locus_tag LOCUS_24530 3514 4104 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071130048.1 protein_id gnl|my_center|LOCUS_24530 >Feature sequence281 728 1657 gene locus_tag LOCUS_24540 728 1657 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033580.1 protein_id gnl|my_center|LOCUS_24540 1673 2338 gene locus_tag LOCUS_24550 1673 2338 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358158.1 protein_id gnl|my_center|LOCUS_24550 2418 3857 gene locus_tag LOCUS_24560 2418 3857 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965348.1 protein_id gnl|my_center|LOCUS_24560 >Feature sequence282 145 777 gene locus_tag LOCUS_24570 145 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 935 1609 gene locus_tag LOCUS_24580 935 1609 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814489.1 protein_id gnl|my_center|LOCUS_24580 1633 2478 gene locus_tag LOCUS_24590 1633 2478 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289121.1 protein_id gnl|my_center|LOCUS_24590 3917 2487 gene locus_tag LOCUS_24600 3917 2487 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838678.1 protein_id gnl|my_center|LOCUS_24600 >Feature sequence283 283 1488 gene locus_tag LOCUS_24610 283 1488 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460662.1 protein_id gnl|my_center|LOCUS_24610 1560 1682 gene locus_tag LOCUS_24620 1560 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 1913 3292 gene locus_tag LOCUS_24630 1913 3292 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_24630 >Feature sequence284 2470 47 gene locus_tag LOCUS_24640 gene pheT 2470 47 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_24640 3514 2495 gene locus_tag LOCUS_24650 gene pheS 3514 2495 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965654.1 protein_id gnl|my_center|LOCUS_24650 >Feature sequence285 644 24 gene locus_tag LOCUS_24660 gene udk 644 24 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225916.1 protein_id gnl|my_center|LOCUS_24660 1812 874 gene locus_tag LOCUS_24670 1812 874 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966679.1 protein_id gnl|my_center|LOCUS_24670 2037 2594 gene locus_tag LOCUS_24680 2037 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 2867 3823 gene locus_tag LOCUS_24690 2867 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056248.1 protein_id gnl|my_center|LOCUS_24690 >Feature sequence286 >Feature sequence287 1391 600 gene locus_tag LOCUS_24700 1391 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 2639 1404 gene locus_tag LOCUS_24710 2639 1404 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294683.1 protein_id gnl|my_center|LOCUS_24710 3776 2667 gene locus_tag LOCUS_24720 3776 2667 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963366.1 protein_id gnl|my_center|LOCUS_24720 >Feature sequence288 <1 672 gene locus_tag LOCUS_24730 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817323.1:MogA/MoaB family molybdenum cofactor biosynthesis protein 711 1676 gene locus_tag LOCUS_24740 gene modA 711 1676 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860975.1 protein_id gnl|my_center|LOCUS_24740 1686 2360 gene locus_tag LOCUS_24750 gene modB 1686 2360 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937491.1 protein_id gnl|my_center|LOCUS_24750 2357 3400 gene locus_tag LOCUS_24760 2357 3400 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888694.1 protein_id gnl|my_center|LOCUS_24760 >Feature sequence289 <1 933 gene locus_tag LOCUS_24770 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966273.1:methionine--tRNA ligase 1737 1093 gene locus_tag LOCUS_24780 gene pcp 1737 1093 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287081.1 protein_id gnl|my_center|LOCUS_24780 2781 1837 gene locus_tag LOCUS_24790 2781 1837 CDS product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287082.1 protein_id gnl|my_center|LOCUS_24790 3497 2784 gene locus_tag LOCUS_24800 3497 2784 CDS product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024797200.1 protein_id gnl|my_center|LOCUS_24800 >Feature sequence290 1767 580 gene locus_tag LOCUS_24810 1767 580 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861090.1 protein_id gnl|my_center|LOCUS_24810 1939 3120 gene locus_tag LOCUS_24820 1939 3120 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861090.1 protein_id gnl|my_center|LOCUS_24820 <3915 3230 gene locus_tag LOCUS_24830 <3915 3230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002262369.1:LysR family transcriptional regulator >Feature sequence291 <1 1701 gene locus_tag LOCUS_24840 <1 1701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584100.1:diguanylate cyclase 2588 1869 gene locus_tag LOCUS_24850 2588 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 >Feature sequence292 >Feature sequence293 588 316 gene locus_tag LOCUS_24860 588 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 1041 958 gene locus_tag LOCUS_t00340 1041 958 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1130 1047 gene locus_tag LOCUS_t00350 1130 1047 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1545 1219 gene locus_tag LOCUS_24870 1545 1219 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 protein_id gnl|my_center|LOCUS_24870 1757 3355 gene locus_tag LOCUS_24880 1757 3355 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015673.1 protein_id gnl|my_center|LOCUS_24880 >Feature sequence294 2894 1428 gene locus_tag LOCUS_24890 gene gltX 2894 1428 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964308.1 protein_id gnl|my_center|LOCUS_24890 >Feature sequence295 1426 353 gene locus_tag LOCUS_24900 1426 353 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902589.1 protein_id gnl|my_center|LOCUS_24900 2592 1516 gene locus_tag LOCUS_24910 2592 1516 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_24910 3784 2645 gene locus_tag LOCUS_24920 3784 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 >Feature sequence296 1474 554 gene locus_tag LOCUS_24930 1474 554 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101316.1 protein_id gnl|my_center|LOCUS_24930 1551 1679 gene locus_tag LOCUS_24940 1551 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 1730 3214 gene locus_tag LOCUS_24950 1730 3214 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101282.1 protein_id gnl|my_center|LOCUS_24950 >Feature sequence297 1611 919 gene locus_tag LOCUS_24960 1611 919 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_24960 3215 1827 gene locus_tag LOCUS_24970 3215 1827 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 protein_id gnl|my_center|LOCUS_24970 <3800 3216 gene locus_tag LOCUS_24980 <3800 3216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861729.1:MATE family efflux transporter >Feature sequence298 2080 1007 gene locus_tag LOCUS_24990 2080 1007 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898508.1 protein_id gnl|my_center|LOCUS_24990 3007 2150 gene locus_tag LOCUS_25000 3007 2150 CDS product anti-sigma-V factor rsiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436661.1 protein_id gnl|my_center|LOCUS_25000 3501 3004 gene locus_tag LOCUS_25010 3501 3004 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813613.1 protein_id gnl|my_center|LOCUS_25010 >Feature sequence299 <1 804 gene locus_tag LOCUS_25020 <1 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852607.1:tyrosine-type recombinase/integrase 1059 1190 gene locus_tag LOCUS_25030 1059 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 1227 2288 gene locus_tag LOCUS_25040 1227 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 2445 3266 gene locus_tag LOCUS_25050 2445 3266 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044978750.1 protein_id gnl|my_center|LOCUS_25050 3298 3576 gene locus_tag LOCUS_25060 3298 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 >Feature sequence300 1698 424 gene locus_tag LOCUS_25070 gene purD 1698 424 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_25070 2297 1695 gene locus_tag LOCUS_25080 gene purN 2297 1695 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_25080 3322 2291 gene locus_tag LOCUS_25090 gene purM 3322 2291 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262439.1 protein_id gnl|my_center|LOCUS_25090 >Feature sequence301 <1 1545 gene locus_tag LOCUS_25100 <1 1545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048336.1:FAD-dependent oxidoreductase 1542 2393 gene locus_tag LOCUS_25110 gene proB 1542 2393 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_25110 2805 3026 gene locus_tag LOCUS_25120 2805 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 3031 3603 gene locus_tag LOCUS_25130 3031 3603 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_25130 >Feature sequence302 <1 755 gene locus_tag LOCUS_25140 <1 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_157860128.1:lectin like domain-containing protein 772 1386 gene locus_tag LOCUS_25150 772 1386 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357527.1 protein_id gnl|my_center|LOCUS_25150 1383 1874 gene locus_tag LOCUS_25160 1383 1874 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435609.1 protein_id gnl|my_center|LOCUS_25160 2617 2009 gene locus_tag LOCUS_25170 2617 2009 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435157.1 protein_id gnl|my_center|LOCUS_25170 >Feature sequence303 <1 917 gene locus_tag LOCUS_25180 <1 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012099547.1:YjjI family glycine radical enzyme 914 1756 gene locus_tag LOCUS_25190 914 1756 CDS product YjjW family glycine radical enzyme activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099548.1 protein_id gnl|my_center|LOCUS_25190 2490 1789 gene locus_tag LOCUS_25200 2490 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 >Feature sequence304 1648 3060 gene locus_tag LOCUS_25210 1648 3060 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732174.1 protein_id gnl|my_center|LOCUS_25210 >Feature sequence305 2063 1731 gene locus_tag LOCUS_25220 2063 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 <3592 2402 gene locus_tag LOCUS_25230 <3592 2402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836754.1:DNA helicase PcrA >Feature sequence306 154 1326 gene locus_tag LOCUS_25240 154 1326 CDS product NEW3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107521.1 protein_id gnl|my_center|LOCUS_25240 1368 2369 gene locus_tag LOCUS_25250 1368 2369 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228695.1 protein_id gnl|my_center|LOCUS_25250 2395 3327 gene locus_tag LOCUS_25260 2395 3327 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761587.1 protein_id gnl|my_center|LOCUS_25260 >Feature sequence307 1901 270 gene locus_tag LOCUS_25270 gene nikA 1901 270 CDS product nickel ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493122.1 protein_id gnl|my_center|LOCUS_25270 2920 2006 gene locus_tag LOCUS_25280 2920 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 >Feature sequence308 3252 1384 gene locus_tag LOCUS_25290 3252 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 >Feature sequence309 719 231 gene locus_tag LOCUS_25300 gene rplJ 719 231 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421187.1 protein_id gnl|my_center|LOCUS_25300 1746 991 gene locus_tag LOCUS_25310 1746 991 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_25310 <3524 1871 gene locus_tag LOCUS_25320 <3524 1871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011947993.1:ATP-dependent RecD-like DNA helicase >Feature sequence310 715 1161 gene locus_tag LOCUS_25330 715 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 1166 2554 gene locus_tag LOCUS_25340 1166 2554 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_25340 >Feature sequence311 41 472 gene locus_tag LOCUS_25350 41 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 503 958 gene locus_tag LOCUS_25360 gene spoVAC 503 958 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944604.1 protein_id gnl|my_center|LOCUS_25360 976 2055 gene locus_tag LOCUS_25370 gene spoVAD 976 2055 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_25370 2058 2417 gene locus_tag LOCUS_25380 gene spoVAE 2058 2417 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418423.1 protein_id gnl|my_center|LOCUS_25380 2876 2553 gene locus_tag LOCUS_25390 2876 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25390 3427 2864 gene locus_tag LOCUS_25400 3427 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25400 >Feature sequence312 808 128 gene locus_tag LOCUS_25410 808 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 1005 1868 gene locus_tag LOCUS_25420 1005 1868 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047035641.1 protein_id gnl|my_center|LOCUS_25420 1872 3296 gene locus_tag LOCUS_25430 1872 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 >Feature sequence313 2005 1232 gene locus_tag LOCUS_25440 2005 1232 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815786.1 protein_id gnl|my_center|LOCUS_25440 2690 2016 gene locus_tag LOCUS_25450 2690 2016 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262170.1 protein_id gnl|my_center|LOCUS_25450 <3462 2774 gene locus_tag LOCUS_25460 <3462 2774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948208.1:amino acid ABC transporter substrate-binding protein >Feature sequence314 2731 1661 gene locus_tag LOCUS_25470 2731 1661 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966353.1 protein_id gnl|my_center|LOCUS_25470 <3435 2840 gene locus_tag LOCUS_25480 <3435 2840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000521474.1:phosphoglucosamine mutase >Feature sequence315 62 2314 gene locus_tag LOCUS_25490 62 2314 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461874.1 protein_id gnl|my_center|LOCUS_25490 2360 2674 gene locus_tag LOCUS_25500 2360 2674 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_25500 2713 2904 gene locus_tag LOCUS_25510 2713 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 3120 3195 gene locus_tag LOCUS_t00360 3120 3195 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3202 3273 gene locus_tag LOCUS_t00370 3202 3273 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3307 3380 gene locus_tag LOCUS_t00380 3307 3380 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence316 <1 1031 gene locus_tag LOCUS_25520 <1 1031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979482.1:ATP synthase subunit B 1043 1663 gene locus_tag LOCUS_25530 1043 1663 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 protein_id gnl|my_center|LOCUS_25530 1796 2470 gene locus_tag LOCUS_25540 1796 2470 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254956.1 protein_id gnl|my_center|LOCUS_25540 2467 3177 gene locus_tag LOCUS_25550 2467 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 >Feature sequence317 1 1086 gene locus_tag LOCUS_25560 1 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 1100 2275 gene locus_tag LOCUS_25570 1100 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 2294 3031 gene locus_tag LOCUS_25580 2294 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 >Feature sequence318 1070 444 gene locus_tag LOCUS_25590 1070 444 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422086.1 protein_id gnl|my_center|LOCUS_25590 1971 1204 gene locus_tag LOCUS_25600 1971 1204 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942064.1 protein_id gnl|my_center|LOCUS_25600 <3367 2040 gene locus_tag LOCUS_25610 <3367 2040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986794.1:PolC-type DNA polymerase III >Feature sequence319 1241 705 gene locus_tag LOCUS_25620 1241 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25620 <3292 1348 gene locus_tag LOCUS_25630 <3292 1348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003246684.1:DNA topoisomerase III >Feature sequence320 3 710 gene locus_tag LOCUS_25640 3 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 825 1925 gene locus_tag LOCUS_25650 825 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 2139 2858 gene locus_tag LOCUS_25660 2139 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 >Feature sequence321 2315 129 gene locus_tag LOCUS_25670 2315 129 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111154492.1 protein_id gnl|my_center|LOCUS_25670 >Feature sequence322 242 520 gene locus_tag LOCUS_25680 242 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 517 1458 gene locus_tag LOCUS_25690 517 1458 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020472.1 protein_id gnl|my_center|LOCUS_25690 1473 2045 gene locus_tag LOCUS_25700 1473 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 2049 2915 gene locus_tag LOCUS_25710 2049 2915 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787284.1 protein_id gnl|my_center|LOCUS_25710 >Feature sequence323 <1 692 gene locus_tag LOCUS_25720 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880858.1:ATP-dependent Clp protease ATP-binding subunit ClpX 2429 675 gene locus_tag LOCUS_25730 2429 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 2614 3099 gene locus_tag LOCUS_25740 gene lspA 2614 3099 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399621.1 protein_id gnl|my_center|LOCUS_25740 >Feature sequence324 <3231 1459 gene locus_tag LOCUS_25750 <3231 1459 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704393.1:response regulator >Feature sequence325 1633 95 gene locus_tag LOCUS_25760 1633 95 CDS product Lsa family ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987127.1 protein_id gnl|my_center|LOCUS_25760 2349 2813 gene locus_tag LOCUS_25770 2349 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 >Feature sequence326 763 41 gene locus_tag LOCUS_25780 763 41 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028020226.1 protein_id gnl|my_center|LOCUS_25780 1340 858 gene locus_tag LOCUS_25790 gene tadA 1340 858 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 protein_id gnl|my_center|LOCUS_25790 1574 2281 gene locus_tag LOCUS_25800 1574 2281 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_25800 3019 2417 gene locus_tag LOCUS_25810 3019 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 >Feature sequence327 637 1974 gene locus_tag LOCUS_25820 637 1974 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809868.1 protein_id gnl|my_center|LOCUS_25820 2984 2070 gene locus_tag LOCUS_25830 gene argF 2984 2070 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_25830 >Feature sequence328 <1 1252 gene locus_tag LOCUS_25840 <1 1252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006996423.1:Na+/H+ antiporter NhaC family protein 1342 1890 gene locus_tag LOCUS_25850 gene spoVT 1342 1890 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391631.1 protein_id gnl|my_center|LOCUS_25850 2800 2003 gene locus_tag LOCUS_25860 2800 2003 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_25860 >Feature sequence329 1782 454 gene locus_tag LOCUS_25870 1782 454 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436703.1 protein_id gnl|my_center|LOCUS_25870 1866 2669 gene locus_tag LOCUS_25880 1866 2669 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434903.1 protein_id gnl|my_center|LOCUS_25880 2869 3042 gene locus_tag LOCUS_25890 2869 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 >Feature sequence330 3094 2216 gene locus_tag LOCUS_25900 3094 2216 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385464.1 protein_id gnl|my_center|LOCUS_25900 >Feature sequence331 1802 819 gene locus_tag LOCUS_25910 1802 819 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_25910 1916 2638 gene locus_tag LOCUS_25920 1916 2638 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460301.1 protein_id gnl|my_center|LOCUS_25920 2619 2987 gene locus_tag LOCUS_25930 gene azlD 2619 2987 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_25930 >Feature sequence332 120 800 gene locus_tag LOCUS_25940 gene cmk 120 800 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565355.1 protein_id gnl|my_center|LOCUS_25940 803 2749 gene locus_tag LOCUS_25950 803 2749 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965152.1 protein_id gnl|my_center|LOCUS_25950 >Feature sequence333 >Feature sequence334 783 856 gene locus_tag LOCUS_t00390 783 856 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2181 1234 gene locus_tag LOCUS_25960 2181 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 2844 2350 gene locus_tag LOCUS_25970 2844 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964816.1 protein_id gnl|my_center|LOCUS_25970 >Feature sequence335 1511 510 gene locus_tag LOCUS_25980 1511 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 2462 1641 gene locus_tag LOCUS_25990 2462 1641 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861146.1 protein_id gnl|my_center|LOCUS_25990 >Feature sequence336 414 1538 gene locus_tag LOCUS_26000 414 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 1557 2903 gene locus_tag LOCUS_26010 1557 2903 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392414.1 protein_id gnl|my_center|LOCUS_26010 >Feature sequence337 375 1271 gene locus_tag LOCUS_26020 375 1271 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393753.1 protein_id gnl|my_center|LOCUS_26020 1319 2284 gene locus_tag LOCUS_26030 1319 2284 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966228.1 protein_id gnl|my_center|LOCUS_26030 >Feature sequence338 1899 472 gene locus_tag LOCUS_26040 1899 472 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262239.1 protein_id gnl|my_center|LOCUS_26040 <3015 1987 gene locus_tag LOCUS_26050 <3015 1987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861819.1:beta-glucoside-specific PTS transporter subunit IIABC >Feature sequence339 <1 1066 gene locus_tag LOCUS_26060 <1 1066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861611.1:bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC 1063 1845 gene locus_tag LOCUS_26070 1063 1845 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727676.1 protein_id gnl|my_center|LOCUS_26070 1842 2372 gene locus_tag LOCUS_26080 1842 2372 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355209.1 protein_id gnl|my_center|LOCUS_26080 >Feature sequence340 228 956 gene locus_tag LOCUS_26090 228 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 1102 2778 gene locus_tag LOCUS_26100 1102 2778 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986179.1 protein_id gnl|my_center|LOCUS_26100 >Feature sequence341 <1 768 gene locus_tag LOCUS_26110 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000287157.1:glycine--tRNA ligase 1055 2395 gene locus_tag LOCUS_26120 1055 2395 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109460.1 protein_id gnl|my_center|LOCUS_26120 >Feature sequence342 <1 875 gene locus_tag LOCUS_26130 <1 875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002364387.1:glucose-1-phosphate thymidylyltransferase RfbA 944 1966 gene locus_tag LOCUS_26140 gene rfbB 944 1966 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_26140 1966 2808 gene locus_tag LOCUS_26150 gene rfbD 1966 2808 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286428.1 protein_id gnl|my_center|LOCUS_26150 >Feature sequence343 <1 1490 gene locus_tag LOCUS_26160 <1 1490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964611.1:DNA primase 1529 2677 gene locus_tag LOCUS_26170 gene rpoD 1529 2677 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358052.1 protein_id gnl|my_center|LOCUS_26170 >Feature sequence344 330 130 gene locus_tag LOCUS_26180 330 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26180 689 327 gene locus_tag LOCUS_26190 689 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26190 2434 866 gene locus_tag LOCUS_26200 gene citF 2434 866 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355996.1 protein_id gnl|my_center|LOCUS_26200 >Feature sequence345 <2924 995 gene locus_tag LOCUS_26210 <2924 995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272332.1:DNA helicase RecQ >Feature sequence346 42 647 gene locus_tag LOCUS_26220 42 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 640 2406 gene locus_tag LOCUS_26230 640 2406 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869269.1 protein_id gnl|my_center|LOCUS_26230 >Feature sequence347 2347 2117 gene locus_tag LOCUS_26240 2347 2117 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_26240 2605 2393 gene locus_tag LOCUS_26250 2605 2393 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360986.1 protein_id gnl|my_center|LOCUS_26250 >Feature sequence348 >Feature sequence349 1454 273 gene locus_tag LOCUS_26260 gene thiI 1454 273 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_26260 2615 1461 gene locus_tag LOCUS_26270 2615 1461 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391743.1 protein_id gnl|my_center|LOCUS_26270 >Feature sequence350 570 307 gene locus_tag LOCUS_26280 gene rpsT 570 307 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902954.1 protein_id gnl|my_center|LOCUS_26280 1114 1983 gene locus_tag LOCUS_26290 gene gpr 1114 1983 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964587.1 protein_id gnl|my_center|LOCUS_26290 >Feature sequence351 78 320 gene locus_tag LOCUS_26300 78 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 301 954 gene locus_tag LOCUS_26310 gene thiE 301 954 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_26310 951 1739 gene locus_tag LOCUS_26320 gene thiD 951 1739 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_26320 1844 2455 gene locus_tag LOCUS_26330 1844 2455 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966844.1 protein_id gnl|my_center|LOCUS_26330 >Feature sequence352 67 1599 gene locus_tag LOCUS_26340 gene gguA 67 1599 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992366.1 protein_id gnl|my_center|LOCUS_26340 1596 2612 gene locus_tag LOCUS_26350 1596 2612 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074641.1 protein_id gnl|my_center|LOCUS_26350 >Feature sequence353 2381 795 gene locus_tag LOCUS_26360 2381 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233218.1 protein_id gnl|my_center|LOCUS_26360 >Feature sequence354 927 238 gene locus_tag LOCUS_26370 927 238 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760196.1 protein_id gnl|my_center|LOCUS_26370 2182 902 gene locus_tag LOCUS_26380 2182 902 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861243.1 protein_id gnl|my_center|LOCUS_26380 >Feature sequence355 1344 832 gene locus_tag LOCUS_26390 1344 832 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583010.1 protein_id gnl|my_center|LOCUS_26390 2432 1410 gene locus_tag LOCUS_26400 2432 1410 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080516.1 protein_id gnl|my_center|LOCUS_26400 >Feature sequence356 204 551 gene locus_tag LOCUS_26410 204 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 1784 708 gene locus_tag LOCUS_26420 1784 708 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356041.1 protein_id gnl|my_center|LOCUS_26420 <2713 1872 gene locus_tag LOCUS_26430 <2713 1872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005903217.1:AbgT family transporter >Feature sequence357 1006 74 gene locus_tag LOCUS_26440 gene yieE 1006 74 CDS product DNA-binding transcriptional regulator YeiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548316.1 protein_id gnl|my_center|LOCUS_26440 1117 1683 gene locus_tag LOCUS_26450 1117 1683 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802804.1 protein_id gnl|my_center|LOCUS_26450 1680 2243 gene locus_tag LOCUS_26460 1680 2243 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789600.1 protein_id gnl|my_center|LOCUS_26460 >Feature sequence358 356 937 gene locus_tag LOCUS_26470 356 937 CDS product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385065.1 protein_id gnl|my_center|LOCUS_26470 956 1792 gene locus_tag LOCUS_26480 956 1792 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680483.1 protein_id gnl|my_center|LOCUS_26480 1808 2629 gene locus_tag LOCUS_26490 1808 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 >Feature sequence359 556 1101 gene locus_tag LOCUS_26500 556 1101 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262000.1 protein_id gnl|my_center|LOCUS_26500 1067 1270 gene locus_tag LOCUS_26510 1067 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 >Feature sequence360 1769 60 gene locus_tag LOCUS_26520 1769 60 CDS product DUF5722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303098.1 protein_id gnl|my_center|LOCUS_26520 <2612 2070 gene locus_tag LOCUS_26530 <2612 2070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389346.1:glycosyltransferase family 2 protein >Feature sequence361 593 1453 gene locus_tag LOCUS_26540 gene metF 593 1453 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_26540 1481 2131 gene locus_tag LOCUS_26550 1481 2131 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986274.1 protein_id gnl|my_center|LOCUS_26550 >Feature sequence362 <1 2373 gene locus_tag LOCUS_26560 <1 2373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948198.1:helicase-exonuclease AddAB subunit AddA >Feature sequence363 430 356 gene locus_tag LOCUS_t00400 430 356 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 521 447 gene locus_tag LOCUS_t00410 521 447 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 686 1600 gene locus_tag LOCUS_26570 686 1600 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227672.1 protein_id gnl|my_center|LOCUS_26570 1639 2187 gene locus_tag LOCUS_26580 gene ispF 1639 2187 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963756.1 protein_id gnl|my_center|LOCUS_26580 >Feature sequence364 2043 331 gene locus_tag LOCUS_26590 2043 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 >Feature sequence365 364 555 gene locus_tag LOCUS_26600 364 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 548 1135 gene locus_tag LOCUS_26610 548 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 1506 2294 gene locus_tag LOCUS_26620 1506 2294 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068222.1 protein_id gnl|my_center|LOCUS_26620 >Feature sequence366 2114 885 gene locus_tag LOCUS_26630 2114 885 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681116.1 protein_id gnl|my_center|LOCUS_26630 2544 2125 gene locus_tag LOCUS_26640 2544 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 >Feature sequence367 1632 718 gene locus_tag LOCUS_26650 1632 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 1854 2363 gene locus_tag LOCUS_26660 1854 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 >Feature sequence368 1340 909 gene locus_tag LOCUS_26670 gene dutB 1340 909 CDS product dUTP diphosphatase DutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399492.1 protein_id gnl|my_center|LOCUS_26670 1843 1352 gene locus_tag LOCUS_26680 gene nrdG 1843 1352 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287943.1 protein_id gnl|my_center|LOCUS_26680 2158 1985 gene locus_tag LOCUS_26690 2158 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 >Feature sequence369 <1 765 gene locus_tag LOCUS_26700 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948041.1:malate dehydrogenase 775 1299 gene locus_tag LOCUS_26710 775 1299 CDS product DUF4364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891708.1 protein_id gnl|my_center|LOCUS_26710 1311 1748 gene locus_tag LOCUS_26720 1311 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 <2527 1907 gene locus_tag LOCUS_26730 <2527 1907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013231047.1:ADP-ribosylglycohydrolase family protein >Feature sequence370 392 1060 gene locus_tag LOCUS_26740 392 1060 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148833.1 protein_id gnl|my_center|LOCUS_26740 >Feature sequence371 <1 1699 gene locus_tag LOCUS_26750 <1 1699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015945515.1:glutamine--tRNA ligase/YqeY domain fusion protein