>Feature sequence001 773 438 gene locus_tag LOCUS_00010 773 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1513 881 gene locus_tag LOCUS_00020 1513 881 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948833.1 protein_id gnl|my_center|LOCUS_00020 2989 1610 gene locus_tag LOCUS_00030 2989 1610 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987111.1 protein_id gnl|my_center|LOCUS_00030 4826 3393 gene locus_tag LOCUS_00040 gene rlmD 4826 3393 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963844.1 protein_id gnl|my_center|LOCUS_00040 5567 4986 gene locus_tag LOCUS_00050 5567 4986 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476287.1 protein_id gnl|my_center|LOCUS_00050 6945 5707 gene locus_tag LOCUS_00060 gene aroC 6945 5707 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258378.1 protein_id gnl|my_center|LOCUS_00060 8170 7109 gene locus_tag LOCUS_00070 8170 7109 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194770.1 protein_id gnl|my_center|LOCUS_00070 8721 9254 gene locus_tag LOCUS_00080 8721 9254 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418769.1 protein_id gnl|my_center|LOCUS_00080 9303 10379 gene locus_tag LOCUS_00090 9303 10379 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437017.1 protein_id gnl|my_center|LOCUS_00090 10372 11205 gene locus_tag LOCUS_00100 10372 11205 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808911.1 protein_id gnl|my_center|LOCUS_00100 11205 13232 gene locus_tag LOCUS_00110 11205 13232 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948299.1 protein_id gnl|my_center|LOCUS_00110 13277 13666 gene locus_tag LOCUS_00120 13277 13666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 15258 13798 gene locus_tag LOCUS_00130 15258 13798 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_00130 16394 15486 gene locus_tag LOCUS_00140 16394 15486 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972486.1 protein_id gnl|my_center|LOCUS_00140 17345 16410 gene locus_tag LOCUS_00150 17345 16410 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894437.1 protein_id gnl|my_center|LOCUS_00150 17874 17422 gene locus_tag LOCUS_00160 17874 17422 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890423.1 protein_id gnl|my_center|LOCUS_00160 19425 17926 gene locus_tag LOCUS_00170 19425 17926 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430454.1 protein_id gnl|my_center|LOCUS_00170 20372 19446 gene locus_tag LOCUS_00180 20372 19446 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654136.1 protein_id gnl|my_center|LOCUS_00180 21172 20480 gene locus_tag LOCUS_00190 21172 20480 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706813.1 protein_id gnl|my_center|LOCUS_00190 21464 22207 gene locus_tag LOCUS_00200 gene nagB 21464 22207 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437039.1 protein_id gnl|my_center|LOCUS_00200 23493 22354 gene locus_tag LOCUS_00210 gene nagA 23493 22354 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386286.1 protein_id gnl|my_center|LOCUS_00210 24081 23590 gene locus_tag LOCUS_00220 gene trmL 24081 23590 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016664.1 protein_id gnl|my_center|LOCUS_00220 25330 24158 gene locus_tag LOCUS_00230 25330 24158 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_00230 25809 25327 gene locus_tag LOCUS_00240 25809 25327 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_00240 26417 25806 gene locus_tag LOCUS_00250 26417 25806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 27983 26436 gene locus_tag LOCUS_00260 27983 26436 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986179.1 protein_id gnl|my_center|LOCUS_00260 28878 28123 gene locus_tag LOCUS_00270 28878 28123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 29665 28850 gene locus_tag LOCUS_00280 29665 28850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 31703 29736 gene locus_tag LOCUS_00290 31703 29736 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462181.1 protein_id gnl|my_center|LOCUS_00290 32234 31704 gene locus_tag LOCUS_00300 32234 31704 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_00300 33459 32326 gene locus_tag LOCUS_00310 33459 32326 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947984.1 protein_id gnl|my_center|LOCUS_00310 37144 33719 gene locus_tag LOCUS_00320 37144 33719 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459255.1 protein_id gnl|my_center|LOCUS_00320 37878 37141 gene locus_tag LOCUS_00330 37878 37141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 39307 37862 gene locus_tag LOCUS_00340 39307 37862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 39618 39304 gene locus_tag LOCUS_00350 39618 39304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 39834 41177 gene locus_tag LOCUS_00360 39834 41177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 41161 42027 gene locus_tag LOCUS_00370 41161 42027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 42038 43402 gene locus_tag LOCUS_00380 42038 43402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 43426 44559 gene locus_tag LOCUS_00390 43426 44559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 45055 44534 gene locus_tag LOCUS_00400 gene cwlD 45055 44534 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966373.1 protein_id gnl|my_center|LOCUS_00400 46595 45072 gene locus_tag LOCUS_00410 46595 45072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 46831 46592 gene locus_tag LOCUS_00420 46831 46592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 47436 46921 gene locus_tag LOCUS_00430 47436 46921 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948661.1 protein_id gnl|my_center|LOCUS_00430 47698 47459 gene locus_tag LOCUS_00440 47698 47459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 49684 47978 gene locus_tag LOCUS_00450 49684 47978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 >Feature sequence002 2161 479 gene locus_tag LOCUS_00460 gene treC 2161 479 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986524.1 protein_id gnl|my_center|LOCUS_00460 4197 2182 gene locus_tag LOCUS_00470 gene treP 4197 2182 CDS product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297133.1 protein_id gnl|my_center|LOCUS_00470 4474 5196 gene locus_tag LOCUS_00480 4474 5196 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861813.1 protein_id gnl|my_center|LOCUS_00480 7317 5428 gene locus_tag LOCUS_00490 7317 5428 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_00490 9043 7310 gene locus_tag LOCUS_00500 9043 7310 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_00500 9607 9062 gene locus_tag LOCUS_00510 9607 9062 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002913878.1 protein_id gnl|my_center|LOCUS_00510 10354 9851 gene locus_tag LOCUS_00520 10354 9851 CDS product DUF2798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287457.1 protein_id gnl|my_center|LOCUS_00520 11203 10634 gene locus_tag LOCUS_00530 11203 10634 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_00530 11883 11200 gene locus_tag LOCUS_00540 11883 11200 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948278.1 protein_id gnl|my_center|LOCUS_00540 12577 14418 gene locus_tag LOCUS_00550 12577 14418 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679271.1 protein_id gnl|my_center|LOCUS_00550 14412 16178 gene locus_tag LOCUS_00560 14412 16178 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671107.1 protein_id gnl|my_center|LOCUS_00560 16241 16627 gene locus_tag LOCUS_00570 16241 16627 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104332.1 protein_id gnl|my_center|LOCUS_00570 17309 16803 gene locus_tag LOCUS_00580 17309 16803 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986296.1 protein_id gnl|my_center|LOCUS_00580 17828 17322 gene locus_tag LOCUS_00590 17828 17322 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_00590 18509 19333 gene locus_tag LOCUS_00600 18509 19333 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047741.1 protein_id gnl|my_center|LOCUS_00600 21412 19433 gene locus_tag LOCUS_00610 21412 19433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 22961 21543 gene locus_tag LOCUS_00620 22961 21543 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_00620 25295 23007 gene locus_tag LOCUS_00630 25295 23007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 26381 25332 gene locus_tag LOCUS_00640 26381 25332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 28599 26413 gene locus_tag LOCUS_00650 28599 26413 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289076.1 protein_id gnl|my_center|LOCUS_00650 29675 28596 gene locus_tag LOCUS_00660 29675 28596 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088722.1 protein_id gnl|my_center|LOCUS_00660 30728 29784 gene locus_tag LOCUS_00670 30728 29784 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545190.1 protein_id gnl|my_center|LOCUS_00670 32684 30756 gene locus_tag LOCUS_00680 gene ilvB 32684 30756 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182646.1 protein_id gnl|my_center|LOCUS_00680 33048 33746 gene locus_tag LOCUS_00690 gene kdsB 33048 33746 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030749.1 protein_id gnl|my_center|LOCUS_00690 33747 34472 gene locus_tag LOCUS_00700 33747 34472 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027441.1 protein_id gnl|my_center|LOCUS_00700 34500 36107 gene locus_tag LOCUS_00710 34500 36107 CDS product aldolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461003.1 protein_id gnl|my_center|LOCUS_00710 36605 37969 gene locus_tag LOCUS_00720 36605 37969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 38153 37980 gene locus_tag LOCUS_00730 38153 37980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 38386 38784 gene locus_tag LOCUS_00740 38386 38784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 39109 38957 gene locus_tag LOCUS_00750 39109 38957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 40889 39447 gene locus_tag LOCUS_00760 40889 39447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 41962 41015 gene locus_tag LOCUS_00770 41962 41015 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109323.1 protein_id gnl|my_center|LOCUS_00770 42346 42921 gene locus_tag LOCUS_00780 42346 42921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 44270 43092 gene locus_tag LOCUS_00790 44270 43092 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_00790 46713 44857 gene locus_tag LOCUS_00800 46713 44857 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476102.1 protein_id gnl|my_center|LOCUS_00800 48419 46776 gene locus_tag LOCUS_00810 48419 46776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 >Feature sequence003 <1 1012 gene locus_tag LOCUS_00820 <1 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000898619.1:sugar diacid recognition domain-containing protein 1181 1561 gene locus_tag LOCUS_00830 1181 1561 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434285.1 protein_id gnl|my_center|LOCUS_00830 3084 1615 gene locus_tag LOCUS_00840 3084 1615 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861828.1 protein_id gnl|my_center|LOCUS_00840 4837 3209 gene locus_tag LOCUS_00850 4837 3209 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_00850 5945 4962 gene locus_tag LOCUS_00860 5945 4962 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_00860 6948 5932 gene locus_tag LOCUS_00870 6948 5932 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583524.1 protein_id gnl|my_center|LOCUS_00870 7873 6962 gene locus_tag LOCUS_00880 7873 6962 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453817.1 protein_id gnl|my_center|LOCUS_00880 8863 7877 gene locus_tag LOCUS_00890 8863 7877 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_00890 9402 10409 gene locus_tag LOCUS_00900 9402 10409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 11523 10579 gene locus_tag LOCUS_00910 11523 10579 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016517.1 protein_id gnl|my_center|LOCUS_00910 11652 12938 gene locus_tag LOCUS_00920 11652 12938 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_00920 13101 13301 gene locus_tag LOCUS_00930 13101 13301 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964294.1 protein_id gnl|my_center|LOCUS_00930 13559 14233 gene locus_tag LOCUS_00940 13559 14233 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_00940 14596 14387 gene locus_tag LOCUS_00950 14596 14387 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354768.1 protein_id gnl|my_center|LOCUS_00950 15280 14636 gene locus_tag LOCUS_00960 15280 14636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 16901 15402 gene locus_tag LOCUS_00970 gene malQ 16901 15402 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917858.1 protein_id gnl|my_center|LOCUS_00970 17837 17019 gene locus_tag LOCUS_00980 17837 17019 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760203.1 protein_id gnl|my_center|LOCUS_00980 19108 17834 gene locus_tag LOCUS_00990 19108 17834 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861243.1 protein_id gnl|my_center|LOCUS_00990 19599 19222 gene locus_tag LOCUS_01000 19599 19222 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419037.1 protein_id gnl|my_center|LOCUS_01000 20318 19596 gene locus_tag LOCUS_01010 20318 19596 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815292.1 protein_id gnl|my_center|LOCUS_01010 20873 20472 gene locus_tag LOCUS_01020 20873 20472 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_01020 21455 21054 gene locus_tag LOCUS_01030 21455 21054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 21748 21539 gene locus_tag LOCUS_01040 21748 21539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 21860 22786 gene locus_tag LOCUS_01050 21860 22786 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435007.1 protein_id gnl|my_center|LOCUS_01050 23418 22990 gene locus_tag LOCUS_01060 23418 22990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 24200 23478 gene locus_tag LOCUS_01070 24200 23478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 24739 24197 gene locus_tag LOCUS_01080 24739 24197 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760619.1 protein_id gnl|my_center|LOCUS_01080 25979 25107 gene locus_tag LOCUS_01090 25979 25107 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965718.1 protein_id gnl|my_center|LOCUS_01090 27738 26038 gene locus_tag LOCUS_01100 27738 26038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 29350 27761 gene locus_tag LOCUS_01110 29350 27761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 29873 29376 gene locus_tag LOCUS_01120 29873 29376 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903575.1 protein_id gnl|my_center|LOCUS_01120 31224 29890 gene locus_tag LOCUS_01130 31224 29890 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887812.1 protein_id gnl|my_center|LOCUS_01130 32313 31306 gene locus_tag LOCUS_01140 32313 31306 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016517.1 protein_id gnl|my_center|LOCUS_01140 33552 32437 gene locus_tag LOCUS_01150 33552 32437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 34255 33542 gene locus_tag LOCUS_01160 34255 33542 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582846.1 protein_id gnl|my_center|LOCUS_01160 35093 34401 gene locus_tag LOCUS_01170 35093 34401 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943875.1 protein_id gnl|my_center|LOCUS_01170 35572 35090 gene locus_tag LOCUS_01180 35572 35090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 37126 35636 gene locus_tag LOCUS_01190 37126 35636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 38374 37217 gene locus_tag LOCUS_01200 38374 37217 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426667.1 protein_id gnl|my_center|LOCUS_01200 39469 38381 gene locus_tag LOCUS_01210 39469 38381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 41584 39725 gene locus_tag LOCUS_01220 41584 39725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 42485 41739 gene locus_tag LOCUS_01230 42485 41739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 42624 42785 gene locus_tag LOCUS_01240 42624 42785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 44572 43001 gene locus_tag LOCUS_01250 44572 43001 CDS product DUF3794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947967.1 protein_id gnl|my_center|LOCUS_01250 >Feature sequence004 990 1952 gene locus_tag LOCUS_01260 990 1952 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965621.1 protein_id gnl|my_center|LOCUS_01260 2000 2233 gene locus_tag LOCUS_01270 2000 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 2380 4263 gene locus_tag LOCUS_01280 2380 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 4415 5419 gene locus_tag LOCUS_01290 gene trpS 4415 5419 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048270.1 protein_id gnl|my_center|LOCUS_01290 6811 5567 gene locus_tag LOCUS_01300 6811 5567 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814514.1 protein_id gnl|my_center|LOCUS_01300 7482 6808 gene locus_tag LOCUS_01310 7482 6808 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_01310 7827 8816 gene locus_tag LOCUS_01320 gene dhaK 7827 8816 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166915.1 protein_id gnl|my_center|LOCUS_01320 9021 9644 gene locus_tag LOCUS_01330 gene dhaL 9021 9644 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257203.1 protein_id gnl|my_center|LOCUS_01330 9644 10024 gene locus_tag LOCUS_01340 9644 10024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 10087 10878 gene locus_tag LOCUS_01350 10087 10878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 11231 11064 gene locus_tag LOCUS_01360 11231 11064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01360 11606 11346 gene locus_tag LOCUS_01370 11606 11346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01370 12364 11969 gene locus_tag LOCUS_01380 12364 11969 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392341.1 protein_id gnl|my_center|LOCUS_01380 12600 17456 gene locus_tag LOCUS_01390 12600 17456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986914.1 protein_id gnl|my_center|LOCUS_01390 17683 18960 gene locus_tag LOCUS_01400 17683 18960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986915.1 protein_id gnl|my_center|LOCUS_01400 19119 20354 gene locus_tag LOCUS_01410 19119 20354 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986916.1 protein_id gnl|my_center|LOCUS_01410 20429 21709 gene locus_tag LOCUS_01420 20429 21709 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948343.1 protein_id gnl|my_center|LOCUS_01420 21712 22557 gene locus_tag LOCUS_01430 21712 22557 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948342.1 protein_id gnl|my_center|LOCUS_01430 22979 24172 gene locus_tag LOCUS_01440 gene gltS 22979 24172 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903453.1 protein_id gnl|my_center|LOCUS_01440 24695 26047 gene locus_tag LOCUS_01450 gene gdhA 24695 26047 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020063.1 protein_id gnl|my_center|LOCUS_01450 26263 27207 gene locus_tag LOCUS_01460 26263 27207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 28214 27489 gene locus_tag LOCUS_01470 28214 27489 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895939.1 protein_id gnl|my_center|LOCUS_01470 28362 29297 gene locus_tag LOCUS_01480 28362 29297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 29446 30246 gene locus_tag LOCUS_01490 29446 30246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 30269 30721 gene locus_tag LOCUS_01500 gene dtd 30269 30721 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426448.1 protein_id gnl|my_center|LOCUS_01500 30762 32150 gene locus_tag LOCUS_01510 30762 32150 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861085.1 protein_id gnl|my_center|LOCUS_01510 32357 33427 gene locus_tag LOCUS_01520 32357 33427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 33465 34061 gene locus_tag LOCUS_01530 33465 34061 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057285.1 protein_id gnl|my_center|LOCUS_01530 34076 34870 gene locus_tag LOCUS_01540 34076 34870 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965542.1 protein_id gnl|my_center|LOCUS_01540 35092 36153 gene locus_tag LOCUS_01550 35092 36153 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112414.1 protein_id gnl|my_center|LOCUS_01550 37640 36315 gene locus_tag LOCUS_01560 gene hutI 37640 36315 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108451.1 protein_id gnl|my_center|LOCUS_01560 39748 37724 gene locus_tag LOCUS_01570 39748 37724 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836512.1 protein_id gnl|my_center|LOCUS_01570 40013 43087 gene locus_tag LOCUS_01580 40013 43087 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017124.1 protein_id gnl|my_center|LOCUS_01580 >Feature sequence005 1939 1400 gene locus_tag LOCUS_01590 gene tadA 1939 1400 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 protein_id gnl|my_center|LOCUS_01590 2402 3139 gene locus_tag LOCUS_01600 2402 3139 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_01600 4864 3152 gene locus_tag LOCUS_01610 4864 3152 CDS product DUF6128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104439672.1 protein_id gnl|my_center|LOCUS_01610 5156 5069 gene locus_tag LOCUS_t00010 5156 5069 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5285 5202 gene locus_tag LOCUS_t00020 5285 5202 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 7618 5423 gene locus_tag LOCUS_01620 7618 5423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 9931 8084 gene locus_tag LOCUS_01630 gene ftsH 9931 8084 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_01630 10468 9944 gene locus_tag LOCUS_01640 gene hpt 10468 9944 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416006.1 protein_id gnl|my_center|LOCUS_01640 11855 10461 gene locus_tag LOCUS_01650 gene tilS 11855 10461 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546068.1 protein_id gnl|my_center|LOCUS_01650 13362 11953 gene locus_tag LOCUS_01660 13362 11953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 13824 13504 gene locus_tag LOCUS_01670 13824 13504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 14208 13882 gene locus_tag LOCUS_01680 14208 13882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 14503 14219 gene locus_tag LOCUS_01690 14503 14219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 14805 14566 gene locus_tag LOCUS_01700 14805 14566 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 protein_id gnl|my_center|LOCUS_01700 15085 14810 gene locus_tag LOCUS_01710 15085 14810 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391633.1 protein_id gnl|my_center|LOCUS_01710 15687 15229 gene locus_tag LOCUS_01720 15687 15229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 15865 15620 gene locus_tag LOCUS_01730 15865 15620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 16431 15883 gene locus_tag LOCUS_01740 gene spoVT 16431 15883 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391631.1 protein_id gnl|my_center|LOCUS_01740 18079 16595 gene locus_tag LOCUS_01750 18079 16595 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996423.1 protein_id gnl|my_center|LOCUS_01750 18835 18551 gene locus_tag LOCUS_01760 gene spoVG 18835 18551 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_01760 20019 18898 gene locus_tag LOCUS_01770 gene glgD 20019 18898 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082940.1 protein_id gnl|my_center|LOCUS_01770 21290 20016 gene locus_tag LOCUS_01780 21290 20016 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082942.1 protein_id gnl|my_center|LOCUS_01780 21723 23114 gene locus_tag LOCUS_01790 gene asnS 21723 23114 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430444.1 protein_id gnl|my_center|LOCUS_01790 23435 24505 gene locus_tag LOCUS_01800 23435 24505 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545188.1 protein_id gnl|my_center|LOCUS_01800 24518 26392 gene locus_tag LOCUS_01810 24518 26392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 27997 26696 gene locus_tag LOCUS_01820 27997 26696 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987123.1 protein_id gnl|my_center|LOCUS_01820 29200 28148 gene locus_tag LOCUS_01830 29200 28148 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795587.1 protein_id gnl|my_center|LOCUS_01830 30648 29467 gene locus_tag LOCUS_01840 30648 29467 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_01840 31855 30854 gene locus_tag LOCUS_01850 31855 30854 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519082.1 protein_id gnl|my_center|LOCUS_01850 33133 31970 gene locus_tag LOCUS_01860 33133 31970 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132280311.1 protein_id gnl|my_center|LOCUS_01860 34867 33470 gene locus_tag LOCUS_01870 gene murC 34867 33470 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_01870 35684 35181 gene locus_tag LOCUS_01880 35684 35181 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357508.1 protein_id gnl|my_center|LOCUS_01880 36818 36402 gene locus_tag LOCUS_01890 36818 36402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 38199 36985 gene locus_tag LOCUS_01900 38199 36985 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_01900 39517 38672 gene locus_tag LOCUS_01910 39517 38672 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289459.1 protein_id gnl|my_center|LOCUS_01910 40676 39798 gene locus_tag LOCUS_01920 40676 39798 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332337.1 protein_id gnl|my_center|LOCUS_01920 41671 40673 gene locus_tag LOCUS_01930 gene rihA 41671 40673 CDS product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097582.1 protein_id gnl|my_center|LOCUS_01930 <43015 41694 gene locus_tag LOCUS_01940 <43015 41694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963751.1:ABC transporter substrate-binding protein >Feature sequence006 1 996 gene locus_tag LOCUS_01950 1 996 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 protein_id gnl|my_center|LOCUS_01950 1121 1756 gene locus_tag LOCUS_01960 gene catA 1121 1756 CDS product type A-8 chloramphenicol O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143686.1 protein_id gnl|my_center|LOCUS_01960 2683 1877 gene locus_tag LOCUS_01970 2683 1877 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886407.1 protein_id gnl|my_center|LOCUS_01970 4086 2872 gene locus_tag LOCUS_01980 gene dacF 4086 2872 CDS product serine-type D-Ala-D-Ala carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831996.1 protein_id gnl|my_center|LOCUS_01980 4596 6038 gene locus_tag LOCUS_01990 4596 6038 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296829.1 protein_id gnl|my_center|LOCUS_01990 6268 7158 gene locus_tag LOCUS_02000 6268 7158 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989461.1 protein_id gnl|my_center|LOCUS_02000 7297 7650 gene locus_tag LOCUS_02010 7297 7650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 7666 8532 gene locus_tag LOCUS_02020 7666 8532 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764890.1 protein_id gnl|my_center|LOCUS_02020 8617 9312 gene locus_tag LOCUS_02030 8617 9312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 9352 9561 gene locus_tag LOCUS_02040 9352 9561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 9575 10612 gene locus_tag LOCUS_02050 9575 10612 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200459.1 protein_id gnl|my_center|LOCUS_02050 10627 11313 gene locus_tag LOCUS_02060 10627 11313 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254163.1 protein_id gnl|my_center|LOCUS_02060 11310 12005 gene locus_tag LOCUS_02070 11310 12005 CDS product DUF4405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211250.1 protein_id gnl|my_center|LOCUS_02070 13017 12082 gene locus_tag LOCUS_02080 13017 12082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 14329 13100 gene locus_tag LOCUS_02090 14329 13100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 14633 15826 gene locus_tag LOCUS_02100 14633 15826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 16610 15885 gene locus_tag LOCUS_02110 16610 15885 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232924.1 protein_id gnl|my_center|LOCUS_02110 16907 16632 gene locus_tag LOCUS_02120 16907 16632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 17659 17207 gene locus_tag LOCUS_02130 17659 17207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 19061 17673 gene locus_tag LOCUS_02140 gene atpD 19061 17673 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_02140 19969 19073 gene locus_tag LOCUS_02150 gene atpG 19969 19073 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_02150 21515 20004 gene locus_tag LOCUS_02160 gene atpA 21515 20004 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966151.1 protein_id gnl|my_center|LOCUS_02160 22024 21512 gene locus_tag LOCUS_02170 22024 21512 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425856.1 protein_id gnl|my_center|LOCUS_02170 22514 22005 gene locus_tag LOCUS_02180 22514 22005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 22753 22529 gene locus_tag LOCUS_02190 22753 22529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 23508 22867 gene locus_tag LOCUS_02200 gene atpB 23508 22867 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437836.1 protein_id gnl|my_center|LOCUS_02200 24691 23867 gene locus_tag LOCUS_02210 24691 23867 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_02210 25398 24691 gene locus_tag LOCUS_02220 25398 24691 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059649.1 protein_id gnl|my_center|LOCUS_02220 26528 25398 gene locus_tag LOCUS_02230 26528 25398 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943615.1 protein_id gnl|my_center|LOCUS_02230 27298 26618 gene locus_tag LOCUS_02240 27298 26618 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680765.1 protein_id gnl|my_center|LOCUS_02240 28052 27411 gene locus_tag LOCUS_02250 28052 27411 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_02250 29415 28282 gene locus_tag LOCUS_02260 gene rpoD 29415 28282 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_02260 30613 29714 gene locus_tag LOCUS_02270 30613 29714 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814621.1 protein_id gnl|my_center|LOCUS_02270 31866 30628 gene locus_tag LOCUS_02280 gene mutY 31866 30628 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989787.1 protein_id gnl|my_center|LOCUS_02280 33012 32032 gene locus_tag LOCUS_02290 33012 32032 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768282.1 protein_id gnl|my_center|LOCUS_02290 33327 33019 gene locus_tag LOCUS_02300 33327 33019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 33536 33682 gene locus_tag LOCUS_02310 33536 33682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 34718 33786 gene locus_tag LOCUS_02320 34718 33786 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_02320 35157 34720 gene locus_tag LOCUS_02330 35157 34720 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971919.1 protein_id gnl|my_center|LOCUS_02330 36126 35290 gene locus_tag LOCUS_02340 36126 35290 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965655.1 protein_id gnl|my_center|LOCUS_02340 38123 36123 gene locus_tag LOCUS_02350 38123 36123 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107164.1 protein_id gnl|my_center|LOCUS_02350 39586 38216 gene locus_tag LOCUS_02360 39586 38216 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682366.1 protein_id gnl|my_center|LOCUS_02360 40486 39677 gene locus_tag LOCUS_02370 40486 39677 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_02370 40537 40716 gene locus_tag LOCUS_02380 40537 40716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 41620 40724 gene locus_tag LOCUS_02390 41620 40724 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723662.1 protein_id gnl|my_center|LOCUS_02390 >Feature sequence007 1159 239 gene locus_tag LOCUS_02400 1159 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 1525 2166 gene locus_tag LOCUS_02410 gene trmB 1525 2166 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398646.1 protein_id gnl|my_center|LOCUS_02410 2263 2424 gene locus_tag LOCUS_02420 2263 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 2680 2753 gene locus_tag LOCUS_t00030 2680 2753 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3981 2923 gene locus_tag LOCUS_02430 3981 2923 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386380.1 protein_id gnl|my_center|LOCUS_02430 4476 4009 gene locus_tag LOCUS_02440 4476 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 4976 4473 gene locus_tag LOCUS_02450 4976 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 5593 4988 gene locus_tag LOCUS_02460 5593 4988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 5940 5587 gene locus_tag LOCUS_02470 5940 5587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 7121 6075 gene locus_tag LOCUS_02480 7121 6075 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583240.1 protein_id gnl|my_center|LOCUS_02480 8063 7155 gene locus_tag LOCUS_02490 8063 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 8452 9849 gene locus_tag LOCUS_02500 8452 9849 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_02500 12241 9851 gene locus_tag LOCUS_02510 12241 9851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 12946 12251 gene locus_tag LOCUS_02520 12946 12251 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_02520 13526 14491 gene locus_tag LOCUS_02530 13526 14491 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_02530 14662 14895 gene locus_tag LOCUS_02540 gene acpP 14662 14895 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_02540 14895 15818 gene locus_tag LOCUS_02550 gene fabK 14895 15818 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966839.1 protein_id gnl|my_center|LOCUS_02550 15985 16902 gene locus_tag LOCUS_02560 gene fabD 15985 16902 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_02560 16998 17741 gene locus_tag LOCUS_02570 gene fabG 16998 17741 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 protein_id gnl|my_center|LOCUS_02570 17793 19031 gene locus_tag LOCUS_02580 gene fabF 17793 19031 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099549.1 protein_id gnl|my_center|LOCUS_02580 19050 19565 gene locus_tag LOCUS_02590 gene accB 19050 19565 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194067.1 protein_id gnl|my_center|LOCUS_02590 19626 20048 gene locus_tag LOCUS_02600 gene fabZ 19626 20048 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048424.1 protein_id gnl|my_center|LOCUS_02600 20049 21410 gene locus_tag LOCUS_02610 20049 21410 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966833.1 protein_id gnl|my_center|LOCUS_02610 21503 23386 gene locus_tag LOCUS_02620 21503 23386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 23418 24518 gene locus_tag LOCUS_02630 23418 24518 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430617.1 protein_id gnl|my_center|LOCUS_02630 24597 25226 gene locus_tag LOCUS_02640 24597 25226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 25431 26522 gene locus_tag LOCUS_02650 25431 26522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462288.1 protein_id gnl|my_center|LOCUS_02650 26908 26552 gene locus_tag LOCUS_02660 26908 26552 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459556.1 protein_id gnl|my_center|LOCUS_02660 27449 27976 gene locus_tag LOCUS_02670 27449 27976 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947935.1 protein_id gnl|my_center|LOCUS_02670 28167 28607 gene locus_tag LOCUS_02680 28167 28607 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048431.1 protein_id gnl|my_center|LOCUS_02680 28754 29401 gene locus_tag LOCUS_02690 28754 29401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 29808 29683 gene locus_tag LOCUS_02700 29808 29683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 30542 29802 gene locus_tag LOCUS_02710 30542 29802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 32235 31381 gene locus_tag LOCUS_02720 32235 31381 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893097.1 protein_id gnl|my_center|LOCUS_02720 32395 33084 gene locus_tag LOCUS_02730 32395 33084 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420189.1 protein_id gnl|my_center|LOCUS_02730 35210 33333 gene locus_tag LOCUS_02740 35210 33333 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193735789.1 protein_id gnl|my_center|LOCUS_02740 36302 35472 gene locus_tag LOCUS_02750 36302 35472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 36704 37360 gene locus_tag LOCUS_02760 36704 37360 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_02760 37710 38270 gene locus_tag LOCUS_02770 37710 38270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 >Feature sequence008 <1 689 gene locus_tag LOCUS_02780 <1 689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047993.1:pyruvate, phosphate dikinase 851 1510 gene locus_tag LOCUS_02790 851 1510 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943981.1 protein_id gnl|my_center|LOCUS_02790 1889 2857 gene locus_tag LOCUS_02800 1889 2857 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393776.1 protein_id gnl|my_center|LOCUS_02800 2924 4111 gene locus_tag LOCUS_02810 gene gltS 2924 4111 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903453.1 protein_id gnl|my_center|LOCUS_02810 4264 5373 gene locus_tag LOCUS_02820 4264 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 5567 7147 gene locus_tag LOCUS_02830 5567 7147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 7322 8395 gene locus_tag LOCUS_02840 7322 8395 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_02840 8650 10164 gene locus_tag LOCUS_02850 8650 10164 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467107.1 protein_id gnl|my_center|LOCUS_02850 10166 11221 gene locus_tag LOCUS_02860 10166 11221 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226242.1 protein_id gnl|my_center|LOCUS_02860 11224 12246 gene locus_tag LOCUS_02870 gene yjfF 11224 12246 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815317.1 protein_id gnl|my_center|LOCUS_02870 12257 12388 gene locus_tag LOCUS_02880 12257 12388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 12363 13868 gene locus_tag LOCUS_02890 gene araA 12363 13868 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229499.1 protein_id gnl|my_center|LOCUS_02890 13925 15532 gene locus_tag LOCUS_02900 13925 15532 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_02900 15558 16259 gene locus_tag LOCUS_02910 15558 16259 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837546.1 protein_id gnl|my_center|LOCUS_02910 16556 18565 gene locus_tag LOCUS_02920 gene pdcB 16556 18565 CDS product phosphodiesterase PdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437448.1 protein_id gnl|my_center|LOCUS_02920 18743 19363 gene locus_tag LOCUS_02930 18743 19363 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426696.1 protein_id gnl|my_center|LOCUS_02930 19432 20301 gene locus_tag LOCUS_02940 19432 20301 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966060.1 protein_id gnl|my_center|LOCUS_02940 21408 20536 gene locus_tag LOCUS_02950 gene sdaAA 21408 20536 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963993.1 protein_id gnl|my_center|LOCUS_02950 22096 21425 gene locus_tag LOCUS_02960 gene sdaAB 22096 21425 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963992.1 protein_id gnl|my_center|LOCUS_02960 23327 22116 gene locus_tag LOCUS_02970 23327 22116 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861646.1 protein_id gnl|my_center|LOCUS_02970 23781 24581 gene locus_tag LOCUS_02980 23781 24581 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986419.1 protein_id gnl|my_center|LOCUS_02980 24694 25380 gene locus_tag LOCUS_02990 gene scpB 24694 25380 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965360.1 protein_id gnl|my_center|LOCUS_02990 25829 27961 gene locus_tag LOCUS_03000 gene nrdD 25829 27961 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693847.1 protein_id gnl|my_center|LOCUS_03000 28058 28549 gene locus_tag LOCUS_03010 gene nrdG 28058 28549 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_03010 28950 29381 gene locus_tag LOCUS_03020 gene dutA 28950 29381 CDS product dUTP diphosphatase DutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245820.1 protein_id gnl|my_center|LOCUS_03020 29414 30388 gene locus_tag LOCUS_03030 29414 30388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 30546 31799 gene locus_tag LOCUS_03040 gene hflX 30546 31799 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030461.1 protein_id gnl|my_center|LOCUS_03040 32054 34456 gene locus_tag LOCUS_03050 32054 34456 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678883.1 protein_id gnl|my_center|LOCUS_03050 34767 36725 gene locus_tag LOCUS_03060 34767 36725 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964880.1 protein_id gnl|my_center|LOCUS_03060 >Feature sequence009 1574 84 gene locus_tag LOCUS_03070 1574 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 4410 1891 gene locus_tag LOCUS_03080 4410 1891 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391709.1 protein_id gnl|my_center|LOCUS_03080 5492 4455 gene locus_tag LOCUS_03090 5492 4455 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328432.1 protein_id gnl|my_center|LOCUS_03090 6039 5485 gene locus_tag LOCUS_03100 6039 5485 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966468.1 protein_id gnl|my_center|LOCUS_03100 6488 6102 gene locus_tag LOCUS_03110 6488 6102 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963919.1 protein_id gnl|my_center|LOCUS_03110 8849 6681 gene locus_tag LOCUS_03120 8849 6681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 11488 8870 gene locus_tag LOCUS_03130 11488 8870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 13388 11976 gene locus_tag LOCUS_03140 13388 11976 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 protein_id gnl|my_center|LOCUS_03140 14578 13430 gene locus_tag LOCUS_03150 14578 13430 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_03150 14800 14609 gene locus_tag LOCUS_03160 14800 14609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 16041 15085 gene locus_tag LOCUS_03170 16041 15085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 17510 16059 gene locus_tag LOCUS_03180 17510 16059 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250573.1 protein_id gnl|my_center|LOCUS_03180 17923 18120 gene locus_tag LOCUS_03190 17923 18120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 18095 18376 gene locus_tag LOCUS_03200 18095 18376 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392904.1 protein_id gnl|my_center|LOCUS_03200 18376 18993 gene locus_tag LOCUS_03210 18376 18993 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392905.1 protein_id gnl|my_center|LOCUS_03210 19971 19261 gene locus_tag LOCUS_03220 19971 19261 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656001.1 protein_id gnl|my_center|LOCUS_03220 21588 20164 gene locus_tag LOCUS_03230 21588 20164 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682366.1 protein_id gnl|my_center|LOCUS_03230 23051 21780 gene locus_tag LOCUS_03240 gene sleC 23051 21780 CDS product spore cortex-lytic germination protein SleC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425119.1 protein_id gnl|my_center|LOCUS_03240 24942 23146 gene locus_tag LOCUS_03250 24942 23146 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897431.1 protein_id gnl|my_center|LOCUS_03250 26100 25090 gene locus_tag LOCUS_03260 gene asnA 26100 25090 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_03260 27146 26364 gene locus_tag LOCUS_03270 27146 26364 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965719.1 protein_id gnl|my_center|LOCUS_03270 27381 27456 gene locus_tag LOCUS_t00040 27381 27456 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 27668 28102 gene locus_tag LOCUS_03280 27668 28102 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793479.1 protein_id gnl|my_center|LOCUS_03280 29063 28134 gene locus_tag LOCUS_03290 29063 28134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 29461 29234 gene locus_tag LOCUS_03300 29461 29234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 30652 29675 gene locus_tag LOCUS_03310 gene gigC 30652 29675 CDS product LysR family transcriptional regulator GigC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120024.1 protein_id gnl|my_center|LOCUS_03310 30855 31445 gene locus_tag LOCUS_03320 30855 31445 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948278.1 protein_id gnl|my_center|LOCUS_03320 31460 32053 gene locus_tag LOCUS_03330 31460 32053 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860666.1 protein_id gnl|my_center|LOCUS_03330 33556 32126 gene locus_tag LOCUS_03340 gene dsdA 33556 32126 CDS product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658347.1 protein_id gnl|my_center|LOCUS_03340 34675 34436 gene locus_tag LOCUS_03350 34675 34436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 34803 35315 gene locus_tag LOCUS_03360 34803 35315 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_03360 35337 35579 gene locus_tag LOCUS_03370 35337 35579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 35825 35900 gene locus_tag LOCUS_t00050 35825 35900 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 36198 36440 gene locus_tag LOCUS_03380 36198 36440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 36873 36631 gene locus_tag LOCUS_03390 36873 36631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 >Feature sequence010 <1 574 gene locus_tag LOCUS_03400 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010819456.1:PfkB family carbohydrate kinase 2145 766 gene locus_tag LOCUS_03410 2145 766 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948764.1 protein_id gnl|my_center|LOCUS_03410 2921 2274 gene locus_tag LOCUS_03420 2921 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 3695 2991 gene locus_tag LOCUS_03430 3695 2991 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948716.1 protein_id gnl|my_center|LOCUS_03430 5068 3776 gene locus_tag LOCUS_03440 5068 3776 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191948.1 protein_id gnl|my_center|LOCUS_03440 5345 6382 gene locus_tag LOCUS_03450 5345 6382 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966513.1 protein_id gnl|my_center|LOCUS_03450 7593 6364 gene locus_tag LOCUS_03460 7593 6364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 8469 7615 gene locus_tag LOCUS_03470 8469 7615 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836880.1 protein_id gnl|my_center|LOCUS_03470 9663 8611 gene locus_tag LOCUS_03480 9663 8611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 10441 10019 gene locus_tag LOCUS_03490 10441 10019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 10554 10826 gene locus_tag LOCUS_03500 10554 10826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 11885 10890 gene locus_tag LOCUS_03510 11885 10890 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966891.1 protein_id gnl|my_center|LOCUS_03510 12916 11924 gene locus_tag LOCUS_03520 12916 11924 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099510.1 protein_id gnl|my_center|LOCUS_03520 13863 12928 gene locus_tag LOCUS_03530 13863 12928 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986232.1 protein_id gnl|my_center|LOCUS_03530 14837 13869 gene locus_tag LOCUS_03540 14837 13869 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278786.1 protein_id gnl|my_center|LOCUS_03540 16640 15015 gene locus_tag LOCUS_03550 16640 15015 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861635.1 protein_id gnl|my_center|LOCUS_03550 18938 16938 gene locus_tag LOCUS_03560 gene htpG 18938 16938 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435963.1 protein_id gnl|my_center|LOCUS_03560 19263 20450 gene locus_tag LOCUS_03570 19263 20450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 21087 20590 gene locus_tag LOCUS_03580 21087 20590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 21422 22717 gene locus_tag LOCUS_03590 21422 22717 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048276.1 protein_id gnl|my_center|LOCUS_03590 24510 22993 gene locus_tag LOCUS_03600 24510 22993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 25508 24510 gene locus_tag LOCUS_03610 25508 24510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 26342 25554 gene locus_tag LOCUS_03620 26342 25554 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861671.1 protein_id gnl|my_center|LOCUS_03620 27043 26339 gene locus_tag LOCUS_03630 27043 26339 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_03630 30614 27213 gene locus_tag LOCUS_03640 30614 27213 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937760.1 protein_id gnl|my_center|LOCUS_03640 32521 30812 gene locus_tag LOCUS_03650 gene hcp 32521 30812 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047923.1 protein_id gnl|my_center|LOCUS_03650 32839 33585 gene locus_tag LOCUS_03660 32839 33585 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_03660 34031 33594 gene locus_tag LOCUS_03670 34031 33594 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355907.1 protein_id gnl|my_center|LOCUS_03670 34602 35987 gene locus_tag LOCUS_03680 gene rlmD 34602 35987 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963844.1 protein_id gnl|my_center|LOCUS_03680 35912 36136 gene locus_tag LOCUS_03690 35912 36136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 36390 36563 gene locus_tag LOCUS_03700 36390 36563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 >Feature sequence011 2036 9 gene locus_tag LOCUS_03710 2036 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 3377 2463 gene locus_tag LOCUS_03720 gene metA 3377 2463 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796420.1 protein_id gnl|my_center|LOCUS_03720 3803 3657 gene locus_tag LOCUS_03730 3803 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 3909 4607 gene locus_tag LOCUS_03740 3909 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 4755 4579 gene locus_tag LOCUS_03750 4755 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 6773 4776 gene locus_tag LOCUS_03760 gene ligA 6773 4776 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546277.1 protein_id gnl|my_center|LOCUS_03760 7847 7038 gene locus_tag LOCUS_03770 7847 7038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 8879 8070 gene locus_tag LOCUS_03780 gene dapF 8879 8070 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_03780 9515 8964 gene locus_tag LOCUS_03790 9515 8964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 10950 9592 gene locus_tag LOCUS_03800 gene glnA 10950 9592 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807771.1 protein_id gnl|my_center|LOCUS_03800 12258 11392 gene locus_tag LOCUS_03810 gene dapF 12258 11392 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583145.1 protein_id gnl|my_center|LOCUS_03810 12562 13422 gene locus_tag LOCUS_03820 12562 13422 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948300.1 protein_id gnl|my_center|LOCUS_03820 14576 13437 gene locus_tag LOCUS_03830 gene ytvI 14576 13437 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440267.1 protein_id gnl|my_center|LOCUS_03830 15864 14674 gene locus_tag LOCUS_03840 15864 14674 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459580.1 protein_id gnl|my_center|LOCUS_03840 17241 15922 gene locus_tag LOCUS_03850 17241 15922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 19312 17591 gene locus_tag LOCUS_03860 gene ptsP 19312 17591 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431795.1 protein_id gnl|my_center|LOCUS_03860 19606 19343 gene locus_tag LOCUS_03870 gene ptsH 19606 19343 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874410.1 protein_id gnl|my_center|LOCUS_03870 21055 19670 gene locus_tag LOCUS_03880 21055 19670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 21908 21036 gene locus_tag LOCUS_03890 gene cdaA 21908 21036 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_03890 22883 21936 gene locus_tag LOCUS_03900 22883 21936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 23308 22880 gene locus_tag LOCUS_03910 23308 22880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 24763 23543 gene locus_tag LOCUS_03920 24763 23543 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812525.1 protein_id gnl|my_center|LOCUS_03920 25659 24757 gene locus_tag LOCUS_03930 25659 24757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 27155 25656 gene locus_tag LOCUS_03940 27155 25656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 28038 27403 gene locus_tag LOCUS_03950 28038 27403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 28394 28323 gene locus_tag LOCUS_t00060 28394 28323 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 30089 28725 gene locus_tag LOCUS_03960 30089 28725 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_03960 32583 30208 gene locus_tag LOCUS_03970 32583 30208 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903701.1 protein_id gnl|my_center|LOCUS_03970 33633 32704 gene locus_tag LOCUS_03980 33633 32704 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432388.1 protein_id gnl|my_center|LOCUS_03980 33781 33705 gene locus_tag LOCUS_t00070 33781 33705 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 33865 33791 gene locus_tag LOCUS_t00080 33865 33791 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 33959 33884 gene locus_tag LOCUS_t00090 33959 33884 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 34074 33998 gene locus_tag LOCUS_t00100 34074 33998 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 34249 34178 gene locus_tag LOCUS_t00110 34249 34178 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 34331 34257 gene locus_tag LOCUS_t00120 34331 34257 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence012 219 2210 gene locus_tag LOCUS_03990 gene uvrB 219 2210 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_03990 2357 2602 gene locus_tag LOCUS_04000 2357 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 2599 4602 gene locus_tag LOCUS_04010 gene feoB 2599 4602 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044821.1 protein_id gnl|my_center|LOCUS_04010 4710 5480 gene locus_tag LOCUS_04020 4710 5480 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965563.1 protein_id gnl|my_center|LOCUS_04020 5480 5899 gene locus_tag LOCUS_04030 5480 5899 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986910.1 protein_id gnl|my_center|LOCUS_04030 6818 5859 gene locus_tag LOCUS_04040 6818 5859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 8880 7966 gene locus_tag LOCUS_04050 8880 7966 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542436.1 protein_id gnl|my_center|LOCUS_04050 9080 9829 gene locus_tag LOCUS_04060 9080 9829 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460301.1 protein_id gnl|my_center|LOCUS_04060 9819 10145 gene locus_tag LOCUS_04070 gene azlD 9819 10145 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_04070 10551 10246 gene locus_tag LOCUS_04080 10551 10246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 11103 10606 gene locus_tag LOCUS_04090 11103 10606 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_04090 11297 13396 gene locus_tag LOCUS_04100 gene ftsH 11297 13396 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963922.1 protein_id gnl|my_center|LOCUS_04100 15040 13559 gene locus_tag LOCUS_04110 15040 13559 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_04110 15311 16621 gene locus_tag LOCUS_04120 15311 16621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 16637 17476 gene locus_tag LOCUS_04130 16637 17476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 17563 19428 gene locus_tag LOCUS_04140 gene uvrC 17563 19428 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_04140 19550 20479 gene locus_tag LOCUS_04150 gene hprK 19550 20479 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_04150 20588 21646 gene locus_tag LOCUS_04160 gene murB 20588 21646 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_04160 21650 22531 gene locus_tag LOCUS_04170 gene rapZ 21650 22531 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963833.1 protein_id gnl|my_center|LOCUS_04170 22534 23493 gene locus_tag LOCUS_04180 gene whiA 22534 23493 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436252.1 protein_id gnl|my_center|LOCUS_04180 23528 23782 gene locus_tag LOCUS_04190 23528 23782 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219835.1 protein_id gnl|my_center|LOCUS_04190 24113 27592 gene locus_tag LOCUS_04200 24113 27592 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_04200 27659 28633 gene locus_tag LOCUS_04210 gene pfkA 27659 28633 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_04210 28838 29335 gene locus_tag LOCUS_04220 28838 29335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 29332 30291 gene locus_tag LOCUS_04230 gene dusB 29332 30291 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_04230 30538 31020 gene locus_tag LOCUS_04240 gene greA 30538 31020 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_04240 31046 32998 gene locus_tag LOCUS_04250 31046 32998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 34004 33138 gene locus_tag LOCUS_04260 34004 33138 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909131.1 protein_id gnl|my_center|LOCUS_04260 >Feature sequence013 1187 2419 gene locus_tag LOCUS_04270 1187 2419 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965048.1 protein_id gnl|my_center|LOCUS_04270 3758 2508 gene locus_tag LOCUS_04280 3758 2508 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681116.1 protein_id gnl|my_center|LOCUS_04280 5195 3816 gene locus_tag LOCUS_04290 5195 3816 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_04290 5485 5213 gene locus_tag LOCUS_04300 5485 5213 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053740.1 protein_id gnl|my_center|LOCUS_04300 6416 5619 gene locus_tag LOCUS_04310 6416 5619 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_04310 7000 6413 gene locus_tag LOCUS_04320 gene coaE 7000 6413 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398928.1 protein_id gnl|my_center|LOCUS_04320 10053 7093 gene locus_tag LOCUS_04330 10053 7093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 10431 10096 gene locus_tag LOCUS_04340 10431 10096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 10969 10886 gene locus_tag LOCUS_t00130 10969 10886 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12339 11161 gene locus_tag LOCUS_04350 12339 11161 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_04350 13083 12358 gene locus_tag LOCUS_04360 13083 12358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 13442 14254 gene locus_tag LOCUS_04370 13442 14254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 14323 14952 gene locus_tag LOCUS_04380 gene upp 14323 14952 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515974.1 protein_id gnl|my_center|LOCUS_04380 15744 15067 gene locus_tag LOCUS_04390 15744 15067 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_04390 17902 15731 gene locus_tag LOCUS_04400 17902 15731 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948909.1 protein_id gnl|my_center|LOCUS_04400 19150 18092 gene locus_tag LOCUS_04410 19150 18092 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_04410 20336 19245 gene locus_tag LOCUS_04420 gene asd 20336 19245 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699652.1 protein_id gnl|my_center|LOCUS_04420 22255 20471 gene locus_tag LOCUS_04430 gene ade 22255 20471 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392001.1 protein_id gnl|my_center|LOCUS_04430 23638 22511 gene locus_tag LOCUS_04440 23638 22511 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383860.1 protein_id gnl|my_center|LOCUS_04440 24686 23772 gene locus_tag LOCUS_04450 24686 23772 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537587.1 protein_id gnl|my_center|LOCUS_04450 25784 24699 gene locus_tag LOCUS_04460 25784 24699 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383862.1 protein_id gnl|my_center|LOCUS_04460 27329 25788 gene locus_tag LOCUS_04470 27329 25788 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865052.1 protein_id gnl|my_center|LOCUS_04470 28075 27356 gene locus_tag LOCUS_04480 gene deoD 28075 27356 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843292.1 protein_id gnl|my_center|LOCUS_04480 29487 28198 gene locus_tag LOCUS_04490 29487 28198 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439092.1 protein_id gnl|my_center|LOCUS_04490 29746 29561 gene locus_tag LOCUS_04500 29746 29561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 31958 29718 gene locus_tag LOCUS_04510 gene gyrA 31958 29718 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_04510 <33080 32133 gene locus_tag LOCUS_04520 <33080 32133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963335.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence014 285 548 gene locus_tag LOCUS_04530 285 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 672 1757 gene locus_tag LOCUS_04540 gene recA 672 1757 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965121.1 protein_id gnl|my_center|LOCUS_04540 1845 2453 gene locus_tag LOCUS_04550 gene recX 1845 2453 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830417.1 protein_id gnl|my_center|LOCUS_04550 2640 4184 gene locus_tag LOCUS_04560 gene rny 2640 4184 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986783.1 protein_id gnl|my_center|LOCUS_04560 4447 5244 gene locus_tag LOCUS_04570 gene proC 4447 5244 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898446.1 protein_id gnl|my_center|LOCUS_04570 5427 6011 gene locus_tag LOCUS_04580 5427 6011 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194850.1 protein_id gnl|my_center|LOCUS_04580 6113 6682 gene locus_tag LOCUS_04590 6113 6682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 6698 6946 gene locus_tag LOCUS_04600 6698 6946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 7052 7915 gene locus_tag LOCUS_04610 gene xerD 7052 7915 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_04610 9223 8177 gene locus_tag LOCUS_04620 9223 8177 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928176.1 protein_id gnl|my_center|LOCUS_04620 9897 9220 gene locus_tag LOCUS_04630 9897 9220 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948592.1 protein_id gnl|my_center|LOCUS_04630 10258 11499 gene locus_tag LOCUS_04640 10258 11499 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815035.1 protein_id gnl|my_center|LOCUS_04640 11515 14529 gene locus_tag LOCUS_04650 11515 14529 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861545.1 protein_id gnl|my_center|LOCUS_04650 14687 15856 gene locus_tag LOCUS_04660 14687 15856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 15881 17194 gene locus_tag LOCUS_04670 15881 17194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 17823 17356 gene locus_tag LOCUS_04680 17823 17356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 18459 18010 gene locus_tag LOCUS_04690 18459 18010 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816860.1 protein_id gnl|my_center|LOCUS_04690 22465 18689 gene locus_tag LOCUS_04700 22465 18689 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484061.1 protein_id gnl|my_center|LOCUS_04700 22960 22496 gene locus_tag LOCUS_04710 22960 22496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04710 23315 24202 gene locus_tag LOCUS_04720 23315 24202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 24323 25759 gene locus_tag LOCUS_04730 gene pyk 24323 25759 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_04730 26030 27298 gene locus_tag LOCUS_04740 26030 27298 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856534.1 protein_id gnl|my_center|LOCUS_04740 28958 27726 gene locus_tag LOCUS_04750 28958 27726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 29571 31985 gene locus_tag LOCUS_04760 29571 31985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 <32750 32069 gene locus_tag LOCUS_04770 <32750 32069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005816655.1:3-deoxy-7-phosphoheptulonate synthase >Feature sequence015 139 867 gene locus_tag LOCUS_04780 139 867 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263190.1 protein_id gnl|my_center|LOCUS_04780 1014 1682 gene locus_tag LOCUS_04790 gene catA 1014 1682 CDS product type A chloramphenicol O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986550.1 protein_id gnl|my_center|LOCUS_04790 1853 2371 gene locus_tag LOCUS_04800 1853 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04800 3148 2573 gene locus_tag LOCUS_04810 3148 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986764.1 protein_id gnl|my_center|LOCUS_04810 3650 3129 gene locus_tag LOCUS_04820 3650 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 4185 3640 gene locus_tag LOCUS_04830 4185 3640 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986765.1 protein_id gnl|my_center|LOCUS_04830 4372 4842 gene locus_tag LOCUS_04840 4372 4842 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_04840 5228 6484 gene locus_tag LOCUS_04850 5228 6484 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 protein_id gnl|my_center|LOCUS_04850 6481 8772 gene locus_tag LOCUS_04860 6481 8772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 10134 8914 gene locus_tag LOCUS_04870 10134 8914 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_04870 10428 11393 gene locus_tag LOCUS_04880 10428 11393 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167205.1 protein_id gnl|my_center|LOCUS_04880 11530 12468 gene locus_tag LOCUS_04890 gene pstC 11530 12468 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676681.1 protein_id gnl|my_center|LOCUS_04890 12471 13346 gene locus_tag LOCUS_04900 gene pstA 12471 13346 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201789.1 protein_id gnl|my_center|LOCUS_04900 13407 14216 gene locus_tag LOCUS_04910 gene pstB 13407 14216 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_04910 14216 14878 gene locus_tag LOCUS_04920 gene phoU 14216 14878 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_04920 15145 15300 gene locus_tag LOCUS_04930 15145 15300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 16526 15693 gene locus_tag LOCUS_04940 16526 15693 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925927.1 protein_id gnl|my_center|LOCUS_04940 17166 17675 gene locus_tag LOCUS_04950 17166 17675 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359469.1 protein_id gnl|my_center|LOCUS_04950 18827 17772 gene locus_tag LOCUS_04960 18827 17772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 19107 19880 gene locus_tag LOCUS_04970 19107 19880 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_04970 19877 20785 gene locus_tag LOCUS_04980 gene hslO 19877 20785 CDS product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226695.1 protein_id gnl|my_center|LOCUS_04980 21155 20955 gene locus_tag LOCUS_04990 21155 20955 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966272.1 protein_id gnl|my_center|LOCUS_04990 21425 21973 gene locus_tag LOCUS_05000 21425 21973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 23278 22025 gene locus_tag LOCUS_05010 23278 22025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 23497 24243 gene locus_tag LOCUS_05020 gene ruvA 23497 24243 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580325.1 protein_id gnl|my_center|LOCUS_05020 24292 25287 gene locus_tag LOCUS_05030 gene ruvB 24292 25287 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_05030 25406 25873 gene locus_tag LOCUS_05040 25406 25873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 26125 28470 gene locus_tag LOCUS_05050 26125 28470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 28481 29806 gene locus_tag LOCUS_05060 28481 29806 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963827.1 protein_id gnl|my_center|LOCUS_05060 >Feature sequence016 889 2073 gene locus_tag LOCUS_05070 gene gltS 889 2073 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903453.1 protein_id gnl|my_center|LOCUS_05070 2290 3024 gene locus_tag LOCUS_05080 2290 3024 CDS product DUF5714 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673563.1 protein_id gnl|my_center|LOCUS_05080 3088 4164 gene locus_tag LOCUS_05090 3088 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 4652 4194 gene locus_tag LOCUS_05100 4652 4194 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810945.1 protein_id gnl|my_center|LOCUS_05100 5213 4695 gene locus_tag LOCUS_05110 5213 4695 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964974.1 protein_id gnl|my_center|LOCUS_05110 6879 5434 gene locus_tag LOCUS_05120 gene glgA 6879 5434 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_05120 7871 7065 gene locus_tag LOCUS_05130 gene spo0A 7871 7065 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226427.1 protein_id gnl|my_center|LOCUS_05130 8655 8089 gene locus_tag LOCUS_05140 8655 8089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 10209 8788 gene locus_tag LOCUS_05150 10209 8788 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893433.1 protein_id gnl|my_center|LOCUS_05150 10784 10302 gene locus_tag LOCUS_05160 10784 10302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 11727 10894 gene locus_tag LOCUS_05170 11727 10894 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_05170 12724 11720 gene locus_tag LOCUS_05180 12724 11720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 13664 12702 gene locus_tag LOCUS_05190 13664 12702 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330018.1 protein_id gnl|my_center|LOCUS_05190 16186 13664 gene locus_tag LOCUS_05200 16186 13664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 17391 16255 gene locus_tag LOCUS_05210 17391 16255 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243312.1 protein_id gnl|my_center|LOCUS_05210 18085 17381 gene locus_tag LOCUS_05220 18085 17381 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435805.1 protein_id gnl|my_center|LOCUS_05220 20631 18433 gene locus_tag LOCUS_05230 20631 18433 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_05230 22199 20634 gene locus_tag LOCUS_05240 22199 20634 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814148.1 protein_id gnl|my_center|LOCUS_05240 23502 22189 gene locus_tag LOCUS_05250 23502 22189 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966536.1 protein_id gnl|my_center|LOCUS_05250 24908 23781 gene locus_tag LOCUS_05260 gene pheA 24908 23781 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_05260 25638 24868 gene locus_tag LOCUS_05270 25638 24868 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948182.1 protein_id gnl|my_center|LOCUS_05270 27392 25863 gene locus_tag LOCUS_05280 gene cls 27392 25863 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429110.1 protein_id gnl|my_center|LOCUS_05280 27675 27496 gene locus_tag LOCUS_05290 27675 27496 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405297.1 protein_id gnl|my_center|LOCUS_05290 27914 27672 gene locus_tag LOCUS_05300 27914 27672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 <28895 27994 gene locus_tag LOCUS_05310 <28895 27994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461101.1:DNA polymerase IV >Feature sequence017 2549 6 gene locus_tag LOCUS_05320 2549 6 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861274.1 protein_id gnl|my_center|LOCUS_05320 3001 3252 gene locus_tag LOCUS_05330 3001 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 3540 4193 gene locus_tag LOCUS_05340 3540 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 5133 5582 gene locus_tag LOCUS_05350 5133 5582 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_05350 5919 6089 gene locus_tag LOCUS_05360 5919 6089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 6125 8350 gene locus_tag LOCUS_05370 6125 8350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 8406 9155 gene locus_tag LOCUS_05380 8406 9155 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_05380 9273 10235 gene locus_tag LOCUS_05390 gene mgrA 9273 10235 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640297.1 protein_id gnl|my_center|LOCUS_05390 10311 10520 gene locus_tag LOCUS_05400 10311 10520 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_05400 10669 10956 gene locus_tag LOCUS_05410 gene rpsF 10669 10956 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_05410 10976 11428 gene locus_tag LOCUS_05420 10976 11428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 11568 11834 gene locus_tag LOCUS_05430 gene rpsR 11568 11834 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966982.1 protein_id gnl|my_center|LOCUS_05430 12009 13364 gene locus_tag LOCUS_05440 12009 13364 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682366.1 protein_id gnl|my_center|LOCUS_05440 13542 14162 gene locus_tag LOCUS_05450 13542 14162 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_05450 15726 14377 gene locus_tag LOCUS_05460 gene thiC 15726 14377 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047970.1 protein_id gnl|my_center|LOCUS_05460 16297 18339 gene locus_tag LOCUS_05470 16297 18339 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_05470 18341 18787 gene locus_tag LOCUS_05480 gene rplI 18341 18787 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641637.1 protein_id gnl|my_center|LOCUS_05480 18791 20128 gene locus_tag LOCUS_05490 gene dnaB 18791 20128 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_05490 20506 21315 gene locus_tag LOCUS_05500 20506 21315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 21952 22260 gene locus_tag LOCUS_05510 21952 22260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 22396 24408 gene locus_tag LOCUS_05520 22396 24408 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986938.1 protein_id gnl|my_center|LOCUS_05520 24411 24884 gene locus_tag LOCUS_05530 24411 24884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 24940 25554 gene locus_tag LOCUS_05540 24940 25554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 25658 26632 gene locus_tag LOCUS_05550 25658 26632 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439726.1 protein_id gnl|my_center|LOCUS_05550 26625 26945 gene locus_tag LOCUS_05560 26625 26945 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986934.1 protein_id gnl|my_center|LOCUS_05560 >Feature sequence018 4019 2919 gene locus_tag LOCUS_05570 4019 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 4779 4111 gene locus_tag LOCUS_05580 4779 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 6374 5154 gene locus_tag LOCUS_05590 6374 5154 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942020.1 protein_id gnl|my_center|LOCUS_05590 7057 6371 gene locus_tag LOCUS_05600 7057 6371 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_05600 7965 7054 gene locus_tag LOCUS_05610 gene ispE 7965 7054 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226742.1 protein_id gnl|my_center|LOCUS_05610 8861 8157 gene locus_tag LOCUS_05620 8861 8157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 9397 8879 gene locus_tag LOCUS_05630 9397 8879 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048399.1 protein_id gnl|my_center|LOCUS_05630 11124 9775 gene locus_tag LOCUS_05640 11124 9775 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930859.1 protein_id gnl|my_center|LOCUS_05640 11607 12584 gene locus_tag LOCUS_05650 11607 12584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 13367 12597 gene locus_tag LOCUS_05660 13367 12597 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144055.1 protein_id gnl|my_center|LOCUS_05660 14094 13444 gene locus_tag LOCUS_05670 14094 13444 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272546.1 protein_id gnl|my_center|LOCUS_05670 15046 14138 gene locus_tag LOCUS_05680 15046 14138 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_05680 16109 15477 gene locus_tag LOCUS_05690 16109 15477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 17308 16337 gene locus_tag LOCUS_05700 17308 16337 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_05700 18263 17415 gene locus_tag LOCUS_05710 18263 17415 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811992.1 protein_id gnl|my_center|LOCUS_05710 19674 18343 gene locus_tag LOCUS_05720 gene rfbH 19674 18343 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126347.1 protein_id gnl|my_center|LOCUS_05720 20952 19801 gene locus_tag LOCUS_05730 gene rfbG 20952 19801 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261039.1 protein_id gnl|my_center|LOCUS_05730 21686 20910 gene locus_tag LOCUS_05740 gene rfbF 21686 20910 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088721.1 protein_id gnl|my_center|LOCUS_05740 23389 21716 gene locus_tag LOCUS_05750 23389 21716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 24798 23389 gene locus_tag LOCUS_05760 24798 23389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 25503 24856 gene locus_tag LOCUS_05770 25503 24856 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966335.1 protein_id gnl|my_center|LOCUS_05770 >Feature sequence019 1349 108 gene locus_tag LOCUS_05780 1349 108 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549213.1 protein_id gnl|my_center|LOCUS_05780 1837 1361 gene locus_tag LOCUS_05790 1837 1361 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426364.1 protein_id gnl|my_center|LOCUS_05790 2394 1990 gene locus_tag LOCUS_05800 2394 1990 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027178.1 protein_id gnl|my_center|LOCUS_05800 4289 2415 gene locus_tag LOCUS_05810 4289 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 4638 5204 gene locus_tag LOCUS_05820 4638 5204 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798510.1 protein_id gnl|my_center|LOCUS_05820 6207 5392 gene locus_tag LOCUS_05830 6207 5392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 9834 6277 gene locus_tag LOCUS_05840 gene mfd 9834 6277 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966492.1 protein_id gnl|my_center|LOCUS_05840 10552 9953 gene locus_tag LOCUS_05850 gene pth 10552 9953 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892068.1 protein_id gnl|my_center|LOCUS_05850 11050 11502 gene locus_tag LOCUS_05860 11050 11502 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386596.1 protein_id gnl|my_center|LOCUS_05860 12304 11798 gene locus_tag LOCUS_05870 12304 11798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 13499 12513 gene locus_tag LOCUS_05880 13499 12513 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920869.1 protein_id gnl|my_center|LOCUS_05880 14141 13656 gene locus_tag LOCUS_05890 14141 13656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 14383 15237 gene locus_tag LOCUS_05900 14383 15237 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458995.1 protein_id gnl|my_center|LOCUS_05900 15802 15296 gene locus_tag LOCUS_05910 15802 15296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 16049 17296 gene locus_tag LOCUS_05920 16049 17296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 18747 17428 gene locus_tag LOCUS_05930 18747 17428 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893433.1 protein_id gnl|my_center|LOCUS_05930 20047 18884 gene locus_tag LOCUS_05940 20047 18884 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_05940 21171 20083 gene locus_tag LOCUS_05950 gene serC 21171 20083 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_05950 22972 21284 gene locus_tag LOCUS_05960 gene ilvB 22972 21284 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_05960 24671 22998 gene locus_tag LOCUS_05970 gene ilvD 24671 22998 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_05970 25973 24888 gene locus_tag LOCUS_05980 gene leuB 25973 24888 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940244.1 protein_id gnl|my_center|LOCUS_05980 >Feature sequence020 415 801 gene locus_tag LOCUS_05990 gene spoIIIAD 415 801 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359080.1 protein_id gnl|my_center|LOCUS_05990 819 2069 gene locus_tag LOCUS_06000 819 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 2126 2851 gene locus_tag LOCUS_06010 2126 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 2793 3512 gene locus_tag LOCUS_06020 2793 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 3526 4335 gene locus_tag LOCUS_06030 3526 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 4606 4995 gene locus_tag LOCUS_06040 4606 4995 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_06040 5518 6654 gene locus_tag LOCUS_06050 5518 6654 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991766.1 protein_id gnl|my_center|LOCUS_06050 6667 6786 gene locus_tag LOCUS_06060 6667 6786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 7487 6948 gene locus_tag LOCUS_06070 7487 6948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 8265 7561 gene locus_tag LOCUS_06080 8265 7561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 10618 9032 gene locus_tag LOCUS_06090 10618 9032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 10992 11435 gene locus_tag LOCUS_06100 gene nusB 10992 11435 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358828.1 protein_id gnl|my_center|LOCUS_06100 11481 12707 gene locus_tag LOCUS_06110 gene xseA 11481 12707 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393024.1 protein_id gnl|my_center|LOCUS_06110 12707 13129 gene locus_tag LOCUS_06120 12707 13129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 13119 14015 gene locus_tag LOCUS_06130 13119 14015 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_06130 14035 15930 gene locus_tag LOCUS_06140 gene dxs 14035 15930 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_06140 16037 16846 gene locus_tag LOCUS_06150 16037 16846 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438136.1 protein_id gnl|my_center|LOCUS_06150 16901 17767 gene locus_tag LOCUS_06160 16901 17767 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_06160 17825 18277 gene locus_tag LOCUS_06170 17825 18277 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_06170 18320 20008 gene locus_tag LOCUS_06180 gene recN 18320 20008 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699855.1 protein_id gnl|my_center|LOCUS_06180 20759 20016 gene locus_tag LOCUS_06190 20759 20016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 20973 21644 gene locus_tag LOCUS_06200 20973 21644 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264517.1 protein_id gnl|my_center|LOCUS_06200 21646 23070 gene locus_tag LOCUS_06210 21646 23070 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110230.1 protein_id gnl|my_center|LOCUS_06210 23630 23208 gene locus_tag LOCUS_06220 23630 23208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 24195 23848 gene locus_tag LOCUS_06230 24195 23848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 25524 24244 gene locus_tag LOCUS_06240 25524 24244 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177663.1 protein_id gnl|my_center|LOCUS_06240 25825 25992 gene locus_tag LOCUS_06250 25825 25992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 >Feature sequence021 283 1485 gene locus_tag LOCUS_06260 283 1485 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932730.1 protein_id gnl|my_center|LOCUS_06260 1663 2430 gene locus_tag LOCUS_06270 1663 2430 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254611.1 protein_id gnl|my_center|LOCUS_06270 2518 2862 gene locus_tag LOCUS_06280 2518 2862 CDS product phenylpyruvate tautomerase MIF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964238.1 protein_id gnl|my_center|LOCUS_06280 2925 3437 gene locus_tag LOCUS_06290 2925 3437 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459551.1 protein_id gnl|my_center|LOCUS_06290 3490 4602 gene locus_tag LOCUS_06300 3490 4602 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813710.1 protein_id gnl|my_center|LOCUS_06300 5464 4745 gene locus_tag LOCUS_06310 5464 4745 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438111.1 protein_id gnl|my_center|LOCUS_06310 5574 5789 gene locus_tag LOCUS_06320 5574 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 5897 7624 gene locus_tag LOCUS_06330 gene gsiB 5897 7624 CDS product glutathione ABC transporter substrate-binding protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184428.1 protein_id gnl|my_center|LOCUS_06330 7917 8837 gene locus_tag LOCUS_06340 gene gsiC 7917 8837 CDS product glutathione ABC transporter permease GsiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065129.1 protein_id gnl|my_center|LOCUS_06340 8856 9737 gene locus_tag LOCUS_06350 gene gsiD 8856 9737 CDS product glutathione ABC transporter permease GsiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524243.1 protein_id gnl|my_center|LOCUS_06350 9790 10767 gene locus_tag LOCUS_06360 9790 10767 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618802.1 protein_id gnl|my_center|LOCUS_06360 10780 11757 gene locus_tag LOCUS_06370 10780 11757 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_06370 11960 12760 gene locus_tag LOCUS_06380 11960 12760 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889182.1 protein_id gnl|my_center|LOCUS_06380 12949 14079 gene locus_tag LOCUS_06390 12949 14079 CDS product M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546357.1 protein_id gnl|my_center|LOCUS_06390 14538 15179 gene locus_tag LOCUS_06400 14538 15179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 15207 17483 gene locus_tag LOCUS_06410 15207 17483 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787402.1 protein_id gnl|my_center|LOCUS_06410 17751 17891 gene locus_tag LOCUS_06420 17751 17891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 17867 19156 gene locus_tag LOCUS_06430 17867 19156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 19295 19957 gene locus_tag LOCUS_06440 gene cas5c 19295 19957 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176707.1 protein_id gnl|my_center|LOCUS_06440 19954 21732 gene locus_tag LOCUS_06450 gene cas8c 19954 21732 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176708.1 protein_id gnl|my_center|LOCUS_06450 21733 22632 gene locus_tag LOCUS_06460 gene cas7c 21733 22632 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_06460 22773 23435 gene locus_tag LOCUS_06470 gene cas4 22773 23435 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060901.1 protein_id gnl|my_center|LOCUS_06470 23453 24463 gene locus_tag LOCUS_06480 gene cas1c 23453 24463 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_06480 24588 24878 gene locus_tag LOCUS_06490 gene cas2 24588 24878 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932801.1 protein_id gnl|my_center|LOCUS_06490 25048 >25337 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgctcccctcgcgggagcgtggattgaaat >Feature sequence022 4584 1327 gene locus_tag LOCUS_06500 4584 1327 CDS product SNF2 helicase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986302.1 protein_id gnl|my_center|LOCUS_06500 5590 4619 gene locus_tag LOCUS_06510 gene holA 5590 4619 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468790.1 protein_id gnl|my_center|LOCUS_06510 5978 6736 gene locus_tag LOCUS_06520 5978 6736 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861832.1 protein_id gnl|my_center|LOCUS_06520 9320 6741 gene locus_tag LOCUS_06530 9320 6741 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157831.1 protein_id gnl|my_center|LOCUS_06530 10379 9435 gene locus_tag LOCUS_06540 10379 9435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 11849 10395 gene locus_tag LOCUS_06550 11849 10395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 12713 11850 gene locus_tag LOCUS_06560 12713 11850 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888619.1 protein_id gnl|my_center|LOCUS_06560 15060 13516 gene locus_tag LOCUS_06570 gene gpmI 15060 13516 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_06570 16876 15287 gene locus_tag LOCUS_06580 16876 15287 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015673.1 protein_id gnl|my_center|LOCUS_06580 17095 18108 gene locus_tag LOCUS_06590 gene aroF 17095 18108 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392848.1 protein_id gnl|my_center|LOCUS_06590 18758 18237 gene locus_tag LOCUS_06600 18758 18237 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814019.1 protein_id gnl|my_center|LOCUS_06600 19746 18994 gene locus_tag LOCUS_06610 gene tpiA 19746 18994 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700616.1 protein_id gnl|my_center|LOCUS_06610 21059 19854 gene locus_tag LOCUS_06620 21059 19854 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964029.1 protein_id gnl|my_center|LOCUS_06620 22238 21225 gene locus_tag LOCUS_06630 gene gap 22238 21225 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_06630 22523 24343 gene locus_tag LOCUS_06640 22523 24343 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746421.1 protein_id gnl|my_center|LOCUS_06640 24331 25023 gene locus_tag LOCUS_06650 24331 25023 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598666.1 protein_id gnl|my_center|LOCUS_06650 >Feature sequence023 767 39 gene locus_tag LOCUS_06660 767 39 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_06660 2314 935 gene locus_tag LOCUS_06670 2314 935 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963782.1 protein_id gnl|my_center|LOCUS_06670 2926 2579 gene locus_tag LOCUS_06680 gene ndoA 2926 2579 CDS product type II toxin-antitoxin system endoribonuclease NdoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156187.1 protein_id gnl|my_center|LOCUS_06680 4327 3068 gene locus_tag LOCUS_06690 gene alr 4327 3068 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_06690 5999 4461 gene locus_tag LOCUS_06700 5999 4461 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_06700 6409 6029 gene locus_tag LOCUS_06710 gene acpS 6409 6029 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017085.1 protein_id gnl|my_center|LOCUS_06710 7083 6406 gene locus_tag LOCUS_06720 7083 6406 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_06720 7480 9549 gene locus_tag LOCUS_06730 7480 9549 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966001.1 protein_id gnl|my_center|LOCUS_06730 10807 9701 gene locus_tag LOCUS_06740 10807 9701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 11334 10804 gene locus_tag LOCUS_06750 11334 10804 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813613.1 protein_id gnl|my_center|LOCUS_06750 12976 11660 gene locus_tag LOCUS_06760 12976 11660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 13314 13619 gene locus_tag LOCUS_06770 13314 13619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 15077 13800 gene locus_tag LOCUS_06780 15077 13800 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401829.1 protein_id gnl|my_center|LOCUS_06780 16178 15261 gene locus_tag LOCUS_06790 16178 15261 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462306.1 protein_id gnl|my_center|LOCUS_06790 17833 16403 gene locus_tag LOCUS_06800 gene purB 17833 16403 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_06800 18385 18164 gene locus_tag LOCUS_06810 18385 18164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 19130 18798 gene locus_tag LOCUS_06820 19130 18798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 19941 19186 gene locus_tag LOCUS_06830 gene dapB 19941 19186 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048150.1 protein_id gnl|my_center|LOCUS_06830 20920 20036 gene locus_tag LOCUS_06840 gene dapA 20920 20036 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_06840 21747 21247 gene locus_tag LOCUS_06850 gene cobO 21747 21247 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442279.1 protein_id gnl|my_center|LOCUS_06850 22484 21849 gene locus_tag LOCUS_06860 22484 21849 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422086.1 protein_id gnl|my_center|LOCUS_06860 24554 22701 gene locus_tag LOCUS_06870 gene typA 24554 22701 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_06870 >Feature sequence024 1476 658 gene locus_tag LOCUS_06880 1476 658 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262157.1 protein_id gnl|my_center|LOCUS_06880 1856 1473 gene locus_tag LOCUS_06890 1856 1473 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816592.1 protein_id gnl|my_center|LOCUS_06890 2243 2830 gene locus_tag LOCUS_06900 2243 2830 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027149.1 protein_id gnl|my_center|LOCUS_06900 2907 3458 gene locus_tag LOCUS_06910 2907 3458 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775452.1 protein_id gnl|my_center|LOCUS_06910 3543 3953 gene locus_tag LOCUS_06920 3543 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 4938 4279 gene locus_tag LOCUS_06930 gene deoC 4938 4279 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453154.1 protein_id gnl|my_center|LOCUS_06930 6218 5016 gene locus_tag LOCUS_06940 gene deoB 6218 5016 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046079.1 protein_id gnl|my_center|LOCUS_06940 6408 6205 gene locus_tag LOCUS_06950 6408 6205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 7249 6458 gene locus_tag LOCUS_06960 gene udp 7249 6458 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_06960 9210 7759 gene locus_tag LOCUS_06970 9210 7759 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096862.1 protein_id gnl|my_center|LOCUS_06970 9998 9261 gene locus_tag LOCUS_06980 9998 9261 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986547.1 protein_id gnl|my_center|LOCUS_06980 10671 9988 gene locus_tag LOCUS_06990 10671 9988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 11682 10744 gene locus_tag LOCUS_07000 11682 10744 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047707.1 protein_id gnl|my_center|LOCUS_07000 12407 12024 gene locus_tag LOCUS_07010 12407 12024 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016864.1 protein_id gnl|my_center|LOCUS_07010 13832 12435 gene locus_tag LOCUS_07020 13832 12435 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_07020 15598 13949 gene locus_tag LOCUS_07030 15598 13949 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_07030 16048 17685 gene locus_tag LOCUS_07040 16048 17685 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_07040 17729 18859 gene locus_tag LOCUS_07050 gene ytvI 17729 18859 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440267.1 protein_id gnl|my_center|LOCUS_07050 19366 19082 gene locus_tag LOCUS_07060 19366 19082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 19449 19991 gene locus_tag LOCUS_07070 19449 19991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 21183 20068 gene locus_tag LOCUS_07080 21183 20068 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387217.1 protein_id gnl|my_center|LOCUS_07080 21703 21170 gene locus_tag LOCUS_07090 21703 21170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 22189 23322 gene locus_tag LOCUS_07100 22189 23322 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812249.1 protein_id gnl|my_center|LOCUS_07100 23525 24109 gene locus_tag LOCUS_07110 23525 24109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 >Feature sequence025 <1 725 gene locus_tag LOCUS_07120 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393194.1:HD domain-containing protein 937 2502 gene locus_tag LOCUS_07130 937 2502 CDS product glucosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674711.1 protein_id gnl|my_center|LOCUS_07130 3012 4229 gene locus_tag LOCUS_07140 3012 4229 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461501.1 protein_id gnl|my_center|LOCUS_07140 4232 4669 gene locus_tag LOCUS_07150 4232 4669 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476578.1 protein_id gnl|my_center|LOCUS_07150 5054 5947 gene locus_tag LOCUS_07160 gene rfbA 5054 5947 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112125.1 protein_id gnl|my_center|LOCUS_07160 6053 7075 gene locus_tag LOCUS_07170 gene rfbB 6053 7075 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_07170 7075 7920 gene locus_tag LOCUS_07180 gene rfbD 7075 7920 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664653.1 protein_id gnl|my_center|LOCUS_07180 7956 9308 gene locus_tag LOCUS_07190 gene glmM 7956 9308 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521416.1 protein_id gnl|my_center|LOCUS_07190 9550 10083 gene locus_tag LOCUS_07200 gene greA 9550 10083 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965725.1 protein_id gnl|my_center|LOCUS_07200 10083 11498 gene locus_tag LOCUS_07210 10083 11498 CDS product 2-hydroxycarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002308483.1 protein_id gnl|my_center|LOCUS_07210 12173 11490 gene locus_tag LOCUS_07220 12173 11490 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966634.1 protein_id gnl|my_center|LOCUS_07220 12846 12298 gene locus_tag LOCUS_07230 12846 12298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 13969 12848 gene locus_tag LOCUS_07240 13969 12848 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861704.1 protein_id gnl|my_center|LOCUS_07240 15363 14194 gene locus_tag LOCUS_07250 15363 14194 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064402.1 protein_id gnl|my_center|LOCUS_07250 15585 16418 gene locus_tag LOCUS_07260 15585 16418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 16662 17033 gene locus_tag LOCUS_07270 16662 17033 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_07270 17049 18032 gene locus_tag LOCUS_07280 17049 18032 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_07280 18013 18633 gene locus_tag LOCUS_07290 18013 18633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 18950 19309 gene locus_tag LOCUS_07300 18950 19309 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459353.1 protein_id gnl|my_center|LOCUS_07300 19391 19609 gene locus_tag LOCUS_07310 19391 19609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 19723 21600 gene locus_tag LOCUS_07320 19723 21600 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07320 21949 23736 gene locus_tag LOCUS_07330 21949 23736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 >Feature sequence026 4364 2811 gene locus_tag LOCUS_07340 4364 2811 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896350.1 protein_id gnl|my_center|LOCUS_07340 4824 5771 gene locus_tag LOCUS_07350 4824 5771 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937958.1 protein_id gnl|my_center|LOCUS_07350 7389 5761 gene locus_tag LOCUS_07360 gene cobA 7389 5761 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_07360 8372 7476 gene locus_tag LOCUS_07370 gene hemC 8372 7476 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260939.1 protein_id gnl|my_center|LOCUS_07370 9039 8365 gene locus_tag LOCUS_07380 9039 8365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 9231 9488 gene locus_tag LOCUS_07390 9231 9488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 9642 9878 gene locus_tag LOCUS_07400 9642 9878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 11220 9967 gene locus_tag LOCUS_07410 11220 9967 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964048.1 protein_id gnl|my_center|LOCUS_07410 12391 11228 gene locus_tag LOCUS_07420 12391 11228 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964224.1 protein_id gnl|my_center|LOCUS_07420 12564 12818 gene locus_tag LOCUS_07430 12564 12818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 13636 12977 gene locus_tag LOCUS_07440 13636 12977 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948611.1 protein_id gnl|my_center|LOCUS_07440 15400 13850 gene locus_tag LOCUS_07450 15400 13850 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836536.1 protein_id gnl|my_center|LOCUS_07450 16585 15482 gene locus_tag LOCUS_07460 gene cobD 16585 15482 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009926914.1 protein_id gnl|my_center|LOCUS_07460 17580 16684 gene locus_tag LOCUS_07470 gene cbiB 17580 16684 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943620.1 protein_id gnl|my_center|LOCUS_07470 18156 17710 gene locus_tag LOCUS_07480 18156 17710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 19014 18190 gene locus_tag LOCUS_07490 gene cobS 19014 18190 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680312.1 protein_id gnl|my_center|LOCUS_07490 19598 19011 gene locus_tag LOCUS_07500 19598 19011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 20846 19734 gene locus_tag LOCUS_07510 gene cobT 20846 19734 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 protein_id gnl|my_center|LOCUS_07510 22198 20843 gene locus_tag LOCUS_07520 22198 20843 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901682.1 protein_id gnl|my_center|LOCUS_07520 22758 22195 gene locus_tag LOCUS_07530 22758 22195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 <24336 22854 gene locus_tag LOCUS_07540 <24336 22854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681810.1:precorrin-6A reductase >Feature sequence027 528 1163 gene locus_tag LOCUS_07550 528 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 1264 2322 gene locus_tag LOCUS_07560 1264 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 2532 3899 gene locus_tag LOCUS_07570 2532 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 3877 5265 gene locus_tag LOCUS_07580 3877 5265 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382305.1 protein_id gnl|my_center|LOCUS_07580 5383 5673 gene locus_tag LOCUS_07590 5383 5673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 7264 5909 gene locus_tag LOCUS_07600 7264 5909 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 protein_id gnl|my_center|LOCUS_07600 7430 9616 gene locus_tag LOCUS_07610 7430 9616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 9662 9961 gene locus_tag LOCUS_07620 9662 9961 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965129.1 protein_id gnl|my_center|LOCUS_07620 10037 12442 gene locus_tag LOCUS_07630 gene clpA 10037 12442 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965130.1 protein_id gnl|my_center|LOCUS_07630 12439 13623 gene locus_tag LOCUS_07640 12439 13623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 13962 14927 gene locus_tag LOCUS_07650 13962 14927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 14981 15622 gene locus_tag LOCUS_07660 14981 15622 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905527.1 protein_id gnl|my_center|LOCUS_07660 15813 15740 gene locus_tag LOCUS_t00140 15813 15740 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 17236 15869 gene locus_tag LOCUS_07670 17236 15869 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816666.1 protein_id gnl|my_center|LOCUS_07670 17524 18516 gene locus_tag LOCUS_07680 17524 18516 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053899.1 protein_id gnl|my_center|LOCUS_07680 18862 20295 gene locus_tag LOCUS_07690 18862 20295 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546599.1 protein_id gnl|my_center|LOCUS_07690 21723 20446 gene locus_tag LOCUS_07700 21723 20446 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_07700 >Feature sequence028 1660 284 gene locus_tag LOCUS_07710 1660 284 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948237.1 protein_id gnl|my_center|LOCUS_07710 3026 2280 gene locus_tag LOCUS_07720 3026 2280 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986406.1 protein_id gnl|my_center|LOCUS_07720 6286 3023 gene locus_tag LOCUS_07730 6286 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 7078 6290 gene locus_tag LOCUS_07740 7078 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 8519 7152 gene locus_tag LOCUS_07750 8519 7152 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387739.1 protein_id gnl|my_center|LOCUS_07750 9667 8846 gene locus_tag LOCUS_07760 9667 8846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 10229 9627 gene locus_tag LOCUS_07770 10229 9627 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391659.1 protein_id gnl|my_center|LOCUS_07770 11749 10391 gene locus_tag LOCUS_07780 11749 10391 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393158.1 protein_id gnl|my_center|LOCUS_07780 12534 11803 gene locus_tag LOCUS_07790 12534 11803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 13704 12859 gene locus_tag LOCUS_07800 13704 12859 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706548.1 protein_id gnl|my_center|LOCUS_07800 14394 13720 gene locus_tag LOCUS_07810 14394 13720 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432519.1 protein_id gnl|my_center|LOCUS_07810 15220 14543 gene locus_tag LOCUS_07820 15220 14543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 16089 15286 gene locus_tag LOCUS_07830 16089 15286 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459709.1 protein_id gnl|my_center|LOCUS_07830 16857 16483 gene locus_tag LOCUS_07840 gene rplL 16857 16483 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421186.1 protein_id gnl|my_center|LOCUS_07840 17477 16989 gene locus_tag LOCUS_07850 gene rplJ 17477 16989 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360185.1 protein_id gnl|my_center|LOCUS_07850 18517 17822 gene locus_tag LOCUS_07860 gene rplA 18517 17822 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421188.1 protein_id gnl|my_center|LOCUS_07860 19030 18605 gene locus_tag LOCUS_07870 gene rplK 19030 18605 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421189.1 protein_id gnl|my_center|LOCUS_07870 19623 19108 gene locus_tag LOCUS_07880 gene nusG 19623 19108 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966426.1 protein_id gnl|my_center|LOCUS_07880 19849 19646 gene locus_tag LOCUS_07890 19849 19646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 21263 20331 gene locus_tag LOCUS_07900 21263 20331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 >Feature sequence029 862 1698 gene locus_tag LOCUS_07910 862 1698 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814219.1 protein_id gnl|my_center|LOCUS_07910 2021 3286 gene locus_tag LOCUS_07920 2021 3286 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902958.1 protein_id gnl|my_center|LOCUS_07920 5306 3216 gene locus_tag LOCUS_07930 gene recQ 5306 3216 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058493.1 protein_id gnl|my_center|LOCUS_07930 6256 5276 gene locus_tag LOCUS_07940 6256 5276 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948398.1 protein_id gnl|my_center|LOCUS_07940 8296 6716 gene locus_tag LOCUS_07950 8296 6716 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437129.1 protein_id gnl|my_center|LOCUS_07950 9429 8296 gene locus_tag LOCUS_07960 9429 8296 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437132.1 protein_id gnl|my_center|LOCUS_07960 11171 9891 gene locus_tag LOCUS_07970 11171 9891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 12086 11715 gene locus_tag LOCUS_07980 12086 11715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 12382 12251 gene locus_tag LOCUS_07990 12382 12251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 13548 12382 gene locus_tag LOCUS_08000 13548 12382 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048302.1 protein_id gnl|my_center|LOCUS_08000 14635 13616 gene locus_tag LOCUS_08010 14635 13616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 14947 15546 gene locus_tag LOCUS_08020 14947 15546 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361699.1 protein_id gnl|my_center|LOCUS_08020 17027 15669 gene locus_tag LOCUS_08030 17027 15669 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143455604.1 protein_id gnl|my_center|LOCUS_08030 17706 17098 gene locus_tag LOCUS_08040 17706 17098 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530472.1 protein_id gnl|my_center|LOCUS_08040 18813 17767 gene locus_tag LOCUS_08050 18813 17767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 19400 18921 gene locus_tag LOCUS_08060 gene rlmH 19400 18921 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053094.1 protein_id gnl|my_center|LOCUS_08060 20529 19366 gene locus_tag LOCUS_08070 20529 19366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 >Feature sequence030 <1 1079 gene locus_tag LOCUS_08080 <1 1079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003562821.1:replication-associated recombination protein A 1142 2224 gene locus_tag LOCUS_08090 gene rsmH 1142 2224 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_08090 2411 3568 gene locus_tag LOCUS_08100 gene spoIIIAA 2411 3568 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272423.1 protein_id gnl|my_center|LOCUS_08100 3456 3914 gene locus_tag LOCUS_08110 3456 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 4094 4288 gene locus_tag LOCUS_08120 gene spoIIIAC 4094 4288 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888937.1 protein_id gnl|my_center|LOCUS_08120 4463 4909 gene locus_tag LOCUS_08130 4463 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 6416 5115 gene locus_tag LOCUS_08140 gene spoIVB 6416 5115 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986434.1 protein_id gnl|my_center|LOCUS_08140 6968 7549 gene locus_tag LOCUS_08150 6968 7549 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722740.1 protein_id gnl|my_center|LOCUS_08150 7829 8773 gene locus_tag LOCUS_08160 7829 8773 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053942.1 protein_id gnl|my_center|LOCUS_08160 8853 9203 gene locus_tag LOCUS_08170 8853 9203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 9721 11133 gene locus_tag LOCUS_08180 9721 11133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 11130 11774 gene locus_tag LOCUS_08190 11130 11774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 11771 15088 gene locus_tag LOCUS_08200 11771 15088 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392027.1 protein_id gnl|my_center|LOCUS_08200 15099 16310 gene locus_tag LOCUS_08210 15099 16310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 16300 16428 gene locus_tag LOCUS_08220 16300 16428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 17010 16492 gene locus_tag LOCUS_08230 17010 16492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 18380 17016 gene locus_tag LOCUS_08240 gene melA 18380 17016 CDS product alpha-galactosidase MelA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246000.1 protein_id gnl|my_center|LOCUS_08240 18536 19324 gene locus_tag LOCUS_08250 18536 19324 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909131.1 protein_id gnl|my_center|LOCUS_08250 19367 19774 gene locus_tag LOCUS_08260 19367 19774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 19722 19877 gene locus_tag LOCUS_08270 19722 19877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 21203 19986 gene locus_tag LOCUS_08280 gene coaBC 21203 19986 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_08280 >Feature sequence031 78 150 gene locus_tag LOCUS_t00150 78 150 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 313 1071 gene locus_tag LOCUS_08290 313 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 1093 1221 gene locus_tag LOCUS_08300 1093 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 1265 2287 gene locus_tag LOCUS_08310 1265 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 2593 4530 gene locus_tag LOCUS_08320 2593 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 4699 6318 gene locus_tag LOCUS_08330 4699 6318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 6242 7003 gene locus_tag LOCUS_08340 6242 7003 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963621.1 protein_id gnl|my_center|LOCUS_08340 7211 8200 gene locus_tag LOCUS_08350 7211 8200 CDS product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435878.1 protein_id gnl|my_center|LOCUS_08350 8205 9113 gene locus_tag LOCUS_08360 8205 9113 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963624.1 protein_id gnl|my_center|LOCUS_08360 9156 9908 gene locus_tag LOCUS_08370 9156 9908 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_08370 9927 10805 gene locus_tag LOCUS_08380 gene rsmI 9927 10805 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963630.1 protein_id gnl|my_center|LOCUS_08380 11358 10978 gene locus_tag LOCUS_08390 11358 10978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 13553 11580 gene locus_tag LOCUS_08400 gene glgB 13553 11580 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141306.1 protein_id gnl|my_center|LOCUS_08400 13918 13694 gene locus_tag LOCUS_08410 13918 13694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 14367 14038 gene locus_tag LOCUS_08420 14367 14038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 14653 15309 gene locus_tag LOCUS_08430 gene fsa 14653 15309 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964656.1 protein_id gnl|my_center|LOCUS_08430 16040 16465 gene locus_tag LOCUS_08440 16040 16465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 16462 17478 gene locus_tag LOCUS_08450 16462 17478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 17702 18859 gene locus_tag LOCUS_08460 17702 18859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 18807 19616 gene locus_tag LOCUS_08470 18807 19616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 19606 20997 gene locus_tag LOCUS_08480 19606 20997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 21177 21374 gene locus_tag LOCUS_08490 21177 21374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 >Feature sequence032 1547 531 gene locus_tag LOCUS_08500 1547 531 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075125.1 protein_id gnl|my_center|LOCUS_08500 2574 1612 gene locus_tag LOCUS_08510 2574 1612 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963717.1 protein_id gnl|my_center|LOCUS_08510 3553 2588 gene locus_tag LOCUS_08520 3553 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 4927 3575 gene locus_tag LOCUS_08530 4927 3575 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897651.1 protein_id gnl|my_center|LOCUS_08530 6122 4956 gene locus_tag LOCUS_08540 6122 4956 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867899.1 protein_id gnl|my_center|LOCUS_08540 6572 7594 gene locus_tag LOCUS_08550 6572 7594 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963715.1 protein_id gnl|my_center|LOCUS_08550 9588 7702 gene locus_tag LOCUS_08560 gene rho 9588 7702 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898714.1 protein_id gnl|my_center|LOCUS_08560 9967 10431 gene locus_tag LOCUS_08570 9967 10431 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964912.1 protein_id gnl|my_center|LOCUS_08570 11771 10581 gene locus_tag LOCUS_08580 gene nspC 11771 10581 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764364.1 protein_id gnl|my_center|LOCUS_08580 12986 11784 gene locus_tag LOCUS_08590 12986 11784 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088780.1 protein_id gnl|my_center|LOCUS_08590 13917 13012 gene locus_tag LOCUS_08600 gene speB 13917 13012 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888724.1 protein_id gnl|my_center|LOCUS_08600 14825 13974 gene locus_tag LOCUS_08610 gene speE 14825 13974 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808145.1 protein_id gnl|my_center|LOCUS_08610 16313 14853 gene locus_tag LOCUS_08620 16313 14853 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808143.1 protein_id gnl|my_center|LOCUS_08620 17107 16349 gene locus_tag LOCUS_08630 gene speD 17107 16349 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965890.1 protein_id gnl|my_center|LOCUS_08630 19224 17932 gene locus_tag LOCUS_08640 19224 17932 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_08640 20748 19315 gene locus_tag LOCUS_08650 gene proS 20748 19315 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450718.1 protein_id gnl|my_center|LOCUS_08650 >Feature sequence033 288 1949 gene locus_tag LOCUS_08660 288 1949 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_08660 1951 2637 gene locus_tag LOCUS_08670 1951 2637 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_08670 2722 4122 gene locus_tag LOCUS_08680 2722 4122 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254665.1 protein_id gnl|my_center|LOCUS_08680 4684 4097 gene locus_tag LOCUS_08690 4684 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 5072 6097 gene locus_tag LOCUS_08700 5072 6097 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811776.1 protein_id gnl|my_center|LOCUS_08700 6099 7019 gene locus_tag LOCUS_08710 6099 7019 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811777.1 protein_id gnl|my_center|LOCUS_08710 7013 7810 gene locus_tag LOCUS_08720 7013 7810 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_08720 8150 9979 gene locus_tag LOCUS_08730 8150 9979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 10231 11919 gene locus_tag LOCUS_08740 10231 11919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 13162 12050 gene locus_tag LOCUS_08750 gene citC 13162 12050 CDS product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263235.1 protein_id gnl|my_center|LOCUS_08750 13437 14225 gene locus_tag LOCUS_08760 gene tepA 13437 14225 CDS product translocation-enhancing protein TepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245712.1 protein_id gnl|my_center|LOCUS_08760 14619 17771 gene locus_tag LOCUS_08770 14619 17771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 17843 19306 gene locus_tag LOCUS_08780 17843 19306 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_08780 19378 20808 gene locus_tag LOCUS_08790 19378 20808 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272578.1 protein_id gnl|my_center|LOCUS_08790 >Feature sequence034 <1 589 gene locus_tag LOCUS_08800 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681044.1:DUF3793 family protein 660 1091 gene locus_tag LOCUS_08810 660 1091 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902921.1 protein_id gnl|my_center|LOCUS_08810 1223 1504 gene locus_tag LOCUS_08820 1223 1504 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890712.1 protein_id gnl|my_center|LOCUS_08820 2109 1660 gene locus_tag LOCUS_08830 2109 1660 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_08830 2494 2805 gene locus_tag LOCUS_08840 2494 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 2885 3070 gene locus_tag LOCUS_08850 2885 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 3721 3116 gene locus_tag LOCUS_08860 3721 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 4088 5368 gene locus_tag LOCUS_08870 4088 5368 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048319.1 protein_id gnl|my_center|LOCUS_08870 5380 6708 gene locus_tag LOCUS_08880 5380 6708 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925421.1 protein_id gnl|my_center|LOCUS_08880 6967 8607 gene locus_tag LOCUS_08890 6967 8607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 8830 9237 gene locus_tag LOCUS_08900 8830 9237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 10017 9442 gene locus_tag LOCUS_08910 10017 9442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 10273 11742 gene locus_tag LOCUS_08920 10273 11742 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_08920 11904 12602 gene locus_tag LOCUS_08930 11904 12602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 13583 12690 gene locus_tag LOCUS_08940 13583 12690 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886481.1 protein_id gnl|my_center|LOCUS_08940 13752 14288 gene locus_tag LOCUS_08950 13752 14288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 14282 15565 gene locus_tag LOCUS_08960 14282 15565 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099149.1 protein_id gnl|my_center|LOCUS_08960 15851 17203 gene locus_tag LOCUS_08970 15851 17203 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_08970 17383 17967 gene locus_tag LOCUS_08980 17383 17967 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948351.1 protein_id gnl|my_center|LOCUS_08980 17985 19004 gene locus_tag LOCUS_08990 17985 19004 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964797.1 protein_id gnl|my_center|LOCUS_08990 19794 19126 gene locus_tag LOCUS_09000 19794 19126 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948142.1 protein_id gnl|my_center|LOCUS_09000 20217 20143 gene locus_tag LOCUS_t00160 20217 20143 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence035 2191 1325 gene locus_tag LOCUS_09010 2191 1325 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667339.1 protein_id gnl|my_center|LOCUS_09010 3807 2356 gene locus_tag LOCUS_09020 gene guaB 3807 2356 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965988.1 protein_id gnl|my_center|LOCUS_09020 4984 3977 gene locus_tag LOCUS_09030 4984 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 5944 5165 gene locus_tag LOCUS_09040 5944 5165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 6859 6107 gene locus_tag LOCUS_09050 6859 6107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 <20085 7000 gene locus_tag LOCUS_09060 <20085 7000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011837269.1:SpaA isopeptide-forming pilin-related protein >Feature sequence036 236 421 gene locus_tag LOCUS_09070 236 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09070 487 1428 gene locus_tag LOCUS_09080 gene cysK 487 1428 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_09080 1904 1557 gene locus_tag LOCUS_09090 1904 1557 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721726.1 protein_id gnl|my_center|LOCUS_09090 2175 2531 gene locus_tag LOCUS_09100 2175 2531 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947952.1 protein_id gnl|my_center|LOCUS_09100 2506 3189 gene locus_tag LOCUS_09110 2506 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 3338 4366 gene locus_tag LOCUS_09120 3338 4366 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389346.1 protein_id gnl|my_center|LOCUS_09120 4387 6102 gene locus_tag LOCUS_09130 4387 6102 CDS product glucosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674711.1 protein_id gnl|my_center|LOCUS_09130 6176 6946 gene locus_tag LOCUS_09140 6176 6946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09140 7016 7462 gene locus_tag LOCUS_09150 7016 7462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09150 9370 7544 gene locus_tag LOCUS_09160 9370 7544 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082593.1 protein_id gnl|my_center|LOCUS_09160 9716 10855 gene locus_tag LOCUS_09170 9716 10855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 12043 11027 gene locus_tag LOCUS_09180 12043 11027 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948341.1 protein_id gnl|my_center|LOCUS_09180 14353 12437 gene locus_tag LOCUS_09190 14353 12437 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392246.1 protein_id gnl|my_center|LOCUS_09190 14939 15955 gene locus_tag LOCUS_09200 14939 15955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 16000 16701 gene locus_tag LOCUS_09210 16000 16701 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066872391.1 protein_id gnl|my_center|LOCUS_09210 16796 18067 gene locus_tag LOCUS_09220 16796 18067 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703620.1 protein_id gnl|my_center|LOCUS_09220 18197 19360 gene locus_tag LOCUS_09230 18197 19360 CDS product metallo-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977198.1 protein_id gnl|my_center|LOCUS_09230 >Feature sequence037 1269 613 gene locus_tag LOCUS_09240 1269 613 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272615.1 protein_id gnl|my_center|LOCUS_09240 2178 1300 gene locus_tag LOCUS_09250 2178 1300 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809174.1 protein_id gnl|my_center|LOCUS_09250 4419 2275 gene locus_tag LOCUS_09260 4419 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 6089 4473 gene locus_tag LOCUS_09270 6089 4473 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272616.1 protein_id gnl|my_center|LOCUS_09270 6925 7494 gene locus_tag LOCUS_09280 6925 7494 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566988.1 protein_id gnl|my_center|LOCUS_09280 7735 8949 gene locus_tag LOCUS_09290 gene gltS 7735 8949 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003392508.1 protein_id gnl|my_center|LOCUS_09290 9921 9106 gene locus_tag LOCUS_09300 9921 9106 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289081.1 protein_id gnl|my_center|LOCUS_09300 10528 9974 gene locus_tag LOCUS_09310 gene rfbC 10528 9974 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_09310 11091 10666 gene locus_tag LOCUS_09320 11091 10666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 11807 11088 gene locus_tag LOCUS_09330 11807 11088 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985169.1 protein_id gnl|my_center|LOCUS_09330 12896 11886 gene locus_tag LOCUS_09340 gene rfbN 12896 11886 CDS product O antigen biosynthesis rhamnosyltransferase RfbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705149.1 protein_id gnl|my_center|LOCUS_09340 13745 12906 gene locus_tag LOCUS_09350 13745 12906 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917001.1 protein_id gnl|my_center|LOCUS_09350 15870 13783 gene locus_tag LOCUS_09360 15870 13783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 16601 15846 gene locus_tag LOCUS_09370 16601 15846 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878638.1 protein_id gnl|my_center|LOCUS_09370 17689 16598 gene locus_tag LOCUS_09380 17689 16598 CDS product serine-pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081619.1 protein_id gnl|my_center|LOCUS_09380 18980 17682 gene locus_tag LOCUS_09390 18980 17682 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922136.1 protein_id gnl|my_center|LOCUS_09390 19198 18977 gene locus_tag LOCUS_09400 19198 18977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 >Feature sequence038 1648 386 gene locus_tag LOCUS_09410 gene hisS 1648 386 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767712.1 protein_id gnl|my_center|LOCUS_09410 3378 1822 gene locus_tag LOCUS_09420 3378 1822 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_09420 4074 3427 gene locus_tag LOCUS_09430 4074 3427 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_09430 6491 4206 gene locus_tag LOCUS_09440 6491 4206 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048080.1 protein_id gnl|my_center|LOCUS_09440 7836 6805 gene locus_tag LOCUS_09450 7836 6805 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906252.1 protein_id gnl|my_center|LOCUS_09450 8530 8006 gene locus_tag LOCUS_09460 8530 8006 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357763.1 protein_id gnl|my_center|LOCUS_09460 10022 8613 gene locus_tag LOCUS_09470 gene argH 10022 8613 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_09470 13015 10037 gene locus_tag LOCUS_09480 13015 10037 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106612643.1 protein_id gnl|my_center|LOCUS_09480 13592 13032 gene locus_tag LOCUS_09490 13592 13032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 15026 13740 gene locus_tag LOCUS_09500 15026 13740 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731178.1 protein_id gnl|my_center|LOCUS_09500 15361 15894 gene locus_tag LOCUS_09510 15361 15894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 15989 16552 gene locus_tag LOCUS_09520 15989 16552 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_09520 17636 16629 gene locus_tag LOCUS_09530 17636 16629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 17970 17716 gene locus_tag LOCUS_09540 17970 17716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 <18757 17957 gene locus_tag LOCUS_09550 <18757 17957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048264.1:tyrosine--tRNA ligase >Feature sequence039 1383 403 gene locus_tag LOCUS_09560 1383 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 1781 2626 gene locus_tag LOCUS_09570 1781 2626 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_09570 3525 2797 gene locus_tag LOCUS_09580 3525 2797 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966768.1 protein_id gnl|my_center|LOCUS_09580 4644 3667 gene locus_tag LOCUS_09590 4644 3667 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288613.1 protein_id gnl|my_center|LOCUS_09590 5536 4679 gene locus_tag LOCUS_09600 5536 4679 CDS product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966764.1 protein_id gnl|my_center|LOCUS_09600 6509 5781 gene locus_tag LOCUS_09610 6509 5781 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635556.1 protein_id gnl|my_center|LOCUS_09610 8409 6697 gene locus_tag LOCUS_09620 8409 6697 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538203.1 protein_id gnl|my_center|LOCUS_09620 10472 8409 gene locus_tag LOCUS_09630 10472 8409 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491196.1 protein_id gnl|my_center|LOCUS_09630 10836 10492 gene locus_tag LOCUS_09640 10836 10492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 12255 10840 gene locus_tag LOCUS_09650 12255 10840 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096862.1 protein_id gnl|my_center|LOCUS_09650 13247 12252 gene locus_tag LOCUS_09660 13247 12252 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_09660 14229 13237 gene locus_tag LOCUS_09670 14229 13237 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963503.1 protein_id gnl|my_center|LOCUS_09670 15979 14336 gene locus_tag LOCUS_09680 15979 14336 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678775.1 protein_id gnl|my_center|LOCUS_09680 16935 16072 gene locus_tag LOCUS_09690 16935 16072 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678776.1 protein_id gnl|my_center|LOCUS_09690 17902 16949 gene locus_tag LOCUS_09700 17902 16949 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678777.1 protein_id gnl|my_center|LOCUS_09700 18382 18310 gene locus_tag LOCUS_t00170 18382 18310 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence040 1847 927 gene locus_tag LOCUS_09710 1847 927 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_09710 2425 2952 gene locus_tag LOCUS_09720 2425 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 2994 3740 gene locus_tag LOCUS_09730 2994 3740 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_09730 4614 3787 gene locus_tag LOCUS_09740 4614 3787 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101946.1 protein_id gnl|my_center|LOCUS_09740 5337 4846 gene locus_tag LOCUS_09750 5337 4846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 6174 5869 gene locus_tag LOCUS_09760 gene trxA 6174 5869 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329897.1 protein_id gnl|my_center|LOCUS_09760 7917 6415 gene locus_tag LOCUS_09770 gene malQ 7917 6415 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747274.1 protein_id gnl|my_center|LOCUS_09770 8898 7924 gene locus_tag LOCUS_09780 8898 7924 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286367.1 protein_id gnl|my_center|LOCUS_09780 11323 9011 gene locus_tag LOCUS_09790 11323 9011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 11732 12790 gene locus_tag LOCUS_09800 gene malR 11732 12790 CDS product maltose operon transcriptional repressor MalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219053.1 protein_id gnl|my_center|LOCUS_09800 13517 12810 gene locus_tag LOCUS_09810 13517 12810 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861910.1 protein_id gnl|my_center|LOCUS_09810 14097 13834 gene locus_tag LOCUS_09820 14097 13834 CDS product CD3324 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986726.1 protein_id gnl|my_center|LOCUS_09820 14859 14290 gene locus_tag LOCUS_09830 14859 14290 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583215.1 protein_id gnl|my_center|LOCUS_09830 16116 15457 gene locus_tag LOCUS_09840 16116 15457 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891221.1 protein_id gnl|my_center|LOCUS_09840 17504 16131 gene locus_tag LOCUS_09850 17504 16131 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422669.1 protein_id gnl|my_center|LOCUS_09850 <18074 17504 gene locus_tag LOCUS_09860 <18074 17504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033047490.1:V-type ATP synthase subunit A >Feature sequence041 841 3846 gene locus_tag LOCUS_09870 gene ebgA 841 3846 CDS product beta-galactosidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706828.1 protein_id gnl|my_center|LOCUS_09870 3925 4929 gene locus_tag LOCUS_09880 gene ebgR 3925 4929 CDS product transcriptional regulator EbgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263230.1 protein_id gnl|my_center|LOCUS_09880 5167 6279 gene locus_tag LOCUS_09890 gene ugpC 5167 6279 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_09890 6463 6663 gene locus_tag LOCUS_09900 6463 6663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 6715 7863 gene locus_tag LOCUS_09910 6715 7863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 7839 8042 gene locus_tag LOCUS_09920 7839 8042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 8101 9015 gene locus_tag LOCUS_09930 8101 9015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 9104 9823 gene locus_tag LOCUS_09940 9104 9823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 9840 11882 gene locus_tag LOCUS_09950 9840 11882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 11857 12534 gene locus_tag LOCUS_09960 11857 12534 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583630.1 protein_id gnl|my_center|LOCUS_09960 12758 14038 gene locus_tag LOCUS_09970 12758 14038 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_09970 14186 15736 gene locus_tag LOCUS_09980 gene cls 14186 15736 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262851.1 protein_id gnl|my_center|LOCUS_09980 15849 16706 gene locus_tag LOCUS_09990 15849 16706 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203249.1 protein_id gnl|my_center|LOCUS_09990 >Feature sequence042 <1 1981 gene locus_tag LOCUS_10000 <1 1981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003232079.1:primosomal protein N' 2041 2520 gene locus_tag LOCUS_10010 gene def 2041 2520 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965029.1 protein_id gnl|my_center|LOCUS_10010 2586 3524 gene locus_tag LOCUS_10020 gene fmt 2586 3524 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388615.1 protein_id gnl|my_center|LOCUS_10020 3619 4335 gene locus_tag LOCUS_10030 3619 4335 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287139.1 protein_id gnl|my_center|LOCUS_10030 4328 5746 gene locus_tag LOCUS_10040 gene rsmB 4328 5746 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861607.1 protein_id gnl|my_center|LOCUS_10040 5801 6931 gene locus_tag LOCUS_10050 gene rlmN 5801 6931 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986842.1 protein_id gnl|my_center|LOCUS_10050 6937 7683 gene locus_tag LOCUS_10060 6937 7683 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354922.1 protein_id gnl|my_center|LOCUS_10060 7680 10085 gene locus_tag LOCUS_10070 7680 10085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 10088 10966 gene locus_tag LOCUS_10080 gene rsgA 10088 10966 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893669.1 protein_id gnl|my_center|LOCUS_10080 10970 11629 gene locus_tag LOCUS_10090 gene rpe 10970 11629 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965037.1 protein_id gnl|my_center|LOCUS_10090 11681 12511 gene locus_tag LOCUS_10100 11681 12511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 12717 13304 gene locus_tag LOCUS_10110 12717 13304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 13315 14172 gene locus_tag LOCUS_10120 13315 14172 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428191.1 protein_id gnl|my_center|LOCUS_10120 14315 15592 gene locus_tag LOCUS_10130 gene serS 14315 15592 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_10130 15775 16908 gene locus_tag LOCUS_10140 15775 16908 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053675.1 protein_id gnl|my_center|LOCUS_10140 >Feature sequence043 461 1678 gene locus_tag LOCUS_10150 461 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 1782 2318 gene locus_tag LOCUS_10160 1782 2318 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966606.1 protein_id gnl|my_center|LOCUS_10160 2450 3430 gene locus_tag LOCUS_10170 2450 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 3569 5305 gene locus_tag LOCUS_10180 3569 5305 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396540.1 protein_id gnl|my_center|LOCUS_10180 6581 5487 gene locus_tag LOCUS_10190 6581 5487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 6882 8441 gene locus_tag LOCUS_10200 6882 8441 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233752.1 protein_id gnl|my_center|LOCUS_10200 8457 9620 gene locus_tag LOCUS_10210 8457 9620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 9701 10708 gene locus_tag LOCUS_10220 gene ansA 9701 10708 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399032.1 protein_id gnl|my_center|LOCUS_10220 11265 12269 gene locus_tag LOCUS_10230 11265 12269 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966142.1 protein_id gnl|my_center|LOCUS_10230 12278 14635 gene locus_tag LOCUS_10240 12278 14635 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434402.1 protein_id gnl|my_center|LOCUS_10240 15024 15794 gene locus_tag LOCUS_10250 15024 15794 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099097343.1 protein_id gnl|my_center|LOCUS_10250 15966 16742 gene locus_tag LOCUS_10260 15966 16742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 >Feature sequence044 3058 446 gene locus_tag LOCUS_10270 3058 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 3273 3929 gene locus_tag LOCUS_10280 gene ytaF 3273 3929 CDS product sporulation membrane protein YtaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949142.1 protein_id gnl|my_center|LOCUS_10280 6620 3957 gene locus_tag LOCUS_10290 6620 3957 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272299.1 protein_id gnl|my_center|LOCUS_10290 7638 6775 gene locus_tag LOCUS_10300 7638 6775 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948636.1 protein_id gnl|my_center|LOCUS_10300 7861 7595 gene locus_tag LOCUS_10310 7861 7595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 9829 8090 gene locus_tag LOCUS_10320 9829 8090 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812007.1 protein_id gnl|my_center|LOCUS_10320 11974 10241 gene locus_tag LOCUS_10330 11974 10241 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812007.1 protein_id gnl|my_center|LOCUS_10330 13153 12092 gene locus_tag LOCUS_10340 13153 12092 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812005.1 protein_id gnl|my_center|LOCUS_10340 14157 13153 gene locus_tag LOCUS_10350 14157 13153 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812003.1 protein_id gnl|my_center|LOCUS_10350 15211 14171 gene locus_tag LOCUS_10360 15211 14171 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812002.1 protein_id gnl|my_center|LOCUS_10360 16143 15226 gene locus_tag LOCUS_10370 16143 15226 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811999.1 protein_id gnl|my_center|LOCUS_10370 >Feature sequence045 836 630 gene locus_tag LOCUS_10380 836 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 2287 779 gene locus_tag LOCUS_10390 gene thrC 2287 779 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_10390 2721 3440 gene locus_tag LOCUS_10400 gene sfsA 2721 3440 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461735.1 protein_id gnl|my_center|LOCUS_10400 3528 3803 gene locus_tag LOCUS_10410 3528 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 4338 4090 gene locus_tag LOCUS_10420 4338 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 4802 4668 gene locus_tag LOCUS_10430 4802 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 7087 4976 gene locus_tag LOCUS_10440 7087 4976 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986616.1 protein_id gnl|my_center|LOCUS_10440 8693 7191 gene locus_tag LOCUS_10450 8693 7191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 8954 9949 gene locus_tag LOCUS_10460 8954 9949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 9956 10822 gene locus_tag LOCUS_10470 9956 10822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 11894 10956 gene locus_tag LOCUS_10480 11894 10956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 13317 12889 gene locus_tag LOCUS_10490 13317 12889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 13693 13412 gene locus_tag LOCUS_10500 gene spoIIID 13693 13412 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420727.1 protein_id gnl|my_center|LOCUS_10500 15569 13770 gene locus_tag LOCUS_10510 15569 13770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 >Feature sequence046 903 250 gene locus_tag LOCUS_10520 903 250 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398827.1 protein_id gnl|my_center|LOCUS_10520 2160 916 gene locus_tag LOCUS_10530 2160 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 2778 2419 gene locus_tag LOCUS_10540 gene rnpA 2778 2419 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966998.1 protein_id gnl|my_center|LOCUS_10540 2987 2853 gene locus_tag LOCUS_10550 2987 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 3644 3093 gene locus_tag LOCUS_10560 3644 3093 CDS product DUF3841 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680352.1 protein_id gnl|my_center|LOCUS_10560 4225 3674 gene locus_tag LOCUS_10570 4225 3674 CDS product DUF3841 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680352.1 protein_id gnl|my_center|LOCUS_10570 5116 6486 gene locus_tag LOCUS_10580 gene dnaA 5116 6486 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_10580 6872 7990 gene locus_tag LOCUS_10590 gene dnaN 6872 7990 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947896.1 protein_id gnl|my_center|LOCUS_10590 8206 8415 gene locus_tag LOCUS_10600 8206 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 8478 9563 gene locus_tag LOCUS_10610 gene recF 8478 9563 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963333.1 protein_id gnl|my_center|LOCUS_10610 9577 11487 gene locus_tag LOCUS_10620 gene gyrB 9577 11487 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963335.1 protein_id gnl|my_center|LOCUS_10620 11580 14147 gene locus_tag LOCUS_10630 gene gyrA 11580 14147 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_10630 14317 15159 gene locus_tag LOCUS_10640 14317 15159 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519031.1 protein_id gnl|my_center|LOCUS_10640 15217 15783 gene locus_tag LOCUS_10650 15217 15783 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099538.1 protein_id gnl|my_center|LOCUS_10650 16062 16150 gene locus_tag LOCUS_t00180 16062 16150 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence047 300 1232 gene locus_tag LOCUS_10660 300 1232 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476368.1 protein_id gnl|my_center|LOCUS_10660 1478 3079 gene locus_tag LOCUS_10670 1478 3079 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048268.1 protein_id gnl|my_center|LOCUS_10670 3202 3648 gene locus_tag LOCUS_10680 3202 3648 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081070.1 protein_id gnl|my_center|LOCUS_10680 3743 5146 gene locus_tag LOCUS_10690 gene pepV 3743 5146 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048281.1 protein_id gnl|my_center|LOCUS_10690 5458 6486 gene locus_tag LOCUS_10700 5458 6486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 6551 6799 gene locus_tag LOCUS_10710 6551 6799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 6868 7323 gene locus_tag LOCUS_10720 gene nrdR 6868 7323 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_10720 7330 7884 gene locus_tag LOCUS_10730 7330 7884 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583237.1 protein_id gnl|my_center|LOCUS_10730 7961 9469 gene locus_tag LOCUS_10740 7961 9469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 9637 10194 gene locus_tag LOCUS_10750 gene efp 9637 10194 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_10750 10544 11290 gene locus_tag LOCUS_10760 10544 11290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 11500 13269 gene locus_tag LOCUS_10770 gene argS 11500 13269 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020254.1 protein_id gnl|my_center|LOCUS_10770 >Feature sequence048 <1 570 gene locus_tag LOCUS_10780 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009994495.1:Sir2 family NAD-dependent protein deacetylase 1144 716 gene locus_tag LOCUS_10790 1144 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1353 1144 gene locus_tag LOCUS_10800 1353 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 1532 2164 gene locus_tag LOCUS_10810 1532 2164 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439354.1 protein_id gnl|my_center|LOCUS_10810 2164 2310 gene locus_tag LOCUS_10820 2164 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 2411 3367 gene locus_tag LOCUS_10830 2411 3367 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861239.1 protein_id gnl|my_center|LOCUS_10830 4355 3582 gene locus_tag LOCUS_10840 4355 3582 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948811.1 protein_id gnl|my_center|LOCUS_10840 5246 4356 gene locus_tag LOCUS_10850 5246 4356 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948810.1 protein_id gnl|my_center|LOCUS_10850 6372 5266 gene locus_tag LOCUS_10860 6372 5266 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811776.1 protein_id gnl|my_center|LOCUS_10860 7501 6758 gene locus_tag LOCUS_10870 7501 6758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 8877 7594 gene locus_tag LOCUS_10880 gene aroA 8877 7594 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943243.1 protein_id gnl|my_center|LOCUS_10880 10010 8913 gene locus_tag LOCUS_10890 gene tyrA 10010 8913 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228138.1 protein_id gnl|my_center|LOCUS_10890 10443 12539 gene locus_tag LOCUS_10900 gene fusA 10443 12539 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 protein_id gnl|my_center|LOCUS_10900 12697 14064 gene locus_tag LOCUS_10910 gene rpoN 12697 14064 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170876203.1 protein_id gnl|my_center|LOCUS_10910 14206 15060 gene locus_tag LOCUS_10920 14206 15060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 15075 15260 gene locus_tag LOCUS_10930 15075 15260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 15193 16140 gene locus_tag LOCUS_10940 15193 16140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 >Feature sequence049 1263 379 gene locus_tag LOCUS_10950 1263 379 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_10950 2697 1498 gene locus_tag LOCUS_10960 2697 1498 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815196.1 protein_id gnl|my_center|LOCUS_10960 3989 2982 gene locus_tag LOCUS_10970 3989 2982 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016741.1 protein_id gnl|my_center|LOCUS_10970 4694 4038 gene locus_tag LOCUS_10980 gene plsY 4694 4038 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_10980 6035 4701 gene locus_tag LOCUS_10990 gene der 6035 4701 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426959.1 protein_id gnl|my_center|LOCUS_10990 7559 6162 gene locus_tag LOCUS_11000 7559 6162 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903281.1 protein_id gnl|my_center|LOCUS_11000 7854 9041 gene locus_tag LOCUS_11010 7854 9041 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_11010 10110 9163 gene locus_tag LOCUS_11020 10110 9163 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964728.1 protein_id gnl|my_center|LOCUS_11020 12208 10154 gene locus_tag LOCUS_11030 gene recG 12208 10154 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_11030 14097 12367 gene locus_tag LOCUS_11040 14097 12367 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454872.1 protein_id gnl|my_center|LOCUS_11040 14474 14118 gene locus_tag LOCUS_11050 14474 14118 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813375.1 protein_id gnl|my_center|LOCUS_11050 14669 14854 gene locus_tag LOCUS_11060 gene rpmB 14669 14854 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775872.1 protein_id gnl|my_center|LOCUS_11060 15181 15044 gene locus_tag LOCUS_11070 15181 15044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 <16145 15389 gene locus_tag LOCUS_11080 <16145 15389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047962.1:sodium:alanine symporter family protein >Feature sequence050 1405 836 gene locus_tag LOCUS_11090 1405 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 2277 1402 gene locus_tag LOCUS_11100 2277 1402 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_11100 4349 2346 gene locus_tag LOCUS_11110 4349 2346 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459965.1 protein_id gnl|my_center|LOCUS_11110 4762 4436 gene locus_tag LOCUS_11120 4762 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11120 5854 4775 gene locus_tag LOCUS_11130 5854 4775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 7470 5854 gene locus_tag LOCUS_11140 gene rsmF 7470 5854 CDS product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228642.1 protein_id gnl|my_center|LOCUS_11140 7610 7467 gene locus_tag LOCUS_11150 7610 7467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 8403 7600 gene locus_tag LOCUS_11160 8403 7600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 8456 9469 gene locus_tag LOCUS_11170 gene ylbJ 8456 9469 CDS product sporulation integral membrane protein YlbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965047.1 protein_id gnl|my_center|LOCUS_11170 10025 9444 gene locus_tag LOCUS_11180 10025 9444 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460509.1 protein_id gnl|my_center|LOCUS_11180 10541 10050 gene locus_tag LOCUS_11190 gene coaD 10541 10050 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728846.1 protein_id gnl|my_center|LOCUS_11190 11136 10564 gene locus_tag LOCUS_11200 gene rsmD 11136 10564 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_11200 11504 11710 gene locus_tag LOCUS_11210 11504 11710 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422115.1 protein_id gnl|my_center|LOCUS_11210 12890 12039 gene locus_tag LOCUS_11220 gene pgeF 12890 12039 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_11220 13331 12951 gene locus_tag LOCUS_11230 13331 12951 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110149.1 protein_id gnl|my_center|LOCUS_11230 14005 13334 gene locus_tag LOCUS_11240 14005 13334 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_11240 14880 14002 gene locus_tag LOCUS_11250 gene ylqF 14880 14002 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236704.1 protein_id gnl|my_center|LOCUS_11250 15387 15040 gene locus_tag LOCUS_11260 gene rplS 15387 15040 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419350.1 protein_id gnl|my_center|LOCUS_11260 >Feature sequence051 1455 865 gene locus_tag LOCUS_11270 1455 865 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_11270 2385 1588 gene locus_tag LOCUS_11280 gene thiD 2385 1588 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055440.1 protein_id gnl|my_center|LOCUS_11280 2785 2483 gene locus_tag LOCUS_11290 2785 2483 CDS product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461833.1 protein_id gnl|my_center|LOCUS_11290 3454 2813 gene locus_tag LOCUS_11300 3454 2813 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056362.1 protein_id gnl|my_center|LOCUS_11300 4106 3447 gene locus_tag LOCUS_11310 gene thiE 4106 3447 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_11310 4866 4087 gene locus_tag LOCUS_11320 gene thiM 4866 4087 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_11320 5637 5077 gene locus_tag LOCUS_11330 gene thiW 5637 5077 CDS product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047762.1 protein_id gnl|my_center|LOCUS_11330 8322 6241 gene locus_tag LOCUS_11340 8322 6241 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860870.1 protein_id gnl|my_center|LOCUS_11340 8632 8330 gene locus_tag LOCUS_11350 8632 8330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 9077 8844 gene locus_tag LOCUS_11360 9077 8844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 11598 9592 gene locus_tag LOCUS_11370 gene feoB 11598 9592 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399646.1 protein_id gnl|my_center|LOCUS_11370 11908 11696 gene locus_tag LOCUS_11380 11908 11696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 12099 12458 gene locus_tag LOCUS_11390 12099 12458 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949091.1 protein_id gnl|my_center|LOCUS_11390 13292 13468 gene locus_tag LOCUS_11400 13292 13468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 14337 13438 gene locus_tag LOCUS_11410 14337 13438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 15364 14339 gene locus_tag LOCUS_11420 15364 14339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 >Feature sequence052 4 223 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgtcgctcccctcgcgggagcg 366 1958 gene locus_tag LOCUS_11430 gene pckA 366 1958 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626187.1 protein_id gnl|my_center|LOCUS_11430 3241 2351 gene locus_tag LOCUS_11440 3241 2351 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102114.1 protein_id gnl|my_center|LOCUS_11440 4290 3388 gene locus_tag LOCUS_11450 4290 3388 CDS product DUF4392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249434.1 protein_id gnl|my_center|LOCUS_11450 4659 4994 gene locus_tag LOCUS_11460 4659 4994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 5159 7252 gene locus_tag LOCUS_11470 5159 7252 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459555.1 protein_id gnl|my_center|LOCUS_11470 8788 7382 gene locus_tag LOCUS_11480 8788 7382 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_11480 9030 10037 gene locus_tag LOCUS_11490 9030 10037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 10101 10520 gene locus_tag LOCUS_11500 10101 10520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 11007 10552 gene locus_tag LOCUS_11510 11007 10552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 11361 12251 gene locus_tag LOCUS_11520 11361 12251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 12295 13113 gene locus_tag LOCUS_11530 12295 13113 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931881.1 protein_id gnl|my_center|LOCUS_11530 13842 13189 gene locus_tag LOCUS_11540 13842 13189 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809652.1 protein_id gnl|my_center|LOCUS_11540 15218 13872 gene locus_tag LOCUS_11550 15218 13872 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_11550 >Feature sequence053 1842 607 gene locus_tag LOCUS_11560 1842 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 2722 1997 gene locus_tag LOCUS_11570 2722 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 4072 2747 gene locus_tag LOCUS_11580 gene murA 4072 2747 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393852.1 protein_id gnl|my_center|LOCUS_11580 5298 4147 gene locus_tag LOCUS_11590 gene spoVE 5298 4147 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426995.1 protein_id gnl|my_center|LOCUS_11590 6733 5387 gene locus_tag LOCUS_11600 gene murD 6733 5387 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_11600 7718 6747 gene locus_tag LOCUS_11610 gene mraY 7718 6747 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358738.1 protein_id gnl|my_center|LOCUS_11610 9582 7843 gene locus_tag LOCUS_11620 9582 7843 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_11620 12023 9819 gene locus_tag LOCUS_11630 12023 9819 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_11630 12546 12046 gene locus_tag LOCUS_11640 12546 12046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 13542 12589 gene locus_tag LOCUS_11650 gene rsmH 13542 12589 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949033.1 protein_id gnl|my_center|LOCUS_11650 13964 13539 gene locus_tag LOCUS_11660 gene mraZ 13964 13539 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625480.1 protein_id gnl|my_center|LOCUS_11660 >Feature sequence054 545 1393 gene locus_tag LOCUS_11670 545 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1519 3273 gene locus_tag LOCUS_11680 1519 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 3442 4221 gene locus_tag LOCUS_11690 gene srtB 3442 4221 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095595.1 protein_id gnl|my_center|LOCUS_11690 7079 6312 gene locus_tag LOCUS_11700 7079 6312 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682287.1 protein_id gnl|my_center|LOCUS_11700 7512 8450 gene locus_tag LOCUS_11710 7512 8450 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861865.1 protein_id gnl|my_center|LOCUS_11710 8580 9062 gene locus_tag LOCUS_11720 8580 9062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 9666 9496 gene locus_tag LOCUS_11730 9666 9496 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809805.1 protein_id gnl|my_center|LOCUS_11730 9907 10035 gene locus_tag LOCUS_11740 9907 10035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 11118 10267 gene locus_tag LOCUS_11750 11118 10267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 11308 12801 gene locus_tag LOCUS_11760 11308 12801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 12825 13454 gene locus_tag LOCUS_11770 12825 13454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 13529 13783 gene locus_tag LOCUS_11780 13529 13783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 >Feature sequence055 599 1975 gene locus_tag LOCUS_11790 gene mnmE 599 1975 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898860.1 protein_id gnl|my_center|LOCUS_11790 2947 3351 gene locus_tag LOCUS_11800 2947 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 3733 5658 gene locus_tag LOCUS_11810 gene mnmG 3733 5658 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966993.1 protein_id gnl|my_center|LOCUS_11810 5655 6383 gene locus_tag LOCUS_11820 gene rsmG 5655 6383 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131091.1 protein_id gnl|my_center|LOCUS_11820 7672 6722 gene locus_tag LOCUS_11830 7672 6722 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057729.1 protein_id gnl|my_center|LOCUS_11830 8008 8775 gene locus_tag LOCUS_11840 gene soj 8008 8775 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_11840 8778 9872 gene locus_tag LOCUS_11850 8778 9872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 9903 10403 gene locus_tag LOCUS_11860 9903 10403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 10475 11356 gene locus_tag LOCUS_11870 10475 11356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 11685 11761 gene locus_tag LOCUS_t00190 11685 11761 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13421 12027 gene locus_tag LOCUS_11880 13421 12027 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861441.1 protein_id gnl|my_center|LOCUS_11880 13650 13396 gene locus_tag LOCUS_11890 13650 13396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 >Feature sequence056 595 1212 gene locus_tag LOCUS_11900 595 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 1234 1656 gene locus_tag LOCUS_11910 1234 1656 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723834.1 protein_id gnl|my_center|LOCUS_11910 1665 2234 gene locus_tag LOCUS_11920 1665 2234 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975857.1 protein_id gnl|my_center|LOCUS_11920 3267 2203 gene locus_tag LOCUS_11930 3267 2203 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987044.1 protein_id gnl|my_center|LOCUS_11930 3400 3765 gene locus_tag LOCUS_11940 3400 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 4378 4133 gene locus_tag LOCUS_11950 4378 4133 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428433.1 protein_id gnl|my_center|LOCUS_11950 4783 5481 gene locus_tag LOCUS_11960 4783 5481 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965416.1 protein_id gnl|my_center|LOCUS_11960 5741 6820 gene locus_tag LOCUS_11970 5741 6820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 7062 8411 gene locus_tag LOCUS_11980 7062 8411 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103658.1 protein_id gnl|my_center|LOCUS_11980 9914 8595 gene locus_tag LOCUS_11990 9914 8595 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090934236.1 protein_id gnl|my_center|LOCUS_11990 10062 10328 gene locus_tag LOCUS_12000 10062 10328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 10450 11547 gene locus_tag LOCUS_12010 10450 11547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 11699 12298 gene locus_tag LOCUS_12020 11699 12298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 12437 13891 gene locus_tag LOCUS_12030 12437 13891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 >Feature sequence057 2357 1200 gene locus_tag LOCUS_12040 gene dnaJ 2357 1200 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048002.1 protein_id gnl|my_center|LOCUS_12040 4393 2531 gene locus_tag LOCUS_12050 gene dnaK 4393 2531 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_12050 5186 4521 gene locus_tag LOCUS_12060 5186 4521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 6359 5316 gene locus_tag LOCUS_12070 gene hrcA 6359 5316 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964592.1 protein_id gnl|my_center|LOCUS_12070 6591 7046 gene locus_tag LOCUS_12080 6591 7046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 7395 8114 gene locus_tag LOCUS_12090 7395 8114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 9392 8142 gene locus_tag LOCUS_12100 gene uraA 9392 8142 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667891.1 protein_id gnl|my_center|LOCUS_12100 10136 9615 gene locus_tag LOCUS_12110 10136 9615 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_12110 10531 11442 gene locus_tag LOCUS_12120 10531 11442 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421915.1 protein_id gnl|my_center|LOCUS_12120 11979 13391 gene locus_tag LOCUS_12130 gene mgtE 11979 13391 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062407.1 protein_id gnl|my_center|LOCUS_12130 >Feature sequence058 2065 410 gene locus_tag LOCUS_12140 2065 410 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_12140 2904 2107 gene locus_tag LOCUS_12150 2904 2107 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047988.1 protein_id gnl|my_center|LOCUS_12150 3637 2858 gene locus_tag LOCUS_12160 3637 2858 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889262.1 protein_id gnl|my_center|LOCUS_12160 4903 3785 gene locus_tag LOCUS_12170 gene rpoD 4903 3785 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_12170 6780 4984 gene locus_tag LOCUS_12180 gene dnaG 6780 4984 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896376.1 protein_id gnl|my_center|LOCUS_12180 7832 6825 gene locus_tag LOCUS_12190 7832 6825 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_12190 9789 8080 gene locus_tag LOCUS_12200 9789 8080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 11236 9902 gene locus_tag LOCUS_12210 11236 9902 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178657.1 protein_id gnl|my_center|LOCUS_12210 12260 11343 gene locus_tag LOCUS_12220 12260 11343 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435793.1 protein_id gnl|my_center|LOCUS_12220 12997 12260 gene locus_tag LOCUS_12230 12997 12260 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429190.1 protein_id gnl|my_center|LOCUS_12230 13325 13242 gene locus_tag LOCUS_t00200 13325 13242 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence059 184 1515 gene locus_tag LOCUS_12240 gene mtaB 184 1515 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_12240 1678 1941 gene locus_tag LOCUS_12250 1678 1941 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025772973.1 protein_id gnl|my_center|LOCUS_12250 1983 2138 gene locus_tag LOCUS_12260 1983 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 2420 2842 gene locus_tag LOCUS_12270 gene ruvX 2420 2842 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730148.1 protein_id gnl|my_center|LOCUS_12270 2982 3275 gene locus_tag LOCUS_12280 2982 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 3297 4964 gene locus_tag LOCUS_12290 3297 4964 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_12290 5070 5477 gene locus_tag LOCUS_12300 5070 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 5474 6181 gene locus_tag LOCUS_12310 5474 6181 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706832.1 protein_id gnl|my_center|LOCUS_12310 6182 7444 gene locus_tag LOCUS_12320 6182 7444 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_12320 7577 8404 gene locus_tag LOCUS_12330 7577 8404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 8518 11439 gene locus_tag LOCUS_12340 8518 11439 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966288.1 protein_id gnl|my_center|LOCUS_12340 11462 12367 gene locus_tag LOCUS_12350 gene era 11462 12367 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_12350 12432 13079 gene locus_tag LOCUS_12360 12432 13079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 >Feature sequence060 449 1477 gene locus_tag LOCUS_12370 449 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 1849 2157 gene locus_tag LOCUS_12380 gene rplU 1849 2157 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419082.1 protein_id gnl|my_center|LOCUS_12380 2164 2493 gene locus_tag LOCUS_12390 2164 2493 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816543.1 protein_id gnl|my_center|LOCUS_12390 2497 2787 gene locus_tag LOCUS_12400 gene rpmA 2497 2787 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357774.1 protein_id gnl|my_center|LOCUS_12400 2868 4160 gene locus_tag LOCUS_12410 gene obgE 2868 4160 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964572.1 protein_id gnl|my_center|LOCUS_12410 4289 4582 gene locus_tag LOCUS_12420 gene yhbY 4289 4582 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721997.1 protein_id gnl|my_center|LOCUS_12420 4636 5238 gene locus_tag LOCUS_12430 gene nadD 4636 5238 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360011.1 protein_id gnl|my_center|LOCUS_12430 5296 5880 gene locus_tag LOCUS_12440 gene yqeK 5296 5880 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964575.1 protein_id gnl|my_center|LOCUS_12440 5885 6238 gene locus_tag LOCUS_12450 gene rsfS 5885 6238 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416416.1 protein_id gnl|my_center|LOCUS_12450 6997 6380 gene locus_tag LOCUS_12460 gene lexA 6997 6380 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_12460 7232 7588 gene locus_tag LOCUS_12470 7232 7588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 8774 7722 gene locus_tag LOCUS_12480 8774 7722 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435347.1 protein_id gnl|my_center|LOCUS_12480 9525 8800 gene locus_tag LOCUS_12490 9525 8800 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947991.1 protein_id gnl|my_center|LOCUS_12490 12573 10516 gene locus_tag LOCUS_12500 12573 10516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 >Feature sequence061 27 371 gene locus_tag LOCUS_12510 27 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 603 959 gene locus_tag LOCUS_12520 603 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 3471 1330 gene locus_tag LOCUS_12530 3471 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 3840 5096 gene locus_tag LOCUS_12540 3840 5096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 6080 5334 gene locus_tag LOCUS_12550 6080 5334 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383586.1 protein_id gnl|my_center|LOCUS_12550 6372 7784 gene locus_tag LOCUS_12560 6372 7784 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298077.1 protein_id gnl|my_center|LOCUS_12560 7800 8948 gene locus_tag LOCUS_12570 7800 8948 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860647.1 protein_id gnl|my_center|LOCUS_12570 9053 10462 gene locus_tag LOCUS_12580 9053 10462 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440000.1 protein_id gnl|my_center|LOCUS_12580 11397 10504 gene locus_tag LOCUS_12590 11397 10504 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175095.1 protein_id gnl|my_center|LOCUS_12590 11656 12507 gene locus_tag LOCUS_12600 11656 12507 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966271.1 protein_id gnl|my_center|LOCUS_12600 12511 12744 gene locus_tag LOCUS_12610 12511 12744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 >Feature sequence062 114 26 gene locus_tag LOCUS_t00210 114 26 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 237 151 gene locus_tag LOCUS_t00220 237 151 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1270 497 gene locus_tag LOCUS_12620 gene ispD 1270 497 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966461.1 protein_id gnl|my_center|LOCUS_12620 2363 1326 gene locus_tag LOCUS_12630 gene tsaD 2363 1326 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_12630 3351 2437 gene locus_tag LOCUS_12640 3351 2437 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518928.1 protein_id gnl|my_center|LOCUS_12640 3808 3476 gene locus_tag LOCUS_12650 3808 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 4388 4146 gene locus_tag LOCUS_12660 4388 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 5183 4689 gene locus_tag LOCUS_12670 gene rimI 5183 4689 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925883.1 protein_id gnl|my_center|LOCUS_12670 6052 5183 gene locus_tag LOCUS_12680 gene tsaB 6052 5183 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048262.1 protein_id gnl|my_center|LOCUS_12680 6480 6049 gene locus_tag LOCUS_12690 gene tsaE 6480 6049 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048261.1 protein_id gnl|my_center|LOCUS_12690 6974 6483 gene locus_tag LOCUS_12700 6974 6483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 8588 7512 gene locus_tag LOCUS_12710 gene prfA 8588 7512 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_12710 9763 8747 gene locus_tag LOCUS_12720 gene prmC 9763 8747 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966169.1 protein_id gnl|my_center|LOCUS_12720 10815 9760 gene locus_tag LOCUS_12730 10815 9760 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947980.1 protein_id gnl|my_center|LOCUS_12730 11169 10954 gene locus_tag LOCUS_12740 gene rpmE 11169 10954 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_12740 12511 11552 gene locus_tag LOCUS_12750 12511 11552 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075126.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence063 172 381 gene locus_tag LOCUS_12760 172 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 1065 448 gene locus_tag LOCUS_12770 1065 448 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205505.1 protein_id gnl|my_center|LOCUS_12770 1492 2424 gene locus_tag LOCUS_12780 1492 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 2532 4769 gene locus_tag LOCUS_12790 2532 4769 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_12790 4759 7140 gene locus_tag LOCUS_12800 4759 7140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 7507 8877 gene locus_tag LOCUS_12810 7507 8877 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272524.1 protein_id gnl|my_center|LOCUS_12810 8864 9025 gene locus_tag LOCUS_12820 8864 9025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 9031 10428 gene locus_tag LOCUS_12830 9031 10428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 10726 11157 gene locus_tag LOCUS_12840 10726 11157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 11145 11594 gene locus_tag LOCUS_12850 gene spoIIAB 11145 11594 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_12850 11599 12336 gene locus_tag LOCUS_12860 gene sigF 11599 12336 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393005.1 protein_id gnl|my_center|LOCUS_12860 >Feature sequence064 1180 170 gene locus_tag LOCUS_12870 1180 170 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_12870 2118 1426 gene locus_tag LOCUS_12880 2118 1426 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_12880 3372 2404 gene locus_tag LOCUS_12890 3372 2404 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814023.1 protein_id gnl|my_center|LOCUS_12890 4792 3407 gene locus_tag LOCUS_12900 4792 3407 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861729.1 protein_id gnl|my_center|LOCUS_12900 4974 4789 gene locus_tag LOCUS_12910 4974 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 6492 5086 gene locus_tag LOCUS_12920 gene gltA 6492 5086 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986285.1 protein_id gnl|my_center|LOCUS_12920 7382 6492 gene locus_tag LOCUS_12930 7382 6492 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896496.1 protein_id gnl|my_center|LOCUS_12930 7895 9016 gene locus_tag LOCUS_12940 7895 9016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 9690 9013 gene locus_tag LOCUS_12950 9690 9013 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902979.1 protein_id gnl|my_center|LOCUS_12950 11425 9800 gene locus_tag LOCUS_12960 11425 9800 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016558.1 protein_id gnl|my_center|LOCUS_12960 12269 11526 gene locus_tag LOCUS_12970 12269 11526 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434659.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence065 1497 616 gene locus_tag LOCUS_12980 1497 616 CDS product RsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813616.1 protein_id gnl|my_center|LOCUS_12980 1985 1497 gene locus_tag LOCUS_12990 gene sigV 1985 1497 CDS product RNA polymerase sigma factor SigV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398891.1 protein_id gnl|my_center|LOCUS_12990 5478 2263 gene locus_tag LOCUS_13000 gene carB 5478 2263 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_13000 5762 6205 gene locus_tag LOCUS_13010 5762 6205 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810723.1 protein_id gnl|my_center|LOCUS_13010 6384 6911 gene locus_tag LOCUS_13020 6384 6911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 7958 7017 gene locus_tag LOCUS_13030 7958 7017 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931936.1 protein_id gnl|my_center|LOCUS_13030 8887 7961 gene locus_tag LOCUS_13040 gene truB 8887 7961 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282298.1 protein_id gnl|my_center|LOCUS_13040 9858 8887 gene locus_tag LOCUS_13050 9858 8887 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_13050 10409 9978 gene locus_tag LOCUS_13060 gene rbfA 10409 9978 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_13060 <12546 10420 gene locus_tag LOCUS_13070 <12546 10420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460393.1:translation initiation factor IF-2 >Feature sequence066 997 1794 gene locus_tag LOCUS_13080 997 1794 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_13080 1920 3311 gene locus_tag LOCUS_13090 gene gcvPA 1920 3311 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979226.1 protein_id gnl|my_center|LOCUS_13090 3335 4900 gene locus_tag LOCUS_13100 gene gcvPB 3335 4900 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868896.1 protein_id gnl|my_center|LOCUS_13100 5253 6383 gene locus_tag LOCUS_13110 5253 6383 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705766.1 protein_id gnl|my_center|LOCUS_13110 7415 6594 gene locus_tag LOCUS_13120 7415 6594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 7819 8682 gene locus_tag LOCUS_13130 7819 8682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 8793 9485 gene locus_tag LOCUS_13140 8793 9485 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 protein_id gnl|my_center|LOCUS_13140 9475 10224 gene locus_tag LOCUS_13150 9475 10224 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016658.1 protein_id gnl|my_center|LOCUS_13150 11578 10484 gene locus_tag LOCUS_13160 11578 10484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 <12437 11578 gene locus_tag LOCUS_13170 <12437 11578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764673.1:tyrosine-type recombinase/integrase >Feature sequence067 733 140 gene locus_tag LOCUS_13180 733 140 CDS product Abortive infection protein AbiEi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072726816.1 protein_id gnl|my_center|LOCUS_13180 1624 983 gene locus_tag LOCUS_13190 gene mocA 1624 983 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459387.1 protein_id gnl|my_center|LOCUS_13190 3922 1628 gene locus_tag LOCUS_13200 3922 1628 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897245.1 protein_id gnl|my_center|LOCUS_13200 4395 3919 gene locus_tag LOCUS_13210 4395 3919 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902988.1 protein_id gnl|my_center|LOCUS_13210 5207 4386 gene locus_tag LOCUS_13220 5207 4386 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861448.1 protein_id gnl|my_center|LOCUS_13220 5599 5438 gene locus_tag LOCUS_13230 5599 5438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 5711 6277 gene locus_tag LOCUS_13240 5711 6277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 6308 6604 gene locus_tag LOCUS_13250 6308 6604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 7157 6777 gene locus_tag LOCUS_13260 7157 6777 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_13260 7613 8374 gene locus_tag LOCUS_13270 7613 8374 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297003.1 protein_id gnl|my_center|LOCUS_13270 8475 9569 gene locus_tag LOCUS_13280 8475 9569 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861411.1 protein_id gnl|my_center|LOCUS_13280 9656 10408 gene locus_tag LOCUS_13290 9656 10408 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297010.1 protein_id gnl|my_center|LOCUS_13290 10395 11249 gene locus_tag LOCUS_13300 10395 11249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 <12134 11246 gene locus_tag LOCUS_13310 <12134 11246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964346.1:triacylglycerol lipase >Feature sequence068 418 744 gene locus_tag LOCUS_13320 418 744 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807804.1 protein_id gnl|my_center|LOCUS_13320 948 1412 gene locus_tag LOCUS_13330 948 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 1409 2596 gene locus_tag LOCUS_13340 1409 2596 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765133.1 protein_id gnl|my_center|LOCUS_13340 2593 5778 gene locus_tag LOCUS_13350 2593 5778 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399936.1 protein_id gnl|my_center|LOCUS_13350 6135 7460 gene locus_tag LOCUS_13360 gene rsxC 6135 7460 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_13360 7474 8409 gene locus_tag LOCUS_13370 7474 8409 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_13370 8409 9023 gene locus_tag LOCUS_13380 8409 9023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 9039 9893 gene locus_tag LOCUS_13390 9039 9893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 9907 10515 gene locus_tag LOCUS_13400 gene rsxA 9907 10515 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_13400 10531 11322 gene locus_tag LOCUS_13410 10531 11322 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_13410 >Feature sequence069 645 151 gene locus_tag LOCUS_13420 645 151 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435609.1 protein_id gnl|my_center|LOCUS_13420 1250 642 gene locus_tag LOCUS_13430 1250 642 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816920.1 protein_id gnl|my_center|LOCUS_13430 3136 1361 gene locus_tag LOCUS_13440 3136 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 4298 3126 gene locus_tag LOCUS_13450 4298 3126 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423769.1 protein_id gnl|my_center|LOCUS_13450 4733 4383 gene locus_tag LOCUS_13460 4733 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 5275 5066 gene locus_tag LOCUS_13470 5275 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 6308 5601 gene locus_tag LOCUS_13480 6308 5601 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861674.1 protein_id gnl|my_center|LOCUS_13480 7403 6537 gene locus_tag LOCUS_13490 7403 6537 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229020.1 protein_id gnl|my_center|LOCUS_13490 8358 7405 gene locus_tag LOCUS_13500 8358 7405 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173997.1 protein_id gnl|my_center|LOCUS_13500 9847 8513 gene locus_tag LOCUS_13510 9847 8513 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136207383.1 protein_id gnl|my_center|LOCUS_13510 11269 10121 gene locus_tag LOCUS_13520 11269 10121 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681416.1 protein_id gnl|my_center|LOCUS_13520 >Feature sequence070 876 541 gene locus_tag LOCUS_13530 876 541 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583235.1 protein_id gnl|my_center|LOCUS_13530 1866 1105 gene locus_tag LOCUS_13540 1866 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 2517 1936 gene locus_tag LOCUS_13550 gene cobO 2517 1936 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812021.1 protein_id gnl|my_center|LOCUS_13550 4452 2596 gene locus_tag LOCUS_13560 4452 2596 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860946.1 protein_id gnl|my_center|LOCUS_13560 6033 4582 gene locus_tag LOCUS_13570 gene gltX 6033 4582 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_13570 7573 6221 gene locus_tag LOCUS_13580 gene mgtE 7573 6221 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_13580 8953 7904 gene locus_tag LOCUS_13590 8953 7904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 10130 8946 gene locus_tag LOCUS_13600 10130 8946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 >Feature sequence071 <1 933 gene locus_tag LOCUS_13610 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965688.1:ABC transporter ATP-binding protein 1018 1512 gene locus_tag LOCUS_13620 1018 1512 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860931.1 protein_id gnl|my_center|LOCUS_13620 1836 1546 gene locus_tag LOCUS_13630 1836 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 2262 2501 gene locus_tag LOCUS_13640 2262 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 2584 3912 gene locus_tag LOCUS_13650 2584 3912 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681171.1 protein_id gnl|my_center|LOCUS_13650 4111 5097 gene locus_tag LOCUS_13660 4111 5097 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_13660 5321 5800 gene locus_tag LOCUS_13670 5321 5800 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_13670 6064 7128 gene locus_tag LOCUS_13680 6064 7128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 7216 7488 gene locus_tag LOCUS_13690 7216 7488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 8046 8216 gene locus_tag LOCUS_13700 8046 8216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 8308 10959 gene locus_tag LOCUS_13710 8308 10959 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_13710 >Feature sequence072 2090 783 gene locus_tag LOCUS_13720 2090 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 2601 3626 gene locus_tag LOCUS_13730 2601 3626 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948644.1 protein_id gnl|my_center|LOCUS_13730 3648 4145 gene locus_tag LOCUS_13740 gene moaC 3648 4145 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 protein_id gnl|my_center|LOCUS_13740 4138 5136 gene locus_tag LOCUS_13750 gene moaA 4138 5136 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461492.1 protein_id gnl|my_center|LOCUS_13750 5157 6209 gene locus_tag LOCUS_13760 5157 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 6214 7188 gene locus_tag LOCUS_13770 gene modA 6214 7188 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243706.1 protein_id gnl|my_center|LOCUS_13770 7199 7873 gene locus_tag LOCUS_13780 gene modB 7199 7873 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937491.1 protein_id gnl|my_center|LOCUS_13780 7870 9006 gene locus_tag LOCUS_13790 7870 9006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 9091 9957 gene locus_tag LOCUS_13800 9091 9957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13800 11085 10081 gene locus_tag LOCUS_13810 11085 10081 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234240.1 protein_id gnl|my_center|LOCUS_13810 >Feature sequence073 57 593 gene locus_tag LOCUS_13820 57 593 CDS product DUF4364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357273.1 protein_id gnl|my_center|LOCUS_13820 647 961 gene locus_tag LOCUS_13830 647 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 1757 1140 gene locus_tag LOCUS_13840 gene yihA 1757 1140 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891775.1 protein_id gnl|my_center|LOCUS_13840 4258 1787 gene locus_tag LOCUS_13850 gene lon 4258 1787 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097310.1 protein_id gnl|my_center|LOCUS_13850 5717 4482 gene locus_tag LOCUS_13860 gene clpX 5717 4482 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_13860 6397 5816 gene locus_tag LOCUS_13870 gene clpP 6397 5816 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965928.1 protein_id gnl|my_center|LOCUS_13870 8027 6741 gene locus_tag LOCUS_13880 gene tig 8027 6741 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965929.1 protein_id gnl|my_center|LOCUS_13880 8811 8245 gene locus_tag LOCUS_13890 8811 8245 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_13890 9745 8960 gene locus_tag LOCUS_13900 9745 8960 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949104.1 protein_id gnl|my_center|LOCUS_13900 10225 10698 gene locus_tag LOCUS_13910 10225 10698 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962372.1 protein_id gnl|my_center|LOCUS_13910 11347 11021 gene locus_tag LOCUS_13920 11347 11021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 >Feature sequence074 1507 794 gene locus_tag LOCUS_13930 1507 794 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103743.1 protein_id gnl|my_center|LOCUS_13930 3184 1688 gene locus_tag LOCUS_13940 gene glpK 3184 1688 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987067.1 protein_id gnl|my_center|LOCUS_13940 3879 3280 gene locus_tag LOCUS_13950 3879 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 4460 3894 gene locus_tag LOCUS_13960 4460 3894 CDS product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130278.1 protein_id gnl|my_center|LOCUS_13960 5407 4745 gene locus_tag LOCUS_13970 5407 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 5768 5968 gene locus_tag LOCUS_13980 5768 5968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 6949 6068 gene locus_tag LOCUS_13990 6949 6068 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272216.1 protein_id gnl|my_center|LOCUS_13990 8802 7135 gene locus_tag LOCUS_14000 8802 7135 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888533.1 protein_id gnl|my_center|LOCUS_14000 9559 8921 gene locus_tag LOCUS_14010 9559 8921 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108450.1 protein_id gnl|my_center|LOCUS_14010 10473 9562 gene locus_tag LOCUS_14020 gene ftcD 10473 9562 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765436.1 protein_id gnl|my_center|LOCUS_14020 10800 11267 gene locus_tag LOCUS_14030 10800 11267 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421494.1 protein_id gnl|my_center|LOCUS_14030 >Feature sequence075 182 622 gene locus_tag LOCUS_14040 gene rpiB 182 622 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721856.1 protein_id gnl|my_center|LOCUS_14040 1341 1892 gene locus_tag LOCUS_14050 1341 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 1902 2174 gene locus_tag LOCUS_14060 1902 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 3613 2294 gene locus_tag LOCUS_14070 3613 2294 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_14070 4399 3776 gene locus_tag LOCUS_14080 gene lepB 4399 3776 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460080.1 protein_id gnl|my_center|LOCUS_14080 4813 7572 gene locus_tag LOCUS_14090 gene glgB 4813 7572 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_14090 7642 8625 gene locus_tag LOCUS_14100 7642 8625 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902661.1 protein_id gnl|my_center|LOCUS_14100 8709 9290 gene locus_tag LOCUS_14110 8709 9290 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014279.1 protein_id gnl|my_center|LOCUS_14110 9566 10261 gene locus_tag LOCUS_14120 gene cysE 9566 10261 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459083.1 protein_id gnl|my_center|LOCUS_14120 10410 11339 gene locus_tag LOCUS_14130 10410 11339 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362794.1 protein_id gnl|my_center|LOCUS_14130 >Feature sequence076 688 71 gene locus_tag LOCUS_14140 gene sigK 688 71 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047887.1 protein_id gnl|my_center|LOCUS_14140 2712 853 gene locus_tag LOCUS_14150 2712 853 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_14150 4441 2696 gene locus_tag LOCUS_14160 4441 2696 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_14160 4881 4453 gene locus_tag LOCUS_14170 4881 4453 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948763.1 protein_id gnl|my_center|LOCUS_14170 6603 5251 gene locus_tag LOCUS_14180 6603 5251 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459130.1 protein_id gnl|my_center|LOCUS_14180 8404 6590 gene locus_tag LOCUS_14190 8404 6590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 9338 8328 gene locus_tag LOCUS_14200 9338 8328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 9563 10486 gene locus_tag LOCUS_14210 gene pyrB 9563 10486 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_14210 10480 10908 gene locus_tag LOCUS_14220 10480 10908 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 protein_id gnl|my_center|LOCUS_14220 >Feature sequence077 367 1554 gene locus_tag LOCUS_14230 367 1554 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_14230 1627 2553 gene locus_tag LOCUS_14240 1627 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 2635 3429 gene locus_tag LOCUS_14250 2635 3429 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339313.1 protein_id gnl|my_center|LOCUS_14250 4259 3483 gene locus_tag LOCUS_14260 gene aroD 4259 3483 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897376.1 protein_id gnl|my_center|LOCUS_14260 5662 4316 gene locus_tag LOCUS_14270 5662 4316 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048416.1 protein_id gnl|my_center|LOCUS_14270 5831 6013 gene locus_tag LOCUS_14280 5831 6013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 6032 6238 gene locus_tag LOCUS_14290 6032 6238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 6428 9112 gene locus_tag LOCUS_14300 6428 9112 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032453.1 protein_id gnl|my_center|LOCUS_14300 11044 9389 gene locus_tag LOCUS_14310 11044 9389 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503960.1 protein_id gnl|my_center|LOCUS_14310 >Feature sequence078 484 834 gene locus_tag LOCUS_14320 484 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 1048 1917 gene locus_tag LOCUS_14330 1048 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 2237 3064 gene locus_tag LOCUS_14340 gene licT 2237 3064 CDS product transcriptional antiterminator LicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242598.1 protein_id gnl|my_center|LOCUS_14340 3093 3578 gene locus_tag LOCUS_14350 3093 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 3616 3870 gene locus_tag LOCUS_14360 3616 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 3947 5416 gene locus_tag LOCUS_14370 gene nagE 3947 5416 CDS product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705424.1 protein_id gnl|my_center|LOCUS_14370 5712 6482 gene locus_tag LOCUS_14380 5712 6482 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578368.1 protein_id gnl|my_center|LOCUS_14380 6532 7356 gene locus_tag LOCUS_14390 6532 7356 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461790.1 protein_id gnl|my_center|LOCUS_14390 7486 8496 gene locus_tag LOCUS_14400 gene plsX 7486 8496 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965053.1 protein_id gnl|my_center|LOCUS_14400 8558 8788 gene locus_tag LOCUS_14410 gene acpP 8558 8788 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280528.1 protein_id gnl|my_center|LOCUS_14410 8872 9576 gene locus_tag LOCUS_14420 gene rnc 8872 9576 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_14420 >Feature sequence079 792 268 gene locus_tag LOCUS_14430 792 268 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895862.1 protein_id gnl|my_center|LOCUS_14430 1093 1022 gene locus_tag LOCUS_t00230 1093 1022 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4006 1349 gene locus_tag LOCUS_14440 4006 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 6876 4252 gene locus_tag LOCUS_14450 6876 4252 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_14450 8618 7236 gene locus_tag LOCUS_14460 8618 7236 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_14460 8983 9441 gene locus_tag LOCUS_14470 gene lrpA 8983 9441 CDS product HTH-type transcriptional regulator LrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867694.1 protein_id gnl|my_center|LOCUS_14470 9671 10030 gene locus_tag LOCUS_14480 9671 10030 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006307660.1 protein_id gnl|my_center|LOCUS_14480 10036 10323 gene locus_tag LOCUS_14490 10036 10323 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815811.1 protein_id gnl|my_center|LOCUS_14490 >Feature sequence080 <1 502 gene locus_tag LOCUS_14500 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_073167773.1:tyrosine-type recombinase/integrase 702 612 gene locus_tag LOCUS_t00240 702 612 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2342 807 gene locus_tag LOCUS_14510 2342 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 3418 2339 gene locus_tag LOCUS_14520 gene mnmA 3418 2339 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_14520 3861 3424 gene locus_tag LOCUS_14530 gene nifU 3861 3424 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438275.1 protein_id gnl|my_center|LOCUS_14530 5229 4048 gene locus_tag LOCUS_14540 gene nifS 5229 4048 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_14540 5381 6943 gene locus_tag LOCUS_14550 5381 6943 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888874.1 protein_id gnl|my_center|LOCUS_14550 7556 7116 gene locus_tag LOCUS_14560 7556 7116 CDS product DUF1284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061260.1 protein_id gnl|my_center|LOCUS_14560 8211 7636 gene locus_tag LOCUS_14570 8211 7636 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080866.1 protein_id gnl|my_center|LOCUS_14570 8768 8923 gene locus_tag LOCUS_14580 8768 8923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 9532 9176 gene locus_tag LOCUS_14590 9532 9176 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399582.1 protein_id gnl|my_center|LOCUS_14590 10858 9536 gene locus_tag LOCUS_14600 10858 9536 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948740.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence081 118 1626 gene locus_tag LOCUS_14610 118 1626 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680067.1 protein_id gnl|my_center|LOCUS_14610 1636 3300 gene locus_tag LOCUS_14620 1636 3300 CDS product galactoside ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680065.1 protein_id gnl|my_center|LOCUS_14620 3680 3955 gene locus_tag LOCUS_14630 3680 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 4058 4783 gene locus_tag LOCUS_14640 4058 4783 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943112.1 protein_id gnl|my_center|LOCUS_14640 4817 5140 gene locus_tag LOCUS_14650 4817 5140 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861511.1 protein_id gnl|my_center|LOCUS_14650 5248 6114 gene locus_tag LOCUS_14660 5248 6114 CDS product bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809876.1 protein_id gnl|my_center|LOCUS_14660 6290 7063 gene locus_tag LOCUS_14670 6290 7063 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404569.1 protein_id gnl|my_center|LOCUS_14670 7150 7584 gene locus_tag LOCUS_14680 7150 7584 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966812.1 protein_id gnl|my_center|LOCUS_14680 7698 8492 gene locus_tag LOCUS_14690 7698 8492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 8515 9213 gene locus_tag LOCUS_14700 gene walR 8515 9213 CDS product cell wall metabolism DNA-binding response regulator WalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244363.1 protein_id gnl|my_center|LOCUS_14700 9448 9936 gene locus_tag LOCUS_14710 9448 9936 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890795.1 protein_id gnl|my_center|LOCUS_14710 >Feature sequence082 161 871 gene locus_tag LOCUS_14720 161 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 996 1310 gene locus_tag LOCUS_14730 996 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 1401 2168 gene locus_tag LOCUS_14740 1401 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 3049 2255 gene locus_tag LOCUS_14750 3049 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 3107 4051 gene locus_tag LOCUS_14760 3107 4051 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814288.1 protein_id gnl|my_center|LOCUS_14760 4330 4187 gene locus_tag LOCUS_14770 4330 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 4629 5270 gene locus_tag LOCUS_14780 4629 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 5290 6615 gene locus_tag LOCUS_14790 5290 6615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 6690 7052 gene locus_tag LOCUS_14800 6690 7052 CDS product YlxM family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460448.1 protein_id gnl|my_center|LOCUS_14800 7084 8442 gene locus_tag LOCUS_14810 gene ffh 7084 8442 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362591.1 protein_id gnl|my_center|LOCUS_14810 8500 8739 gene locus_tag LOCUS_14820 gene rpsP 8500 8739 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_14820 8825 9052 gene locus_tag LOCUS_14830 8825 9052 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362589.1 protein_id gnl|my_center|LOCUS_14830 9133 9645 gene locus_tag LOCUS_14840 gene rimM 9133 9645 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_14840 >Feature sequence083 1432 107 gene locus_tag LOCUS_14850 1432 107 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028844369.1 protein_id gnl|my_center|LOCUS_14850 2144 1413 gene locus_tag LOCUS_14860 2144 1413 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460898.1 protein_id gnl|my_center|LOCUS_14860 3993 2128 gene locus_tag LOCUS_14870 3993 2128 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_14870 5313 4234 gene locus_tag LOCUS_14880 5313 4234 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107230.1 protein_id gnl|my_center|LOCUS_14880 6598 5288 gene locus_tag LOCUS_14890 6598 5288 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861675.1 protein_id gnl|my_center|LOCUS_14890 7743 6595 gene locus_tag LOCUS_14900 7743 6595 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925972.1 protein_id gnl|my_center|LOCUS_14900 8888 7773 gene locus_tag LOCUS_14910 8888 7773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 10314 8893 gene locus_tag LOCUS_14920 10314 8893 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449553.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence084 1885 698 gene locus_tag LOCUS_14930 1885 698 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957226.1 protein_id gnl|my_center|LOCUS_14930 6557 1941 gene locus_tag LOCUS_14940 gene polC 6557 1941 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966712.1 protein_id gnl|my_center|LOCUS_14940 7639 6554 gene locus_tag LOCUS_14950 gene ispG 7639 6554 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194540.1 protein_id gnl|my_center|LOCUS_14950 8971 7775 gene locus_tag LOCUS_14960 gene rseP 8971 7775 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922682.1 protein_id gnl|my_center|LOCUS_14960 10161 9016 gene locus_tag LOCUS_14970 10161 9016 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_14970 10840 10346 gene locus_tag LOCUS_14980 10840 10346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 >Feature sequence085 2523 271 gene locus_tag LOCUS_14990 2523 271 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246684.1 protein_id gnl|my_center|LOCUS_14990 3164 2589 gene locus_tag LOCUS_15000 3164 2589 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_15000 3962 3201 gene locus_tag LOCUS_15010 3962 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 5918 4266 gene locus_tag LOCUS_15020 5918 4266 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047904.1 protein_id gnl|my_center|LOCUS_15020 7076 6132 gene locus_tag LOCUS_15030 7076 6132 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_15030 9374 7395 gene locus_tag LOCUS_15040 gene tkt 9374 7395 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964657.1 protein_id gnl|my_center|LOCUS_15040 >Feature sequence086 622 888 gene locus_tag LOCUS_15050 622 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 839 1702 gene locus_tag LOCUS_15060 gene metF 839 1702 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_15060 1776 2690 gene locus_tag LOCUS_15070 1776 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 2733 5240 gene locus_tag LOCUS_15080 2733 5240 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903830.1 protein_id gnl|my_center|LOCUS_15080 5349 5615 gene locus_tag LOCUS_15090 5349 5615 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621026.1 protein_id gnl|my_center|LOCUS_15090 5834 6292 gene locus_tag LOCUS_15100 5834 6292 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264782.1 protein_id gnl|my_center|LOCUS_15100 6643 7221 gene locus_tag LOCUS_15110 6643 7221 CDS product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567081.1 protein_id gnl|my_center|LOCUS_15110 7590 8417 gene locus_tag LOCUS_15120 7590 8417 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680483.1 protein_id gnl|my_center|LOCUS_15120 9451 8600 gene locus_tag LOCUS_15130 9451 8600 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964110.1 protein_id gnl|my_center|LOCUS_15130 9758 10501 gene locus_tag LOCUS_15140 9758 10501 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966612.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence087 157 1989 gene locus_tag LOCUS_15150 157 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 2311 3321 gene locus_tag LOCUS_15160 2311 3321 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294378.1 protein_id gnl|my_center|LOCUS_15160 4214 3402 gene locus_tag LOCUS_15170 4214 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 5431 4211 gene locus_tag LOCUS_15180 5431 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 9202 5456 gene locus_tag LOCUS_15190 9202 5456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 >Feature sequence088 <1 1594 gene locus_tag LOCUS_15200 <1 1594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861809.1:PTS sugar transporter subunit IIA 1691 2311 gene locus_tag LOCUS_15210 1691 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 2424 2747 gene locus_tag LOCUS_15220 2424 2747 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722139.1 protein_id gnl|my_center|LOCUS_15220 2846 3166 gene locus_tag LOCUS_15230 2846 3166 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425440.1 protein_id gnl|my_center|LOCUS_15230 3188 4558 gene locus_tag LOCUS_15240 gene celB 3188 4558 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901597.1 protein_id gnl|my_center|LOCUS_15240 4586 5110 gene locus_tag LOCUS_15250 4586 5110 CDS product GrdB-related putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860643.1 protein_id gnl|my_center|LOCUS_15250 5218 6174 gene locus_tag LOCUS_15260 5218 6174 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895213.1 protein_id gnl|my_center|LOCUS_15260 6259 7362 gene locus_tag LOCUS_15270 6259 7362 CDS product Sapep family Mn(2+)-dependent dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860644.1 protein_id gnl|my_center|LOCUS_15270 7453 8190 gene locus_tag LOCUS_15280 7453 8190 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674428.1 protein_id gnl|my_center|LOCUS_15280 8187 9050 gene locus_tag LOCUS_15290 8187 9050 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357090.1 protein_id gnl|my_center|LOCUS_15290 9118 10209 gene locus_tag LOCUS_15300 9118 10209 CDS product DUF871 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253349.1 protein_id gnl|my_center|LOCUS_15300 >Feature sequence089 <1 702 gene locus_tag LOCUS_15310 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965142.1:DNA mismatch repair protein MutS 756 2960 gene locus_tag LOCUS_15320 756 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 3023 4039 gene locus_tag LOCUS_15330 gene miaA 3023 4039 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_15330 4063 5343 gene locus_tag LOCUS_15340 4063 5343 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_15340 5510 5764 gene locus_tag LOCUS_15350 5510 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 5827 6519 gene locus_tag LOCUS_15360 gene radC 5827 6519 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360029.1 protein_id gnl|my_center|LOCUS_15360 6523 7353 gene locus_tag LOCUS_15370 gene mreC 6523 7353 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392075.1 protein_id gnl|my_center|LOCUS_15370 7355 7888 gene locus_tag LOCUS_15380 7355 7888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 >Feature sequence090 284 1156 gene locus_tag LOCUS_15390 284 1156 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048407.1 protein_id gnl|my_center|LOCUS_15390 2160 1549 gene locus_tag LOCUS_15400 gene thrH 2160 1549 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_15400 2349 2513 gene locus_tag LOCUS_15410 2349 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 2516 3766 gene locus_tag LOCUS_15420 2516 3766 CDS product D-threonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783298.1 protein_id gnl|my_center|LOCUS_15420 4078 5298 gene locus_tag LOCUS_15430 4078 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence091 97 366 gene locus_tag LOCUS_15440 97 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 428 1120 gene locus_tag LOCUS_15450 428 1120 CDS product DUF2848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085745.1 protein_id gnl|my_center|LOCUS_15450 1120 1977 gene locus_tag LOCUS_15460 1120 1977 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039499.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15460 1971 2171 gene locus_tag LOCUS_15470 1971 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 2140 2637 gene locus_tag LOCUS_15480 2140 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 2634 3902 gene locus_tag LOCUS_15490 2634 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 4411 6396 gene locus_tag LOCUS_15500 gene metG 4411 6396 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_15500 6832 7059 gene locus_tag LOCUS_15510 6832 7059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 7056 7925 gene locus_tag LOCUS_15520 7056 7925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 8043 8825 gene locus_tag LOCUS_15530 8043 8825 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966271.1 protein_id gnl|my_center|LOCUS_15530 8983 9915 gene locus_tag LOCUS_15540 gene rsmA 8983 9915 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892086.1 protein_id gnl|my_center|LOCUS_15540 10148 10222 gene locus_tag LOCUS_t00250 10148 10222 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 10235 10306 gene locus_tag LOCUS_t00260 10235 10306 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence092 3425 2043 gene locus_tag LOCUS_15550 3425 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 4890 3439 gene locus_tag LOCUS_15560 gene miaB 4890 3439 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435252.1 protein_id gnl|my_center|LOCUS_15560 6430 5189 gene locus_tag LOCUS_15570 6430 5189 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_15570 7060 6461 gene locus_tag LOCUS_15580 7060 6461 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_15580 7318 7091 gene locus_tag LOCUS_15590 7318 7091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 8203 7361 gene locus_tag LOCUS_15600 gene proB 8203 7361 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_15600 9931 8315 gene locus_tag LOCUS_15610 9931 8315 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966358.1 protein_id gnl|my_center|LOCUS_15610 >Feature sequence093 2360 1401 gene locus_tag LOCUS_15620 2360 1401 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390147.1 protein_id gnl|my_center|LOCUS_15620 3136 2459 gene locus_tag LOCUS_15630 3136 2459 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293786.1 protein_id gnl|my_center|LOCUS_15630 4164 3133 gene locus_tag LOCUS_15640 4164 3133 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356948.1 protein_id gnl|my_center|LOCUS_15640 5444 4911 gene locus_tag LOCUS_15650 5444 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 5846 7684 gene locus_tag LOCUS_15660 gene glmS 5846 7684 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_15660 8622 7843 gene locus_tag LOCUS_15670 gene codY 8622 7843 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362579.1 protein_id gnl|my_center|LOCUS_15670 <10177 8959 gene locus_tag LOCUS_15680 <10177 8959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965091.1:type I DNA topoisomerase >Feature sequence094 888 1601 gene locus_tag LOCUS_15690 888 1601 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426384.1 protein_id gnl|my_center|LOCUS_15690 1801 2637 gene locus_tag LOCUS_15700 1801 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 2760 3092 gene locus_tag LOCUS_15710 2760 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 4585 3158 gene locus_tag LOCUS_15720 4585 3158 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346373.1 protein_id gnl|my_center|LOCUS_15720 5802 4807 gene locus_tag LOCUS_15730 gene glsA 5802 4807 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903278.1 protein_id gnl|my_center|LOCUS_15730 6076 7056 gene locus_tag LOCUS_15740 6076 7056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 7459 8208 gene locus_tag LOCUS_15750 7459 8208 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812271.1 protein_id gnl|my_center|LOCUS_15750 8208 8633 gene locus_tag LOCUS_15760 8208 8633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 8634 9401 gene locus_tag LOCUS_15770 gene cbiQ 8634 9401 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812266.1 protein_id gnl|my_center|LOCUS_15770 >Feature sequence095 363 1697 gene locus_tag LOCUS_15780 gene larC 363 1697 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947957.1 protein_id gnl|my_center|LOCUS_15780 1829 2671 gene locus_tag LOCUS_15790 gene larE 1829 2671 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584116.1 protein_id gnl|my_center|LOCUS_15790 3512 2856 gene locus_tag LOCUS_15800 3512 2856 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964200.1 protein_id gnl|my_center|LOCUS_15800 3784 4548 gene locus_tag LOCUS_15810 3784 4548 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459709.1 protein_id gnl|my_center|LOCUS_15810 4579 5397 gene locus_tag LOCUS_15820 4579 5397 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_15820 5404 5772 gene locus_tag LOCUS_15830 5404 5772 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143218.1 protein_id gnl|my_center|LOCUS_15830 6211 7281 gene locus_tag LOCUS_15840 gene ytvI 6211 7281 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944296.1 protein_id gnl|my_center|LOCUS_15840 7338 8087 gene locus_tag LOCUS_15850 7338 8087 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358908.1 protein_id gnl|my_center|LOCUS_15850 8077 8763 gene locus_tag LOCUS_15860 8077 8763 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949003.1 protein_id gnl|my_center|LOCUS_15860 8760 9032 gene locus_tag LOCUS_15870 8760 9032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 <10094 9022 gene locus_tag LOCUS_15880 <10094 9022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013399531.1:MFS transporter >Feature sequence096 <1 1003 gene locus_tag LOCUS_15890 <1 1003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009887863.1:elongation factor Tu 2696 1278 gene locus_tag LOCUS_15900 2696 1278 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891654.1 protein_id gnl|my_center|LOCUS_15900 3148 2693 gene locus_tag LOCUS_15910 3148 2693 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902189.1 protein_id gnl|my_center|LOCUS_15910 3271 3474 gene locus_tag LOCUS_15920 3271 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 3681 5165 gene locus_tag LOCUS_15930 3681 5165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 5249 7393 gene locus_tag LOCUS_15940 5249 7393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 7460 8548 gene locus_tag LOCUS_15950 7460 8548 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760828.1 protein_id gnl|my_center|LOCUS_15950 >Feature sequence097 <1 1130 gene locus_tag LOCUS_15960 <1 1130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011922218.1:DEAD/DEAH box helicase family protein 2237 1539 gene locus_tag LOCUS_15970 2237 1539 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949129.1 protein_id gnl|my_center|LOCUS_15970 2420 5974 gene locus_tag LOCUS_15980 gene addB 2420 5974 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151864400.1 protein_id gnl|my_center|LOCUS_15980 5965 9786 gene locus_tag LOCUS_15990 gene addA 5965 9786 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861079.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence098 113 39 gene locus_tag LOCUS_t00270 113 39 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 552 478 gene locus_tag LOCUS_t00280 552 478 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 644 570 gene locus_tag LOCUS_t00290 644 570 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 821 1747 gene locus_tag LOCUS_16000 821 1747 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229243.1 protein_id gnl|my_center|LOCUS_16000 1814 2365 gene locus_tag LOCUS_16010 gene ispF 1814 2365 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_16010 2475 3884 gene locus_tag LOCUS_16020 gene cysS 2475 3884 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_16020 3869 4312 gene locus_tag LOCUS_16030 3869 4312 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293091.1 protein_id gnl|my_center|LOCUS_16030 4391 5134 gene locus_tag LOCUS_16040 gene rlmB 4391 5134 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887855.1 protein_id gnl|my_center|LOCUS_16040 5477 5396 gene locus_tag LOCUS_t00300 5477 5396 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5786 6439 gene locus_tag LOCUS_16050 gene pcp 5786 6439 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390168.1 protein_id gnl|my_center|LOCUS_16050 6495 7667 gene locus_tag LOCUS_16060 gene iadA 6495 7667 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048339.1 protein_id gnl|my_center|LOCUS_16060 7677 9197 gene locus_tag LOCUS_16070 gene yfcC 7677 9197 CDS product putative basic amino acid antiporter YfcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868954.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence099 1750 1217 gene locus_tag LOCUS_16080 1750 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 4028 1869 gene locus_tag LOCUS_16090 4028 1869 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_16090 4538 4041 gene locus_tag LOCUS_16100 gene ybeY 4538 4041 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047996.1 protein_id gnl|my_center|LOCUS_16100 5633 4572 gene locus_tag LOCUS_16110 5633 4572 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_16110 6945 5716 gene locus_tag LOCUS_16120 gene yqfD 6945 5716 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792498.1 protein_id gnl|my_center|LOCUS_16120 7230 6958 gene locus_tag LOCUS_16130 7230 6958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 7559 7383 gene locus_tag LOCUS_16140 gene rpsU 7559 7383 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964600.1 protein_id gnl|my_center|LOCUS_16140 <9963 7743 gene locus_tag LOCUS_16150 <9963 7743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009889064.1:alanine--tRNA ligase >Feature sequence100 478 639 gene locus_tag LOCUS_16160 478 639 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_16160 751 1206 gene locus_tag LOCUS_16170 751 1206 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015980.1 protein_id gnl|my_center|LOCUS_16170 1266 2132 gene locus_tag LOCUS_16180 1266 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 2184 3056 gene locus_tag LOCUS_16190 2184 3056 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681808.1 protein_id gnl|my_center|LOCUS_16190 3312 4706 gene locus_tag LOCUS_16200 3312 4706 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017097.1 protein_id gnl|my_center|LOCUS_16200 4830 5774 gene locus_tag LOCUS_16210 4830 5774 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247679.1 protein_id gnl|my_center|LOCUS_16210 5813 6613 gene locus_tag LOCUS_16220 5813 6613 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531216.1 protein_id gnl|my_center|LOCUS_16220 6629 8554 gene locus_tag LOCUS_16230 6629 8554 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064864.1 protein_id gnl|my_center|LOCUS_16230 8612 9415 gene locus_tag LOCUS_16240 8612 9415 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860631.1 protein_id gnl|my_center|LOCUS_16240 >Feature sequence101 562 1950 gene locus_tag LOCUS_16250 562 1950 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_16250 2305 3399 gene locus_tag LOCUS_16260 2305 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 3417 5126 gene locus_tag LOCUS_16270 3417 5126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 5148 5912 gene locus_tag LOCUS_16280 5148 5912 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722723.1 protein_id gnl|my_center|LOCUS_16280 5914 7050 gene locus_tag LOCUS_16290 5914 7050 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931069.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence102 1803 826 gene locus_tag LOCUS_16300 1803 826 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582802.1 protein_id gnl|my_center|LOCUS_16300 3535 1790 gene locus_tag LOCUS_16310 3535 1790 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_16310 5136 3532 gene locus_tag LOCUS_16320 5136 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 5415 6875 gene locus_tag LOCUS_16330 5415 6875 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427657.1 protein_id gnl|my_center|LOCUS_16330 7960 7043 gene locus_tag LOCUS_16340 7960 7043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 9445 8156 gene locus_tag LOCUS_16350 9445 8156 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021362269.1 protein_id gnl|my_center|LOCUS_16350 >Feature sequence103 339 1529 gene locus_tag LOCUS_16360 339 1529 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460506.1 protein_id gnl|my_center|LOCUS_16360 1805 2332 gene locus_tag LOCUS_16370 1805 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 2336 2518 gene locus_tag LOCUS_16380 gene rpmF 2336 2518 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545520.1 protein_id gnl|my_center|LOCUS_16380 3106 3969 gene locus_tag LOCUS_16390 gene selD 3106 3969 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q9L4E1 protein_id gnl|my_center|LOCUS_16390 4138 5052 gene locus_tag LOCUS_16400 4138 5052 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545377.1 protein_id gnl|my_center|LOCUS_16400 5496 6185 gene locus_tag LOCUS_16410 5496 6185 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272454.1 protein_id gnl|my_center|LOCUS_16410 6203 7189 gene locus_tag LOCUS_16420 6203 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 7189 7890 gene locus_tag LOCUS_16430 7189 7890 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460538.1 protein_id gnl|my_center|LOCUS_16430 7887 8021 gene locus_tag LOCUS_16440 7887 8021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16440 8046 9221 gene locus_tag LOCUS_16450 8046 9221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 >Feature sequence104 260 901 gene locus_tag LOCUS_16460 260 901 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462102.1 protein_id gnl|my_center|LOCUS_16460 2436 925 gene locus_tag LOCUS_16470 gene xylB 2436 925 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_16470 4051 2549 gene locus_tag LOCUS_16480 4051 2549 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965898.1 protein_id gnl|my_center|LOCUS_16480 4946 6583 gene locus_tag LOCUS_16490 4946 6583 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633861.1 protein_id gnl|my_center|LOCUS_16490 6657 7586 gene locus_tag LOCUS_16500 6657 7586 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_16500 8153 9346 gene locus_tag LOCUS_16510 8153 9346 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948034.1 protein_id gnl|my_center|LOCUS_16510 >Feature sequence105 1396 77 gene locus_tag LOCUS_16520 1396 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 1669 4125 gene locus_tag LOCUS_16530 1669 4125 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048130.1 protein_id gnl|my_center|LOCUS_16530 4142 4855 gene locus_tag LOCUS_16540 4142 4855 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_16540 5030 6433 gene locus_tag LOCUS_16550 5030 6433 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048386.1 protein_id gnl|my_center|LOCUS_16550 8241 6451 gene locus_tag LOCUS_16560 8241 6451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 9055 8300 gene locus_tag LOCUS_16570 9055 8300 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861605.1 protein_id gnl|my_center|LOCUS_16570 9370 9065 gene locus_tag LOCUS_16580 9370 9065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 >Feature sequence106 174 2117 gene locus_tag LOCUS_16590 174 2117 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861834.1 protein_id gnl|my_center|LOCUS_16590 2139 3572 gene locus_tag LOCUS_16600 2139 3572 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948572.1 protein_id gnl|my_center|LOCUS_16600 4235 3708 gene locus_tag LOCUS_16610 4235 3708 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103131.1 protein_id gnl|my_center|LOCUS_16610 4788 4306 gene locus_tag LOCUS_16620 4788 4306 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_16620 5132 6964 gene locus_tag LOCUS_16630 5132 6964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 6986 7984 gene locus_tag LOCUS_16640 6986 7984 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096000.1 protein_id gnl|my_center|LOCUS_16640 >Feature sequence107 1033 239 gene locus_tag LOCUS_16650 1033 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 2444 1149 gene locus_tag LOCUS_16660 2444 1149 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209167.1 protein_id gnl|my_center|LOCUS_16660 2879 2469 gene locus_tag LOCUS_16670 2879 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16670 5029 2840 gene locus_tag LOCUS_16680 5029 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16680 6250 5336 gene locus_tag LOCUS_16690 6250 5336 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385464.1 protein_id gnl|my_center|LOCUS_16690 7076 6327 gene locus_tag LOCUS_16700 7076 6327 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860724.1 protein_id gnl|my_center|LOCUS_16700 8493 7201 gene locus_tag LOCUS_16710 8493 7201 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860723.1 protein_id gnl|my_center|LOCUS_16710 <9242 8505 gene locus_tag LOCUS_16720 <9242 8505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164925117.1:nucleoside hydrolase >Feature sequence108 457 1104 gene locus_tag LOCUS_16730 457 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 1166 2605 gene locus_tag LOCUS_16740 1166 2605 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_16740 2675 3913 gene locus_tag LOCUS_16750 2675 3913 CDS product DHHW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138263010.1 protein_id gnl|my_center|LOCUS_16750 4702 6063 gene locus_tag LOCUS_16760 4702 6063 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_16760 6088 6822 gene locus_tag LOCUS_16770 6088 6822 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662263.1 protein_id gnl|my_center|LOCUS_16770 7711 6866 gene locus_tag LOCUS_16780 7711 6866 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_16780 <9221 8196 gene locus_tag LOCUS_16790 <9221 8196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003392508.1:sodium/glutamate symporter >Feature sequence109 <1 1605 gene locus_tag LOCUS_16800 <1 1605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003416556.1:translation elongation factor 4 1646 2992 gene locus_tag LOCUS_16810 gene hemW 1646 2992 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_16810 3218 3976 gene locus_tag LOCUS_16820 3218 3976 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681078.1 protein_id gnl|my_center|LOCUS_16820 4213 5172 gene locus_tag LOCUS_16830 gene prmA 4213 5172 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964596.1 protein_id gnl|my_center|LOCUS_16830 5191 5934 gene locus_tag LOCUS_16840 5191 5934 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 protein_id gnl|my_center|LOCUS_16840 5947 7152 gene locus_tag LOCUS_16850 5947 7152 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895806.1 protein_id gnl|my_center|LOCUS_16850 7208 8383 gene locus_tag LOCUS_16860 gene thiI 7208 8383 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_16860 8826 8593 gene locus_tag LOCUS_16870 8826 8593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 >Feature sequence110 498 1061 gene locus_tag LOCUS_16880 gene ahpC 498 1061 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817384.1 protein_id gnl|my_center|LOCUS_16880 1268 2563 gene locus_tag LOCUS_16890 gene eno 1268 2563 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_16890 2801 2950 gene locus_tag LOCUS_16900 2801 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 3125 4141 gene locus_tag LOCUS_16910 gene galE 3125 4141 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_16910 4584 4820 gene locus_tag LOCUS_16920 4584 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 5102 6655 gene locus_tag LOCUS_16930 5102 6655 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207773.1 protein_id gnl|my_center|LOCUS_16930 6742 7560 gene locus_tag LOCUS_16940 6742 7560 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207772.1 protein_id gnl|my_center|LOCUS_16940 7849 8256 gene locus_tag LOCUS_16950 gene ytrA 7849 8256 CDS product GntR family transcriptional regulator YtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229121.1 protein_id gnl|my_center|LOCUS_16950 >Feature sequence111 318 1466 gene locus_tag LOCUS_16960 318 1466 CDS product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902650.1 protein_id gnl|my_center|LOCUS_16960 2498 1734 gene locus_tag LOCUS_16970 2498 1734 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250769.1 protein_id gnl|my_center|LOCUS_16970 2983 2519 gene locus_tag LOCUS_16980 2983 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 3652 3936 gene locus_tag LOCUS_16990 gene groES 3652 3936 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965991.1 protein_id gnl|my_center|LOCUS_16990 4060 5682 gene locus_tag LOCUS_17000 gene groL 4060 5682 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435012.1 protein_id gnl|my_center|LOCUS_17000 6640 6014 gene locus_tag LOCUS_17010 6640 6014 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048417.1 protein_id gnl|my_center|LOCUS_17010 7058 8170 gene locus_tag LOCUS_17020 7058 8170 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948802.1 protein_id gnl|my_center|LOCUS_17020 >Feature sequence112 371 1084 gene locus_tag LOCUS_17030 371 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 2096 1017 gene locus_tag LOCUS_17040 gene add 2096 1017 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368573.1 protein_id gnl|my_center|LOCUS_17040 2601 5606 gene locus_tag LOCUS_17050 2601 5606 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966288.1 protein_id gnl|my_center|LOCUS_17050 6661 5825 gene locus_tag LOCUS_17060 6661 5825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 7536 7063 gene locus_tag LOCUS_17070 gene ybaK 7536 7063 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763164.1 protein_id gnl|my_center|LOCUS_17070 <8703 7627 gene locus_tag LOCUS_17080 <8703 7627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_151612398.1:sugar ABC transporter ATP-binding protein >Feature sequence113 2003 675 gene locus_tag LOCUS_17090 2003 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 2715 2239 gene locus_tag LOCUS_17100 gene rnhA 2715 2239 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705464.1 protein_id gnl|my_center|LOCUS_17100 4359 2752 gene locus_tag LOCUS_17110 4359 2752 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_17110 6035 4560 gene locus_tag LOCUS_17120 gene spoIVA 6035 4560 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392832.1 protein_id gnl|my_center|LOCUS_17120 7070 6360 gene locus_tag LOCUS_17130 7070 6360 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027478.1 protein_id gnl|my_center|LOCUS_17130 7937 7179 gene locus_tag LOCUS_17140 7937 7179 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017145.1 protein_id gnl|my_center|LOCUS_17140 <8609 7940 gene locus_tag LOCUS_17150 <8609 7940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005815200.1:branched-chain amino acid ABC transporter permease >Feature sequence114 155 2059 gene locus_tag LOCUS_17160 155 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 2369 2782 gene locus_tag LOCUS_17170 2369 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 3026 4483 gene locus_tag LOCUS_17180 gene radA 3026 4483 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674860.1 protein_id gnl|my_center|LOCUS_17180 4732 4802 gene locus_tag LOCUS_t00310 4732 4802 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 5223 5462 gene locus_tag LOCUS_17190 5223 5462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 5683 8049 gene locus_tag LOCUS_17200 5683 8049 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459887.1 protein_id gnl|my_center|LOCUS_17200 <8563 8046 gene locus_tag LOCUS_17210 <8563 8046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003435316.1:LysR family transcriptional regulator >Feature sequence115 3122 4804 gene locus_tag LOCUS_17220 3122 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 4808 6163 gene locus_tag LOCUS_17230 4808 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 6335 6856 gene locus_tag LOCUS_17240 6335 6856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 >Feature sequence116 990 700 gene locus_tag LOCUS_17250 990 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 2747 1914 gene locus_tag LOCUS_17260 2747 1914 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964664.1 protein_id gnl|my_center|LOCUS_17260 5003 2772 gene locus_tag LOCUS_17270 gene ptsG 5003 2772 CDS product PTS glucose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244661.1 protein_id gnl|my_center|LOCUS_17270 7194 5413 gene locus_tag LOCUS_17280 7194 5413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 7327 7103 gene locus_tag LOCUS_17290 7327 7103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 7864 7355 gene locus_tag LOCUS_17300 7864 7355 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022620559.1 protein_id gnl|my_center|LOCUS_17300 8325 8396 gene locus_tag LOCUS_t00320 8325 8396 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence117 2066 519 gene locus_tag LOCUS_17310 2066 519 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965729.1 protein_id gnl|my_center|LOCUS_17310 2740 2063 gene locus_tag LOCUS_17320 2740 2063 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044679.1 protein_id gnl|my_center|LOCUS_17320 4185 2899 gene locus_tag LOCUS_17330 4185 2899 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040374.1 protein_id gnl|my_center|LOCUS_17330 4676 4179 gene locus_tag LOCUS_17340 4676 4179 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040373.1 protein_id gnl|my_center|LOCUS_17340 5767 4721 gene locus_tag LOCUS_17350 5767 4721 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039499.1 protein_id gnl|my_center|LOCUS_17350 6609 5764 gene locus_tag LOCUS_17360 6609 5764 CDS product DUF6282 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877507.1 protein_id gnl|my_center|LOCUS_17360 6959 7903 gene locus_tag LOCUS_17370 6959 7903 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966633.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence118 <1 677 gene locus_tag LOCUS_17380 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003440236.1:PTS sugar transporter subunit IIC 3077 825 gene locus_tag LOCUS_17390 3077 825 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454973.1 protein_id gnl|my_center|LOCUS_17390 3894 3094 gene locus_tag LOCUS_17400 3894 3094 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016757.1 protein_id gnl|my_center|LOCUS_17400 5488 3977 gene locus_tag LOCUS_17410 gene galT 5488 3977 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_17410 6228 5680 gene locus_tag LOCUS_17420 6228 5680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 6400 6203 gene locus_tag LOCUS_17430 6400 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 6566 7606 gene locus_tag LOCUS_17440 6566 7606 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897671.1 protein_id gnl|my_center|LOCUS_17440 7625 8014 gene locus_tag LOCUS_17450 7625 8014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 >Feature sequence119 1833 1162 gene locus_tag LOCUS_17460 1833 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 4190 2079 gene locus_tag LOCUS_17470 gene pnp 4190 2079 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_17470 4763 4497 gene locus_tag LOCUS_17480 gene rpsO 4763 4497 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419491.1 protein_id gnl|my_center|LOCUS_17480 5282 4977 gene locus_tag LOCUS_17490 5282 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 6865 5279 gene locus_tag LOCUS_17500 6865 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 <8339 6916 gene locus_tag LOCUS_17510 <8339 6916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009898068.1:L,D-transpeptidase family protein >Feature sequence120 3133 1541 gene locus_tag LOCUS_17520 gene citG 3133 1541 CDS product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668027.1 protein_id gnl|my_center|LOCUS_17520 3378 3677 gene locus_tag LOCUS_17530 gene citD 3378 3677 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684015.1 protein_id gnl|my_center|LOCUS_17530 3677 4579 gene locus_tag LOCUS_17540 gene citE 3677 4579 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898727.1 protein_id gnl|my_center|LOCUS_17540 4581 6143 gene locus_tag LOCUS_17550 gene citF 4581 6143 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355996.1 protein_id gnl|my_center|LOCUS_17550 7397 6450 gene locus_tag LOCUS_17560 7397 6450 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966633.1 protein_id gnl|my_center|LOCUS_17560 >Feature sequence121 256 972 gene locus_tag LOCUS_17570 256 972 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048437.1 protein_id gnl|my_center|LOCUS_17570 1078 1911 gene locus_tag LOCUS_17580 1078 1911 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986367.1 protein_id gnl|my_center|LOCUS_17580 2006 2380 gene locus_tag LOCUS_17590 2006 2380 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417516.1 protein_id gnl|my_center|LOCUS_17590 2700 3473 gene locus_tag LOCUS_17600 2700 3473 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582797.1 protein_id gnl|my_center|LOCUS_17600 4112 5224 gene locus_tag LOCUS_17610 4112 5224 CDS product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860941.1 protein_id gnl|my_center|LOCUS_17610 5352 6848 gene locus_tag LOCUS_17620 gene glpK 5352 6848 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence122 219 1832 gene locus_tag LOCUS_17630 219 1832 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159960.1 protein_id gnl|my_center|LOCUS_17630 1875 2939 gene locus_tag LOCUS_17640 1875 2939 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828679.1 protein_id gnl|my_center|LOCUS_17640 3006 6272 gene locus_tag LOCUS_17650 gene carB 3006 6272 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_17650 6256 7443 gene locus_tag LOCUS_17660 6256 7443 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_17660 8248 7613 gene locus_tag LOCUS_17670 8248 7613 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069661899.1 protein_id gnl|my_center|LOCUS_17670 >Feature sequence123 1482 868 gene locus_tag LOCUS_17680 1482 868 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641962.1 protein_id gnl|my_center|LOCUS_17680 1876 3048 gene locus_tag LOCUS_17690 1876 3048 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434490.1 protein_id gnl|my_center|LOCUS_17690 4469 3174 gene locus_tag LOCUS_17700 4469 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458963.1 protein_id gnl|my_center|LOCUS_17700 5382 4513 gene locus_tag LOCUS_17710 5382 4513 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942615.1 protein_id gnl|my_center|LOCUS_17710 7022 5823 gene locus_tag LOCUS_17720 7022 5823 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467385.1 protein_id gnl|my_center|LOCUS_17720 <8245 7065 gene locus_tag LOCUS_17730 <8245 7065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227758.1:DUF5682 family protein >Feature sequence124 1823 1323 gene locus_tag LOCUS_17740 1823 1323 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902172.1 protein_id gnl|my_center|LOCUS_17740 3887 2073 gene locus_tag LOCUS_17750 3887 2073 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143606.1 protein_id gnl|my_center|LOCUS_17750 5647 3887 gene locus_tag LOCUS_17760 5647 3887 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814218.1 protein_id gnl|my_center|LOCUS_17760 6105 5644 gene locus_tag LOCUS_17770 6105 5644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 6435 6887 gene locus_tag LOCUS_17780 6435 6887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 <8205 7029 gene locus_tag LOCUS_17790 <8205 7029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020940.1:sodium-dependent transporter >Feature sequence125 1496 1260 gene locus_tag LOCUS_17800 1496 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 2350 1595 gene locus_tag LOCUS_17810 2350 1595 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670138.1 protein_id gnl|my_center|LOCUS_17810 4908 2461 gene locus_tag LOCUS_17820 gene pheT 4908 2461 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_17820 6011 4992 gene locus_tag LOCUS_17830 gene pheS 6011 4992 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965654.1 protein_id gnl|my_center|LOCUS_17830 6778 6488 gene locus_tag LOCUS_17840 6778 6488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 <8109 6837 gene locus_tag LOCUS_17850 <8109 6837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048068.1:MBOAT family protein >Feature sequence126 235 708 gene locus_tag LOCUS_17860 235 708 CDS product glycine/betaine reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956809.1 transl_except (pos:364..366,aa:Sec) note codon on position 44 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_17860 886 2433 gene locus_tag LOCUS_17870 gene grdC 886 2433 CDS product glycine/sarcosine/betaine reductase complex component C subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897537.1 protein_id gnl|my_center|LOCUS_17870 2462 3580 gene locus_tag LOCUS_17880 gene grdD 2462 3580 CDS product glycine/sarcosine/betaine reductase complex component C subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948889.1 protein_id gnl|my_center|LOCUS_17880 3706 3870 gene locus_tag LOCUS_17890 3706 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 3899 3991 gene locus_tag LOCUS_t00330 3899 3991 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 4034 5506 gene locus_tag LOCUS_17900 gene selA 4034 5506 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048015.1 protein_id gnl|my_center|LOCUS_17900 5511 7424 gene locus_tag LOCUS_17910 gene selB 5511 7424 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393980.1 protein_id gnl|my_center|LOCUS_17910 >Feature sequence127 <1 794 gene locus_tag LOCUS_17920 <1 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003430279.1:tRNA pseudouridine(38-40) synthase TruA 840 1424 gene locus_tag LOCUS_17930 840 1424 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259574.1 protein_id gnl|my_center|LOCUS_17930 1427 2917 gene locus_tag LOCUS_17940 1427 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 3477 3749 gene locus_tag LOCUS_17950 3477 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 3842 3915 gene locus_tag LOCUS_t00340 3842 3915 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4498 5607 gene locus_tag LOCUS_17960 gene ugpC 4498 5607 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_17960 5904 6992 gene locus_tag LOCUS_17970 5904 6992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 >Feature sequence128 <1 1583 gene locus_tag LOCUS_17980 <1 1583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963849.1:Lsa family ABC-F type ribosomal protection protein 1787 2176 gene locus_tag LOCUS_17990 1787 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 2173 3540 gene locus_tag LOCUS_18000 2173 3540 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_18000 3930 4310 gene locus_tag LOCUS_18010 3930 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18010 4550 7141 gene locus_tag LOCUS_18020 gene clpB 4550 7141 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_18020 7238 7477 gene locus_tag LOCUS_18030 7238 7477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 >Feature sequence129 1743 616 gene locus_tag LOCUS_18040 1743 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18040 2656 1724 gene locus_tag LOCUS_18050 2656 1724 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439450.1 protein_id gnl|my_center|LOCUS_18050 3541 2855 gene locus_tag LOCUS_18060 gene cmk 3541 2855 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565355.1 protein_id gnl|my_center|LOCUS_18060 4204 3752 gene locus_tag LOCUS_18070 4204 3752 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807795.1 protein_id gnl|my_center|LOCUS_18070 6357 4273 gene locus_tag LOCUS_18080 6357 4273 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183138.1 protein_id gnl|my_center|LOCUS_18080 6578 6393 gene locus_tag LOCUS_18090 6578 6393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 6867 6586 gene locus_tag LOCUS_18100 6867 6586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 7835 7164 gene locus_tag LOCUS_18110 7835 7164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 >Feature sequence130 500 2998 gene locus_tag LOCUS_18120 500 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 3182 4474 gene locus_tag LOCUS_18130 3182 4474 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_18130 4908 6101 gene locus_tag LOCUS_18140 gene metK 4908 6101 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 protein_id gnl|my_center|LOCUS_18140 6471 6902 gene locus_tag LOCUS_18150 6471 6902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 >Feature sequence131 89 787 gene locus_tag LOCUS_18160 89 787 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974505.1 protein_id gnl|my_center|LOCUS_18160 861 2216 gene locus_tag LOCUS_18170 861 2216 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804134.1 protein_id gnl|my_center|LOCUS_18170 2404 3396 gene locus_tag LOCUS_18180 2404 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 3556 4692 gene locus_tag LOCUS_18190 gene spoVAD 3556 4692 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_18190 4696 5052 gene locus_tag LOCUS_18200 gene spoVAE 4696 5052 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418423.1 protein_id gnl|my_center|LOCUS_18200 <7817 5390 gene locus_tag LOCUS_18210 <7817 5390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000808183.1:PBP1A family penicillin-binding protein >Feature sequence132 1619 858 gene locus_tag LOCUS_18220 gene bioD 1619 858 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986727.1 protein_id gnl|my_center|LOCUS_18220 2631 1603 gene locus_tag LOCUS_18230 gene bioB 2631 1603 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986728.1 protein_id gnl|my_center|LOCUS_18230 3229 2648 gene locus_tag LOCUS_18240 3229 2648 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986729.1 protein_id gnl|my_center|LOCUS_18240 3634 4098 gene locus_tag LOCUS_18250 3634 4098 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_18250 5445 6773 gene locus_tag LOCUS_18260 5445 6773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 6913 7698 gene locus_tag LOCUS_18270 6913 7698 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357525.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence133 1013 1327 gene locus_tag LOCUS_18280 1013 1327 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669619.1 protein_id gnl|my_center|LOCUS_18280 1331 2245 gene locus_tag LOCUS_18290 1331 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 2242 2481 gene locus_tag LOCUS_18300 2242 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 2851 3009 gene locus_tag LOCUS_18310 2851 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 3013 3237 gene locus_tag LOCUS_18320 3013 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 3363 4238 gene locus_tag LOCUS_18330 3363 4238 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680703.1 protein_id gnl|my_center|LOCUS_18330 4367 5782 gene locus_tag LOCUS_18340 gene cbiD 4367 5782 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861964.1 protein_id gnl|my_center|LOCUS_18340 5869 6573 gene locus_tag LOCUS_18350 gene cobI 5869 6573 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461549.1 protein_id gnl|my_center|LOCUS_18350 6621 7421 gene locus_tag LOCUS_18360 gene cobM 6621 7421 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871103.1 protein_id gnl|my_center|LOCUS_18360 >Feature sequence134 39 773 gene locus_tag LOCUS_18370 39 773 CDS product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414378.1 protein_id gnl|my_center|LOCUS_18370 914 2623 gene locus_tag LOCUS_18380 914 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 3971 2913 gene locus_tag LOCUS_18390 3971 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 5127 6860 gene locus_tag LOCUS_18400 5127 6860 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459675.1 protein_id gnl|my_center|LOCUS_18400 7554 7186 gene locus_tag LOCUS_18410 7554 7186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 >Feature sequence135 257 1066 gene locus_tag LOCUS_18420 257 1066 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780022.1 protein_id gnl|my_center|LOCUS_18420 1212 1287 gene locus_tag LOCUS_t00350 1212 1287 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1457 1879 gene locus_tag LOCUS_18430 1457 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 1833 2426 gene locus_tag LOCUS_18440 1833 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 2526 4235 gene locus_tag LOCUS_18450 gene recJ 2526 4235 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943623.1 protein_id gnl|my_center|LOCUS_18450 5624 4395 gene locus_tag LOCUS_18460 5624 4395 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_18460 5895 6053 gene locus_tag LOCUS_18470 5895 6053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 6178 7506 gene locus_tag LOCUS_18480 6178 7506 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674469.1 protein_id gnl|my_center|LOCUS_18480 >Feature sequence136 342 1250 gene locus_tag LOCUS_18490 gene ftsX 342 1250 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357632.1 protein_id gnl|my_center|LOCUS_18490 1263 2462 gene locus_tag LOCUS_18500 1263 2462 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_18500 2573 3883 gene locus_tag LOCUS_18510 2573 3883 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963821.1 protein_id gnl|my_center|LOCUS_18510 4338 4820 gene locus_tag LOCUS_18520 4338 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 6079 5012 gene locus_tag LOCUS_18530 6079 5012 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461701.1 protein_id gnl|my_center|LOCUS_18530 6836 7057 gene locus_tag LOCUS_18540 6836 7057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 >Feature sequence137 3 263 gene locus_tag LOCUS_18550 3 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 238 2562 gene locus_tag LOCUS_18560 238 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 2604 3065 gene locus_tag LOCUS_18570 2604 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 3026 3253 gene locus_tag LOCUS_18580 3026 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 3205 3510 gene locus_tag LOCUS_18590 3205 3510 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_18590 4012 3940 gene locus_tag LOCUS_t00360 4012 3940 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4115 4044 gene locus_tag LOCUS_t00370 4115 4044 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4195 4120 gene locus_tag LOCUS_t00380 4195 4120 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4643 4571 gene locus_tag LOCUS_t00390 4643 4571 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4722 4647 gene locus_tag LOCUS_t00400 4722 4647 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4906 6051 gene locus_tag LOCUS_18600 4906 6051 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898508.1 protein_id gnl|my_center|LOCUS_18600 >Feature sequence138 435 2222 gene locus_tag LOCUS_18610 435 2222 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678765.1 protein_id gnl|my_center|LOCUS_18610 2317 4497 gene locus_tag LOCUS_18620 2317 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 6743 4626 gene locus_tag LOCUS_18630 6743 4626 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_18630 >Feature sequence139 33 1394 gene locus_tag LOCUS_18640 33 1394 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546410.1 protein_id gnl|my_center|LOCUS_18640 1621 2382 gene locus_tag LOCUS_18650 1621 2382 CDS product LamB/YcsF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851457.1 protein_id gnl|my_center|LOCUS_18650 2434 3654 gene locus_tag LOCUS_18660 2434 3654 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419704.1 protein_id gnl|my_center|LOCUS_18660 3770 4498 gene locus_tag LOCUS_18670 gene pxpB 3770 4498 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889166.1 protein_id gnl|my_center|LOCUS_18670 4502 5608 gene locus_tag LOCUS_18680 4502 5608 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896290.1 protein_id gnl|my_center|LOCUS_18680 5964 6398 gene locus_tag LOCUS_18690 gene rplM 5964 6398 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650450.1 protein_id gnl|my_center|LOCUS_18690 6427 6819 gene locus_tag LOCUS_18700 gene rpsI 6427 6819 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357662.1 protein_id gnl|my_center|LOCUS_18700 >Feature sequence140 1621 275 gene locus_tag LOCUS_18710 gene rocR 1621 275 CDS product arginine utilization regulatory protein RocR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244510.1 protein_id gnl|my_center|LOCUS_18710 3310 1829 gene locus_tag LOCUS_18720 gene nhaC 3310 1829 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426252.1 protein_id gnl|my_center|LOCUS_18720 4041 3550 gene locus_tag LOCUS_18730 4041 3550 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288392.1 protein_id gnl|my_center|LOCUS_18730 5042 4164 gene locus_tag LOCUS_18740 5042 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 5472 6095 gene locus_tag LOCUS_18750 5472 6095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021681.1 protein_id gnl|my_center|LOCUS_18750 6362 6096 gene locus_tag LOCUS_18760 6362 6096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 >Feature sequence141 4150 5511 gene locus_tag LOCUS_18770 4150 5511 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107748.1 protein_id gnl|my_center|LOCUS_18770 <6508 5465 gene locus_tag LOCUS_18780 <6508 5465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010906161.1:linear amide C-N hydrolase >Feature sequence142 2117 417 gene locus_tag LOCUS_18790 2117 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 2732 2316 gene locus_tag LOCUS_18800 2732 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 3312 2839 gene locus_tag LOCUS_18810 3312 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 4157 3309 gene locus_tag LOCUS_18820 4157 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 6303 4321 gene locus_tag LOCUS_18830 6303 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 >Feature sequence143 <1 1204 gene locus_tag LOCUS_18840 <1 1204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_166276588.1:S8 family serine peptidase 1266 2180 gene locus_tag LOCUS_18850 1266 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 2102 2407 gene locus_tag LOCUS_18860 2102 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 2404 3456 gene locus_tag LOCUS_18870 2404 3456 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765274.1 protein_id gnl|my_center|LOCUS_18870 4339 3473 gene locus_tag LOCUS_18880 4339 3473 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_18880 4626 5990 gene locus_tag LOCUS_18890 4626 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 >Feature sequence144 2970 1543 gene locus_tag LOCUS_18900 gene scfB 2970 1543 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_18900 3266 3120 gene locus_tag LOCUS_18910 gene scfA 3266 3120 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_18910 3454 3813 gene locus_tag LOCUS_18920 3454 3813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 5210 3984 gene locus_tag LOCUS_18930 5210 3984 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_18930 5460 5305 gene locus_tag LOCUS_18940 5460 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 6003 5542 gene locus_tag LOCUS_18950 gene lspA 6003 5542 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974241.1 protein_id gnl|my_center|LOCUS_18950 >Feature sequence145 <1 1601 gene locus_tag LOCUS_18960 <1 1601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965567.1:aspartate--tRNA ligase 2059 4134 gene locus_tag LOCUS_18970 2059 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 >Feature sequence146 1608 268 gene locus_tag LOCUS_18980 1608 268 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021843.1 protein_id gnl|my_center|LOCUS_18980 2581 1748 gene locus_tag LOCUS_18990 2581 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 3480 2578 gene locus_tag LOCUS_19000 3480 2578 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808885.1 protein_id gnl|my_center|LOCUS_19000 3784 5199 gene locus_tag LOCUS_19010 3784 5199 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891874.1 protein_id gnl|my_center|LOCUS_19010 <6183 5228 gene locus_tag LOCUS_19020 <6183 5228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392886.1:spore germination protein >Feature sequence147 2 580 gene locus_tag LOCUS_19030 2 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 577 1620 gene locus_tag LOCUS_19040 577 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 1677 2252 gene locus_tag LOCUS_19050 1677 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 2423 2581 gene locus_tag LOCUS_19060 2423 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 2562 3398 gene locus_tag LOCUS_19070 2562 3398 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_19070 3473 3982 gene locus_tag LOCUS_19080 3473 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 4052 5116 gene locus_tag LOCUS_19090 4052 5116 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288210.1 protein_id gnl|my_center|LOCUS_19090 5166 5666 gene locus_tag LOCUS_19100 5166 5666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 >Feature sequence148 366 1178 gene locus_tag LOCUS_19110 366 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 1183 2826 gene locus_tag LOCUS_19120 1183 2826 CDS product putative 2-aminoethylphosphonate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425420.1 protein_id gnl|my_center|LOCUS_19120 2966 3955 gene locus_tag LOCUS_19130 2966 3955 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750893.1 protein_id gnl|my_center|LOCUS_19130 >Feature sequence149 348 908 gene locus_tag LOCUS_19140 gene recU 348 908 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460152.1 protein_id gnl|my_center|LOCUS_19140 942 2174 gene locus_tag LOCUS_19150 gene pepT 942 2174 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963798.1 protein_id gnl|my_center|LOCUS_19150 4134 2281 gene locus_tag LOCUS_19160 gene asnB 4134 2281 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233080.1 protein_id gnl|my_center|LOCUS_19160 5723 4317 gene locus_tag LOCUS_19170 5723 4317 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537860.1 protein_id gnl|my_center|LOCUS_19170 >Feature sequence150 106 405 gene locus_tag LOCUS_19180 106 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 817 416 gene locus_tag LOCUS_19190 817 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19190 1456 854 gene locus_tag LOCUS_19200 1456 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19200 1745 2851 gene locus_tag LOCUS_19210 1745 2851 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_19210 3912 2953 gene locus_tag LOCUS_19220 3912 2953 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809146.1 protein_id gnl|my_center|LOCUS_19220 4915 3890 gene locus_tag LOCUS_19230 4915 3890 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039355.1 protein_id gnl|my_center|LOCUS_19230 5765 4908 gene locus_tag LOCUS_19240 5765 4908 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948770.1 protein_id gnl|my_center|LOCUS_19240 >Feature sequence151 1191 535 gene locus_tag LOCUS_19250 1191 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 2347 1277 gene locus_tag LOCUS_19260 2347 1277 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966336.1 protein_id gnl|my_center|LOCUS_19260 3051 2341 gene locus_tag LOCUS_19270 3051 2341 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966337.1 protein_id gnl|my_center|LOCUS_19270 4152 3058 gene locus_tag LOCUS_19280 4152 3058 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356506.1 protein_id gnl|my_center|LOCUS_19280 5294 4317 gene locus_tag LOCUS_19290 5294 4317 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065125.1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence152 276 905 gene locus_tag LOCUS_19300 276 905 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066132.1 protein_id gnl|my_center|LOCUS_19300 902 1684 gene locus_tag LOCUS_19310 902 1684 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_19310 1638 2510 gene locus_tag LOCUS_19320 1638 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_19320 3311 2661 gene locus_tag LOCUS_19330 3311 2661 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_19330 4422 3505 gene locus_tag LOCUS_19340 4422 3505 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371731.1 protein_id gnl|my_center|LOCUS_19340 5109 4588 gene locus_tag LOCUS_19350 gene lspA 5109 4588 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358651.1 protein_id gnl|my_center|LOCUS_19350 <5924 5174 gene locus_tag LOCUS_19360 <5924 5174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920845.1:3-dehydroquinate synthase >Feature sequence153 2238 1594 gene locus_tag LOCUS_19370 gene recR 2238 1594 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_19370 2560 2195 gene locus_tag LOCUS_19380 2560 2195 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_19380 4353 2686 gene locus_tag LOCUS_19390 4353 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 5466 4384 gene locus_tag LOCUS_19400 5466 4384 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_19400 >Feature sequence154 1192 443 gene locus_tag LOCUS_19410 1192 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 2311 1637 gene locus_tag LOCUS_19420 2311 1637 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986729.1 protein_id gnl|my_center|LOCUS_19420 2860 2414 gene locus_tag LOCUS_19430 2860 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 3748 2933 gene locus_tag LOCUS_19440 gene murI 3748 2933 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_19440 4833 3772 gene locus_tag LOCUS_19450 4833 3772 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459778.1 protein_id gnl|my_center|LOCUS_19450 >Feature sequence155 385 62 gene locus_tag LOCUS_19460 385 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 794 369 gene locus_tag LOCUS_19470 794 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 1176 1027 gene locus_tag LOCUS_19480 1176 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 1888 1214 gene locus_tag LOCUS_19490 gene pyrE 1888 1214 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_19490 2840 1938 gene locus_tag LOCUS_19500 2840 1938 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_19500 3604 2840 gene locus_tag LOCUS_19510 gene pyrK 3604 2840 CDS product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983358.1 protein_id gnl|my_center|LOCUS_19510 4703 3786 gene locus_tag LOCUS_19520 gene pyrF 4703 3786 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_19520 <5613 5033 gene locus_tag LOCUS_19530 <5613 5033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870273.1:type I restriction endonuclease subunit R >Feature sequence156 1027 203 gene locus_tag LOCUS_19540 1027 203 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963750.1 protein_id gnl|my_center|LOCUS_19540 1530 1024 gene locus_tag LOCUS_19550 1530 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19550 1961 1536 gene locus_tag LOCUS_19560 1961 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19560 2709 1861 gene locus_tag LOCUS_19570 2709 1861 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477847.1 protein_id gnl|my_center|LOCUS_19570 3686 2895 gene locus_tag LOCUS_19580 3686 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 4531 3611 gene locus_tag LOCUS_19590 4531 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 <5528 4687 gene locus_tag LOCUS_19600 <5528 4687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003244272.1:alpha,alpha-phosphotrehalase >Feature sequence157 791 456 gene locus_tag LOCUS_19610 791 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 2145 901 gene locus_tag LOCUS_19620 2145 901 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_19620 2690 2148 gene locus_tag LOCUS_19630 gene pgsA 2690 2148 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052967.1 protein_id gnl|my_center|LOCUS_19630 4014 2674 gene locus_tag LOCUS_19640 gene rimO 4014 2674 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_19640 4387 4127 gene locus_tag LOCUS_19650 4387 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 5126 4491 gene locus_tag LOCUS_19660 gene gmk 5126 4491 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257738.1 protein_id gnl|my_center|LOCUS_19660 >Feature sequence158 2044 347 gene locus_tag LOCUS_19670 2044 347 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945515.1 protein_id gnl|my_center|LOCUS_19670 2359 3312 gene locus_tag LOCUS_19680 2359 3312 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715339.1 protein_id gnl|my_center|LOCUS_19680 <5430 3563 gene locus_tag LOCUS_19690 <5430 3563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392862.1:sodium-translocating pyrophosphatase >Feature sequence159 138 1763 gene locus_tag LOCUS_19700 138 1763 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678766.1 protein_id gnl|my_center|LOCUS_19700 2581 1955 gene locus_tag LOCUS_19710 2581 1955 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890811.1 protein_id gnl|my_center|LOCUS_19710 3198 2725 gene locus_tag LOCUS_19720 3198 2725 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_19720 4104 3214 gene locus_tag LOCUS_19730 4104 3214 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_19730 <5424 4507 gene locus_tag LOCUS_19740 <5424 4507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011947999.1:Tex family protein >Feature sequence160 1320 55 gene locus_tag LOCUS_19750 1320 55 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_19750 3006 1468 gene locus_tag LOCUS_19760 gene pap 3006 1468 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869086.1 protein_id gnl|my_center|LOCUS_19760 4195 3077 gene locus_tag LOCUS_19770 4195 3077 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080165.1 protein_id gnl|my_center|LOCUS_19770 4581 4195 gene locus_tag LOCUS_19780 4581 4195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 5072 4806 gene locus_tag LOCUS_19790 5072 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 >Feature sequence161 1529 849 gene locus_tag LOCUS_19800 1529 849 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963522.1 protein_id gnl|my_center|LOCUS_19800 1954 1526 gene locus_tag LOCUS_19810 1954 1526 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398241.1 protein_id gnl|my_center|LOCUS_19810 2812 2195 gene locus_tag LOCUS_19820 2812 2195 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454488.1 protein_id gnl|my_center|LOCUS_19820 3296 2865 gene locus_tag LOCUS_19830 3296 2865 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477396.1 protein_id gnl|my_center|LOCUS_19830 4545 3451 gene locus_tag LOCUS_19840 4545 3451 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048169508.1 protein_id gnl|my_center|LOCUS_19840 <5329 4676 gene locus_tag LOCUS_19850 <5329 4676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964083.1:aldo/keto reductase >Feature sequence162 1586 477 gene locus_tag LOCUS_19860 1586 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 3035 1995 gene locus_tag LOCUS_19870 gene gpr 3035 1995 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430954.1 protein_id gnl|my_center|LOCUS_19870 3361 3624 gene locus_tag LOCUS_19880 gene rpsT 3361 3624 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902954.1 protein_id gnl|my_center|LOCUS_19880 5045 4233 gene locus_tag LOCUS_19890 5045 4233 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108784.1 protein_id gnl|my_center|LOCUS_19890 >Feature sequence163 1187 249 gene locus_tag LOCUS_19900 1187 249 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948769.1 protein_id gnl|my_center|LOCUS_19900 2497 1187 gene locus_tag LOCUS_19910 2497 1187 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948768.1 protein_id gnl|my_center|LOCUS_19910 3427 2513 gene locus_tag LOCUS_19920 3427 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 5047 3545 gene locus_tag LOCUS_19930 5047 3545 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948793.1 protein_id gnl|my_center|LOCUS_19930 >Feature sequence164 <1 986 gene locus_tag LOCUS_19940 <1 986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003246072.1:leucine--tRNA ligase 1700 2770 gene locus_tag LOCUS_19950 1700 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 2956 3675 gene locus_tag LOCUS_19960 2956 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 3804 4628 gene locus_tag LOCUS_19970 3804 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 >Feature sequence165 <1 872 gene locus_tag LOCUS_19980 <1 872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680347.1:glycogen/starch/alpha-glucan phosphorylase 1277 921 gene locus_tag LOCUS_19990 1277 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018213024.1 protein_id gnl|my_center|LOCUS_19990 1712 2557 gene locus_tag LOCUS_20000 1712 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 2589 3386 gene locus_tag LOCUS_20010 2589 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 3779 4369 gene locus_tag LOCUS_20020 3779 4369 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583891.1 protein_id gnl|my_center|LOCUS_20020 4453 4866 gene locus_tag LOCUS_20030 4453 4866 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889129.1 protein_id gnl|my_center|LOCUS_20030 >Feature sequence166 981 619 gene locus_tag LOCUS_20040 981 619 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288776.1 protein_id gnl|my_center|LOCUS_20040 1909 1082 gene locus_tag LOCUS_20050 1909 1082 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529491.1 protein_id gnl|my_center|LOCUS_20050 3170 1953 gene locus_tag LOCUS_20060 3170 1953 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_20060 4247 3198 gene locus_tag LOCUS_20070 4247 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 <5047 4339 gene locus_tag LOCUS_20080 <5047 4339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530262.1:ABC transporter permease >Feature sequence167 164 2257 gene locus_tag LOCUS_20090 164 2257 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461804.1 protein_id gnl|my_center|LOCUS_20090 2271 3914 gene locus_tag LOCUS_20100 gene asnB 2271 3914 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905297.1 protein_id gnl|my_center|LOCUS_20100 4977 3946 gene locus_tag LOCUS_20110 4977 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 >Feature sequence168 757 296 gene locus_tag LOCUS_20120 757 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 1480 3342 gene locus_tag LOCUS_20130 gene ftsH 1480 3342 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272679.1 protein_id gnl|my_center|LOCUS_20130 >Feature sequence169 <4903 2367 gene locus_tag LOCUS_20140 <4903 2367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_110323000.1:Ig-like domain-containing protein >Feature sequence170 447 1112 gene locus_tag LOCUS_20150 gene minC 447 1112 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816782.1 protein_id gnl|my_center|LOCUS_20150 1180 1971 gene locus_tag LOCUS_20160 gene minD 1180 1971 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392079.1 protein_id gnl|my_center|LOCUS_20160 1986 2267 gene locus_tag LOCUS_20170 gene minE 1986 2267 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419058.1 protein_id gnl|my_center|LOCUS_20170 2264 3388 gene locus_tag LOCUS_20180 gene rodA 2264 3388 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_20180 3403 3798 gene locus_tag LOCUS_20190 3403 3798 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438060.1 protein_id gnl|my_center|LOCUS_20190 3844 4845 gene locus_tag LOCUS_20200 3844 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 >Feature sequence171 1965 820 gene locus_tag LOCUS_20210 1965 820 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247133.1 protein_id gnl|my_center|LOCUS_20210 2964 2137 gene locus_tag LOCUS_20220 2964 2137 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896027.1 protein_id gnl|my_center|LOCUS_20220 3197 3024 gene locus_tag LOCUS_20230 3197 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 4531 3257 gene locus_tag LOCUS_20240 gene purD 4531 3257 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_20240 >Feature sequence172 119 34 gene locus_tag LOCUS_t00410 119 34 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 798 442 gene locus_tag LOCUS_20250 gene rplT 798 442 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429730.1 protein_id gnl|my_center|LOCUS_20250 1027 830 gene locus_tag LOCUS_20260 gene rpmI 1027 830 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_20260 1518 1060 gene locus_tag LOCUS_20270 gene infC 1518 1060 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048135.1 protein_id gnl|my_center|LOCUS_20270 2403 2089 gene locus_tag LOCUS_20280 2403 2089 CDS product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422812.1 protein_id gnl|my_center|LOCUS_20280 4475 2544 gene locus_tag LOCUS_20290 gene thrS 4475 2544 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888359.1 protein_id gnl|my_center|LOCUS_20290 >Feature sequence173 540 1004 gene locus_tag LOCUS_20300 gene smpB 540 1004 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220025.1 protein_id gnl|my_center|LOCUS_20300 1216 1557 gene locus_tag LOCUS_tm00010 1216 1557 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1682 3058 gene locus_tag LOCUS_20310 1682 3058 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_20310 3202 4272 gene locus_tag LOCUS_20320 3202 4272 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_20320 >Feature sequence174 819 223 gene locus_tag LOCUS_20330 gene purN 819 223 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_20330 1844 813 gene locus_tag LOCUS_20340 gene purM 1844 813 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262435.1 protein_id gnl|my_center|LOCUS_20340 2460 1945 gene locus_tag LOCUS_20350 gene purE 2460 1945 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081520.1 protein_id gnl|my_center|LOCUS_20350 4590 2671 gene locus_tag LOCUS_20360 4590 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 >Feature sequence175 <1 687 gene locus_tag LOCUS_20370 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963640.1:HAMP domain-containing sensor histidine kinase 684 1373 gene locus_tag LOCUS_20380 684 1373 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_20380 1528 3171 gene locus_tag LOCUS_20390 1528 3171 CDS product beta-carotene 15,15'-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837343.1 protein_id gnl|my_center|LOCUS_20390 3326 4633 gene locus_tag LOCUS_20400 gene brnQ 3326 4633 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964918.1 protein_id gnl|my_center|LOCUS_20400 >Feature sequence176 1082 618 gene locus_tag LOCUS_20410 1082 618 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965786.1 protein_id gnl|my_center|LOCUS_20410 2087 1302 gene locus_tag LOCUS_20420 2087 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 2859 2167 gene locus_tag LOCUS_20430 2859 2167 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963931.1 protein_id gnl|my_center|LOCUS_20430 3259 2906 gene locus_tag LOCUS_20440 3259 2906 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419862.1 protein_id gnl|my_center|LOCUS_20440 3427 4263 gene locus_tag LOCUS_20450 3427 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 4430 4266 gene locus_tag LOCUS_20460 4430 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 >Feature sequence177 1665 928 gene locus_tag LOCUS_20470 gene rpsB 1665 928 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_20470 3441 1858 gene locus_tag LOCUS_20480 3441 1858 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963421.1 protein_id gnl|my_center|LOCUS_20480 3674 4543 gene locus_tag LOCUS_20490 3674 4543 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262369.1 protein_id gnl|my_center|LOCUS_20490 >Feature sequence178 <1 1424 gene locus_tag LOCUS_20500 <1 1424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011947996.1:preprotein translocase subunit SecA 1781 2812 gene locus_tag LOCUS_20510 gene prfB 1781 2812 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181244843.1 protein_id gnl|my_center|LOCUS_20510 2982 3425 gene locus_tag LOCUS_20520 2982 3425 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964547.1 protein_id gnl|my_center|LOCUS_20520 >Feature sequence179 2529 1330 gene locus_tag LOCUS_20530 gene hydE 2529 1330 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108014.1 protein_id gnl|my_center|LOCUS_20530 2812 2534 gene locus_tag LOCUS_20540 2812 2534 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963809.1 protein_id gnl|my_center|LOCUS_20540 3450 3914 gene locus_tag LOCUS_20550 3450 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 >Feature sequence180 849 2255 gene locus_tag LOCUS_20560 849 2255 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809868.1 protein_id gnl|my_center|LOCUS_20560 3339 2278 gene locus_tag LOCUS_20570 3339 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 <4442 3514 gene locus_tag LOCUS_20580 <4442 3514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861696.1:four-carbon acid sugar kinase family protein >Feature sequence181 640 966 gene locus_tag LOCUS_20590 640 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 1388 1053 gene locus_tag LOCUS_20600 gene darA 1388 1053 CDS product cyclic di-AMP receptor DarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242755.1 protein_id gnl|my_center|LOCUS_20600 1711 2253 gene locus_tag LOCUS_20610 1711 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20610 2311 2748 gene locus_tag LOCUS_20620 2311 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20620 2768 3016 gene locus_tag LOCUS_20630 2768 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 3168 3782 gene locus_tag LOCUS_20640 3168 3782 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966844.1 protein_id gnl|my_center|LOCUS_20640 4406 3879 gene locus_tag LOCUS_20650 4406 3879 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944116.1 protein_id gnl|my_center|LOCUS_20650 >Feature sequence182 1795 581 gene locus_tag LOCUS_20660 1795 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 2725 1949 gene locus_tag LOCUS_20670 2725 1949 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817405.1 protein_id gnl|my_center|LOCUS_20670 3801 2725 gene locus_tag LOCUS_20680 3801 2725 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817406.1 protein_id gnl|my_center|LOCUS_20680 >Feature sequence183 1356 1111 gene locus_tag LOCUS_20690 1356 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 2516 1377 gene locus_tag LOCUS_20700 2516 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 >Feature sequence184 <1 2879 gene locus_tag LOCUS_20710 <1 2879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986028.1:isoleucine--tRNA ligase >Feature sequence185 824 210 gene locus_tag LOCUS_20720 824 210 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052445.1 protein_id gnl|my_center|LOCUS_20720 1106 2059 gene locus_tag LOCUS_20730 1106 2059 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278249.1 protein_id gnl|my_center|LOCUS_20730 3489 2158 gene locus_tag LOCUS_20740 3489 2158 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386645.1 protein_id gnl|my_center|LOCUS_20740 <4352 3551 gene locus_tag LOCUS_20750 <4352 3551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267047.1:voltage-gated chloride channel family protein >Feature sequence186 611 1585 gene locus_tag LOCUS_20760 611 1585 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682287.1 protein_id gnl|my_center|LOCUS_20760 1614 1754 gene locus_tag LOCUS_20770 1614 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 1929 2630 gene locus_tag LOCUS_20780 gene pyrH 1929 2630 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_20780 2646 3200 gene locus_tag LOCUS_20790 gene frr 2646 3200 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965096.1 protein_id gnl|my_center|LOCUS_20790 3344 4066 gene locus_tag LOCUS_20800 3344 4066 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328197.1 protein_id gnl|my_center|LOCUS_20800 >Feature sequence187 1304 573 gene locus_tag LOCUS_20810 1304 573 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948252.1 protein_id gnl|my_center|LOCUS_20810 1627 2547 gene locus_tag LOCUS_20820 gene trxB 1627 2547 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_20820 2562 4037 gene locus_tag LOCUS_20830 2562 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 >Feature sequence188 369 869 gene locus_tag LOCUS_20840 gene ilvN 369 869 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210448.1 protein_id gnl|my_center|LOCUS_20840 976 1986 gene locus_tag LOCUS_20850 gene ilvC 976 1986 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081338.1 protein_id gnl|my_center|LOCUS_20850 3044 2130 gene locus_tag LOCUS_20860 3044 2130 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948557.1 protein_id gnl|my_center|LOCUS_20860 >Feature sequence189 <1 1852 gene locus_tag LOCUS_20870 <1 1852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003244423.1:ABC-F family ATP-binding cassette domain-containing protein 1927 4002 gene locus_tag LOCUS_20880 1927 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 >Feature sequence190 669 1616 gene locus_tag LOCUS_20890 669 1616 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929426.1 protein_id gnl|my_center|LOCUS_20890 1613 2551 gene locus_tag LOCUS_20900 1613 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 2632 3165 gene locus_tag LOCUS_20910 2632 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 3178 3807 gene locus_tag LOCUS_20920 3178 3807 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081572.1 protein_id gnl|my_center|LOCUS_20920 >Feature sequence191 1981 1280 gene locus_tag LOCUS_20930 1981 1280 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704149.1 protein_id gnl|my_center|LOCUS_20930 2694 1984 gene locus_tag LOCUS_20940 2694 1984 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476103.1 protein_id gnl|my_center|LOCUS_20940 3441 2701 gene locus_tag LOCUS_20950 gene cps4B 3441 2701 CDS product capsular polysaccharide biosynthesis protein Cps4B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837624.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence192 353 1933 gene locus_tag LOCUS_20960 353 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 1959 3002 gene locus_tag LOCUS_20970 1959 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 >Feature sequence193 <1 610 gene locus_tag LOCUS_20980 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002296412.1:alpha-galactosidase 615 2486 gene locus_tag LOCUS_20990 615 2486 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258398.1 protein_id gnl|my_center|LOCUS_20990 >Feature sequence194 332 1639 gene locus_tag LOCUS_21000 gene citH 332 1639 CDS product citrate transporter CitH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227205.1 protein_id gnl|my_center|LOCUS_21000 1808 3643 gene locus_tag LOCUS_21010 1808 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 >Feature sequence195 <1 670 gene locus_tag LOCUS_21020 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011987043.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase 1194 2759 gene locus_tag LOCUS_21030 1194 2759 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_21030 >Feature sequence196 400 110 gene locus_tag LOCUS_21040 400 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 929 1381 gene locus_tag LOCUS_21050 929 1381 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416968.1 protein_id gnl|my_center|LOCUS_21050 1803 3308 gene locus_tag LOCUS_21060 1803 3308 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016113.1 protein_id gnl|my_center|LOCUS_21060 >Feature sequence197 2671 989 gene locus_tag LOCUS_21070 2671 989 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_21070 >Feature sequence198 2932 1592 gene locus_tag LOCUS_21080 2932 1592 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986630.1 protein_id gnl|my_center|LOCUS_21080 >Feature sequence199 1021 146 gene locus_tag LOCUS_21090 gene lgt 1021 146 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812530.1 protein_id gnl|my_center|LOCUS_21090 2468 1140 gene locus_tag LOCUS_21100 2468 1140 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015963.1 protein_id gnl|my_center|LOCUS_21100 >Feature sequence200 401 1222 gene locus_tag LOCUS_21110 401 1222 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227109.1 protein_id gnl|my_center|LOCUS_21110 1238 1903 gene locus_tag LOCUS_21120 1238 1903 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481192.1 protein_id gnl|my_center|LOCUS_21120 1914 3110 gene locus_tag LOCUS_21130 1914 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 >Feature sequence201 2267 900 gene locus_tag LOCUS_21140 gene trkA 2267 900 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_21140 2597 3112 gene locus_tag LOCUS_21150 2597 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 3112 3402 gene locus_tag LOCUS_21160 3112 3402 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392904.1 protein_id gnl|my_center|LOCUS_21160 >Feature sequence202 1580 171 gene locus_tag LOCUS_21170 gene rocR 1580 171 CDS product arginine utilization transcriptional regulator RocR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110073.1 protein_id gnl|my_center|LOCUS_21170 >Feature sequence203 385 1185 gene locus_tag LOCUS_21180 385 1185 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963937.1 protein_id gnl|my_center|LOCUS_21180 >Feature sequence204 1707 655 gene locus_tag LOCUS_21190 1707 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 2905 1691 gene locus_tag LOCUS_21200 2905 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 >Feature sequence205 1636 605 gene locus_tag LOCUS_21210 1636 605 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242341.1 protein_id gnl|my_center|LOCUS_21210 2775 1744 gene locus_tag LOCUS_21220 2775 1744 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573417.1 protein_id gnl|my_center|LOCUS_21220 <3370 2789 gene locus_tag LOCUS_21230 <3370 2789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393517.1:xylose ABC transporter ATP-binding protein >Feature sequence206 2413 479 gene locus_tag LOCUS_21240 2413 479 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943766.1 protein_id gnl|my_center|LOCUS_21240 >Feature sequence207 441 115 gene locus_tag LOCUS_21250 441 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 913 2574 gene locus_tag LOCUS_21260 913 2574 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_21260 3022 3180 gene locus_tag LOCUS_21270 3022 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 >Feature sequence208 1159 683 gene locus_tag LOCUS_21280 1159 683 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810020.1 protein_id gnl|my_center|LOCUS_21280 2203 1178 gene locus_tag LOCUS_21290 2203 1178 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039499.1 protein_id gnl|my_center|LOCUS_21290 <3158 2257 gene locus_tag LOCUS_21300 <3158 2257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061266.1:phosphoglycerate dehydrogenase >Feature sequence209 213 995 gene locus_tag LOCUS_21310 213 995 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965614.1 protein_id gnl|my_center|LOCUS_21310 2132 2992 gene locus_tag LOCUS_21320 2132 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 >Feature sequence210 <1 1193 gene locus_tag LOCUS_21330 <1 1193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867411.1:Na+/H+ antiporter NhaC family protein 2598 1450 gene locus_tag LOCUS_21340 2598 1450 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811901.1 protein_id gnl|my_center|LOCUS_21340 2933 2697 gene locus_tag LOCUS_21350 2933 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 >Feature sequence211 471 1247 gene locus_tag LOCUS_21360 gene sigG 471 1247 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_21360 2086 1346 gene locus_tag LOCUS_21370 gene sigE 2086 1346 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774280.1 protein_id gnl|my_center|LOCUS_21370 3059 2076 gene locus_tag LOCUS_21380 3059 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 >Feature sequence212 93 569 gene locus_tag LOCUS_21390 93 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 582 989 gene locus_tag LOCUS_21400 582 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 1496 1119 gene locus_tag LOCUS_21410 1496 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 >Feature sequence213 363 289 gene locus_tag LOCUS_t00420 363 289 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 912 487 gene locus_tag LOCUS_21420 912 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 1261 1064 gene locus_tag LOCUS_21430 1261 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 1846 1616 gene locus_tag LOCUS_21440 1846 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 2161 1856 gene locus_tag LOCUS_21450 2161 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 2370 2179 gene locus_tag LOCUS_21460 2370 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 >Feature sequence214 954 583 gene locus_tag LOCUS_21470 954 583 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399582.1 protein_id gnl|my_center|LOCUS_21470 2224 959 gene locus_tag LOCUS_21480 2224 959 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948740.1 protein_id gnl|my_center|LOCUS_21480 2378 2238 gene locus_tag LOCUS_21490 2378 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21490 >Feature sequence215 1279 755 gene locus_tag LOCUS_21500 1279 755 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877737.1 protein_id gnl|my_center|LOCUS_21500 2185 1325 gene locus_tag LOCUS_21510 2185 1325 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860835.1 protein_id gnl|my_center|LOCUS_21510 2561 2163 gene locus_tag LOCUS_21520 2561 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21520 >Feature sequence216 431 1462 gene locus_tag LOCUS_21530 gene prfB 431 1462 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181244843.1 protein_id gnl|my_center|LOCUS_21530 1639 2082 gene locus_tag LOCUS_21540 1639 2082 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964547.1 protein_id gnl|my_center|LOCUS_21540 >Feature sequence217 126 54 gene locus_tag LOCUS_t00430 126 54 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1137 289 gene locus_tag LOCUS_21550 1137 289 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687382.1 protein_id gnl|my_center|LOCUS_21550 2323 1223 gene locus_tag LOCUS_21560 gene phnW 2323 1223 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032507026.1 protein_id gnl|my_center|LOCUS_21560 >Feature sequence218 <1 1319 gene locus_tag LOCUS_21570 <1 1319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003242814.1:proline transporter OpuE 1288 2679 gene locus_tag LOCUS_21580 1288 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 >Feature sequence219 886 2214 gene locus_tag LOCUS_21590 886 2214 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016800.1 protein_id gnl|my_center|LOCUS_21590 >Feature sequence220 347 556 gene locus_tag LOCUS_21600 347 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 739 1266 gene locus_tag LOCUS_21610 739 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 >Feature sequence221 1928 819 gene locus_tag LOCUS_21620 gene glf 1928 819 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986979.1 protein_id gnl|my_center|LOCUS_21620 >Feature sequence222 25 1077 gene locus_tag LOCUS_21630 25 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 >Feature sequence223 <1 603 gene locus_tag LOCUS_21640 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965059.1:signal recognition particle-docking protein FtsY 769 2019 gene locus_tag LOCUS_21650 gene ilvA 769 2019 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017132.1 protein_id gnl|my_center|LOCUS_21650