>Feature sequence001 1566 3449 gene locus_tag LOCUS_00010 1566 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 3536 3799 gene locus_tag LOCUS_00020 3536 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419670.1 protein_id gnl|my_center|LOCUS_00020 3800 4606 gene locus_tag LOCUS_00030 3800 4606 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435466.1 protein_id gnl|my_center|LOCUS_00030 5022 4765 gene locus_tag LOCUS_00040 5022 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5505 5068 gene locus_tag LOCUS_00050 5505 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5677 5973 gene locus_tag LOCUS_00060 5677 5973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6014 6484 gene locus_tag LOCUS_00070 6014 6484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6998 6717 gene locus_tag LOCUS_00080 6998 6717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 7477 7142 gene locus_tag LOCUS_00090 7477 7142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 8290 7478 gene locus_tag LOCUS_00100 8290 7478 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 protein_id gnl|my_center|LOCUS_00100 8758 8576 gene locus_tag LOCUS_00110 8758 8576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9125 8997 gene locus_tag LOCUS_00120 9125 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 9508 9371 gene locus_tag LOCUS_00130 9508 9371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429855.1 protein_id gnl|my_center|LOCUS_00130 10023 12188 gene locus_tag LOCUS_00140 10023 12188 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011572948.1 protein_id gnl|my_center|LOCUS_00140 12200 12436 gene locus_tag LOCUS_00150 12200 12436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 12457 12795 gene locus_tag LOCUS_00160 12457 12795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 13128 13394 gene locus_tag LOCUS_00170 13128 13394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 13797 13429 gene locus_tag LOCUS_00180 13797 13429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 13966 14142 gene locus_tag LOCUS_00190 13966 14142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 14132 14338 gene locus_tag LOCUS_00200 14132 14338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 14371 15243 gene locus_tag LOCUS_00210 14371 15243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 15268 15714 gene locus_tag LOCUS_00220 15268 15714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 15915 16196 gene locus_tag LOCUS_00230 15915 16196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 16578 16234 gene locus_tag LOCUS_00240 16578 16234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 16667 16840 gene locus_tag LOCUS_00250 16667 16840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 16827 17192 gene locus_tag LOCUS_00260 16827 17192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 17212 17388 gene locus_tag LOCUS_00270 17212 17388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 17381 17596 gene locus_tag LOCUS_00280 17381 17596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 17655 17828 gene locus_tag LOCUS_00290 17655 17828 CDS product DUF3797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861005.1 protein_id gnl|my_center|LOCUS_00290 17843 18247 gene locus_tag LOCUS_00300 gene ssb 17843 18247 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420524.1 protein_id gnl|my_center|LOCUS_00300 18266 18655 gene locus_tag LOCUS_00310 18266 18655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 18667 19029 gene locus_tag LOCUS_00320 18667 19029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 19016 19186 gene locus_tag LOCUS_00330 19016 19186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 19198 19770 gene locus_tag LOCUS_00340 19198 19770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 19948 20556 gene locus_tag LOCUS_00350 19948 20556 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012145.1 protein_id gnl|my_center|LOCUS_00350 21021 21590 gene locus_tag LOCUS_00360 21021 21590 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426023.1 protein_id gnl|my_center|LOCUS_00360 21619 22326 gene locus_tag LOCUS_00370 21619 22326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 22313 23635 gene locus_tag LOCUS_00380 22313 23635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 23636 25048 gene locus_tag LOCUS_00390 23636 25048 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989955.1 protein_id gnl|my_center|LOCUS_00390 25049 26272 gene locus_tag LOCUS_00400 25049 26272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 26274 26600 gene locus_tag LOCUS_00410 26274 26600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 26617 26898 gene locus_tag LOCUS_00420 26617 26898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877351.1 protein_id gnl|my_center|LOCUS_00420 27030 27602 gene locus_tag LOCUS_00430 27030 27602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 27613 28686 gene locus_tag LOCUS_00440 27613 28686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 28690 29022 gene locus_tag LOCUS_00450 28690 29022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 29024 29458 gene locus_tag LOCUS_00460 29024 29458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 29465 29812 gene locus_tag LOCUS_00470 29465 29812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 29809 30240 gene locus_tag LOCUS_00480 29809 30240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 30243 31043 gene locus_tag LOCUS_00490 30243 31043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 31101 31463 gene locus_tag LOCUS_00500 31101 31463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 31463 32071 gene locus_tag LOCUS_00510 31463 32071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 32143 32784 gene locus_tag LOCUS_00520 32143 32784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 32890 38193 gene locus_tag LOCUS_00530 32890 38193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 38316 39050 gene locus_tag LOCUS_00540 38316 39050 CDS product phage tail family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922089.1 protein_id gnl|my_center|LOCUS_00540 39180 41180 gene locus_tag LOCUS_00550 39180 41180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 41205 41447 gene locus_tag LOCUS_00560 41205 41447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 >Feature sequence002 389 39 gene locus_tag LOCUS_00570 389 39 CDS product DUF6483 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437137.1 protein_id gnl|my_center|LOCUS_00570 803 612 gene locus_tag LOCUS_00580 803 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418667.1 protein_id gnl|my_center|LOCUS_00580 1847 921 gene locus_tag LOCUS_00590 1847 921 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860980.1 protein_id gnl|my_center|LOCUS_00590 3477 1981 gene locus_tag LOCUS_00600 3477 1981 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895925.1 protein_id gnl|my_center|LOCUS_00600 5247 3757 gene locus_tag LOCUS_00610 5247 3757 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888725.1 protein_id gnl|my_center|LOCUS_00610 5714 5914 gene locus_tag LOCUS_00620 5714 5914 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418660.1 protein_id gnl|my_center|LOCUS_00620 6972 6094 gene locus_tag LOCUS_00630 gene speB 6972 6094 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888724.1 protein_id gnl|my_center|LOCUS_00630 7813 6962 gene locus_tag LOCUS_00640 gene speE 7813 6962 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888722.1 protein_id gnl|my_center|LOCUS_00640 8256 7843 gene locus_tag LOCUS_00650 gene speD 8256 7843 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418655.1 protein_id gnl|my_center|LOCUS_00650 9818 8343 gene locus_tag LOCUS_00660 9818 8343 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860979.1 protein_id gnl|my_center|LOCUS_00660 11109 10456 gene locus_tag LOCUS_00670 11109 10456 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860978.1 protein_id gnl|my_center|LOCUS_00670 13219 11354 gene locus_tag LOCUS_00680 13219 11354 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437164.1 protein_id gnl|my_center|LOCUS_00680 15644 13224 gene locus_tag LOCUS_00690 15644 13224 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081712308.1 protein_id gnl|my_center|LOCUS_00690 17100 15658 gene locus_tag LOCUS_00700 gene glgA 17100 15658 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860977.1 protein_id gnl|my_center|LOCUS_00700 18259 17129 gene locus_tag LOCUS_00710 gene glgD 18259 17129 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418641.1 protein_id gnl|my_center|LOCUS_00710 19421 18261 gene locus_tag LOCUS_00720 19421 18261 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418638.1 protein_id gnl|my_center|LOCUS_00720 21235 20192 gene locus_tag LOCUS_00730 21235 20192 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437173.1 protein_id gnl|my_center|LOCUS_00730 21702 21256 gene locus_tag LOCUS_00740 21702 21256 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437174.1 protein_id gnl|my_center|LOCUS_00740 23456 21876 gene locus_tag LOCUS_00750 23456 21876 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892822.1 protein_id gnl|my_center|LOCUS_00750 24255 25157 gene locus_tag LOCUS_00760 24255 25157 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902204.1 protein_id gnl|my_center|LOCUS_00760 25144 25899 gene locus_tag LOCUS_00770 25144 25899 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437183.1 protein_id gnl|my_center|LOCUS_00770 26030 27052 gene locus_tag LOCUS_00780 26030 27052 CDS product CD0873 family tyrosine ABC transporter substrate-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860976.1 protein_id gnl|my_center|LOCUS_00780 27773 27216 gene locus_tag LOCUS_00790 27773 27216 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888695.1 protein_id gnl|my_center|LOCUS_00790 28855 27779 gene locus_tag LOCUS_00800 28855 27779 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888694.1 protein_id gnl|my_center|LOCUS_00800 29539 28856 gene locus_tag LOCUS_00810 gene modB 29539 28856 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888685.1 protein_id gnl|my_center|LOCUS_00810 30488 29688 gene locus_tag LOCUS_00820 gene modA 30488 29688 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860975.1 protein_id gnl|my_center|LOCUS_00820 30681 31610 gene locus_tag LOCUS_00830 30681 31610 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454197.1 protein_id gnl|my_center|LOCUS_00830 32220 31771 gene locus_tag LOCUS_00840 32220 31771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860974.1 protein_id gnl|my_center|LOCUS_00840 33403 32423 gene locus_tag LOCUS_00850 33403 32423 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454199.1 protein_id gnl|my_center|LOCUS_00850 34462 33608 gene locus_tag LOCUS_00860 34462 33608 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860973.1 protein_id gnl|my_center|LOCUS_00860 36113 34785 gene locus_tag LOCUS_00870 36113 34785 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454201.1 protein_id gnl|my_center|LOCUS_00870 36590 36261 gene locus_tag LOCUS_00880 36590 36261 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895893.1 protein_id gnl|my_center|LOCUS_00880 37903 36614 gene locus_tag LOCUS_00890 37903 36614 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892810.1 protein_id gnl|my_center|LOCUS_00890 38245 37919 gene locus_tag LOCUS_00900 38245 37919 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453591.1 protein_id gnl|my_center|LOCUS_00900 39009 38380 gene locus_tag LOCUS_00910 39009 38380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453592.1 protein_id gnl|my_center|LOCUS_00910 41881 39224 gene locus_tag LOCUS_00920 41881 39224 CDS product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286607.1 protein_id gnl|my_center|LOCUS_00920 >Feature sequence003 <1 1348 gene locus_tag LOCUS_00930 <1 1348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009902485.1:sigma 54-interacting transcriptional regulator 1548 2132 gene locus_tag LOCUS_00940 1548 2132 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419819.1 protein_id gnl|my_center|LOCUS_00940 3015 2236 gene locus_tag LOCUS_00950 3015 2236 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438534.1 protein_id gnl|my_center|LOCUS_00950 4329 3073 gene locus_tag LOCUS_00960 4329 3073 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438532.1 protein_id gnl|my_center|LOCUS_00960 4587 5486 gene locus_tag LOCUS_00970 4587 5486 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429344.1 protein_id gnl|my_center|LOCUS_00970 5510 6958 gene locus_tag LOCUS_00980 gene ddlR 5510 6958 CDS product transcriptional regulator DdlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902483.1 protein_id gnl|my_center|LOCUS_00980 7041 7823 gene locus_tag LOCUS_00990 7041 7823 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896313.1 protein_id gnl|my_center|LOCUS_00990 7780 9768 gene locus_tag LOCUS_01000 7780 9768 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861202.1 protein_id gnl|my_center|LOCUS_01000 10357 10010 gene locus_tag LOCUS_01010 10357 10010 CDS product PqqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889198.1 protein_id gnl|my_center|LOCUS_01010 12272 10344 gene locus_tag LOCUS_01020 12272 10344 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861201.1 protein_id gnl|my_center|LOCUS_01020 14872 12683 gene locus_tag LOCUS_01030 14872 12683 CDS product amino acid adenylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861200.1 protein_id gnl|my_center|LOCUS_01030 15203 15934 gene locus_tag LOCUS_01040 15203 15934 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861199.1 protein_id gnl|my_center|LOCUS_01040 16014 16649 gene locus_tag LOCUS_01050 16014 16649 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861198.1 protein_id gnl|my_center|LOCUS_01050 17493 16900 gene locus_tag LOCUS_01060 17493 16900 CDS product DUF3867 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419758.1 protein_id gnl|my_center|LOCUS_01060 18427 17564 gene locus_tag LOCUS_01070 18427 17564 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896305.1 protein_id gnl|my_center|LOCUS_01070 18590 19759 gene locus_tag LOCUS_01080 18590 19759 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373411.1 protein_id gnl|my_center|LOCUS_01080 19860 20336 gene locus_tag LOCUS_01090 19860 20336 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438486.1 protein_id gnl|my_center|LOCUS_01090 20574 20738 gene locus_tag LOCUS_01100 20574 20738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 20902 21696 gene locus_tag LOCUS_01110 20902 21696 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889182.1 protein_id gnl|my_center|LOCUS_01110 22042 21689 gene locus_tag LOCUS_01120 22042 21689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 23538 22252 gene locus_tag LOCUS_01130 23538 22252 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861196.1 protein_id gnl|my_center|LOCUS_01130 24646 23756 gene locus_tag LOCUS_01140 24646 23756 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861195.1 protein_id gnl|my_center|LOCUS_01140 24938 25282 gene locus_tag LOCUS_01150 24938 25282 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428131.1 protein_id gnl|my_center|LOCUS_01150 27537 25441 gene locus_tag LOCUS_01160 27537 25441 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373408.1 protein_id gnl|my_center|LOCUS_01160 28710 27550 gene locus_tag LOCUS_01170 28710 27550 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861193.1 protein_id gnl|my_center|LOCUS_01170 29796 28729 gene locus_tag LOCUS_01180 29796 28729 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438474.1 protein_id gnl|my_center|LOCUS_01180 30148 30714 gene locus_tag LOCUS_01190 30148 30714 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393500.1 protein_id gnl|my_center|LOCUS_01190 31919 30933 gene locus_tag LOCUS_01200 31919 30933 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896290.1 protein_id gnl|my_center|LOCUS_01200 32644 31949 gene locus_tag LOCUS_01210 gene pxpB 32644 31949 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889166.1 protein_id gnl|my_center|LOCUS_01210 33884 32664 gene locus_tag LOCUS_01220 33884 32664 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419704.1 protein_id gnl|my_center|LOCUS_01220 34704 33913 gene locus_tag LOCUS_01230 34704 33913 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896287.1 protein_id gnl|my_center|LOCUS_01230 35292 35921 gene locus_tag LOCUS_01240 35292 35921 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438469.1 protein_id gnl|my_center|LOCUS_01240 37549 36035 gene locus_tag LOCUS_01250 gene glpK 37549 36035 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861192.1 protein_id gnl|my_center|LOCUS_01250 37793 38335 gene locus_tag LOCUS_01260 37793 38335 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861191.1 protein_id gnl|my_center|LOCUS_01260 >Feature sequence004 2442 1084 gene locus_tag LOCUS_01270 gene rlmD 2442 1084 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861959.1 protein_id gnl|my_center|LOCUS_01270 4377 2617 gene locus_tag LOCUS_01280 gene pyk 4377 2617 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_01280 5388 4429 gene locus_tag LOCUS_01290 gene pfkA 5388 4429 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429132.1 protein_id gnl|my_center|LOCUS_01290 9166 5597 gene locus_tag LOCUS_01300 9166 5597 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_01300 10270 9323 gene locus_tag LOCUS_01310 gene whiA 10270 9323 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436252.1 protein_id gnl|my_center|LOCUS_01310 10712 10287 gene locus_tag LOCUS_01320 10712 10287 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416968.1 protein_id gnl|my_center|LOCUS_01320 11887 10781 gene locus_tag LOCUS_01330 11887 10781 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891913.1 protein_id gnl|my_center|LOCUS_01330 12756 11899 gene locus_tag LOCUS_01340 gene rapZ 12756 11899 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416961.1 protein_id gnl|my_center|LOCUS_01340 13500 12787 gene locus_tag LOCUS_01350 13500 12787 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436256.1 protein_id gnl|my_center|LOCUS_01350 14418 13504 gene locus_tag LOCUS_01360 gene murB 14418 13504 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_01360 15461 14691 gene locus_tag LOCUS_01370 15461 14691 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429111.1 protein_id gnl|my_center|LOCUS_01370 15779 17260 gene locus_tag LOCUS_01380 gene cls 15779 17260 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429110.1 protein_id gnl|my_center|LOCUS_01380 17578 18075 gene locus_tag LOCUS_01390 17578 18075 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416946.1 protein_id gnl|my_center|LOCUS_01390 18092 19978 gene locus_tag LOCUS_01400 18092 19978 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416938.1 protein_id gnl|my_center|LOCUS_01400 20001 21782 gene locus_tag LOCUS_01410 20001 21782 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429109.1 protein_id gnl|my_center|LOCUS_01410 23718 21922 gene locus_tag LOCUS_01420 23718 21922 CDS product mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861961.1 protein_id gnl|my_center|LOCUS_01420 24861 23932 gene locus_tag LOCUS_01430 gene hprK 24861 23932 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_01430 26678 24861 gene locus_tag LOCUS_01440 gene uvrC 26678 24861 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436264.1 protein_id gnl|my_center|LOCUS_01440 29762 26937 gene locus_tag LOCUS_01450 gene uvrA 29762 26937 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436266.1 protein_id gnl|my_center|LOCUS_01450 31751 29781 gene locus_tag LOCUS_01460 gene uvrB 31751 29781 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891935.1 protein_id gnl|my_center|LOCUS_01460 33199 31937 gene locus_tag LOCUS_01470 33199 31937 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861962.1 protein_id gnl|my_center|LOCUS_01470 34566 33262 gene locus_tag LOCUS_01480 34566 33262 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898649.1 protein_id gnl|my_center|LOCUS_01480 35457 34597 gene locus_tag LOCUS_01490 35457 34597 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898651.1 protein_id gnl|my_center|LOCUS_01490 36370 35501 gene locus_tag LOCUS_01500 36370 35501 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416903.1 protein_id gnl|my_center|LOCUS_01500 37424 36354 gene locus_tag LOCUS_01510 37424 36354 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436292.1 protein_id gnl|my_center|LOCUS_01510 >Feature sequence005 732 7 gene locus_tag LOCUS_01520 732 7 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435810.1 protein_id gnl|my_center|LOCUS_01520 1177 722 gene locus_tag LOCUS_01530 1177 722 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422312.1 protein_id gnl|my_center|LOCUS_01530 2640 1459 gene locus_tag LOCUS_01540 2640 1459 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022618638.1 protein_id gnl|my_center|LOCUS_01540 3322 2630 gene locus_tag LOCUS_01550 3322 2630 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435805.1 protein_id gnl|my_center|LOCUS_01550 4172 3456 gene locus_tag LOCUS_01560 4172 3456 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435804.1 protein_id gnl|my_center|LOCUS_01560 4297 5031 gene locus_tag LOCUS_01570 4297 5031 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_01570 6147 5296 gene locus_tag LOCUS_01580 6147 5296 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898793.1 protein_id gnl|my_center|LOCUS_01580 7111 6173 gene locus_tag LOCUS_01590 7111 6173 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429183.1 protein_id gnl|my_center|LOCUS_01590 7864 7214 gene locus_tag LOCUS_01600 7864 7214 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435799.1 protein_id gnl|my_center|LOCUS_01600 8201 8013 gene locus_tag LOCUS_01610 8201 8013 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422320.1 protein_id gnl|my_center|LOCUS_01610 9492 8308 gene locus_tag LOCUS_01620 9492 8308 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894081.1 protein_id gnl|my_center|LOCUS_01620 10551 9634 gene locus_tag LOCUS_01630 10551 9634 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435793.1 protein_id gnl|my_center|LOCUS_01630 11301 10573 gene locus_tag LOCUS_01640 11301 10573 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429190.1 protein_id gnl|my_center|LOCUS_01640 11697 11497 gene locus_tag LOCUS_01650 11697 11497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420681.1 protein_id gnl|my_center|LOCUS_01650 12202 11822 gene locus_tag LOCUS_01660 12202 11822 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892190.1 protein_id gnl|my_center|LOCUS_01660 13833 12475 gene locus_tag LOCUS_01670 13833 12475 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224723.1 protein_id gnl|my_center|LOCUS_01670 14281 14733 gene locus_tag LOCUS_01680 14281 14733 CDS product staygreen family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892191.1 protein_id gnl|my_center|LOCUS_01680 15507 14890 gene locus_tag LOCUS_01690 15507 14890 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903837.1 protein_id gnl|my_center|LOCUS_01690 16742 15930 gene locus_tag LOCUS_01700 16742 15930 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435784.1 protein_id gnl|my_center|LOCUS_01700 18236 16818 gene locus_tag LOCUS_01710 18236 16818 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435782.1 protein_id gnl|my_center|LOCUS_01710 19628 18720 gene locus_tag LOCUS_01720 19628 18720 CDS product DUF2268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862008.1 protein_id gnl|my_center|LOCUS_01720 19899 20276 gene locus_tag LOCUS_01730 19899 20276 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435779.1 protein_id gnl|my_center|LOCUS_01730 20881 20432 gene locus_tag LOCUS_01740 20881 20432 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862010.1 protein_id gnl|my_center|LOCUS_01740 21452 21048 gene locus_tag LOCUS_01750 21452 21048 CDS product YmaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429200.1 protein_id gnl|my_center|LOCUS_01750 22431 21565 gene locus_tag LOCUS_01760 22431 21565 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862012.1 protein_id gnl|my_center|LOCUS_01760 23345 23001 gene locus_tag LOCUS_01770 23345 23001 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435770.1 protein_id gnl|my_center|LOCUS_01770 24151 23534 gene locus_tag LOCUS_01780 24151 23534 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435768.1 protein_id gnl|my_center|LOCUS_01780 26318 24156 gene locus_tag LOCUS_01790 26318 24156 CDS product DUF1430 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862013.1 protein_id gnl|my_center|LOCUS_01790 28714 26660 gene locus_tag LOCUS_01800 28714 26660 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862014.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01800 29167 28730 gene locus_tag LOCUS_01810 29167 28730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01810 30277 29645 gene locus_tag LOCUS_01820 30277 29645 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862015.1 protein_id gnl|my_center|LOCUS_01820 31288 30383 gene locus_tag LOCUS_01830 gene dapA 31288 30383 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435760.1 protein_id gnl|my_center|LOCUS_01830 31892 31293 gene locus_tag LOCUS_01840 31892 31293 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373863.1 protein_id gnl|my_center|LOCUS_01840 33221 31950 gene locus_tag LOCUS_01850 33221 31950 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435758.1 protein_id gnl|my_center|LOCUS_01850 33535 33248 gene locus_tag LOCUS_01860 33535 33248 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435756.1 protein_id gnl|my_center|LOCUS_01860 35637 33550 gene locus_tag LOCUS_01870 35637 33550 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862017.1 protein_id gnl|my_center|LOCUS_01870 >Feature sequence006 1021 248 gene locus_tag LOCUS_01880 1021 248 CDS product SigB/SigF/SigG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420464.1 protein_id gnl|my_center|LOCUS_01880 1428 1021 gene locus_tag LOCUS_01890 1428 1021 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892343.1 protein_id gnl|my_center|LOCUS_01890 1749 1432 gene locus_tag LOCUS_01900 1749 1432 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429306.1 protein_id gnl|my_center|LOCUS_01900 2021 1761 gene locus_tag LOCUS_01910 2021 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420469.1 protein_id gnl|my_center|LOCUS_01910 2317 2021 gene locus_tag LOCUS_01920 2317 2021 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420471.1 protein_id gnl|my_center|LOCUS_01920 4812 2386 gene locus_tag LOCUS_01930 gene gyrA 4812 2386 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_01930 6733 4832 gene locus_tag LOCUS_01940 gene gyrB 6733 4832 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434229.1 protein_id gnl|my_center|LOCUS_01940 7849 6734 gene locus_tag LOCUS_01950 gene recF 7849 6734 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429303.1 protein_id gnl|my_center|LOCUS_01950 8073 7867 gene locus_tag LOCUS_01960 gene yaaA 8073 7867 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420479.1 protein_id gnl|my_center|LOCUS_01960 9316 8210 gene locus_tag LOCUS_01970 gene dnaN 9316 8210 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420481.1 protein_id gnl|my_center|LOCUS_01970 10877 9558 gene locus_tag LOCUS_01980 gene dnaA 10877 9558 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420483.1 protein_id gnl|my_center|LOCUS_01980 11536 11673 gene locus_tag LOCUS_01990 gene rpmH 11536 11673 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420485.1 protein_id gnl|my_center|LOCUS_01990 11751 12095 gene locus_tag LOCUS_02000 gene rnpA 11751 12095 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429302.1 protein_id gnl|my_center|LOCUS_02000 12127 12378 gene locus_tag LOCUS_02010 gene yidD 12127 12378 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434233.1 protein_id gnl|my_center|LOCUS_02010 12410 13117 gene locus_tag LOCUS_02020 12410 13117 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429300.1 protein_id gnl|my_center|LOCUS_02020 13086 13715 gene locus_tag LOCUS_02030 13086 13715 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434235.1 protein_id gnl|my_center|LOCUS_02030 13827 15206 gene locus_tag LOCUS_02040 gene mnmE 13827 15206 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898860.1 protein_id gnl|my_center|LOCUS_02040 15301 17196 gene locus_tag LOCUS_02050 gene mnmG 15301 17196 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898858.1 protein_id gnl|my_center|LOCUS_02050 17189 17908 gene locus_tag LOCUS_02060 gene rsmG 17189 17908 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966992.1 protein_id gnl|my_center|LOCUS_02060 18071 18856 gene locus_tag LOCUS_02070 gene noc 18071 18856 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429292.1 protein_id gnl|my_center|LOCUS_02070 18991 19764 gene locus_tag LOCUS_02080 18991 19764 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898851.1 protein_id gnl|my_center|LOCUS_02080 19766 20629 gene locus_tag LOCUS_02090 19766 20629 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429290.1 protein_id gnl|my_center|LOCUS_02090 20662 21804 gene locus_tag LOCUS_02100 20662 21804 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434244.1 protein_id gnl|my_center|LOCUS_02100 22513 21938 gene locus_tag LOCUS_02110 22513 21938 CDS product GerMN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898849.1 protein_id gnl|my_center|LOCUS_02110 22773 24065 gene locus_tag LOCUS_02120 gene rstA 22773 24065 CDS product toxin production/motility transcriptional repressor RstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894114.1 protein_id gnl|my_center|LOCUS_02120 24170 24772 gene locus_tag LOCUS_02130 gene yedF 24170 24772 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892314.1 protein_id gnl|my_center|LOCUS_02130 24845 25108 gene locus_tag LOCUS_02140 24845 25108 CDS product DUF3343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434250.1 protein_id gnl|my_center|LOCUS_02140 25123 25308 gene locus_tag LOCUS_02150 25123 25308 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420516.1 protein_id gnl|my_center|LOCUS_02150 25411 26607 gene locus_tag LOCUS_02160 25411 26607 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429271.1 protein_id gnl|my_center|LOCUS_02160 26820 27098 gene locus_tag LOCUS_02170 gene rpsF 26820 27098 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420522.1 protein_id gnl|my_center|LOCUS_02170 27135 27569 gene locus_tag LOCUS_02180 gene ssb 27135 27569 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420524.1 protein_id gnl|my_center|LOCUS_02180 27588 27815 gene locus_tag LOCUS_02190 gene rpsR 27588 27815 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420527.1 protein_id gnl|my_center|LOCUS_02190 27958 28278 gene locus_tag LOCUS_02200 27958 28278 CDS product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420530.1 protein_id gnl|my_center|LOCUS_02200 28286 29242 gene locus_tag LOCUS_02210 28286 29242 CDS product YybS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434254.1 protein_id gnl|my_center|LOCUS_02210 29253 31247 gene locus_tag LOCUS_02220 29253 31247 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_02220 31248 31697 gene locus_tag LOCUS_02230 gene rplI 31248 31697 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429267.1 protein_id gnl|my_center|LOCUS_02230 31716 33044 gene locus_tag LOCUS_02240 gene dnaB 31716 33044 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_02240 33249 33557 gene locus_tag LOCUS_02250 33249 33557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862026.1 protein_id gnl|my_center|LOCUS_02250 >Feature sequence007 376 101 gene locus_tag LOCUS_02260 376 101 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891186.1 protein_id gnl|my_center|LOCUS_02260 1371 397 gene locus_tag LOCUS_02270 1371 397 CDS product 2-keto-3-deoxygluconate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439631.1 protein_id gnl|my_center|LOCUS_02270 3534 1642 gene locus_tag LOCUS_02280 3534 1642 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861721.1 protein_id gnl|my_center|LOCUS_02280 4946 3732 gene locus_tag LOCUS_02290 4946 3732 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861720.1 protein_id gnl|my_center|LOCUS_02290 5190 6572 gene locus_tag LOCUS_02300 5190 6572 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891177.1 protein_id gnl|my_center|LOCUS_02300 6584 7933 gene locus_tag LOCUS_02310 6584 7933 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898040.1 protein_id gnl|my_center|LOCUS_02310 8083 8616 gene locus_tag LOCUS_02320 8083 8616 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439611.1 protein_id gnl|my_center|LOCUS_02320 8755 9510 gene locus_tag LOCUS_02330 8755 9510 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898037.1 protein_id gnl|my_center|LOCUS_02330 9920 11965 gene locus_tag LOCUS_02340 9920 11965 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861719.1 protein_id gnl|my_center|LOCUS_02340 12226 13425 gene locus_tag LOCUS_02350 12226 13425 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861718.1 protein_id gnl|my_center|LOCUS_02350 13477 14172 gene locus_tag LOCUS_02360 13477 14172 CDS product DUF5058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426729.1 protein_id gnl|my_center|LOCUS_02360 14185 14862 gene locus_tag LOCUS_02370 14185 14862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426728.1 protein_id gnl|my_center|LOCUS_02370 14973 16574 gene locus_tag LOCUS_02380 14973 16574 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861717.1 protein_id gnl|my_center|LOCUS_02380 17022 18311 gene locus_tag LOCUS_02390 17022 18311 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439596.1 protein_id gnl|my_center|LOCUS_02390 18340 19020 gene locus_tag LOCUS_02400 18340 19020 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898027.1 protein_id gnl|my_center|LOCUS_02400 19121 19660 gene locus_tag LOCUS_02410 19121 19660 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898025.1 protein_id gnl|my_center|LOCUS_02410 19836 20855 gene locus_tag LOCUS_02420 19836 20855 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439589.1 protein_id gnl|my_center|LOCUS_02420 21143 22333 gene locus_tag LOCUS_02430 gene dltD 21143 22333 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439587.1 protein_id gnl|my_center|LOCUS_02430 22293 22439 gene locus_tag LOCUS_02440 22293 22439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 22454 23968 gene locus_tag LOCUS_02450 22454 23968 CDS product D-alanine--poly(phosphoribitol) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861716.1 protein_id gnl|my_center|LOCUS_02450 23968 25116 gene locus_tag LOCUS_02460 gene dltB 23968 25116 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426712.1 protein_id gnl|my_center|LOCUS_02460 25135 25365 gene locus_tag LOCUS_02470 gene dltC 25135 25365 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861715.1 protein_id gnl|my_center|LOCUS_02470 25582 26367 gene locus_tag LOCUS_02480 25582 26367 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861714.1 protein_id gnl|my_center|LOCUS_02480 26646 28556 gene locus_tag LOCUS_02490 26646 28556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 28915 29736 gene locus_tag LOCUS_02500 28915 29736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891149.1 protein_id gnl|my_center|LOCUS_02500 29777 30544 gene locus_tag LOCUS_02510 29777 30544 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893737.1 protein_id gnl|my_center|LOCUS_02510 30552 31172 gene locus_tag LOCUS_02520 30552 31172 CDS product YhbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861712.1 protein_id gnl|my_center|LOCUS_02520 32059 31472 gene locus_tag LOCUS_02530 32059 31472 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426696.1 protein_id gnl|my_center|LOCUS_02530 32582 32145 gene locus_tag LOCUS_02540 32582 32145 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436793.1 protein_id gnl|my_center|LOCUS_02540 >Feature sequence008 371 45 gene locus_tag LOCUS_02550 371 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 690 1340 gene locus_tag LOCUS_02560 690 1340 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903848.1 protein_id gnl|my_center|LOCUS_02560 2516 1497 gene locus_tag LOCUS_02570 2516 1497 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426955.1 protein_id gnl|my_center|LOCUS_02570 3161 2547 gene locus_tag LOCUS_02580 gene plsY 3161 2547 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_02580 4521 3196 gene locus_tag LOCUS_02590 gene der 4521 3196 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426959.1 protein_id gnl|my_center|LOCUS_02590 5877 4549 gene locus_tag LOCUS_02600 5877 4549 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903281.1 protein_id gnl|my_center|LOCUS_02600 6315 6115 gene locus_tag LOCUS_02610 6315 6115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454951.1 protein_id gnl|my_center|LOCUS_02610 7249 6317 gene locus_tag LOCUS_02620 7249 6317 CDS product YIEGIA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454952.1 protein_id gnl|my_center|LOCUS_02620 8226 7294 gene locus_tag LOCUS_02630 8226 7294 CDS product YIEGIA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454954.1 protein_id gnl|my_center|LOCUS_02630 9570 8281 gene locus_tag LOCUS_02640 9570 8281 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426968.1 protein_id gnl|my_center|LOCUS_02640 10291 9599 gene locus_tag LOCUS_02650 10291 9599 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416112.1 protein_id gnl|my_center|LOCUS_02650 11064 10306 gene locus_tag LOCUS_02660 gene pgeF 11064 10306 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897820.1 protein_id gnl|my_center|LOCUS_02660 11525 11064 gene locus_tag LOCUS_02670 gene nrdR 11525 11064 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454958.1 protein_id gnl|my_center|LOCUS_02670 11810 11547 gene locus_tag LOCUS_02680 11810 11547 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416105.1 protein_id gnl|my_center|LOCUS_02680 12687 11914 gene locus_tag LOCUS_02690 gene sigG 12687 11914 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416101.1 protein_id gnl|my_center|LOCUS_02690 13501 12779 gene locus_tag LOCUS_02700 gene sigE 13501 12779 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416098.1 protein_id gnl|my_center|LOCUS_02700 14371 13526 gene locus_tag LOCUS_02710 14371 13526 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861622.1 protein_id gnl|my_center|LOCUS_02710 15962 14688 gene locus_tag LOCUS_02720 15962 14688 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454961.1 protein_id gnl|my_center|LOCUS_02720 17403 16246 gene locus_tag LOCUS_02730 gene ftsZ 17403 16246 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890867.1 protein_id gnl|my_center|LOCUS_02730 17946 17593 gene locus_tag LOCUS_02740 17946 17593 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454962.1 protein_id gnl|my_center|LOCUS_02740 18719 18045 gene locus_tag LOCUS_02750 18719 18045 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861623.1 protein_id gnl|my_center|LOCUS_02750 19422 18724 gene locus_tag LOCUS_02760 19422 18724 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454964.1 protein_id gnl|my_center|LOCUS_02760 20185 19445 gene locus_tag LOCUS_02770 20185 19445 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861624.1 protein_id gnl|my_center|LOCUS_02770 21684 20455 gene locus_tag LOCUS_02780 gene murG 21684 20455 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893705.1 protein_id gnl|my_center|LOCUS_02780 22829 21699 gene locus_tag LOCUS_02790 gene spoVE 22829 21699 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426995.1 protein_id gnl|my_center|LOCUS_02790 24236 22881 gene locus_tag LOCUS_02800 gene murD 24236 22881 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_02800 25220 24255 gene locus_tag LOCUS_02810 gene mraY 25220 24255 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427000.1 protein_id gnl|my_center|LOCUS_02810 26637 25264 gene locus_tag LOCUS_02820 26637 25264 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861626.1 protein_id gnl|my_center|LOCUS_02820 28783 26804 gene locus_tag LOCUS_02830 28783 26804 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_02830 29142 28795 gene locus_tag LOCUS_02840 29142 28795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427009.1 protein_id gnl|my_center|LOCUS_02840 30563 29628 gene locus_tag LOCUS_02850 gene rsmH 30563 29628 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861627.1 protein_id gnl|my_center|LOCUS_02850 31339 30593 gene locus_tag LOCUS_02860 gene lgt 31339 30593 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897834.1 protein_id gnl|my_center|LOCUS_02860 >Feature sequence009 307 80 gene locus_tag LOCUS_02870 307 80 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892158.1 protein_id gnl|my_center|LOCUS_02870 510 1079 gene locus_tag LOCUS_02880 510 1079 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426023.1 protein_id gnl|my_center|LOCUS_02880 1639 2793 gene locus_tag LOCUS_02890 1639 2793 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862002.1 protein_id gnl|my_center|LOCUS_02890 2844 4097 gene locus_tag LOCUS_02900 2844 4097 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434922.1 protein_id gnl|my_center|LOCUS_02900 4223 5617 gene locus_tag LOCUS_02910 4223 5617 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898767.1 protein_id gnl|my_center|LOCUS_02910 5632 5862 gene locus_tag LOCUS_02920 5632 5862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862001.1 protein_id gnl|my_center|LOCUS_02920 5879 6409 gene locus_tag LOCUS_02930 5879 6409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903821.1 protein_id gnl|my_center|LOCUS_02930 6585 7295 gene locus_tag LOCUS_02940 6585 7295 CDS product UPF0489 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434933.1 protein_id gnl|my_center|LOCUS_02940 7410 7907 gene locus_tag LOCUS_02950 7410 7907 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434936.1 protein_id gnl|my_center|LOCUS_02950 7917 8078 gene locus_tag LOCUS_02960 7917 8078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426006.1 protein_id gnl|my_center|LOCUS_02960 8188 9126 gene locus_tag LOCUS_02970 8188 9126 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 protein_id gnl|my_center|LOCUS_02970 9210 10070 gene locus_tag LOCUS_02980 gene yabG 9210 10070 CDS product sporulation peptidase YabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422239.1 protein_id gnl|my_center|LOCUS_02980 10218 10484 gene locus_tag LOCUS_02990 10218 10484 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892135.1 protein_id gnl|my_center|LOCUS_02990 10578 12128 gene locus_tag LOCUS_03000 10578 12128 CDS product DUF3794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898760.1 protein_id gnl|my_center|LOCUS_03000 12246 13136 gene locus_tag LOCUS_03010 gene ispE 12246 13136 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894070.1 protein_id gnl|my_center|LOCUS_03010 13120 13800 gene locus_tag LOCUS_03020 13120 13800 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_03020 13945 14604 gene locus_tag LOCUS_03030 gene spoIIR 13945 14604 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425996.1 protein_id gnl|my_center|LOCUS_03030 14655 15140 gene locus_tag LOCUS_03040 14655 15140 CDS product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434944.1 protein_id gnl|my_center|LOCUS_03040 15342 16148 gene locus_tag LOCUS_03050 gene murI 15342 16148 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_03050 16180 16593 gene locus_tag LOCUS_03060 16180 16593 CDS product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892126.1 protein_id gnl|my_center|LOCUS_03060 16776 18164 gene locus_tag LOCUS_03070 gene tilS 16776 18164 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434952.1 protein_id gnl|my_center|LOCUS_03070 18198 20168 gene locus_tag LOCUS_03080 gene ftsH 18198 20168 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373798.1 protein_id gnl|my_center|LOCUS_03080 20483 21460 gene locus_tag LOCUS_03090 20483 21460 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903819.1 protein_id gnl|my_center|LOCUS_03090 21453 22421 gene locus_tag LOCUS_03100 21453 22421 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892121.1 protein_id gnl|my_center|LOCUS_03100 22604 23194 gene locus_tag LOCUS_03110 22604 23194 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892118.1 protein_id gnl|my_center|LOCUS_03110 23213 23983 gene locus_tag LOCUS_03120 23213 23983 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861999.1 protein_id gnl|my_center|LOCUS_03120 24120 25088 gene locus_tag LOCUS_03130 gene dusB 24120 25088 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_03130 25197 25676 gene locus_tag LOCUS_03140 gene greA 25197 25676 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422204.1 protein_id gnl|my_center|LOCUS_03140 25691 27220 gene locus_tag LOCUS_03150 gene lysS 25691 27220 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861998.1 protein_id gnl|my_center|LOCUS_03150 27529 27723 gene locus_tag LOCUS_03160 27529 27723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 >Feature sequence010 370 681 gene locus_tag LOCUS_03170 370 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426769.1 protein_id gnl|my_center|LOCUS_03170 683 2608 gene locus_tag LOCUS_03180 683 2608 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898067.1 protein_id gnl|my_center|LOCUS_03180 2611 3102 gene locus_tag LOCUS_03190 2611 3102 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422657.1 protein_id gnl|my_center|LOCUS_03190 3154 3717 gene locus_tag LOCUS_03200 3154 3717 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422659.1 protein_id gnl|my_center|LOCUS_03200 3732 4709 gene locus_tag LOCUS_03210 3732 4709 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439726.1 protein_id gnl|my_center|LOCUS_03210 4696 5019 gene locus_tag LOCUS_03220 4696 5019 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422665.1 protein_id gnl|my_center|LOCUS_03220 5136 6914 gene locus_tag LOCUS_03230 5136 6914 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426762.1 protein_id gnl|my_center|LOCUS_03230 6911 8284 gene locus_tag LOCUS_03240 6911 8284 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422669.1 protein_id gnl|my_center|LOCUS_03240 8290 8958 gene locus_tag LOCUS_03250 8290 8958 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891221.1 protein_id gnl|my_center|LOCUS_03250 9235 10284 gene locus_tag LOCUS_03260 9235 10284 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861761.1 protein_id gnl|my_center|LOCUS_03260 10380 11369 gene locus_tag LOCUS_03270 10380 11369 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435855.1 protein_id gnl|my_center|LOCUS_03270 11374 13092 gene locus_tag LOCUS_03280 11374 13092 CDS product putative 2-aminoethylphosphonate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861730.1 protein_id gnl|my_center|LOCUS_03280 14328 13174 gene locus_tag LOCUS_03290 14328 13174 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439713.1 protein_id gnl|my_center|LOCUS_03290 14827 16188 gene locus_tag LOCUS_03300 14827 16188 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861729.1 protein_id gnl|my_center|LOCUS_03300 16279 16983 gene locus_tag LOCUS_03310 16279 16983 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426754.1 protein_id gnl|my_center|LOCUS_03310 17183 17494 gene locus_tag LOCUS_03320 17183 17494 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422688.1 protein_id gnl|my_center|LOCUS_03320 17516 18829 gene locus_tag LOCUS_03330 17516 18829 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439696.1 protein_id gnl|my_center|LOCUS_03330 18906 20216 gene locus_tag LOCUS_03340 18906 20216 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861728.1 protein_id gnl|my_center|LOCUS_03340 20242 20973 gene locus_tag LOCUS_03350 gene chbG 20242 20973 CDS product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861727.1 protein_id gnl|my_center|LOCUS_03350 20986 21303 gene locus_tag LOCUS_03360 20986 21303 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422696.1 protein_id gnl|my_center|LOCUS_03360 21879 21415 gene locus_tag LOCUS_03370 21879 21415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861726.1 protein_id gnl|my_center|LOCUS_03370 22149 23087 gene locus_tag LOCUS_03380 22149 23087 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861725.1 protein_id gnl|my_center|LOCUS_03380 23215 24228 gene locus_tag LOCUS_03390 23215 24228 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861724.1 protein_id gnl|my_center|LOCUS_03390 24234 25256 gene locus_tag LOCUS_03400 24234 25256 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439679.1 protein_id gnl|my_center|LOCUS_03400 25271 26053 gene locus_tag LOCUS_03410 25271 26053 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861723.1 protein_id gnl|my_center|LOCUS_03410 26065 27405 gene locus_tag LOCUS_03420 26065 27405 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861722.1 protein_id gnl|my_center|LOCUS_03420 >Feature sequence011 1237 368 gene locus_tag LOCUS_03430 gene rsmA 1237 368 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892086.1 protein_id gnl|my_center|LOCUS_03430 1938 1408 gene locus_tag LOCUS_03440 gene rnmV 1938 1408 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437901.1 protein_id gnl|my_center|LOCUS_03440 3197 2130 gene locus_tag LOCUS_03450 3197 2130 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861989.1 protein_id gnl|my_center|LOCUS_03450 5028 3961 gene locus_tag LOCUS_03460 5028 3961 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892094.1 protein_id gnl|my_center|LOCUS_03460 6320 5040 gene locus_tag LOCUS_03470 6320 5040 CDS product putative 2-aminoethylphosphonate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861992.1 protein_id gnl|my_center|LOCUS_03470 6319 6789 gene locus_tag LOCUS_03480 6319 6789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 7741 6746 gene locus_tag LOCUS_03490 7741 6746 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435855.1 protein_id gnl|my_center|LOCUS_03490 8578 7742 gene locus_tag LOCUS_03500 8578 7742 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435856.1 protein_id gnl|my_center|LOCUS_03500 9751 8582 gene locus_tag LOCUS_03510 9751 8582 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435857.1 protein_id gnl|my_center|LOCUS_03510 10465 9752 gene locus_tag LOCUS_03520 10465 9752 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892101.1 protein_id gnl|my_center|LOCUS_03520 11372 10506 gene locus_tag LOCUS_03530 11372 10506 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435860.1 protein_id gnl|my_center|LOCUS_03530 12234 11365 gene locus_tag LOCUS_03540 12234 11365 CDS product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435861.1 protein_id gnl|my_center|LOCUS_03540 13339 12254 gene locus_tag LOCUS_03550 13339 12254 CDS product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861993.1 protein_id gnl|my_center|LOCUS_03550 13917 13342 gene locus_tag LOCUS_03560 gene phnH 13917 13342 CDS product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861994.1 protein_id gnl|my_center|LOCUS_03560 14363 13932 gene locus_tag LOCUS_03570 gene phnG 14363 13932 CDS product phosphonate C-P lyase system protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892105.1 protein_id gnl|my_center|LOCUS_03570 15471 14701 gene locus_tag LOCUS_03580 15471 14701 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_03580 17438 15501 gene locus_tag LOCUS_03590 gene metG 17438 15501 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861995.1 protein_id gnl|my_center|LOCUS_03590 18355 17834 gene locus_tag LOCUS_03600 18355 17834 CDS product spore maturation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898747.1 protein_id gnl|my_center|LOCUS_03600 18955 18371 gene locus_tag LOCUS_03610 18955 18371 CDS product spore maturation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427659.1 protein_id gnl|my_center|LOCUS_03610 19087 20517 gene locus_tag LOCUS_03620 19087 20517 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427657.1 protein_id gnl|my_center|LOCUS_03620 20554 20982 gene locus_tag LOCUS_03630 20554 20982 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421494.1 protein_id gnl|my_center|LOCUS_03630 21874 21170 gene locus_tag LOCUS_03640 21874 21170 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861996.1 protein_id gnl|my_center|LOCUS_03640 22730 21897 gene locus_tag LOCUS_03650 gene rsmI 22730 21897 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435873.1 protein_id gnl|my_center|LOCUS_03650 23477 22731 gene locus_tag LOCUS_03660 23477 22731 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_03660 24448 23555 gene locus_tag LOCUS_03670 24448 23555 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427637.1 protein_id gnl|my_center|LOCUS_03670 25380 24445 gene locus_tag LOCUS_03680 25380 24445 CDS product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435878.1 protein_id gnl|my_center|LOCUS_03680 26072 25383 gene locus_tag LOCUS_03690 26072 25383 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892113.1 protein_id gnl|my_center|LOCUS_03690 27612 26203 gene locus_tag LOCUS_03700 27612 26203 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861997.1 protein_id gnl|my_center|LOCUS_03700 >Feature sequence012 1853 621 gene locus_tag LOCUS_03710 1853 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 2940 1945 gene locus_tag LOCUS_03720 2940 1945 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679040.1 protein_id gnl|my_center|LOCUS_03720 5063 2949 gene locus_tag LOCUS_03730 5063 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 6933 5056 gene locus_tag LOCUS_03740 6933 5056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 9098 6957 gene locus_tag LOCUS_03750 9098 6957 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860691.1 protein_id gnl|my_center|LOCUS_03750 10063 9191 gene locus_tag LOCUS_03760 gene fliC 10063 9191 CDS product flagellin FliC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860690.1 protein_id gnl|my_center|LOCUS_03760 10500 10165 gene locus_tag LOCUS_03770 10500 10165 CDS product flagellar protein FliT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860689.1 protein_id gnl|my_center|LOCUS_03770 12026 10503 gene locus_tag LOCUS_03780 gene fliD 12026 10503 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860688.1 protein_id gnl|my_center|LOCUS_03780 12403 12047 gene locus_tag LOCUS_03790 gene fliS 12403 12047 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436036.1 protein_id gnl|my_center|LOCUS_03790 12798 12403 gene locus_tag LOCUS_03800 gene fliS 12798 12403 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860686.1 protein_id gnl|my_center|LOCUS_03800 13032 12820 gene locus_tag LOCUS_03810 gene csrA 13032 12820 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425267.1 protein_id gnl|my_center|LOCUS_03810 13418 13026 gene locus_tag LOCUS_03820 gene fliW 13418 13026 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860685.1 protein_id gnl|my_center|LOCUS_03820 14366 13434 gene locus_tag LOCUS_03830 gene flgL 14366 13434 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860684.1 protein_id gnl|my_center|LOCUS_03830 15695 14385 gene locus_tag LOCUS_03840 gene flgK 15695 14385 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860683.1 protein_id gnl|my_center|LOCUS_03840 16129 15713 gene locus_tag LOCUS_03850 16129 15713 CDS product flagellar protein FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860682.1 protein_id gnl|my_center|LOCUS_03850 16409 16134 gene locus_tag LOCUS_03860 gene flgM 16409 16134 CDS product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860681.1 protein_id gnl|my_center|LOCUS_03860 16875 16561 gene locus_tag LOCUS_03870 16875 16561 CDS product FliM/FliN family flagellar motor C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860680.1 protein_id gnl|my_center|LOCUS_03870 17327 16899 gene locus_tag LOCUS_03880 17327 16899 CDS product YaaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860679.1 protein_id gnl|my_center|LOCUS_03880 18004 17336 gene locus_tag LOCUS_03890 18004 17336 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860678.1 protein_id gnl|my_center|LOCUS_03890 19017 18034 gene locus_tag LOCUS_03900 gene rfbB 19017 18034 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_03900 19612 19055 gene locus_tag LOCUS_03910 gene rfbC 19612 19055 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_03910 20530 19661 gene locus_tag LOCUS_03920 gene rfbA 20530 19661 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965630.1 protein_id gnl|my_center|LOCUS_03920 21511 20639 gene locus_tag LOCUS_03930 gene rfbD 21511 20639 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_03930 25523 21717 gene locus_tag LOCUS_03940 25523 21717 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860677.1 protein_id gnl|my_center|LOCUS_03940 26798 25548 gene locus_tag LOCUS_03950 gene purD 26798 25548 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436062.1 protein_id gnl|my_center|LOCUS_03950 >Feature sequence013 141 13 gene locus_tag LOCUS_03960 141 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 1561 431 gene locus_tag LOCUS_03970 1561 431 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861876.1 protein_id gnl|my_center|LOCUS_03970 2229 1558 gene locus_tag LOCUS_03980 2229 1558 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434299.1 protein_id gnl|my_center|LOCUS_03980 3104 2454 gene locus_tag LOCUS_03990 3104 2454 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434300.1 protein_id gnl|my_center|LOCUS_03990 3391 3161 gene locus_tag LOCUS_04000 3391 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 3979 4572 gene locus_tag LOCUS_04010 3979 4572 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434301.1 protein_id gnl|my_center|LOCUS_04010 4628 4939 gene locus_tag LOCUS_04020 4628 4939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898334.1 protein_id gnl|my_center|LOCUS_04020 6726 5323 gene locus_tag LOCUS_04030 6726 5323 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891654.1 protein_id gnl|my_center|LOCUS_04030 7171 6710 gene locus_tag LOCUS_04040 7171 6710 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861879.1 protein_id gnl|my_center|LOCUS_04040 7517 8032 gene locus_tag LOCUS_04050 7517 8032 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898339.1 protein_id gnl|my_center|LOCUS_04050 8081 8584 gene locus_tag LOCUS_04060 8081 8584 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861880.1 protein_id gnl|my_center|LOCUS_04060 8581 9231 gene locus_tag LOCUS_04070 8581 9231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861881.1 protein_id gnl|my_center|LOCUS_04070 10145 9366 gene locus_tag LOCUS_04080 10145 9366 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438774.1 protein_id gnl|my_center|LOCUS_04080 10508 10257 gene locus_tag LOCUS_04090 10508 10257 CDS product DUF3781 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438776.1 protein_id gnl|my_center|LOCUS_04090 11706 10837 gene locus_tag LOCUS_04100 11706 10837 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438778.1 protein_id gnl|my_center|LOCUS_04100 12808 12047 gene locus_tag LOCUS_04110 12808 12047 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438780.1 protein_id gnl|my_center|LOCUS_04110 14359 12824 gene locus_tag LOCUS_04120 14359 12824 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861882.1 protein_id gnl|my_center|LOCUS_04120 17011 14771 gene locus_tag LOCUS_04130 17011 14771 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861883.1 protein_id gnl|my_center|LOCUS_04130 18338 17538 gene locus_tag LOCUS_04140 18338 17538 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438785.1 protein_id gnl|my_center|LOCUS_04140 19604 18729 gene locus_tag LOCUS_04150 gene hslO 19604 18729 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_04150 20633 19887 gene locus_tag LOCUS_04160 20633 19887 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_04160 20865 20620 gene locus_tag LOCUS_04170 20865 20620 CDS product small, acid-soluble spore protein, alpha/beta type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891674.1 protein_id gnl|my_center|LOCUS_04170 22114 20996 gene locus_tag LOCUS_04180 22114 20996 CDS product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891676.1 protein_id gnl|my_center|LOCUS_04180 23513 22320 gene locus_tag LOCUS_04190 23513 22320 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422058.1 protein_id gnl|my_center|LOCUS_04190 23836 24717 gene locus_tag LOCUS_04200 gene dapA 23836 24717 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438799.1 protein_id gnl|my_center|LOCUS_04200 >Feature sequence014 <1 1163 gene locus_tag LOCUS_04210 <1 1163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861799.1:6-phospho-alpha-glucosidase 1177 1665 gene locus_tag LOCUS_04220 1177 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431368.1 protein_id gnl|my_center|LOCUS_04220 1679 2146 gene locus_tag LOCUS_04230 1679 2146 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431370.1 protein_id gnl|my_center|LOCUS_04230 2149 3303 gene locus_tag LOCUS_04240 2149 3303 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021359756.1 protein_id gnl|my_center|LOCUS_04240 3619 4371 gene locus_tag LOCUS_04250 3619 4371 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431374.1 protein_id gnl|my_center|LOCUS_04250 4372 6279 gene locus_tag LOCUS_04260 4372 6279 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861796.1 protein_id gnl|my_center|LOCUS_04260 6431 7111 gene locus_tag LOCUS_04270 6431 7111 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903427.1 protein_id gnl|my_center|LOCUS_04270 7105 8124 gene locus_tag LOCUS_04280 7105 8124 CDS product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439911.1 protein_id gnl|my_center|LOCUS_04280 8564 9715 gene locus_tag LOCUS_04290 gene anmK 8564 9715 CDS product anhydro-N-acetylmuramic acid kinase AnmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439909.1 protein_id gnl|my_center|LOCUS_04290 9717 10115 gene locus_tag LOCUS_04300 9717 10115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861794.1 protein_id gnl|my_center|LOCUS_04300 10377 10685 gene locus_tag LOCUS_04310 10377 10685 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898113.1 protein_id gnl|my_center|LOCUS_04310 10774 12120 gene locus_tag LOCUS_04320 10774 12120 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431385.1 protein_id gnl|my_center|LOCUS_04320 12353 13450 gene locus_tag LOCUS_04330 12353 13450 CDS product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861793.1 protein_id gnl|my_center|LOCUS_04330 13549 14463 gene locus_tag LOCUS_04340 gene murQ 13549 14463 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431390.1 protein_id gnl|my_center|LOCUS_04340 14573 15493 gene locus_tag LOCUS_04350 14573 15493 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439905.1 protein_id gnl|my_center|LOCUS_04350 15510 16361 gene locus_tag LOCUS_04360 15510 16361 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439904.1 protein_id gnl|my_center|LOCUS_04360 16973 18034 gene locus_tag LOCUS_04370 16973 18034 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861792.1 protein_id gnl|my_center|LOCUS_04370 19124 18150 gene locus_tag LOCUS_04380 19124 18150 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439901.1 protein_id gnl|my_center|LOCUS_04380 19580 20461 gene locus_tag LOCUS_04390 19580 20461 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439900.1 protein_id gnl|my_center|LOCUS_04390 20843 21646 gene locus_tag LOCUS_04400 20843 21646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861791.1 protein_id gnl|my_center|LOCUS_04400 21658 22788 gene locus_tag LOCUS_04410 21658 22788 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861790.1 protein_id gnl|my_center|LOCUS_04410 22792 24201 gene locus_tag LOCUS_04420 22792 24201 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861789.1 protein_id gnl|my_center|LOCUS_04420 24385 24921 gene locus_tag LOCUS_04430 24385 24921 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022620559.1 protein_id gnl|my_center|LOCUS_04430 >Feature sequence015 1871 846 gene locus_tag LOCUS_04440 1871 846 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454207.1 protein_id gnl|my_center|LOCUS_04440 3514 1946 gene locus_tag LOCUS_04450 3514 1946 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454209.1 protein_id gnl|my_center|LOCUS_04450 4538 3627 gene locus_tag LOCUS_04460 4538 3627 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902199.1 protein_id gnl|my_center|LOCUS_04460 5508 4522 gene locus_tag LOCUS_04470 5508 4522 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895878.1 protein_id gnl|my_center|LOCUS_04470 5835 6269 gene locus_tag LOCUS_04480 5835 6269 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895876.1 protein_id gnl|my_center|LOCUS_04480 6272 6670 gene locus_tag LOCUS_04490 6272 6670 CDS product HsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453603.1 protein_id gnl|my_center|LOCUS_04490 7344 7120 gene locus_tag LOCUS_04500 7344 7120 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888660.1 protein_id gnl|my_center|LOCUS_04500 8746 7379 gene locus_tag LOCUS_04510 8746 7379 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453606.1 protein_id gnl|my_center|LOCUS_04510 10365 8830 gene locus_tag LOCUS_04520 10365 8830 CDS product DUF6179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902197.1 protein_id gnl|my_center|LOCUS_04520 10822 10388 gene locus_tag LOCUS_04530 10822 10388 CDS product DUF6323 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902196.1 protein_id gnl|my_center|LOCUS_04530 12003 11083 gene locus_tag LOCUS_04540 12003 11083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 12290 12643 gene locus_tag LOCUS_04550 12290 12643 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860971.1 protein_id gnl|my_center|LOCUS_04550 13803 12862 gene locus_tag LOCUS_04560 13803 12862 CDS product cell wall-binding protein Cwp25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454223.1 protein_id gnl|my_center|LOCUS_04560 15139 13904 gene locus_tag LOCUS_04570 15139 13904 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895871.1 protein_id gnl|my_center|LOCUS_04570 16037 15183 gene locus_tag LOCUS_04580 16037 15183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454225.1 protein_id gnl|my_center|LOCUS_04580 17340 16165 gene locus_tag LOCUS_04590 17340 16165 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860970.1 protein_id gnl|my_center|LOCUS_04590 18323 17439 gene locus_tag LOCUS_04600 18323 17439 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860969.1 protein_id gnl|my_center|LOCUS_04600 19241 18555 gene locus_tag LOCUS_04610 19241 18555 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895864.1 protein_id gnl|my_center|LOCUS_04610 19580 19269 gene locus_tag LOCUS_04620 19580 19269 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453624.1 protein_id gnl|my_center|LOCUS_04620 20290 19769 gene locus_tag LOCUS_04630 20290 19769 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895862.1 protein_id gnl|my_center|LOCUS_04630 20881 20387 gene locus_tag LOCUS_04640 20881 20387 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454230.1 protein_id gnl|my_center|LOCUS_04640 21364 20915 gene locus_tag LOCUS_04650 21364 20915 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902189.1 protein_id gnl|my_center|LOCUS_04650 22709 21714 gene locus_tag LOCUS_04660 22709 21714 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454234.1 protein_id gnl|my_center|LOCUS_04660 24269 22731 gene locus_tag LOCUS_04670 24269 22731 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454235.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04670 24656 24369 gene locus_tag LOCUS_04680 24656 24369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04680 >Feature sequence016 2074 251 gene locus_tag LOCUS_04690 2074 251 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861230.1 protein_id gnl|my_center|LOCUS_04690 3862 2087 gene locus_tag LOCUS_04700 3862 2087 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861229.1 protein_id gnl|my_center|LOCUS_04700 4164 6383 gene locus_tag LOCUS_04710 4164 6383 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861228.1 protein_id gnl|my_center|LOCUS_04710 6920 6621 gene locus_tag LOCUS_04720 6920 6621 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438666.1 protein_id gnl|my_center|LOCUS_04720 7126 10167 gene locus_tag LOCUS_04730 7126 10167 CDS product cell wall-binding protein Cwp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861227.1 protein_id gnl|my_center|LOCUS_04730 11569 10328 gene locus_tag LOCUS_04740 11569 10328 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438661.1 protein_id gnl|my_center|LOCUS_04740 14354 11793 gene locus_tag LOCUS_04750 14354 11793 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861226.1 protein_id gnl|my_center|LOCUS_04750 15032 14355 gene locus_tag LOCUS_04760 15032 14355 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438655.1 protein_id gnl|my_center|LOCUS_04760 16356 15112 gene locus_tag LOCUS_04770 16356 15112 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861225.1 protein_id gnl|my_center|LOCUS_04770 17047 16343 gene locus_tag LOCUS_04780 17047 16343 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861224.1 protein_id gnl|my_center|LOCUS_04780 17779 17498 gene locus_tag LOCUS_04790 17779 17498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04790 17971 18360 gene locus_tag LOCUS_04800 17971 18360 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429441.1 protein_id gnl|my_center|LOCUS_04800 18353 19444 gene locus_tag LOCUS_04810 18353 19444 CDS product DUF5808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861222.1 protein_id gnl|my_center|LOCUS_04810 19564 20040 gene locus_tag LOCUS_04820 19564 20040 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896384.1 protein_id gnl|my_center|LOCUS_04820 20426 20893 gene locus_tag LOCUS_04830 20426 20893 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429434.1 protein_id gnl|my_center|LOCUS_04830 21525 20953 gene locus_tag LOCUS_04840 21525 20953 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902514.1 protein_id gnl|my_center|LOCUS_04840 22685 21588 gene locus_tag LOCUS_04850 22685 21588 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438644.1 protein_id gnl|my_center|LOCUS_04850 23388 22699 gene locus_tag LOCUS_04860 23388 22699 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889262.1 protein_id gnl|my_center|LOCUS_04860 <24105 23553 gene locus_tag LOCUS_04870 <24105 23553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861220.1:RNA polymerase sigma factor RpoD >Feature sequence017 1211 486 gene locus_tag LOCUS_04880 1211 486 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898159.1 protein_id gnl|my_center|LOCUS_04880 2244 1474 gene locus_tag LOCUS_04890 2244 1474 CDS product ChbG/HpnK family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439975.1 protein_id gnl|my_center|LOCUS_04890 3694 2246 gene locus_tag LOCUS_04900 3694 2246 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898160.1 protein_id gnl|my_center|LOCUS_04900 4064 4786 gene locus_tag LOCUS_04910 4064 4786 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861813.1 protein_id gnl|my_center|LOCUS_04910 4983 6650 gene locus_tag LOCUS_04920 4983 6650 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439981.1 protein_id gnl|my_center|LOCUS_04920 8065 6746 gene locus_tag LOCUS_04930 8065 6746 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861814.1 protein_id gnl|my_center|LOCUS_04930 8843 8106 gene locus_tag LOCUS_04940 8843 8106 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861815.1 protein_id gnl|my_center|LOCUS_04940 11105 9096 gene locus_tag LOCUS_04950 11105 9096 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439994.1 protein_id gnl|my_center|LOCUS_04950 12976 11543 gene locus_tag LOCUS_04960 12976 11543 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861817.1 protein_id gnl|my_center|LOCUS_04960 14416 12992 gene locus_tag LOCUS_04970 14416 12992 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861818.1 protein_id gnl|my_center|LOCUS_04970 16419 14503 gene locus_tag LOCUS_04980 16419 14503 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861819.1 protein_id gnl|my_center|LOCUS_04980 17353 16493 gene locus_tag LOCUS_04990 17353 16493 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439998.1 protein_id gnl|my_center|LOCUS_04990 18891 17704 gene locus_tag LOCUS_05000 18891 17704 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898184.1 protein_id gnl|my_center|LOCUS_05000 20296 18905 gene locus_tag LOCUS_05010 20296 18905 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440000.1 protein_id gnl|my_center|LOCUS_05010 22543 20891 gene locus_tag LOCUS_05020 22543 20891 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861822.1 protein_id gnl|my_center|LOCUS_05020 <23328 22563 gene locus_tag LOCUS_05030 <23328 22563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861823.1:Sapep family Mn(2+)-dependent dipeptidase >Feature sequence018 428 643 gene locus_tag LOCUS_05040 428 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860675.1 protein_id gnl|my_center|LOCUS_05040 649 942 gene locus_tag LOCUS_05050 649 942 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425293.1 protein_id gnl|my_center|LOCUS_05050 1853 1137 gene locus_tag LOCUS_05060 1853 1137 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860672.1 protein_id gnl|my_center|LOCUS_05060 3206 1941 gene locus_tag LOCUS_05070 3206 1941 CDS product class II D-tagatose-bisphosphate aldolase, non-catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860671.1 protein_id gnl|my_center|LOCUS_05070 3618 3310 gene locus_tag LOCUS_05080 3618 3310 CDS product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435043.1 protein_id gnl|my_center|LOCUS_05080 4740 3685 gene locus_tag LOCUS_05090 4740 3685 CDS product PTS fructose transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895303.1 protein_id gnl|my_center|LOCUS_05090 5194 4742 gene locus_tag LOCUS_05100 5194 4742 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435038.1 protein_id gnl|my_center|LOCUS_05100 7221 5191 gene locus_tag LOCUS_05110 7221 5191 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860670.1 protein_id gnl|my_center|LOCUS_05110 9711 7477 gene locus_tag LOCUS_05120 9711 7477 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860669.1 protein_id gnl|my_center|LOCUS_05120 10029 11753 gene locus_tag LOCUS_05130 10029 11753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05130 11889 13457 gene locus_tag LOCUS_05140 11889 13457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05140 13767 14003 gene locus_tag LOCUS_05150 13767 14003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 14698 14132 gene locus_tag LOCUS_05160 14698 14132 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860666.1 protein_id gnl|my_center|LOCUS_05160 15258 14695 gene locus_tag LOCUS_05170 15258 14695 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948278.1 protein_id gnl|my_center|LOCUS_05170 15378 16253 gene locus_tag LOCUS_05180 15378 16253 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091833.1 protein_id gnl|my_center|LOCUS_05180 17792 16401 gene locus_tag LOCUS_05190 17792 16401 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860665.1 protein_id gnl|my_center|LOCUS_05190 19905 18370 gene locus_tag LOCUS_05200 gene guaA 19905 18370 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425341.1 protein_id gnl|my_center|LOCUS_05200 20706 20287 gene locus_tag LOCUS_05210 20706 20287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05210 21470 20736 gene locus_tag LOCUS_05220 21470 20736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05220 22294 21554 gene locus_tag LOCUS_05230 gene larB 22294 21554 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435015.1 protein_id gnl|my_center|LOCUS_05230 >Feature sequence019 351 1049 gene locus_tag LOCUS_05240 351 1049 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896932.1 protein_id gnl|my_center|LOCUS_05240 1052 2485 gene locus_tag LOCUS_05250 1052 2485 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430278.1 protein_id gnl|my_center|LOCUS_05250 2507 3244 gene locus_tag LOCUS_05260 gene truA 2507 3244 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430279.1 protein_id gnl|my_center|LOCUS_05260 3690 4889 gene locus_tag LOCUS_05270 3690 4889 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439524.1 protein_id gnl|my_center|LOCUS_05270 5136 5642 gene locus_tag LOCUS_05280 5136 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05280 5688 6182 gene locus_tag LOCUS_05290 5688 6182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05290 6290 7453 gene locus_tag LOCUS_05300 6290 7453 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861335.1 protein_id gnl|my_center|LOCUS_05300 7922 7542 gene locus_tag LOCUS_05310 7922 7542 CDS product DUF4363 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439516.1 protein_id gnl|my_center|LOCUS_05310 8584 7925 gene locus_tag LOCUS_05320 8584 7925 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889750.1 protein_id gnl|my_center|LOCUS_05320 9664 8690 gene locus_tag LOCUS_05330 9664 8690 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439509.1 protein_id gnl|my_center|LOCUS_05330 10051 9704 gene locus_tag LOCUS_05340 10051 9704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433614.1 protein_id gnl|my_center|LOCUS_05340 11234 10269 gene locus_tag LOCUS_05350 11234 10269 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433612.1 protein_id gnl|my_center|LOCUS_05350 11677 12045 gene locus_tag LOCUS_05360 11677 12045 CDS product C-GCAxxG-C-C family (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430296.1 protein_id gnl|my_center|LOCUS_05360 12470 12715 gene locus_tag LOCUS_05370 12470 12715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430297.1 protein_id gnl|my_center|LOCUS_05370 12814 13077 gene locus_tag LOCUS_05380 12814 13077 CDS product DUF1883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439502.1 protein_id gnl|my_center|LOCUS_05380 14309 13362 gene locus_tag LOCUS_05390 14309 13362 CDS product 4Fe-4S-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430299.1 protein_id gnl|my_center|LOCUS_05390 15943 14312 gene locus_tag LOCUS_05400 15943 14312 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439500.1 protein_id gnl|my_center|LOCUS_05400 16073 16990 gene locus_tag LOCUS_05410 16073 16990 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439497.1 protein_id gnl|my_center|LOCUS_05410 17628 17047 gene locus_tag LOCUS_05420 17628 17047 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430302.1 protein_id gnl|my_center|LOCUS_05420 18234 17668 gene locus_tag LOCUS_05430 18234 17668 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439494.1 protein_id gnl|my_center|LOCUS_05430 19524 18670 gene locus_tag LOCUS_05440 19524 18670 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430304.1 protein_id gnl|my_center|LOCUS_05440 19679 20569 gene locus_tag LOCUS_05450 19679 20569 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861338.1 protein_id gnl|my_center|LOCUS_05450 20796 22541 gene locus_tag LOCUS_05460 20796 22541 CDS product cell wall-binding protein Cwp23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861339.1 protein_id gnl|my_center|LOCUS_05460 >Feature sequence020 475 1272 gene locus_tag LOCUS_05470 475 1272 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436797.1 protein_id gnl|my_center|LOCUS_05470 1858 2877 gene locus_tag LOCUS_05480 gene pheS 1858 2877 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436795.1 protein_id gnl|my_center|LOCUS_05480 2894 5287 gene locus_tag LOCUS_05490 gene pheT 2894 5287 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860925.1 protein_id gnl|my_center|LOCUS_05490 5312 5902 gene locus_tag LOCUS_05500 5312 5902 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895750.1 protein_id gnl|my_center|LOCUS_05500 6191 6805 gene locus_tag LOCUS_05510 6191 6805 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436876.1 protein_id gnl|my_center|LOCUS_05510 7258 9858 gene locus_tag LOCUS_05520 7258 9858 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860926.1 protein_id gnl|my_center|LOCUS_05520 9962 10540 gene locus_tag LOCUS_05530 9962 10540 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860927.1 protein_id gnl|my_center|LOCUS_05530 10575 11051 gene locus_tag LOCUS_05540 10575 11051 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436879.1 protein_id gnl|my_center|LOCUS_05540 11569 12390 gene locus_tag LOCUS_05550 11569 12390 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860928.1 protein_id gnl|my_center|LOCUS_05550 12628 15126 gene locus_tag LOCUS_05560 12628 15126 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860929.1 protein_id gnl|my_center|LOCUS_05560 16781 15330 gene locus_tag LOCUS_05570 16781 15330 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436882.1 protein_id gnl|my_center|LOCUS_05570 17100 19478 gene locus_tag LOCUS_05580 17100 19478 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860930.1 protein_id gnl|my_center|LOCUS_05580 19544 19957 gene locus_tag LOCUS_05590 19544 19957 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860931.1 protein_id gnl|my_center|LOCUS_05590 >Feature sequence021 241 2412 gene locus_tag LOCUS_05600 241 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 3974 2745 gene locus_tag LOCUS_05610 3974 2745 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439074.1 protein_id gnl|my_center|LOCUS_05610 6866 4032 gene locus_tag LOCUS_05620 6866 4032 CDS product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860845.1 protein_id gnl|my_center|LOCUS_05620 7568 8329 gene locus_tag LOCUS_05630 7568 8329 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888325.1 protein_id gnl|my_center|LOCUS_05630 8330 8824 gene locus_tag LOCUS_05640 8330 8824 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860846.1 protein_id gnl|my_center|LOCUS_05640 9050 10228 gene locus_tag LOCUS_05650 9050 10228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439078.1 protein_id gnl|my_center|LOCUS_05650 10482 12089 gene locus_tag LOCUS_05660 10482 12089 CDS product DUF4118 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439079.1 protein_id gnl|my_center|LOCUS_05660 12080 12784 gene locus_tag LOCUS_05670 12080 12784 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439080.1 protein_id gnl|my_center|LOCUS_05670 13228 13076 gene locus_tag LOCUS_05680 13228 13076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860847.1 protein_id gnl|my_center|LOCUS_05680 13651 13469 gene locus_tag LOCUS_05690 13651 13469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 13932 17030 gene locus_tag LOCUS_05700 13932 17030 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860848.1 protein_id gnl|my_center|LOCUS_05700 17153 18439 gene locus_tag LOCUS_05710 17153 18439 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439084.1 protein_id gnl|my_center|LOCUS_05710 19923 18817 gene locus_tag LOCUS_05720 19923 18817 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860849.1 protein_id gnl|my_center|LOCUS_05720 21499 19958 gene locus_tag LOCUS_05730 21499 19958 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891132.1 protein_id gnl|my_center|LOCUS_05730 >Feature sequence022 <1 1620 gene locus_tag LOCUS_05740 <1 1620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003432446.1:glutamine--fructose-6-phosphate transaminase (isomerizing) 2072 3367 gene locus_tag LOCUS_05750 2072 3367 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860639.1 protein_id gnl|my_center|LOCUS_05750 3823 4560 gene locus_tag LOCUS_05760 3823 4560 CDS product YwmB family TATA-box binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432450.1 protein_id gnl|my_center|LOCUS_05760 4581 5834 gene locus_tag LOCUS_05770 gene murA 4581 5834 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420721.1 protein_id gnl|my_center|LOCUS_05770 5921 6985 gene locus_tag LOCUS_05780 gene spoIID 5921 6985 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432452.1 protein_id gnl|my_center|LOCUS_05780 7051 7719 gene locus_tag LOCUS_05790 7051 7719 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432453.1 protein_id gnl|my_center|LOCUS_05790 7817 8077 gene locus_tag LOCUS_05800 gene spoIIID 7817 8077 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420727.1 protein_id gnl|my_center|LOCUS_05800 8274 9293 gene locus_tag LOCUS_05810 8274 9293 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 protein_id gnl|my_center|LOCUS_05810 9309 9737 gene locus_tag LOCUS_05820 gene fabZ 9309 9737 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420731.1 protein_id gnl|my_center|LOCUS_05820 10357 9848 gene locus_tag LOCUS_05830 gene yyaC 10357 9848 CDS product spore protease YyaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887970.1 protein_id gnl|my_center|LOCUS_05830 10786 11979 gene locus_tag LOCUS_05840 gene metK 10786 11979 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432462.1 protein_id gnl|my_center|LOCUS_05840 12295 13392 gene locus_tag LOCUS_05850 12295 13392 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425444.1 protein_id gnl|my_center|LOCUS_05850 13656 15875 gene locus_tag LOCUS_05860 13656 15875 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434402.1 protein_id gnl|my_center|LOCUS_05860 15878 16660 gene locus_tag LOCUS_05870 15878 16660 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860641.1 protein_id gnl|my_center|LOCUS_05870 17001 18905 gene locus_tag LOCUS_05880 17001 18905 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860642.1 protein_id gnl|my_center|LOCUS_05880 19046 19354 gene locus_tag LOCUS_05890 19046 19354 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420747.1 protein_id gnl|my_center|LOCUS_05890 19378 19704 gene locus_tag LOCUS_05900 19378 19704 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425440.1 protein_id gnl|my_center|LOCUS_05900 19743 21077 gene locus_tag LOCUS_05910 gene celB 19743 21077 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901597.1 protein_id gnl|my_center|LOCUS_05910 >Feature sequence023 378 1052 gene locus_tag LOCUS_05920 378 1052 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860645.1 protein_id gnl|my_center|LOCUS_05920 1210 1377 gene locus_tag LOCUS_05930 1210 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 1605 2156 gene locus_tag LOCUS_05940 gene raiA 1605 2156 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434417.1 protein_id gnl|my_center|LOCUS_05940 2288 4963 gene locus_tag LOCUS_05950 gene secA 2288 4963 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895216.1 protein_id gnl|my_center|LOCUS_05950 5069 6085 gene locus_tag LOCUS_05960 gene prfB 5069 6085 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177451831.1 protein_id gnl|my_center|LOCUS_05960 6229 8370 gene locus_tag LOCUS_05970 6229 8370 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895217.1 protein_id gnl|my_center|LOCUS_05970 8518 9684 gene locus_tag LOCUS_05980 8518 9684 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860647.1 protein_id gnl|my_center|LOCUS_05980 9986 10591 gene locus_tag LOCUS_05990 9986 10591 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420780.1 protein_id gnl|my_center|LOCUS_05990 10920 11960 gene locus_tag LOCUS_06000 10920 11960 CDS product DUF4116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895219.1 protein_id gnl|my_center|LOCUS_06000 12099 12551 gene locus_tag LOCUS_06010 gene tsaE 12099 12551 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_06010 12551 13267 gene locus_tag LOCUS_06020 gene tsaB 12551 13267 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860649.1 protein_id gnl|my_center|LOCUS_06020 13257 13733 gene locus_tag LOCUS_06030 gene rimI 13257 13733 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434429.1 protein_id gnl|my_center|LOCUS_06030 13739 14755 gene locus_tag LOCUS_06040 gene tsaD 13739 14755 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860650.1 protein_id gnl|my_center|LOCUS_06040 15052 17760 gene locus_tag LOCUS_06050 gene hpdB 15052 17760 CDS product 4-hydroxyphenylacetate decarboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901609.1 protein_id gnl|my_center|LOCUS_06050 17764 18021 gene locus_tag LOCUS_06060 gene hpdC 17764 18021 CDS product 4-hydroxyphenylacetate decarboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425410.1 protein_id gnl|my_center|LOCUS_06060 18014 18964 gene locus_tag LOCUS_06070 gene hpdA 18014 18964 CDS product 4-hydroxyphenylacetate decarboxylase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860651.1 protein_id gnl|my_center|LOCUS_06070 19279 19959 gene locus_tag LOCUS_06080 19279 19959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06080 20031 20240 gene locus_tag LOCUS_06090 20031 20240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06090 <21104 20339 gene locus_tag LOCUS_06100 <21104 20339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003434442.1:type II CAAX endopeptidase family protein >Feature sequence024 1491 1120 gene locus_tag LOCUS_06110 1491 1120 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419037.1 protein_id gnl|my_center|LOCUS_06110 2318 1719 gene locus_tag LOCUS_06120 2318 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419035.1 protein_id gnl|my_center|LOCUS_06120 2731 2519 gene locus_tag LOCUS_06130 2731 2519 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428495.1 protein_id gnl|my_center|LOCUS_06130 4519 2804 gene locus_tag LOCUS_06140 4519 2804 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861122.1 protein_id gnl|my_center|LOCUS_06140 5073 4519 gene locus_tag LOCUS_06150 5073 4519 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438043.1 protein_id gnl|my_center|LOCUS_06150 5668 5066 gene locus_tag LOCUS_06160 gene coaE 5668 5066 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438041.1 protein_id gnl|my_center|LOCUS_06160 8325 5677 gene locus_tag LOCUS_06170 gene polA 8325 5677 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896068.1 protein_id gnl|my_center|LOCUS_06170 8477 8564 gene locus_tag LOCUS_t00010 8477 8564 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9194 8751 gene locus_tag LOCUS_06180 9194 8751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861121.1 protein_id gnl|my_center|LOCUS_06180 9394 9197 gene locus_tag LOCUS_06190 9394 9197 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438035.1 protein_id gnl|my_center|LOCUS_06190 10452 9586 gene locus_tag LOCUS_06200 10452 9586 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438032.1 protein_id gnl|my_center|LOCUS_06200 11547 10678 gene locus_tag LOCUS_06210 11547 10678 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438030.1 protein_id gnl|my_center|LOCUS_06210 12274 12053 gene locus_tag LOCUS_06220 12274 12053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428522.1 protein_id gnl|my_center|LOCUS_06220 13757 12777 gene locus_tag LOCUS_06230 13757 12777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428523.1 protein_id gnl|my_center|LOCUS_06230 14793 13921 gene locus_tag LOCUS_06240 14793 13921 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888897.1 protein_id gnl|my_center|LOCUS_06240 15508 14957 gene locus_tag LOCUS_06250 15508 14957 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438024.1 protein_id gnl|my_center|LOCUS_06250 16430 15528 gene locus_tag LOCUS_06260 16430 15528 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896060.1 protein_id gnl|my_center|LOCUS_06260 18817 16445 gene locus_tag LOCUS_06270 18817 16445 CDS product formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438022.1 protein_id gnl|my_center|LOCUS_06270 19727 19038 gene locus_tag LOCUS_06280 19727 19038 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861120.1 protein_id gnl|my_center|LOCUS_06280 <20884 19970 gene locus_tag LOCUS_06290 <20884 19970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_021361811.1:ATP-binding protein >Feature sequence025 <1 787 gene locus_tag LOCUS_06300 <1 787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003438062.1:permease prefix domain 1-containing protein 1351 2433 gene locus_tag LOCUS_06310 1351 2433 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861129.1 protein_id gnl|my_center|LOCUS_06310 2474 2641 gene locus_tag LOCUS_06320 2474 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 3838 2645 gene locus_tag LOCUS_06330 3838 2645 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428474.1 protein_id gnl|my_center|LOCUS_06330 4157 6001 gene locus_tag LOCUS_06340 4157 6001 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419074.1 protein_id gnl|my_center|LOCUS_06340 6003 6704 gene locus_tag LOCUS_06350 6003 6704 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438070.1 protein_id gnl|my_center|LOCUS_06350 6722 8143 gene locus_tag LOCUS_06360 6722 8143 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438072.1 protein_id gnl|my_center|LOCUS_06360 8244 8555 gene locus_tag LOCUS_06370 gene rplU 8244 8555 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419082.1 protein_id gnl|my_center|LOCUS_06370 8570 8887 gene locus_tag LOCUS_06380 8570 8887 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438074.1 protein_id gnl|my_center|LOCUS_06380 8901 9191 gene locus_tag LOCUS_06390 gene rpmA 8901 9191 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419086.1 protein_id gnl|my_center|LOCUS_06390 9302 10579 gene locus_tag LOCUS_06400 gene obgE 9302 10579 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888921.1 protein_id gnl|my_center|LOCUS_06400 10631 10999 gene locus_tag LOCUS_06410 10631 10999 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428464.1 protein_id gnl|my_center|LOCUS_06410 11300 12505 gene locus_tag LOCUS_06420 11300 12505 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861130.1 protein_id gnl|my_center|LOCUS_06420 13272 12706 gene locus_tag LOCUS_06430 13272 12706 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438082.1 protein_id gnl|my_center|LOCUS_06430 14811 13552 gene locus_tag LOCUS_06440 14811 13552 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438084.1 protein_id gnl|my_center|LOCUS_06440 14936 15649 gene locus_tag LOCUS_06450 14936 15649 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438086.1 protein_id gnl|my_center|LOCUS_06450 15767 17041 gene locus_tag LOCUS_06460 gene larA 15767 17041 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438088.1 protein_id gnl|my_center|LOCUS_06460 17058 17846 gene locus_tag LOCUS_06470 17058 17846 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438090.1 protein_id gnl|my_center|LOCUS_06470 17860 19080 gene locus_tag LOCUS_06480 17860 19080 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438092.1 protein_id gnl|my_center|LOCUS_06480 19091 20482 gene locus_tag LOCUS_06490 19091 20482 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438093.1 protein_id gnl|my_center|LOCUS_06490 >Feature sequence026 1198 758 gene locus_tag LOCUS_06500 1198 758 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419459.1 protein_id gnl|my_center|LOCUS_06500 1874 1446 gene locus_tag LOCUS_06510 1874 1446 CDS product spore germination protein GerW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428254.1 protein_id gnl|my_center|LOCUS_06510 2457 1828 gene locus_tag LOCUS_06520 2457 1828 CDS product DUF2953 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438288.1 protein_id gnl|my_center|LOCUS_06520 3158 2619 gene locus_tag LOCUS_06530 gene scpB 3158 2619 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428258.1 protein_id gnl|my_center|LOCUS_06530 3879 3160 gene locus_tag LOCUS_06540 3879 3160 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861170.1 protein_id gnl|my_center|LOCUS_06540 4505 3909 gene locus_tag LOCUS_06550 4505 3909 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902398.1 protein_id gnl|my_center|LOCUS_06550 4803 5639 gene locus_tag LOCUS_06560 4803 5639 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438284.1 protein_id gnl|my_center|LOCUS_06560 5660 6082 gene locus_tag LOCUS_06570 5660 6082 CDS product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889078.1 protein_id gnl|my_center|LOCUS_06570 7456 6293 gene locus_tag LOCUS_06580 7456 6293 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428267.1 protein_id gnl|my_center|LOCUS_06580 7710 7510 gene locus_tag LOCUS_06590 7710 7510 CDS product CD1290 family small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428269.1 protein_id gnl|my_center|LOCUS_06590 9586 7916 gene locus_tag LOCUS_06600 9586 7916 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861169.1 protein_id gnl|my_center|LOCUS_06600 9809 10546 gene locus_tag LOCUS_06610 9809 10546 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428273.1 protein_id gnl|my_center|LOCUS_06610 11121 10663 gene locus_tag LOCUS_06620 11121 10663 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419428.1 protein_id gnl|my_center|LOCUS_06620 11690 11403 gene locus_tag LOCUS_06630 11690 11403 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889069.1 protein_id gnl|my_center|LOCUS_06630 12193 11768 gene locus_tag LOCUS_06640 gene ruvX 12193 11768 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428279.1 protein_id gnl|my_center|LOCUS_06640 14570 12399 gene locus_tag LOCUS_06650 14570 12399 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861168.1 protein_id gnl|my_center|LOCUS_06650 14837 14580 gene locus_tag LOCUS_06660 14837 14580 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419418.1 protein_id gnl|my_center|LOCUS_06660 17501 14862 gene locus_tag LOCUS_06670 gene alaS 17501 14862 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_06670 19035 17950 gene locus_tag LOCUS_06680 gene mnmA 19035 17950 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_06680 19758 19318 gene locus_tag LOCUS_06690 gene nifU 19758 19318 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438275.1 protein_id gnl|my_center|LOCUS_06690 >Feature sequence027 1633 2 gene locus_tag LOCUS_06700 1633 2 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434571.1 protein_id gnl|my_center|LOCUS_06700 3153 2116 gene locus_tag LOCUS_06710 3153 2116 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417347.1 protein_id gnl|my_center|LOCUS_06710 3957 3172 gene locus_tag LOCUS_06720 gene etfB 3957 3172 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427760.1 protein_id gnl|my_center|LOCUS_06720 5123 3990 gene locus_tag LOCUS_06730 gene acdB 5123 3990 CDS product putative isocaproyl-CoA dehydrogenase AcdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427762.1 protein_id gnl|my_center|LOCUS_06730 6298 5171 gene locus_tag LOCUS_06740 gene hadC 6298 5171 CDS product (R)-2-hydroxyisocaproyl-CoA dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_06740 7524 6298 gene locus_tag LOCUS_06750 gene hadB 7524 6298 CDS product (R)-2-hydroxyisocaproyl-CoA dehydratase subunit HadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888224.1 protein_id gnl|my_center|LOCUS_06750 8339 7539 gene locus_tag LOCUS_06760 gene hadI 8339 7539 CDS product 2-hydroxyisocaproyl-CoA dehydratase activator HadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888223.1 protein_id gnl|my_center|LOCUS_06760 9577 8378 gene locus_tag LOCUS_06770 gene hadA 9577 8378 CDS product isocaprenoyl-CoA:2-hydroxyisocaproate CoA-transferase HadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427766.1 protein_id gnl|my_center|LOCUS_06770 10254 11252 gene locus_tag LOCUS_06780 10254 11252 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431407.1 protein_id gnl|my_center|LOCUS_06780 11614 12141 gene locus_tag LOCUS_06790 11614 12141 CDS product TIGR04002 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888217.1 protein_id gnl|my_center|LOCUS_06790 12168 12764 gene locus_tag LOCUS_06800 12168 12764 CDS product TIGR04100 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860776.1 protein_id gnl|my_center|LOCUS_06800 14412 12829 gene locus_tag LOCUS_06810 gene asnB 14412 12829 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860775.1 protein_id gnl|my_center|LOCUS_06810 15850 15014 gene locus_tag LOCUS_06820 15850 15014 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860774.1 protein_id gnl|my_center|LOCUS_06820 17340 15874 gene locus_tag LOCUS_06830 17340 15874 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431416.1 protein_id gnl|my_center|LOCUS_06830 19205 17343 gene locus_tag LOCUS_06840 19205 17343 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860773.1 protein_id gnl|my_center|LOCUS_06840 >Feature sequence028 1975 758 gene locus_tag LOCUS_06850 1975 758 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455016.1 protein_id gnl|my_center|LOCUS_06850 3038 2175 gene locus_tag LOCUS_06860 gene aroE 3038 2175 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861653.1 protein_id gnl|my_center|LOCUS_06860 5042 3120 gene locus_tag LOCUS_06870 5042 3120 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455018.1 protein_id gnl|my_center|LOCUS_06870 5984 5136 gene locus_tag LOCUS_06880 5984 5136 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455019.1 protein_id gnl|my_center|LOCUS_06880 6396 7277 gene locus_tag LOCUS_06890 6396 7277 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890955.1 protein_id gnl|my_center|LOCUS_06890 8348 7485 gene locus_tag LOCUS_06900 8348 7485 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861654.1 protein_id gnl|my_center|LOCUS_06900 10437 8503 gene locus_tag LOCUS_06910 10437 8503 CDS product cell wall-binding protein Cwp22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861655.1 protein_id gnl|my_center|LOCUS_06910 11562 10549 gene locus_tag LOCUS_06920 gene galE 11562 10549 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861656.1 protein_id gnl|my_center|LOCUS_06920 12461 11586 gene locus_tag LOCUS_06930 gene galU 12461 11586 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890959.1 protein_id gnl|my_center|LOCUS_06930 12973 12653 gene locus_tag LOCUS_06940 12973 12653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455025.1 protein_id gnl|my_center|LOCUS_06940 14954 12963 gene locus_tag LOCUS_06950 14954 12963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861657.1 protein_id gnl|my_center|LOCUS_06950 17611 15077 gene locus_tag LOCUS_06960 17611 15077 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861658.1 protein_id gnl|my_center|LOCUS_06960 18364 19041 gene locus_tag LOCUS_06970 gene srtB 18364 19041 CDS product sortase SrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903304.1 protein_id gnl|my_center|LOCUS_06970 19275 19201 gene locus_tag LOCUS_t00020 19275 19201 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence029 546 1436 gene locus_tag LOCUS_06980 546 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861935.1 protein_id gnl|my_center|LOCUS_06980 2793 1837 gene locus_tag LOCUS_06990 2793 1837 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898522.1 protein_id gnl|my_center|LOCUS_06990 3496 4491 gene locus_tag LOCUS_07000 3496 4491 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861934.1 protein_id gnl|my_center|LOCUS_07000 4478 5332 gene locus_tag LOCUS_07010 4478 5332 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021362077.1 protein_id gnl|my_center|LOCUS_07010 5329 6123 gene locus_tag LOCUS_07020 5329 6123 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861932.1 protein_id gnl|my_center|LOCUS_07020 6408 7787 gene locus_tag LOCUS_07030 6408 7787 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861931.1 protein_id gnl|my_center|LOCUS_07030 8113 8949 gene locus_tag LOCUS_07040 8113 8949 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861930.1 protein_id gnl|my_center|LOCUS_07040 10759 9221 gene locus_tag LOCUS_07050 10759 9221 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861929.1 protein_id gnl|my_center|LOCUS_07050 11830 12096 gene locus_tag LOCUS_07060 11830 12096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 12145 12729 gene locus_tag LOCUS_07070 12145 12729 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861927.1 protein_id gnl|my_center|LOCUS_07070 13057 12734 gene locus_tag LOCUS_07080 13057 12734 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436216.1 protein_id gnl|my_center|LOCUS_07080 13209 13727 gene locus_tag LOCUS_07090 13209 13727 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429152.1 protein_id gnl|my_center|LOCUS_07090 14571 13903 gene locus_tag LOCUS_07100 14571 13903 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436215.1 protein_id gnl|my_center|LOCUS_07100 14686 16101 gene locus_tag LOCUS_07110 14686 16101 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903720.1 protein_id gnl|my_center|LOCUS_07110 16300 16782 gene locus_tag LOCUS_07120 16300 16782 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891821.1 protein_id gnl|my_center|LOCUS_07120 16779 17363 gene locus_tag LOCUS_07130 gene clpP 16779 17363 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436212.1 protein_id gnl|my_center|LOCUS_07130 17675 18751 gene locus_tag LOCUS_07140 17675 18751 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898508.1 protein_id gnl|my_center|LOCUS_07140 >Feature sequence030 3674 135 gene locus_tag LOCUS_07150 gene nifJ 3674 135 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427073.1 protein_id gnl|my_center|LOCUS_07150 4761 4192 gene locus_tag LOCUS_07160 4761 4192 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861641.1 protein_id gnl|my_center|LOCUS_07160 5441 4833 gene locus_tag LOCUS_07170 5441 4833 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454998.1 protein_id gnl|my_center|LOCUS_07170 7218 5449 gene locus_tag LOCUS_07180 7218 5449 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454999.1 protein_id gnl|my_center|LOCUS_07180 7716 7255 gene locus_tag LOCUS_07190 7716 7255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455001.1 protein_id gnl|my_center|LOCUS_07190 7905 8366 gene locus_tag LOCUS_07200 7905 8366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427085.1 protein_id gnl|my_center|LOCUS_07200 8629 8459 gene locus_tag LOCUS_07210 8629 8459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416012.1 protein_id gnl|my_center|LOCUS_07210 9039 8818 gene locus_tag LOCUS_07220 9039 8818 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416009.1 protein_id gnl|my_center|LOCUS_07220 10349 9123 gene locus_tag LOCUS_07230 10349 9123 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_07230 11343 10411 gene locus_tag LOCUS_07240 11343 10411 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861644.1 protein_id gnl|my_center|LOCUS_07240 11959 11432 gene locus_tag LOCUS_07250 gene hpt 11959 11432 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416006.1 protein_id gnl|my_center|LOCUS_07250 12188 13264 gene locus_tag LOCUS_07260 12188 13264 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861645.1 protein_id gnl|my_center|LOCUS_07260 14558 13350 gene locus_tag LOCUS_07270 14558 13350 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861646.1 protein_id gnl|my_center|LOCUS_07270 15108 14719 gene locus_tag LOCUS_07280 15108 14719 CDS product DUF1232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861647.1 protein_id gnl|my_center|LOCUS_07280 16213 15212 gene locus_tag LOCUS_07290 gene asnA 16213 15212 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427105.1 protein_id gnl|my_center|LOCUS_07290 17851 16661 gene locus_tag LOCUS_07300 17851 16661 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455004.1 protein_id gnl|my_center|LOCUS_07300 <18940 18132 gene locus_tag LOCUS_07310 <18940 18132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861648.1:M20 peptidase aminoacylase family protein >Feature sequence031 <1 818 gene locus_tag LOCUS_07320 <1 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861534.1:glycine reductase complex selenoprotein B 846 1079 gene locus_tag LOCUS_07330 846 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 1335 2867 gene locus_tag LOCUS_07340 gene grdC 1335 2867 CDS product glycine/sarcosine/betaine reductase complex component C subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897537.1 protein_id gnl|my_center|LOCUS_07340 2878 4023 gene locus_tag LOCUS_07350 gene grdD 2878 4023 CDS product glycine/sarcosine/betaine reductase complex component C subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430750.1 protein_id gnl|my_center|LOCUS_07350 4337 5416 gene locus_tag LOCUS_07360 4337 5416 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454650.1 protein_id gnl|my_center|LOCUS_07360 5529 6128 gene locus_tag LOCUS_07370 5529 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903154.1 protein_id gnl|my_center|LOCUS_07370 7187 6315 gene locus_tag LOCUS_07380 7187 6315 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893591.1 protein_id gnl|my_center|LOCUS_07380 7622 9007 gene locus_tag LOCUS_07390 7622 9007 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430743.1 protein_id gnl|my_center|LOCUS_07390 9034 10578 gene locus_tag LOCUS_07400 9034 10578 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861532.1 protein_id gnl|my_center|LOCUS_07400 10609 12000 gene locus_tag LOCUS_07410 10609 12000 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454646.1 protein_id gnl|my_center|LOCUS_07410 12193 13689 gene locus_tag LOCUS_07420 gene abfD 12193 13689 CDS product 4-hydroxybutyryl-CoA dehydratase/vinylacetyl-CoA-Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430738.1 protein_id gnl|my_center|LOCUS_07420 13824 14099 gene locus_tag LOCUS_07430 13824 14099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430736.1 protein_id gnl|my_center|LOCUS_07430 14123 15430 gene locus_tag LOCUS_07440 14123 15430 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454645.1 protein_id gnl|my_center|LOCUS_07440 15450 16568 gene locus_tag LOCUS_07450 15450 16568 CDS product 4-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861531.1 protein_id gnl|my_center|LOCUS_07450 16855 17775 gene locus_tag LOCUS_07460 16855 17775 CDS product 5-bromo-4-chloroindolyl phosphate hydrolysis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890534.1 protein_id gnl|my_center|LOCUS_07460 >Feature sequence032 <1 1344 gene locus_tag LOCUS_07470 <1 1344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454681.1:GGDEF domain-containing protein 1371 3257 gene locus_tag LOCUS_07480 1371 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 3274 5265 gene locus_tag LOCUS_07490 3274 5265 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897559.1 protein_id gnl|my_center|LOCUS_07490 5527 6786 gene locus_tag LOCUS_07500 5527 6786 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454678.1 protein_id gnl|my_center|LOCUS_07500 6847 8634 gene locus_tag LOCUS_07510 gene iorA 6847 8634 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430808.1 protein_id gnl|my_center|LOCUS_07510 8636 9211 gene locus_tag LOCUS_07520 8636 9211 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430806.1 protein_id gnl|my_center|LOCUS_07520 9264 10334 gene locus_tag LOCUS_07530 gene buk 9264 10334 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454677.1 protein_id gnl|my_center|LOCUS_07530 10552 11253 gene locus_tag LOCUS_07540 10552 11253 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454676.1 protein_id gnl|my_center|LOCUS_07540 11313 11819 gene locus_tag LOCUS_07550 11313 11819 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454674.1 protein_id gnl|my_center|LOCUS_07550 11994 13016 gene locus_tag LOCUS_07560 11994 13016 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430799.1 protein_id gnl|my_center|LOCUS_07560 13471 13163 gene locus_tag LOCUS_07570 13471 13163 CDS product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430798.1 protein_id gnl|my_center|LOCUS_07570 13959 13531 gene locus_tag LOCUS_07580 13959 13531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430796.1 protein_id gnl|my_center|LOCUS_07580 15639 14182 gene locus_tag LOCUS_07590 15639 14182 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890565.1 protein_id gnl|my_center|LOCUS_07590 16057 16971 gene locus_tag LOCUS_07600 gene nadA 16057 16971 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454668.1 protein_id gnl|my_center|LOCUS_07600 16984 18285 gene locus_tag LOCUS_07610 16984 18285 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430790.1 protein_id gnl|my_center|LOCUS_07610 >Feature sequence033 57 536 gene locus_tag LOCUS_07620 57 536 CDS product L-2-amino-thiazoline-4-carboxylic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435938.1 protein_id gnl|my_center|LOCUS_07620 601 1908 gene locus_tag LOCUS_07630 601 1908 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435936.1 protein_id gnl|my_center|LOCUS_07630 2868 3962 gene locus_tag LOCUS_07640 2868 3962 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435932.1 protein_id gnl|my_center|LOCUS_07640 3967 4167 gene locus_tag LOCUS_07650 3967 4167 CDS product PLD nuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425157.1 protein_id gnl|my_center|LOCUS_07650 4167 5084 gene locus_tag LOCUS_07660 4167 5084 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860718.1 protein_id gnl|my_center|LOCUS_07660 5081 5839 gene locus_tag LOCUS_07670 5081 5839 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435927.1 protein_id gnl|my_center|LOCUS_07670 6087 7160 gene locus_tag LOCUS_07680 6087 7160 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435926.1 protein_id gnl|my_center|LOCUS_07680 7230 7493 gene locus_tag LOCUS_07690 7230 7493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421054.1 protein_id gnl|my_center|LOCUS_07690 7699 8676 gene locus_tag LOCUS_07700 gene bioB 7699 8676 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895370.1 protein_id gnl|my_center|LOCUS_07700 8905 9918 gene locus_tag LOCUS_07710 8905 9918 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860719.1 protein_id gnl|my_center|LOCUS_07710 9960 10850 gene locus_tag LOCUS_07720 gene rbsK 9960 10850 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860720.1 protein_id gnl|my_center|LOCUS_07720 10898 11860 gene locus_tag LOCUS_07730 10898 11860 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435917.1 protein_id gnl|my_center|LOCUS_07730 11914 13425 gene locus_tag LOCUS_07740 11914 13425 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860721.1 protein_id gnl|my_center|LOCUS_07740 13409 14407 gene locus_tag LOCUS_07750 13409 14407 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860722.1 protein_id gnl|my_center|LOCUS_07750 14591 15853 gene locus_tag LOCUS_07760 14591 15853 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860723.1 protein_id gnl|my_center|LOCUS_07760 15873 16616 gene locus_tag LOCUS_07770 15873 16616 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860724.1 protein_id gnl|my_center|LOCUS_07770 16789 18174 gene locus_tag LOCUS_07780 16789 18174 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860725.1 protein_id gnl|my_center|LOCUS_07780 >Feature sequence034 1710 145 gene locus_tag LOCUS_07790 1710 145 CDS product alpha-glucoside-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861800.1 protein_id gnl|my_center|LOCUS_07790 2664 1879 gene locus_tag LOCUS_07800 2664 1879 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898125.1 protein_id gnl|my_center|LOCUS_07800 4030 2831 gene locus_tag LOCUS_07810 4030 2831 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439927.1 protein_id gnl|my_center|LOCUS_07810 5890 4553 gene locus_tag LOCUS_07820 gene xylA 5890 4553 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898127.1 protein_id gnl|my_center|LOCUS_07820 7530 5986 gene locus_tag LOCUS_07830 gene xylB 7530 5986 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170324985.1 protein_id gnl|my_center|LOCUS_07830 7744 8904 gene locus_tag LOCUS_07840 7744 8904 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891380.1 protein_id gnl|my_center|LOCUS_07840 9464 9060 gene locus_tag LOCUS_07850 9464 9060 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898137.1 protein_id gnl|my_center|LOCUS_07850 9967 9485 gene locus_tag LOCUS_07860 9967 9485 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891383.1 protein_id gnl|my_center|LOCUS_07860 10796 9987 gene locus_tag LOCUS_07870 10796 9987 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427216.1 protein_id gnl|my_center|LOCUS_07870 11568 10789 gene locus_tag LOCUS_07880 11568 10789 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431349.1 protein_id gnl|my_center|LOCUS_07880 13646 11568 gene locus_tag LOCUS_07890 13646 11568 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439934.1 protein_id gnl|my_center|LOCUS_07890 14966 14445 gene locus_tag LOCUS_07900 14966 14445 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861802.1 protein_id gnl|my_center|LOCUS_07900 15132 15698 gene locus_tag LOCUS_07910 15132 15698 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861803.1 protein_id gnl|my_center|LOCUS_07910 17978 15915 gene locus_tag LOCUS_07920 17978 15915 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013856.1 protein_id gnl|my_center|LOCUS_07920 >Feature sequence035 2596 2309 gene locus_tag LOCUS_07930 2596 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429630.1 protein_id gnl|my_center|LOCUS_07930 2891 2616 gene locus_tag LOCUS_07940 2891 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860867.1 protein_id gnl|my_center|LOCUS_07940 3707 3528 gene locus_tag LOCUS_07950 3707 3528 CDS product DUF6440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895603.1 protein_id gnl|my_center|LOCUS_07950 5458 3992 gene locus_tag LOCUS_07960 5458 3992 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860866.1 protein_id gnl|my_center|LOCUS_07960 6713 7624 gene locus_tag LOCUS_07970 6713 7624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 7974 8855 gene locus_tag LOCUS_07980 7974 8855 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022621368.1 protein_id gnl|my_center|LOCUS_07980 8903 9049 gene locus_tag LOCUS_07990 8903 9049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 12040 9473 gene locus_tag LOCUS_08000 12040 9473 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860863.1 protein_id gnl|my_center|LOCUS_08000 12648 12043 gene locus_tag LOCUS_08010 12648 12043 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860862.1 protein_id gnl|my_center|LOCUS_08010 14482 13022 gene locus_tag LOCUS_08020 14482 13022 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895591.1 protein_id gnl|my_center|LOCUS_08020 14815 15393 gene locus_tag LOCUS_08030 14815 15393 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021358883.1 protein_id gnl|my_center|LOCUS_08030 16036 15737 gene locus_tag LOCUS_08040 16036 15737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 16267 16055 gene locus_tag LOCUS_08050 16267 16055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 16723 16424 gene locus_tag LOCUS_08060 16723 16424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 16671 16934 gene locus_tag LOCUS_08070 16671 16934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 17095 17664 gene locus_tag LOCUS_08080 17095 17664 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902004.1 protein_id gnl|my_center|LOCUS_08080 >Feature sequence036 <1 630 gene locus_tag LOCUS_08090 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003417105.1:ATP-dependent Clp protease ATP-binding subunit ClpX 1228 701 gene locus_tag LOCUS_08100 1228 701 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427941.1 protein_id gnl|my_center|LOCUS_08100 1728 1216 gene locus_tag LOCUS_08110 1728 1216 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417110.1 protein_id gnl|my_center|LOCUS_08110 1908 4271 gene locus_tag LOCUS_08120 gene lon 1908 4271 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435613.1 protein_id gnl|my_center|LOCUS_08120 4261 4872 gene locus_tag LOCUS_08130 gene yihA 4261 4872 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891775.1 protein_id gnl|my_center|LOCUS_08130 6507 5137 gene locus_tag LOCUS_08140 6507 5137 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435615.1 protein_id gnl|my_center|LOCUS_08140 7085 8164 gene locus_tag LOCUS_08150 7085 8164 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435617.1 protein_id gnl|my_center|LOCUS_08150 8555 9235 gene locus_tag LOCUS_08160 8555 9235 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427945.1 protein_id gnl|my_center|LOCUS_08160 9258 10607 gene locus_tag LOCUS_08170 9258 10607 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435622.1 protein_id gnl|my_center|LOCUS_08170 10778 11863 gene locus_tag LOCUS_08180 10778 11863 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891769.1 protein_id gnl|my_center|LOCUS_08180 11917 12276 gene locus_tag LOCUS_08190 11917 12276 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891768.1 protein_id gnl|my_center|LOCUS_08190 12329 13201 gene locus_tag LOCUS_08200 12329 13201 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435627.1 protein_id gnl|my_center|LOCUS_08200 13202 13645 gene locus_tag LOCUS_08210 13202 13645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435628.1 protein_id gnl|my_center|LOCUS_08210 13660 14244 gene locus_tag LOCUS_08220 13660 14244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435629.1 protein_id gnl|my_center|LOCUS_08220 14497 15534 gene locus_tag LOCUS_08230 14497 15534 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373757.1 protein_id gnl|my_center|LOCUS_08230 15615 15980 gene locus_tag LOCUS_08240 15615 15980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417144.1 protein_id gnl|my_center|LOCUS_08240 15985 16302 gene locus_tag LOCUS_08250 15985 16302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435631.1 protein_id gnl|my_center|LOCUS_08250 >Feature sequence037 772 545 gene locus_tag LOCUS_08260 gene acpP 772 545 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418905.1 protein_id gnl|my_center|LOCUS_08260 944 1369 gene locus_tag LOCUS_08270 944 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428561.1 protein_id gnl|my_center|LOCUS_08270 1417 1623 gene locus_tag LOCUS_08280 1417 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888870.1 protein_id gnl|my_center|LOCUS_08280 1805 1984 gene locus_tag LOCUS_08290 1805 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 2018 2218 gene locus_tag LOCUS_08300 2018 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428556.1 protein_id gnl|my_center|LOCUS_08300 2471 3487 gene locus_tag LOCUS_08310 gene ccpA 2471 3487 CDS product LacI family transcriptional regulator CcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888871.1 protein_id gnl|my_center|LOCUS_08310 4008 3610 gene locus_tag LOCUS_08320 4008 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896025.1 protein_id gnl|my_center|LOCUS_08320 4220 5125 gene locus_tag LOCUS_08330 4220 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892884.1 protein_id gnl|my_center|LOCUS_08330 5603 6820 gene locus_tag LOCUS_08340 gene cdeC 5603 6820 CDS product exosporium morphogenetic protein CdeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437985.1 protein_id gnl|my_center|LOCUS_08340 8242 6920 gene locus_tag LOCUS_08350 8242 6920 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888874.1 protein_id gnl|my_center|LOCUS_08350 9087 8293 gene locus_tag LOCUS_08360 9087 8293 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896027.1 protein_id gnl|my_center|LOCUS_08360 9197 10642 gene locus_tag LOCUS_08370 9197 10642 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896029.1 protein_id gnl|my_center|LOCUS_08370 10671 10880 gene locus_tag LOCUS_08380 10671 10880 CDS product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418943.1 protein_id gnl|my_center|LOCUS_08380 10900 12294 gene locus_tag LOCUS_08390 10900 12294 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861085.1 protein_id gnl|my_center|LOCUS_08390 12534 13286 gene locus_tag LOCUS_08400 12534 13286 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861086.1 protein_id gnl|my_center|LOCUS_08400 13312 13725 gene locus_tag LOCUS_08410 13312 13725 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861087.1 protein_id gnl|my_center|LOCUS_08410 13729 14472 gene locus_tag LOCUS_08420 13729 14472 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437997.1 protein_id gnl|my_center|LOCUS_08420 14472 14942 gene locus_tag LOCUS_08430 14472 14942 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428544.1 protein_id gnl|my_center|LOCUS_08430 14959 15717 gene locus_tag LOCUS_08440 14959 15717 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888882.1 protein_id gnl|my_center|LOCUS_08440 15701 16543 gene locus_tag LOCUS_08450 15701 16543 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418955.1 protein_id gnl|my_center|LOCUS_08450 17608 16703 gene locus_tag LOCUS_08460 17608 16703 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438004.1 protein_id gnl|my_center|LOCUS_08460 >Feature sequence038 835 110 gene locus_tag LOCUS_08470 835 110 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861779.1 protein_id gnl|my_center|LOCUS_08470 1313 3412 gene locus_tag LOCUS_08480 gene nrdE 1313 3412 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861778.1 protein_id gnl|my_center|LOCUS_08480 3425 4396 gene locus_tag LOCUS_08490 gene nrdF 3425 4396 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439817.1 protein_id gnl|my_center|LOCUS_08490 4472 5098 gene locus_tag LOCUS_08500 4472 5098 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898085.1 protein_id gnl|my_center|LOCUS_08500 5493 6122 gene locus_tag LOCUS_08510 5493 6122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861777.1 protein_id gnl|my_center|LOCUS_08510 6123 6905 gene locus_tag LOCUS_08520 6123 6905 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439810.1 protein_id gnl|my_center|LOCUS_08520 6898 7776 gene locus_tag LOCUS_08530 6898 7776 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861776.1 protein_id gnl|my_center|LOCUS_08530 7809 8768 gene locus_tag LOCUS_08540 7809 8768 CDS product NrtA/SsuA/CpmA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429089.1 protein_id gnl|my_center|LOCUS_08540 9082 9774 gene locus_tag LOCUS_08550 9082 9774 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429090.1 protein_id gnl|my_center|LOCUS_08550 9784 10788 gene locus_tag LOCUS_08560 9784 10788 CDS product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439799.1 protein_id gnl|my_center|LOCUS_08560 11036 11887 gene locus_tag LOCUS_08570 11036 11887 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439797.1 protein_id gnl|my_center|LOCUS_08570 11991 12737 gene locus_tag LOCUS_08580 11991 12737 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439795.1 protein_id gnl|my_center|LOCUS_08580 12737 14653 gene locus_tag LOCUS_08590 12737 14653 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861774.1 protein_id gnl|my_center|LOCUS_08590 14962 15849 gene locus_tag LOCUS_08600 14962 15849 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861773.1 protein_id gnl|my_center|LOCUS_08600 15927 16664 gene locus_tag LOCUS_08610 gene cas6 15927 16664 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861772.1 protein_id gnl|my_center|LOCUS_08610 >Feature sequence039 239 925 gene locus_tag LOCUS_08620 239 925 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891044.1 protein_id gnl|my_center|LOCUS_08620 1020 2075 gene locus_tag LOCUS_08630 1020 2075 CDS product cell wall-binding protein Cwp7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861676.1 protein_id gnl|my_center|LOCUS_08630 2190 3746 gene locus_tag LOCUS_08640 gene murJ 2190 3746 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454106.1 protein_id gnl|my_center|LOCUS_08640 3792 5498 gene locus_tag LOCUS_08650 3792 5498 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454107.1 protein_id gnl|my_center|LOCUS_08650 5520 6593 gene locus_tag LOCUS_08660 5520 6593 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426511.1 protein_id gnl|my_center|LOCUS_08660 6605 7327 gene locus_tag LOCUS_08670 6605 7327 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426509.1 protein_id gnl|my_center|LOCUS_08670 7343 8500 gene locus_tag LOCUS_08680 7343 8500 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426507.1 protein_id gnl|my_center|LOCUS_08680 8503 9342 gene locus_tag LOCUS_08690 8503 9342 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897935.1 protein_id gnl|my_center|LOCUS_08690 9357 10532 gene locus_tag LOCUS_08700 9357 10532 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891031.1 protein_id gnl|my_center|LOCUS_08700 10561 11310 gene locus_tag LOCUS_08710 10561 11310 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422862.1 protein_id gnl|my_center|LOCUS_08710 11332 12240 gene locus_tag LOCUS_08720 11332 12240 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454111.1 protein_id gnl|my_center|LOCUS_08720 12288 13040 gene locus_tag LOCUS_08730 12288 13040 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426498.1 protein_id gnl|my_center|LOCUS_08730 13066 14361 gene locus_tag LOCUS_08740 13066 14361 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861675.1 protein_id gnl|my_center|LOCUS_08740 14367 15458 gene locus_tag LOCUS_08750 14367 15458 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431768.1 protein_id gnl|my_center|LOCUS_08750 >Feature sequence040 61 333 gene locus_tag LOCUS_08760 61 333 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435411.1 protein_id gnl|my_center|LOCUS_08760 326 877 gene locus_tag LOCUS_08770 326 877 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435395.1 protein_id gnl|my_center|LOCUS_08770 889 1980 gene locus_tag LOCUS_08780 gene eutH 889 1980 CDS product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897061.1 protein_id gnl|my_center|LOCUS_08780 1982 2455 gene locus_tag LOCUS_08790 1982 2455 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893336.1 protein_id gnl|my_center|LOCUS_08790 2971 3492 gene locus_tag LOCUS_08800 2971 3492 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679365.1 protein_id gnl|my_center|LOCUS_08800 3871 5046 gene locus_tag LOCUS_08810 3871 5046 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861090.1 protein_id gnl|my_center|LOCUS_08810 5080 6618 gene locus_tag LOCUS_08820 5080 6618 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891132.1 protein_id gnl|my_center|LOCUS_08820 6650 7852 gene locus_tag LOCUS_08830 6650 7852 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455004.1 protein_id gnl|my_center|LOCUS_08830 8618 8019 gene locus_tag LOCUS_08840 8618 8019 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357525.1 protein_id gnl|my_center|LOCUS_08840 8788 10146 gene locus_tag LOCUS_08850 8788 10146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861393.1 protein_id gnl|my_center|LOCUS_08850 10139 10771 gene locus_tag LOCUS_08860 10139 10771 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435381.1 protein_id gnl|my_center|LOCUS_08860 11100 12257 gene locus_tag LOCUS_08870 11100 12257 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435380.1 protein_id gnl|my_center|LOCUS_08870 13039 12404 gene locus_tag LOCUS_08880 gene lexA 13039 12404 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897067.1 protein_id gnl|my_center|LOCUS_08880 14270 13143 gene locus_tag LOCUS_08890 14270 13143 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435347.1 protein_id gnl|my_center|LOCUS_08890 15437 14592 gene locus_tag LOCUS_08900 15437 14592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435340.1 protein_id gnl|my_center|LOCUS_08900 15838 15467 gene locus_tag LOCUS_08910 15838 15467 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861394.1 protein_id gnl|my_center|LOCUS_08910 16251 15991 gene locus_tag LOCUS_08920 16251 15991 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428736.1 protein_id gnl|my_center|LOCUS_08920 <17232 16440 gene locus_tag LOCUS_08930 <17232 16440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009889903.1:acetyl-CoA carboxylase carboxyltransferase subunit alpha >Feature sequence041 793 38 gene locus_tag LOCUS_08940 793 38 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861082.1 protein_id gnl|my_center|LOCUS_08940 1822 812 gene locus_tag LOCUS_08950 1822 812 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428573.1 protein_id gnl|my_center|LOCUS_08950 2623 1841 gene locus_tag LOCUS_08960 2623 1841 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888867.1 protein_id gnl|my_center|LOCUS_08960 3818 2682 gene locus_tag LOCUS_08970 3818 2682 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_08970 4994 4527 gene locus_tag LOCUS_08980 4994 4527 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_08980 5615 5073 gene locus_tag LOCUS_08990 5615 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437961.1 protein_id gnl|my_center|LOCUS_08990 6353 5667 gene locus_tag LOCUS_09000 6353 5667 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892875.1 protein_id gnl|my_center|LOCUS_09000 7213 6353 gene locus_tag LOCUS_09010 7213 6353 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896018.1 protein_id gnl|my_center|LOCUS_09010 7348 8148 gene locus_tag LOCUS_09020 7348 8148 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418878.1 protein_id gnl|my_center|LOCUS_09020 8173 8742 gene locus_tag LOCUS_09030 gene yfcE 8173 8742 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428581.1 protein_id gnl|my_center|LOCUS_09030 10212 9160 gene locus_tag LOCUS_09040 10212 9160 CDS product cell wall-binding protein Cwp18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437956.1 protein_id gnl|my_center|LOCUS_09040 11645 10419 gene locus_tag LOCUS_09050 gene pepT 11645 10419 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437954.1 protein_id gnl|my_center|LOCUS_09050 12788 11736 gene locus_tag LOCUS_09060 gene ytvI 12788 11736 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437952.1 protein_id gnl|my_center|LOCUS_09060 14190 12937 gene locus_tag LOCUS_09070 14190 12937 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_09070 <16978 14321 gene locus_tag LOCUS_09080 <16978 14321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861080.1:AAA family ATPase >Feature sequence042 <1 1060 gene locus_tag LOCUS_09090 <1 1060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861594.1:glycosyltransferase 1071 2147 gene locus_tag LOCUS_09100 1071 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861593.1 protein_id gnl|my_center|LOCUS_09100 2165 3583 gene locus_tag LOCUS_09110 2165 3583 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861592.1 protein_id gnl|my_center|LOCUS_09110 3598 4806 gene locus_tag LOCUS_09120 3598 4806 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454855.1 protein_id gnl|my_center|LOCUS_09120 6268 4880 gene locus_tag LOCUS_09130 6268 4880 CDS product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861591.1 protein_id gnl|my_center|LOCUS_09130 6609 7943 gene locus_tag LOCUS_09140 6609 7943 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861590.1 protein_id gnl|my_center|LOCUS_09140 9002 8085 gene locus_tag LOCUS_09150 9002 8085 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454848.1 protein_id gnl|my_center|LOCUS_09150 9210 10094 gene locus_tag LOCUS_09160 9210 10094 CDS product DUF4846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903242.1 protein_id gnl|my_center|LOCUS_09160 10307 12148 gene locus_tag LOCUS_09170 10307 12148 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903241.1 protein_id gnl|my_center|LOCUS_09170 12453 13160 gene locus_tag LOCUS_09180 12453 13160 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861589.1 protein_id gnl|my_center|LOCUS_09180 13154 14464 gene locus_tag LOCUS_09190 13154 14464 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021362799.1 protein_id gnl|my_center|LOCUS_09190 14581 15264 gene locus_tag LOCUS_09200 14581 15264 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454838.1 protein_id gnl|my_center|LOCUS_09200 >Feature sequence043 <1 683 gene locus_tag LOCUS_09210 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009888947.1:SpoIIIAH-like family protein 793 1155 gene locus_tag LOCUS_09220 793 1155 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419170.1 protein_id gnl|my_center|LOCUS_09220 1237 1746 gene locus_tag LOCUS_09230 gene nusB 1237 1746 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428415.1 protein_id gnl|my_center|LOCUS_09230 1730 2800 gene locus_tag LOCUS_09240 1730 2800 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861140.1 protein_id gnl|my_center|LOCUS_09240 2797 4002 gene locus_tag LOCUS_09250 gene xseA 2797 4002 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438130.1 protein_id gnl|my_center|LOCUS_09250 4004 4219 gene locus_tag LOCUS_09260 gene xseB 4004 4219 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428410.1 protein_id gnl|my_center|LOCUS_09260 4222 5109 gene locus_tag LOCUS_09270 4222 5109 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_09270 5139 5576 gene locus_tag LOCUS_09280 5139 5576 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428407.1 protein_id gnl|my_center|LOCUS_09280 5610 7475 gene locus_tag LOCUS_09290 gene dxs 5610 7475 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861141.1 protein_id gnl|my_center|LOCUS_09290 7608 8420 gene locus_tag LOCUS_09300 7608 8420 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438136.1 protein_id gnl|my_center|LOCUS_09300 8440 10119 gene locus_tag LOCUS_09310 gene recN 8440 10119 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896126.1 protein_id gnl|my_center|LOCUS_09310 10334 11200 gene locus_tag LOCUS_09320 10334 11200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861142.1 protein_id gnl|my_center|LOCUS_09320 11772 11293 gene locus_tag LOCUS_09330 11772 11293 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902308.1 protein_id gnl|my_center|LOCUS_09330 12285 11845 gene locus_tag LOCUS_09340 12285 11845 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861143.1 protein_id gnl|my_center|LOCUS_09340 12446 13504 gene locus_tag LOCUS_09350 12446 13504 CDS product SpoIVB peptidase S55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438145.1 protein_id gnl|my_center|LOCUS_09350 13661 14470 gene locus_tag LOCUS_09360 gene spo0A 13661 14470 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424711.1 protein_id gnl|my_center|LOCUS_09360 14883 16004 gene locus_tag LOCUS_09370 gene steA 14883 16004 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428389.1 protein_id gnl|my_center|LOCUS_09370 16022 16897 gene locus_tag LOCUS_09380 16022 16897 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861144.1 protein_id gnl|my_center|LOCUS_09380 >Feature sequence044 629 123 gene locus_tag LOCUS_09390 629 123 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437086.1 protein_id gnl|my_center|LOCUS_09390 2071 1001 gene locus_tag LOCUS_09400 gene leuB 2071 1001 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861060.1 protein_id gnl|my_center|LOCUS_09400 2569 2078 gene locus_tag LOCUS_09410 gene leuD 2569 2078 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_09410 3861 2584 gene locus_tag LOCUS_09420 gene leuC 3861 2584 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895941.1 protein_id gnl|my_center|LOCUS_09420 5560 3818 gene locus_tag LOCUS_09430 gene leuA 5560 3818 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437098.1 protein_id gnl|my_center|LOCUS_09430 6524 6078 gene locus_tag LOCUS_09440 6524 6078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861059.1 protein_id gnl|my_center|LOCUS_09440 7264 6545 gene locus_tag LOCUS_09450 7264 6545 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895939.1 protein_id gnl|my_center|LOCUS_09450 7606 7382 gene locus_tag LOCUS_09460 7606 7382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09460 8655 7669 gene locus_tag LOCUS_09470 8655 7669 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453528.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09470 10222 8855 gene locus_tag LOCUS_09480 10222 8855 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_09480 10909 10472 gene locus_tag LOCUS_09490 10909 10472 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888743.1 protein_id gnl|my_center|LOCUS_09490 11570 10941 gene locus_tag LOCUS_09500 11570 10941 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861058.1 protein_id gnl|my_center|LOCUS_09500 12491 11604 gene locus_tag LOCUS_09510 12491 11604 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861057.1 protein_id gnl|my_center|LOCUS_09510 13740 12520 gene locus_tag LOCUS_09520 13740 12520 CDS product DUF6080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861056.1 protein_id gnl|my_center|LOCUS_09520 15284 14142 gene locus_tag LOCUS_09530 15284 14142 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949066.1 protein_id gnl|my_center|LOCUS_09530 16291 15425 gene locus_tag LOCUS_09540 16291 15425 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437125.1 protein_id gnl|my_center|LOCUS_09540 >Feature sequence045 415 969 gene locus_tag LOCUS_09550 gene tcdR 415 969 CDS product glycosylating toxin sigma factor TcdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434528.1 protein_id gnl|my_center|LOCUS_09550 1287 8387 gene locus_tag LOCUS_09560 gene tcdB 1287 8387 CDS product glycosylating toxin TcdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902069.1 protein_id gnl|my_center|LOCUS_09560 8587 9009 gene locus_tag LOCUS_09570 gene tcdE 8587 9009 CDS product holin-like glycosylating toxin export protein TcdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434540.1 protein_id gnl|my_center|LOCUS_09570 9118 9249 gene locus_tag LOCUS_09580 9118 9249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895694.1 protein_id gnl|my_center|LOCUS_09580 9737 11992 gene locus_tag LOCUS_09590 9737 11992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09590 >Feature sequence046 1893 2747 gene locus_tag LOCUS_09600 1893 2747 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891331.1 protein_id gnl|my_center|LOCUS_09600 3458 2991 gene locus_tag LOCUS_09610 3458 2991 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431999.1 protein_id gnl|my_center|LOCUS_09610 4495 3563 gene locus_tag LOCUS_09620 4495 3563 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861782.1 protein_id gnl|my_center|LOCUS_09620 5608 4664 gene locus_tag LOCUS_09630 5608 4664 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965842.1 protein_id gnl|my_center|LOCUS_09630 7388 5952 gene locus_tag LOCUS_09640 7388 5952 CDS product glycoside hydrolase family 55 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861783.1 protein_id gnl|my_center|LOCUS_09640 8998 7598 gene locus_tag LOCUS_09650 8998 7598 CDS product glycosyl hydrolase family 28-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861784.1 protein_id gnl|my_center|LOCUS_09650 10371 9025 gene locus_tag LOCUS_09660 10371 9025 CDS product glycoside hydrolase family 55 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861785.1 protein_id gnl|my_center|LOCUS_09660 11413 10739 gene locus_tag LOCUS_09670 11413 10739 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861786.1 protein_id gnl|my_center|LOCUS_09670 12220 11474 gene locus_tag LOCUS_09680 12220 11474 CDS product DUF2087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891335.1 protein_id gnl|my_center|LOCUS_09680 13049 12579 gene locus_tag LOCUS_09690 13049 12579 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439878.1 protein_id gnl|my_center|LOCUS_09690 13672 13073 gene locus_tag LOCUS_09700 13672 13073 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432026.1 protein_id gnl|my_center|LOCUS_09700 14874 13690 gene locus_tag LOCUS_09710 14874 13690 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861787.1 protein_id gnl|my_center|LOCUS_09710 16444 14867 gene locus_tag LOCUS_09720 16444 14867 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893767.1 protein_id gnl|my_center|LOCUS_09720 >Feature sequence047 <1 511 gene locus_tag LOCUS_09730 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861986.1:prepilin-type N-terminal cleavage/methylation domain-containing protein 663 2339 gene locus_tag LOCUS_09740 663 2339 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898724.1 protein_id gnl|my_center|LOCUS_09740 2351 3559 gene locus_tag LOCUS_09750 2351 3559 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892080.1 protein_id gnl|my_center|LOCUS_09750 3574 5286 gene locus_tag LOCUS_09760 3574 5286 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437881.1 protein_id gnl|my_center|LOCUS_09760 5279 6187 gene locus_tag LOCUS_09770 gene pilO 5279 6187 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437879.1 protein_id gnl|my_center|LOCUS_09770 6220 6780 gene locus_tag LOCUS_09780 6220 6780 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437877.1 protein_id gnl|my_center|LOCUS_09780 6950 6747 gene locus_tag LOCUS_09790 6950 6747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 6871 7344 gene locus_tag LOCUS_09800 6871 7344 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903805.1 protein_id gnl|my_center|LOCUS_09800 7365 8903 gene locus_tag LOCUS_09810 7365 8903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861984.1 protein_id gnl|my_center|LOCUS_09810 8999 10081 gene locus_tag LOCUS_09820 8999 10081 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861983.1 protein_id gnl|my_center|LOCUS_09820 10062 10844 gene locus_tag LOCUS_09830 10062 10844 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861982.1 protein_id gnl|my_center|LOCUS_09830 10946 11596 gene locus_tag LOCUS_09840 10946 11596 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903799.1 protein_id gnl|my_center|LOCUS_09840 11610 12170 gene locus_tag LOCUS_09850 gene pth 11610 12170 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892068.1 protein_id gnl|my_center|LOCUS_09850 12187 15573 gene locus_tag LOCUS_09860 gene mfd 12187 15573 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425912.1 protein_id gnl|my_center|LOCUS_09860 >Feature sequence048 536 796 gene locus_tag LOCUS_09870 536 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 919 1416 gene locus_tag LOCUS_09880 gene atpF 919 1416 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892033.1 protein_id gnl|my_center|LOCUS_09880 1413 1958 gene locus_tag LOCUS_09890 1413 1958 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425856.1 protein_id gnl|my_center|LOCUS_09890 1975 3477 gene locus_tag LOCUS_09900 gene atpA 1975 3477 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421367.1 protein_id gnl|my_center|LOCUS_09900 3505 4383 gene locus_tag LOCUS_09910 gene atpG 3505 4383 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_09910 4396 5790 gene locus_tag LOCUS_09920 gene atpD 4396 5790 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425850.1 protein_id gnl|my_center|LOCUS_09920 5793 6053 gene locus_tag LOCUS_09930 gene atpC 5793 6053 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425849.1 protein_id gnl|my_center|LOCUS_09930 6515 6895 gene locus_tag LOCUS_09940 gene acpS 6515 6895 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861979.1 protein_id gnl|my_center|LOCUS_09940 6910 7371 gene locus_tag LOCUS_09950 6910 7371 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421362.1 protein_id gnl|my_center|LOCUS_09950 7392 7982 gene locus_tag LOCUS_09960 gene gerS 7392 7982 CDS product germination lipoprotein GerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892025.1 protein_id gnl|my_center|LOCUS_09960 7997 9154 gene locus_tag LOCUS_09970 gene alr 7997 9154 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437830.1 protein_id gnl|my_center|LOCUS_09970 9187 9474 gene locus_tag LOCUS_09980 9187 9474 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421359.1 protein_id gnl|my_center|LOCUS_09980 9434 9826 gene locus_tag LOCUS_09990 9434 9826 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421356.1 protein_id gnl|my_center|LOCUS_09990 9997 10824 gene locus_tag LOCUS_10000 9997 10824 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421354.1 protein_id gnl|my_center|LOCUS_10000 10817 11758 gene locus_tag LOCUS_10010 10817 11758 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_10010 12181 13275 gene locus_tag LOCUS_10020 12181 13275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437819.1 protein_id gnl|my_center|LOCUS_10020 13501 13917 gene locus_tag LOCUS_10030 13501 13917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894025.1 protein_id gnl|my_center|LOCUS_10030 14668 14099 gene locus_tag LOCUS_10040 14668 14099 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437817.1 protein_id gnl|my_center|LOCUS_10040 >Feature sequence049 416 2086 gene locus_tag LOCUS_10050 gene pdcB 416 2086 CDS product phosphodiesterase PdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437448.1 protein_id gnl|my_center|LOCUS_10050 2942 2208 gene locus_tag LOCUS_10060 gene pflA 2942 2208 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860950.1 protein_id gnl|my_center|LOCUS_10060 5333 3102 gene locus_tag LOCUS_10070 gene pflB 5333 3102 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437454.1 protein_id gnl|my_center|LOCUS_10070 5692 6687 gene locus_tag LOCUS_10080 5692 6687 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902145.1 protein_id gnl|my_center|LOCUS_10080 6778 7854 gene locus_tag LOCUS_10090 6778 7854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10090 8023 8391 gene locus_tag LOCUS_10100 8023 8391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10100 8666 10651 gene locus_tag LOCUS_10110 8666 10651 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860951.1 protein_id gnl|my_center|LOCUS_10110 10656 11090 gene locus_tag LOCUS_10120 10656 11090 CDS product transcriptional regulator GutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437466.1 protein_id gnl|my_center|LOCUS_10120 11119 11679 gene locus_tag LOCUS_10130 11119 11679 CDS product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418408.1 protein_id gnl|my_center|LOCUS_10130 11743 12111 gene locus_tag LOCUS_10140 11743 12111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10140 12136 12702 gene locus_tag LOCUS_10150 12136 12702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10150 12743 13108 gene locus_tag LOCUS_10160 12743 13108 CDS product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437468.1 protein_id gnl|my_center|LOCUS_10160 13209 13982 gene locus_tag LOCUS_10170 gene srlD 13209 13982 CDS product sorbitol-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895815.1 protein_id gnl|my_center|LOCUS_10170 >Feature sequence050 392 1504 gene locus_tag LOCUS_10180 392 1504 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861701.1 protein_id gnl|my_center|LOCUS_10180 2386 1877 gene locus_tag LOCUS_10190 2386 1877 CDS product YjiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861702.1 protein_id gnl|my_center|LOCUS_10190 3035 2388 gene locus_tag LOCUS_10200 3035 2388 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431751.1 protein_id gnl|my_center|LOCUS_10200 4221 3049 gene locus_tag LOCUS_10210 4221 3049 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861703.1 protein_id gnl|my_center|LOCUS_10210 4489 5865 gene locus_tag LOCUS_10220 4489 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436150.1 protein_id gnl|my_center|LOCUS_10220 6451 6116 gene locus_tag LOCUS_10230 6451 6116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 7332 6802 gene locus_tag LOCUS_10240 7332 6802 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436147.1 protein_id gnl|my_center|LOCUS_10240 8514 7420 gene locus_tag LOCUS_10250 8514 7420 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861704.1 protein_id gnl|my_center|LOCUS_10250 8962 8516 gene locus_tag LOCUS_10260 8962 8516 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436142.1 protein_id gnl|my_center|LOCUS_10260 9268 10458 gene locus_tag LOCUS_10270 9268 10458 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436139.1 protein_id gnl|my_center|LOCUS_10270 10628 11590 gene locus_tag LOCUS_10280 10628 11590 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897998.1 protein_id gnl|my_center|LOCUS_10280 12374 11712 gene locus_tag LOCUS_10290 gene zmp1 12374 11712 CDS product zinc metalloprotease Zmp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861706.1 protein_id gnl|my_center|LOCUS_10290 <15305 12745 gene locus_tag LOCUS_10300 <15305 12745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861707.1:SrtB-anchored collagen-binding adhesin >Feature sequence051 436 1113 gene locus_tag LOCUS_10310 436 1113 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896673.1 protein_id gnl|my_center|LOCUS_10310 1287 3323 gene locus_tag LOCUS_10320 1287 3323 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861254.1 protein_id gnl|my_center|LOCUS_10320 4080 3514 gene locus_tag LOCUS_10330 4080 3514 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889452.1 protein_id gnl|my_center|LOCUS_10330 4368 5303 gene locus_tag LOCUS_10340 4368 5303 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436568.1 protein_id gnl|my_center|LOCUS_10340 5768 6982 gene locus_tag LOCUS_10350 5768 6982 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861257.1 protein_id gnl|my_center|LOCUS_10350 7922 7401 gene locus_tag LOCUS_10360 7922 7401 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861258.1 protein_id gnl|my_center|LOCUS_10360 8278 9075 gene locus_tag LOCUS_10370 8278 9075 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861259.1 protein_id gnl|my_center|LOCUS_10370 9185 9775 gene locus_tag LOCUS_10380 9185 9775 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436558.1 protein_id gnl|my_center|LOCUS_10380 9841 11538 gene locus_tag LOCUS_10390 9841 11538 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896733.1 protein_id gnl|my_center|LOCUS_10390 11752 12591 gene locus_tag LOCUS_10400 11752 12591 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861260.1 protein_id gnl|my_center|LOCUS_10400 >Feature sequence052 353 1573 gene locus_tag LOCUS_10410 353 1573 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860656.1 protein_id gnl|my_center|LOCUS_10410 1610 2959 gene locus_tag LOCUS_10420 1610 2959 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860655.1 protein_id gnl|my_center|LOCUS_10420 3073 3636 gene locus_tag LOCUS_10430 3073 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 6077 3744 gene locus_tag LOCUS_10440 6077 3744 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948492.1 protein_id gnl|my_center|LOCUS_10440 6757 6074 gene locus_tag LOCUS_10450 6757 6074 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399472.1 protein_id gnl|my_center|LOCUS_10450 8069 6828 gene locus_tag LOCUS_10460 8069 6828 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948495.1 protein_id gnl|my_center|LOCUS_10460 8766 8080 gene locus_tag LOCUS_10470 8766 8080 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861224.1 protein_id gnl|my_center|LOCUS_10470 9348 9004 gene locus_tag LOCUS_10480 9348 9004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 12186 9679 gene locus_tag LOCUS_10490 12186 9679 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861587.1 protein_id gnl|my_center|LOCUS_10490 12857 12195 gene locus_tag LOCUS_10500 12857 12195 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399472.1 protein_id gnl|my_center|LOCUS_10500 14455 13988 gene locus_tag LOCUS_10510 14455 13988 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860652.1 protein_id gnl|my_center|LOCUS_10510 >Feature sequence053 <1 1300 gene locus_tag LOCUS_10520 <1 1300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009898090.1:FAD-dependent oxidoreductase 1962 2384 gene locus_tag LOCUS_10530 1962 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 2626 2312 gene locus_tag LOCUS_10540 2626 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 2520 3371 gene locus_tag LOCUS_10550 2520 3371 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431686.1 protein_id gnl|my_center|LOCUS_10550 4671 3526 gene locus_tag LOCUS_10560 4671 3526 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439845.1 protein_id gnl|my_center|LOCUS_10560 5781 5005 gene locus_tag LOCUS_10570 5781 5005 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439844.1 protein_id gnl|my_center|LOCUS_10570 6363 7337 gene locus_tag LOCUS_10580 6363 7337 CDS product 2-keto-3-deoxygluconate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422586.1 protein_id gnl|my_center|LOCUS_10580 7435 7740 gene locus_tag LOCUS_10590 7435 7740 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439843.1 protein_id gnl|my_center|LOCUS_10590 7896 9056 gene locus_tag LOCUS_10600 7896 9056 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439842.1 protein_id gnl|my_center|LOCUS_10600 9106 10008 gene locus_tag LOCUS_10610 9106 10008 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439841.1 protein_id gnl|my_center|LOCUS_10610 10088 10981 gene locus_tag LOCUS_10620 10088 10981 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439840.1 protein_id gnl|my_center|LOCUS_10620 11443 12573 gene locus_tag LOCUS_10630 11443 12573 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373662.1 protein_id gnl|my_center|LOCUS_10630 12645 13670 gene locus_tag LOCUS_10640 12645 13670 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453864.1 protein_id gnl|my_center|LOCUS_10640 13673 14869 gene locus_tag LOCUS_10650 13673 14869 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439823.1 protein_id gnl|my_center|LOCUS_10650 >Feature sequence054 582 1040 gene locus_tag LOCUS_10660 582 1040 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889503.1 protein_id gnl|my_center|LOCUS_10660 1044 2006 gene locus_tag LOCUS_10670 1044 2006 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902652.1 protein_id gnl|my_center|LOCUS_10670 2000 2749 gene locus_tag LOCUS_10680 2000 2749 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021359211.1 protein_id gnl|my_center|LOCUS_10680 3117 2815 gene locus_tag LOCUS_10690 3117 2815 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436486.1 protein_id gnl|my_center|LOCUS_10690 3888 3256 gene locus_tag LOCUS_10700 gene thiE 3888 3256 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436488.1 protein_id gnl|my_center|LOCUS_10700 4699 3911 gene locus_tag LOCUS_10710 gene thiM 4699 3911 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861269.1 protein_id gnl|my_center|LOCUS_10710 5517 4723 gene locus_tag LOCUS_10720 gene thiD 5517 4723 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436492.1 protein_id gnl|my_center|LOCUS_10720 6113 5802 gene locus_tag LOCUS_10730 6113 5802 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889495.1 protein_id gnl|my_center|LOCUS_10730 6404 7648 gene locus_tag LOCUS_10740 6404 7648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021359208.1 protein_id gnl|my_center|LOCUS_10740 7845 8714 gene locus_tag LOCUS_10750 7845 8714 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430012.1 protein_id gnl|my_center|LOCUS_10750 8956 8768 gene locus_tag LOCUS_10760 8956 8768 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430011.1 protein_id gnl|my_center|LOCUS_10760 9706 9116 gene locus_tag LOCUS_10770 gene cysE 9706 9116 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889486.1 protein_id gnl|my_center|LOCUS_10770 10641 9733 gene locus_tag LOCUS_10780 gene cysK 10641 9733 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436514.1 protein_id gnl|my_center|LOCUS_10780 11504 10878 gene locus_tag LOCUS_10790 11504 10878 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896752.1 protein_id gnl|my_center|LOCUS_10790 13580 11523 gene locus_tag LOCUS_10800 gene kdpB 13580 11523 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430007.1 protein_id gnl|my_center|LOCUS_10800 <14631 13605 gene locus_tag LOCUS_10810 <14631 13605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_161471071.1:potassium-transporting ATPase subunit KdpA >Feature sequence055 1796 510 gene locus_tag LOCUS_10820 1796 510 CDS product glycine/sarcosine/betaine reductase component B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416871.1 protein_id gnl|my_center|LOCUS_10820 2382 2065 gene locus_tag LOCUS_10830 2382 2065 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416870.1 protein_id gnl|my_center|LOCUS_10830 3414 2467 gene locus_tag LOCUS_10840 gene trxB 3414 2467 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416869.1 protein_id gnl|my_center|LOCUS_10840 3880 3509 gene locus_tag LOCUS_10850 3880 3509 CDS product GrdX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897539.1 protein_id gnl|my_center|LOCUS_10850 6120 4426 gene locus_tag LOCUS_10860 6120 4426 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861536.1 protein_id gnl|my_center|LOCUS_10860 6613 7434 gene locus_tag LOCUS_10870 gene yidA 6613 7434 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861537.1 protein_id gnl|my_center|LOCUS_10870 7719 7570 gene locus_tag LOCUS_10880 7719 7570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430761.1 protein_id gnl|my_center|LOCUS_10880 8211 7726 gene locus_tag LOCUS_10890 gene saoL 8211 7726 CDS product MerB-like organometallic lyase SaoL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357410.1 protein_id gnl|my_center|LOCUS_10890 8976 8224 gene locus_tag LOCUS_10900 gene saoA 8976 8224 CDS product ABC transporter ATP-binding protein SaoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430772.1 protein_id gnl|my_center|LOCUS_10900 9782 9153 gene locus_tag LOCUS_10910 9782 9153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10910 10306 9743 gene locus_tag LOCUS_10920 gene saoB 10306 9743 CDS product ABC transporter substrate-binding (seleno)protein SaoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897547.1 protein_id gnl|my_center|LOCUS_10920 10531 10316 gene locus_tag LOCUS_10930 10531 10316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897548.1 protein_id gnl|my_center|LOCUS_10930 11636 10545 gene locus_tag LOCUS_10940 gene saoX 11636 10545 CDS product ABC transporter substrate-binding subunit SaoX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454662.1 protein_id gnl|my_center|LOCUS_10940 12123 11665 gene locus_tag LOCUS_10950 gene saoC 12123 11665 CDS product Cys-Cys-COOH (seleno)protein SaoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416836.1 protein_id gnl|my_center|LOCUS_10950 13201 12116 gene locus_tag LOCUS_10960 gene saoE 13201 12116 CDS product efflux transporter SaoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454664.1 protein_id gnl|my_center|LOCUS_10960 13413 13228 gene locus_tag LOCUS_10970 gene saoT 13413 13228 CDS product thioredoxin-like (seleno)protein SaoT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432954.1 protein_id gnl|my_center|LOCUS_10970 13907 13575 gene locus_tag LOCUS_10980 gene saoD 13907 13575 CDS product DsrE-related protein SaoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430785.1 protein_id gnl|my_center|LOCUS_10980 14342 14163 gene locus_tag LOCUS_10990 14342 14163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 >Feature sequence056 740 390 gene locus_tag LOCUS_11000 740 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432237.1 protein_id gnl|my_center|LOCUS_11000 1172 756 gene locus_tag LOCUS_11010 1172 756 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418377.1 protein_id gnl|my_center|LOCUS_11010 1382 1191 gene locus_tag LOCUS_11020 1382 1191 CDS product CooT family nickel-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418375.1 protein_id gnl|my_center|LOCUS_11020 2348 1533 gene locus_tag LOCUS_11030 2348 1533 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436933.1 protein_id gnl|my_center|LOCUS_11030 3333 2395 gene locus_tag LOCUS_11040 3333 2395 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860937.1 protein_id gnl|my_center|LOCUS_11040 4202 3330 gene locus_tag LOCUS_11050 4202 3330 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436928.1 protein_id gnl|my_center|LOCUS_11050 6155 4227 gene locus_tag LOCUS_11060 gene acsV 6155 4227 CDS product corrinoid activation/regeneration protein AcsV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436926.1 protein_id gnl|my_center|LOCUS_11060 6644 6267 gene locus_tag LOCUS_11070 gene gcvH 6644 6267 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418363.1 protein_id gnl|my_center|LOCUS_11070 8857 6731 gene locus_tag LOCUS_11080 gene acsB 8857 6731 CDS product acetyl-CoA decarbonylase/synthase complex subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418359.1 protein_id gnl|my_center|LOCUS_11080 9720 8914 gene locus_tag LOCUS_11090 gene acsE 9720 8914 CDS product carbon monoxide dehydrogenase/acetyl-CoA synthase methytransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418356.1 protein_id gnl|my_center|LOCUS_11090 11137 9770 gene locus_tag LOCUS_11100 gene acsC 11137 9770 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436924.1 protein_id gnl|my_center|LOCUS_11100 12112 11168 gene locus_tag LOCUS_11110 gene acsD 12112 11168 CDS product acetyl-CoA decarbonylase/synthase complex subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432254.1 protein_id gnl|my_center|LOCUS_11110 12902 12132 gene locus_tag LOCUS_11120 12902 12132 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418348.1 protein_id gnl|my_center|LOCUS_11120 14178 12958 gene locus_tag LOCUS_11130 gene lpdA 14178 12958 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436922.1 protein_id gnl|my_center|LOCUS_11130 >Feature sequence057 1216 278 gene locus_tag LOCUS_11140 1216 278 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861865.1 protein_id gnl|my_center|LOCUS_11140 1602 1327 gene locus_tag LOCUS_11150 1602 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11150 2485 1988 gene locus_tag LOCUS_11160 2485 1988 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434976.1 protein_id gnl|my_center|LOCUS_11160 2953 2591 gene locus_tag LOCUS_11170 2953 2591 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898297.1 protein_id gnl|my_center|LOCUS_11170 3585 2971 gene locus_tag LOCUS_11180 3585 2971 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891568.1 protein_id gnl|my_center|LOCUS_11180 4181 6316 gene locus_tag LOCUS_11190 gene rnr 4181 6316 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434984.1 protein_id gnl|my_center|LOCUS_11190 7452 7943 gene locus_tag LOCUS_11200 7452 7943 CDS product YfbM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861863.1 protein_id gnl|my_center|LOCUS_11200 8472 9344 gene locus_tag LOCUS_11210 8472 9344 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433732.1 protein_id gnl|my_center|LOCUS_11210 9341 10630 gene locus_tag LOCUS_11220 9341 10630 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861862.1 protein_id gnl|my_center|LOCUS_11220 10560 11204 gene locus_tag LOCUS_11230 10560 11204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032507490.1 protein_id gnl|my_center|LOCUS_11230 11935 11471 gene locus_tag LOCUS_11240 11935 11471 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861860.1 protein_id gnl|my_center|LOCUS_11240 13784 12957 gene locus_tag LOCUS_11250 13784 12957 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861859.1 protein_id gnl|my_center|LOCUS_11250 >Feature sequence058 <1 696 gene locus_tag LOCUS_11260 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004453963.1:2-oxo acid dehydrogenase subunit E2 863 2593 gene locus_tag LOCUS_11270 gene lpdA 863 2593 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860626.1 protein_id gnl|my_center|LOCUS_11270 3007 5955 gene locus_tag LOCUS_11280 3007 5955 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373571.1 protein_id gnl|my_center|LOCUS_11280 5933 6397 gene locus_tag LOCUS_11290 5933 6397 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892531.1 protein_id gnl|my_center|LOCUS_11290 6525 6812 gene locus_tag LOCUS_11300 6525 6812 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453958.1 protein_id gnl|my_center|LOCUS_11300 6889 8238 gene locus_tag LOCUS_11310 6889 8238 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887822.1 protein_id gnl|my_center|LOCUS_11310 8273 8746 gene locus_tag LOCUS_11320 8273 8746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860628.1 protein_id gnl|my_center|LOCUS_11320 8918 9568 gene locus_tag LOCUS_11330 8918 9568 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453954.1 protein_id gnl|my_center|LOCUS_11330 9742 10674 gene locus_tag LOCUS_11340 9742 10674 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453953.1 protein_id gnl|my_center|LOCUS_11340 10948 11661 gene locus_tag LOCUS_11350 gene ispD 10948 11661 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860629.1 protein_id gnl|my_center|LOCUS_11350 11658 12143 gene locus_tag LOCUS_11360 gene ispF 11658 12143 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425513.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence059 178 462 gene locus_tag LOCUS_11370 178 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 2223 559 gene locus_tag LOCUS_11380 2223 559 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438168.1 protein_id gnl|my_center|LOCUS_11380 3542 2295 gene locus_tag LOCUS_11390 3542 2295 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_11390 4203 3529 gene locus_tag LOCUS_11400 4203 3529 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438166.1 protein_id gnl|my_center|LOCUS_11400 5454 4375 gene locus_tag LOCUS_11410 gene mltG 5454 4375 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438164.1 protein_id gnl|my_center|LOCUS_11410 6982 5657 gene locus_tag LOCUS_11420 6982 5657 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896135.1 protein_id gnl|my_center|LOCUS_11420 7998 7186 gene locus_tag LOCUS_11430 7998 7186 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861146.1 protein_id gnl|my_center|LOCUS_11430 9217 8045 gene locus_tag LOCUS_11440 9217 8045 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861145.1 protein_id gnl|my_center|LOCUS_11440 10173 9259 gene locus_tag LOCUS_11450 10173 9259 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428375.1 protein_id gnl|my_center|LOCUS_11450 10790 10185 gene locus_tag LOCUS_11460 10790 10185 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902311.1 protein_id gnl|my_center|LOCUS_11460 11394 10858 gene locus_tag LOCUS_11470 11394 10858 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428379.1 protein_id gnl|my_center|LOCUS_11470 12463 11396 gene locus_tag LOCUS_11480 12463 11396 CDS product DUF3866 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896132.1 protein_id gnl|my_center|LOCUS_11480 13292 12468 gene locus_tag LOCUS_11490 13292 12468 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419210.1 protein_id gnl|my_center|LOCUS_11490 <13935 13300 gene locus_tag LOCUS_11500 <13935 13300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003438150.1:glycosyltransferase family 2 protein >Feature sequence060 <1 1018 gene locus_tag LOCUS_11510 <1 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437772.1:nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase 1050 1610 gene locus_tag LOCUS_11520 gene cobU 1050 1610 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891982.1 protein_id gnl|my_center|LOCUS_11520 1620 2393 gene locus_tag LOCUS_11530 gene cobS 1620 2393 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437766.1 protein_id gnl|my_center|LOCUS_11530 2413 3027 gene locus_tag LOCUS_11540 2413 3027 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861969.1 protein_id gnl|my_center|LOCUS_11540 3388 4902 gene locus_tag LOCUS_11550 3388 4902 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437761.1 protein_id gnl|my_center|LOCUS_11550 4941 6317 gene locus_tag LOCUS_11560 4941 6317 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861968.1 protein_id gnl|my_center|LOCUS_11560 6318 7289 gene locus_tag LOCUS_11570 gene cbiB 6318 7289 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861967.1 protein_id gnl|my_center|LOCUS_11570 7321 8391 gene locus_tag LOCUS_11580 7321 8391 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861966.1 protein_id gnl|my_center|LOCUS_11580 8393 9280 gene locus_tag LOCUS_11590 8393 9280 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861965.1 protein_id gnl|my_center|LOCUS_11590 9268 9900 gene locus_tag LOCUS_11600 9268 9900 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437747.1 protein_id gnl|my_center|LOCUS_11600 9909 11135 gene locus_tag LOCUS_11610 gene cbiD 9909 11135 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861964.1 protein_id gnl|my_center|LOCUS_11610 11132 11740 gene locus_tag LOCUS_11620 11132 11740 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437741.1 protein_id gnl|my_center|LOCUS_11620 11730 12305 gene locus_tag LOCUS_11630 11730 12305 CDS product decarboxylating cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898664.1 protein_id gnl|my_center|LOCUS_11630 12298 13050 gene locus_tag LOCUS_11640 12298 13050 CDS product cobalt-precorrin-4 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891957.1 protein_id gnl|my_center|LOCUS_11640 >Feature sequence061 <1 968 gene locus_tag LOCUS_11650 <1 968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016728698.1:NADP-dependent malic enzyme 1260 1649 gene locus_tag LOCUS_11660 1260 1649 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021359045.1 protein_id gnl|my_center|LOCUS_11660 1799 2062 gene locus_tag LOCUS_11670 1799 2062 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418727.1 protein_id gnl|my_center|LOCUS_11670 3033 2191 gene locus_tag LOCUS_11680 3033 2191 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888767.1 protein_id gnl|my_center|LOCUS_11680 3328 4062 gene locus_tag LOCUS_11690 3328 4062 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437044.1 protein_id gnl|my_center|LOCUS_11690 4072 5205 gene locus_tag LOCUS_11700 gene nagA 4072 5205 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861065.1 protein_id gnl|my_center|LOCUS_11700 5304 6053 gene locus_tag LOCUS_11710 gene nagB 5304 6053 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437039.1 protein_id gnl|my_center|LOCUS_11710 6604 6185 gene locus_tag LOCUS_11720 6604 6185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895962.1 protein_id gnl|my_center|LOCUS_11720 7160 7864 gene locus_tag LOCUS_11730 7160 7864 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437036.1 protein_id gnl|my_center|LOCUS_11730 7866 9353 gene locus_tag LOCUS_11740 7866 9353 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437034.1 protein_id gnl|my_center|LOCUS_11740 10027 9650 gene locus_tag LOCUS_11750 10027 9650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 9912 11171 gene locus_tag LOCUS_11760 9912 11171 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437032.1 protein_id gnl|my_center|LOCUS_11760 12364 11534 gene locus_tag LOCUS_11770 12364 11534 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895974.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence062 1659 475 gene locus_tag LOCUS_11780 1659 475 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373551.1 protein_id gnl|my_center|LOCUS_11780 2821 1763 gene locus_tag LOCUS_11790 2821 1763 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433992.1 protein_id gnl|my_center|LOCUS_11790 3679 3035 gene locus_tag LOCUS_11800 3679 3035 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861468.1 protein_id gnl|my_center|LOCUS_11800 3867 4490 gene locus_tag LOCUS_11810 gene ytaF 3867 4490 CDS product sporulation membrane protein YtaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861469.1 protein_id gnl|my_center|LOCUS_11810 6463 4553 gene locus_tag LOCUS_11820 6463 4553 CDS product mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861470.1 protein_id gnl|my_center|LOCUS_11820 8064 6997 gene locus_tag LOCUS_11830 8064 6997 CDS product RNA ligase RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861471.1 protein_id gnl|my_center|LOCUS_11830 9284 8310 gene locus_tag LOCUS_11840 9284 8310 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897294.1 protein_id gnl|my_center|LOCUS_11840 10823 9564 gene locus_tag LOCUS_11850 10823 9564 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861472.1 protein_id gnl|my_center|LOCUS_11850 11692 11063 gene locus_tag LOCUS_11860 11692 11063 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433980.1 protein_id gnl|my_center|LOCUS_11860 12046 11885 gene locus_tag LOCUS_11870 12046 11885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424559.1 protein_id gnl|my_center|LOCUS_11870 13485 12388 gene locus_tag LOCUS_11880 13485 12388 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430586.1 protein_id gnl|my_center|LOCUS_11880 >Feature sequence063 139 2328 gene locus_tag LOCUS_11890 139 2328 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438236.1 protein_id gnl|my_center|LOCUS_11890 2396 3163 gene locus_tag LOCUS_11900 2396 3163 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_11900 3221 4237 gene locus_tag LOCUS_11910 3221 4237 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438242.1 protein_id gnl|my_center|LOCUS_11910 4303 4551 gene locus_tag LOCUS_11920 4303 4551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419369.1 protein_id gnl|my_center|LOCUS_11920 5223 4726 gene locus_tag LOCUS_11930 5223 4726 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896172.1 protein_id gnl|my_center|LOCUS_11930 6531 5467 gene locus_tag LOCUS_11940 6531 5467 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902389.1 protein_id gnl|my_center|LOCUS_11940 7631 6534 gene locus_tag LOCUS_11950 7631 6534 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861163.1 protein_id gnl|my_center|LOCUS_11950 8580 7645 gene locus_tag LOCUS_11960 8580 7645 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902391.1 protein_id gnl|my_center|LOCUS_11960 9356 8709 gene locus_tag LOCUS_11970 9356 8709 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896181.1 protein_id gnl|my_center|LOCUS_11970 10512 9349 gene locus_tag LOCUS_11980 10512 9349 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896183.1 protein_id gnl|my_center|LOCUS_11980 10696 11040 gene locus_tag LOCUS_11990 10696 11040 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438259.1 protein_id gnl|my_center|LOCUS_11990 11071 12672 gene locus_tag LOCUS_12000 11071 12672 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902393.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence064 929 228 gene locus_tag LOCUS_12010 929 228 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860731.1 protein_id gnl|my_center|LOCUS_12010 1110 922 gene locus_tag LOCUS_12020 1110 922 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434206.1 protein_id gnl|my_center|LOCUS_12020 1338 2267 gene locus_tag LOCUS_12030 1338 2267 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434205.1 protein_id gnl|my_center|LOCUS_12030 2281 4053 gene locus_tag LOCUS_12040 2281 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860733.1 protein_id gnl|my_center|LOCUS_12040 4559 5311 gene locus_tag LOCUS_12050 4559 5311 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895388.1 protein_id gnl|my_center|LOCUS_12050 5301 5585 gene locus_tag LOCUS_12060 5301 5585 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895390.1 protein_id gnl|my_center|LOCUS_12060 5588 6286 gene locus_tag LOCUS_12070 gene cbiQ 5588 6286 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434199.1 protein_id gnl|my_center|LOCUS_12070 6279 7097 gene locus_tag LOCUS_12080 6279 7097 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895392.1 protein_id gnl|my_center|LOCUS_12080 7352 9616 gene locus_tag LOCUS_12090 7352 9616 CDS product DUF3553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888186.1 protein_id gnl|my_center|LOCUS_12090 9633 10931 gene locus_tag LOCUS_12100 9633 10931 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434194.1 protein_id gnl|my_center|LOCUS_12100 10962 11714 gene locus_tag LOCUS_12110 10962 11714 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434193.1 protein_id gnl|my_center|LOCUS_12110 11779 12303 gene locus_tag LOCUS_12120 11779 12303 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence065 <1 880 gene locus_tag LOCUS_12130 <1 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861686.1:S-layer protein SlpA 1116 3461 gene locus_tag LOCUS_12140 gene secA 1116 3461 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861685.1 protein_id gnl|my_center|LOCUS_12140 3876 5747 gene locus_tag LOCUS_12150 3876 5747 CDS product cell wall-binding protein Cwp2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861684.1 protein_id gnl|my_center|LOCUS_12150 5854 6561 gene locus_tag LOCUS_12160 5854 6561 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861683.1 protein_id gnl|my_center|LOCUS_12160 6594 8429 gene locus_tag LOCUS_12170 6594 8429 CDS product cell wall-binding protein Cwp66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861682.1 protein_id gnl|my_center|LOCUS_12170 8872 8477 gene locus_tag LOCUS_12180 8872 8477 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861681.1 protein_id gnl|my_center|LOCUS_12180 9100 11511 gene locus_tag LOCUS_12190 9100 11511 CDS product cell wall-binding cysteine protease Cwp84 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861680.1 protein_id gnl|my_center|LOCUS_12190 11808 13385 gene locus_tag LOCUS_12200 11808 13385 CDS product cell wall-binding protein Cwp5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861679.1 protein_id gnl|my_center|LOCUS_12200 >Feature sequence066 431 303 gene locus_tag LOCUS_12210 431 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 439 1443 gene locus_tag LOCUS_12220 439 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 1546 2628 gene locus_tag LOCUS_12230 1546 2628 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434053.1 protein_id gnl|my_center|LOCUS_12230 2777 2938 gene locus_tag LOCUS_12240 2777 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434055.1 protein_id gnl|my_center|LOCUS_12240 3279 4547 gene locus_tag LOCUS_12250 3279 4547 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433135.1 protein_id gnl|my_center|LOCUS_12250 4742 5530 gene locus_tag LOCUS_12260 4742 5530 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434058.1 protein_id gnl|my_center|LOCUS_12260 5530 5979 gene locus_tag LOCUS_12270 5530 5979 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434060.1 protein_id gnl|my_center|LOCUS_12270 5983 8247 gene locus_tag LOCUS_12280 5983 8247 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897245.1 protein_id gnl|my_center|LOCUS_12280 8387 8698 gene locus_tag LOCUS_12290 8387 8698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433131.1 protein_id gnl|my_center|LOCUS_12290 8984 9484 gene locus_tag LOCUS_12300 8984 9484 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434065.1 protein_id gnl|my_center|LOCUS_12300 9559 10527 gene locus_tag LOCUS_12310 9559 10527 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893441.1 protein_id gnl|my_center|LOCUS_12310 10577 11299 gene locus_tag LOCUS_12320 10577 11299 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861452.1 protein_id gnl|my_center|LOCUS_12320 11328 13262 gene locus_tag LOCUS_12330 11328 13262 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434070.1 protein_id gnl|my_center|LOCUS_12330 >Feature sequence067 536 1927 gene locus_tag LOCUS_12340 536 1927 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430410.1 protein_id gnl|my_center|LOCUS_12340 2180 3973 gene locus_tag LOCUS_12350 2180 3973 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897431.1 protein_id gnl|my_center|LOCUS_12350 5436 4054 gene locus_tag LOCUS_12360 5436 4054 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897429.1 protein_id gnl|my_center|LOCUS_12360 5694 6041 gene locus_tag LOCUS_12370 5694 6041 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440244.1 protein_id gnl|my_center|LOCUS_12370 6059 7093 gene locus_tag LOCUS_12380 6059 7093 CDS product DUF6398 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440238.1 protein_id gnl|my_center|LOCUS_12380 8191 7142 gene locus_tag LOCUS_12390 8191 7142 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_12390 8466 10001 gene locus_tag LOCUS_12400 8466 10001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440234.1 protein_id gnl|my_center|LOCUS_12400 10872 10186 gene locus_tag LOCUS_12410 10872 10186 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440228.1 protein_id gnl|my_center|LOCUS_12410 10997 12379 gene locus_tag LOCUS_12420 10997 12379 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440226.1 protein_id gnl|my_center|LOCUS_12420 >Feature sequence068 2164 863 gene locus_tag LOCUS_12430 2164 863 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435718.1 protein_id gnl|my_center|LOCUS_12430 3089 2388 gene locus_tag LOCUS_12440 3089 2388 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435717.1 protein_id gnl|my_center|LOCUS_12440 3619 3302 gene locus_tag LOCUS_12450 3619 3302 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435715.1 protein_id gnl|my_center|LOCUS_12450 3978 3667 gene locus_tag LOCUS_12460 3978 3667 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429250.1 protein_id gnl|my_center|LOCUS_12460 4606 4127 gene locus_tag LOCUS_12470 gene rlmH 4606 4127 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435703.1 protein_id gnl|my_center|LOCUS_12470 6776 4674 gene locus_tag LOCUS_12480 6776 4674 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435700.1 protein_id gnl|my_center|LOCUS_12480 7586 6789 gene locus_tag LOCUS_12490 7586 6789 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435698.1 protein_id gnl|my_center|LOCUS_12490 9151 7688 gene locus_tag LOCUS_12500 9151 7688 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892302.1 protein_id gnl|my_center|LOCUS_12500 9276 10334 gene locus_tag LOCUS_12510 9276 10334 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429260.1 protein_id gnl|my_center|LOCUS_12510 10343 11335 gene locus_tag LOCUS_12520 10343 11335 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435695.1 protein_id gnl|my_center|LOCUS_12520 11792 11718 gene locus_tag LOCUS_t00030 11792 11718 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 11901 11826 gene locus_tag LOCUS_t00040 11901 11826 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11980 11906 gene locus_tag LOCUS_t00050 11980 11906 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 12062 11987 gene locus_tag LOCUS_t00060 12062 11987 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 <13526 12388 gene locus_tag LOCUS_12530 <13526 12388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003434259.1:adenylosuccinate synthase >Feature sequence069 825 403 gene locus_tag LOCUS_12540 825 403 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861480.1 protein_id gnl|my_center|LOCUS_12540 2962 839 gene locus_tag LOCUS_12550 2962 839 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861481.1 protein_id gnl|my_center|LOCUS_12550 3297 6476 gene locus_tag LOCUS_12560 3297 6476 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373559.1 protein_id gnl|my_center|LOCUS_12560 7525 6761 gene locus_tag LOCUS_12570 7525 6761 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861483.1 protein_id gnl|my_center|LOCUS_12570 7968 7681 gene locus_tag LOCUS_12580 7968 7681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 9481 7988 gene locus_tag LOCUS_12590 9481 7988 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861484.1 protein_id gnl|my_center|LOCUS_12590 10351 9809 gene locus_tag LOCUS_12600 10351 9809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 11588 10641 gene locus_tag LOCUS_12610 11588 10641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361909.1 protein_id gnl|my_center|LOCUS_12610 12107 11616 gene locus_tag LOCUS_12620 12107 11616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861486.1 protein_id gnl|my_center|LOCUS_12620 13443 12550 gene locus_tag LOCUS_12630 13443 12550 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897343.1 protein_id gnl|my_center|LOCUS_12630 >Feature sequence070 94 2022 gene locus_tag LOCUS_12640 94 2022 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860962.1 protein_id gnl|my_center|LOCUS_12640 2199 2609 gene locus_tag LOCUS_12650 2199 2609 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418487.1 protein_id gnl|my_center|LOCUS_12650 2631 2933 gene locus_tag LOCUS_12660 2631 2933 CDS product PTS sugar transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437569.1 protein_id gnl|my_center|LOCUS_12660 3842 3150 gene locus_tag LOCUS_12670 3842 3150 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437572.1 protein_id gnl|my_center|LOCUS_12670 5055 3868 gene locus_tag LOCUS_12680 5055 3868 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860963.1 protein_id gnl|my_center|LOCUS_12680 5391 7268 gene locus_tag LOCUS_12690 5391 7268 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437576.1 protein_id gnl|my_center|LOCUS_12690 7578 8984 gene locus_tag LOCUS_12700 7578 8984 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860965.1 protein_id gnl|my_center|LOCUS_12700 9012 9860 gene locus_tag LOCUS_12710 9012 9860 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454252.1 protein_id gnl|my_center|LOCUS_12710 10521 11213 gene locus_tag LOCUS_12720 10521 11213 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888625.1 protein_id gnl|my_center|LOCUS_12720 11216 12145 gene locus_tag LOCUS_12730 11216 12145 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860966.1 protein_id gnl|my_center|LOCUS_12730 >Feature sequence071 591 1 gene locus_tag LOCUS_12740 591 1 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430243.1 protein_id gnl|my_center|LOCUS_12740 880 1113 gene locus_tag LOCUS_12750 880 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430242.1 protein_id gnl|my_center|LOCUS_12750 3731 1344 gene locus_tag LOCUS_12760 3731 1344 CDS product cell wall-binding cysteine protease Cwp13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861325.1 protein_id gnl|my_center|LOCUS_12760 3631 3858 gene locus_tag LOCUS_12770 3631 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 4678 3923 gene locus_tag LOCUS_12780 4678 3923 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454389.1 protein_id gnl|my_center|LOCUS_12780 5854 4703 gene locus_tag LOCUS_12790 5854 4703 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454390.1 protein_id gnl|my_center|LOCUS_12790 6810 6070 gene locus_tag LOCUS_12800 6810 6070 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454391.1 protein_id gnl|my_center|LOCUS_12800 7871 6882 gene locus_tag LOCUS_12810 gene add 7871 6882 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454392.1 protein_id gnl|my_center|LOCUS_12810 8348 8112 gene locus_tag LOCUS_12820 8348 8112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 8335 9384 gene locus_tag LOCUS_12830 8335 9384 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861324.1 protein_id gnl|my_center|LOCUS_12830 9481 9705 gene locus_tag LOCUS_12840 9481 9705 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423664.1 protein_id gnl|my_center|LOCUS_12840 9860 10096 gene locus_tag LOCUS_12850 9860 10096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861323.1 protein_id gnl|my_center|LOCUS_12850 10793 10359 gene locus_tag LOCUS_12860 10793 10359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902741.1 protein_id gnl|my_center|LOCUS_12860 12241 10883 gene locus_tag LOCUS_12870 12241 10883 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861322.1 protein_id gnl|my_center|LOCUS_12870 >Feature sequence072 <1 748 gene locus_tag LOCUS_12880 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454722.1:PLP-dependent aminotransferase family protein 772 2031 gene locus_tag LOCUS_12890 772 2031 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454721.1 protein_id gnl|my_center|LOCUS_12890 2676 4139 gene locus_tag LOCUS_12900 2676 4139 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903192.1 protein_id gnl|my_center|LOCUS_12900 4195 5331 gene locus_tag LOCUS_12910 4195 5331 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893603.1 protein_id gnl|my_center|LOCUS_12910 5567 6682 gene locus_tag LOCUS_12920 5567 6682 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861550.1 protein_id gnl|my_center|LOCUS_12920 6912 7703 gene locus_tag LOCUS_12930 6912 7703 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861549.1 protein_id gnl|my_center|LOCUS_12930 8079 8624 gene locus_tag LOCUS_12940 8079 8624 CDS product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430863.1 protein_id gnl|my_center|LOCUS_12940 8637 9650 gene locus_tag LOCUS_12950 8637 9650 CDS product PTS glucitol/sorbitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454715.1 protein_id gnl|my_center|LOCUS_12950 9872 11845 gene locus_tag LOCUS_12960 9872 11845 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861548.1 protein_id gnl|my_center|LOCUS_12960 11914 12273 gene locus_tag LOCUS_12970 11914 12273 CDS product transcriptional regulator GutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454711.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence073 2 496 gene locus_tag LOCUS_12980 2 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 498 1631 gene locus_tag LOCUS_12990 498 1631 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903845.1 protein_id gnl|my_center|LOCUS_12990 1649 2758 gene locus_tag LOCUS_13000 1649 2758 CDS product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898827.1 protein_id gnl|my_center|LOCUS_13000 2823 3563 gene locus_tag LOCUS_13010 2823 3563 CDS product KDGP aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862024.1 protein_id gnl|my_center|LOCUS_13010 3568 4560 gene locus_tag LOCUS_13020 3568 4560 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862023.1 protein_id gnl|my_center|LOCUS_13020 5629 4748 gene locus_tag LOCUS_13030 5629 4748 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892281.1 protein_id gnl|my_center|LOCUS_13030 5903 7291 gene locus_tag LOCUS_13040 5903 7291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862022.1 protein_id gnl|my_center|LOCUS_13040 7319 8272 gene locus_tag LOCUS_13050 7319 8272 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021363110.1 protein_id gnl|my_center|LOCUS_13050 8332 8556 gene locus_tag LOCUS_13060 8332 8556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435740.1 protein_id gnl|my_center|LOCUS_13060 8549 9061 gene locus_tag LOCUS_13070 8549 9061 CDS product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862020.1 protein_id gnl|my_center|LOCUS_13070 9099 9947 gene locus_tag LOCUS_13080 9099 9947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862019.1 protein_id gnl|my_center|LOCUS_13080 10481 11275 gene locus_tag LOCUS_13090 10481 11275 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435749.1 protein_id gnl|my_center|LOCUS_13090 11379 12203 gene locus_tag LOCUS_13100 11379 12203 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862018.1 protein_id gnl|my_center|LOCUS_13100 >Feature sequence074 305 922 gene locus_tag LOCUS_13110 gene gmk 305 922 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431170.1 protein_id gnl|my_center|LOCUS_13110 925 1191 gene locus_tag LOCUS_13120 gene rpoZ 925 1191 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431167.1 protein_id gnl|my_center|LOCUS_13120 1196 2395 gene locus_tag LOCUS_13130 gene coaBC 1196 2395 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_13130 2670 5159 gene locus_tag LOCUS_13140 gene priA 2670 5159 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861610.1 protein_id gnl|my_center|LOCUS_13140 5177 5617 gene locus_tag LOCUS_13150 gene def 5177 5617 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_13150 5632 6561 gene locus_tag LOCUS_13160 gene fmt 5632 6561 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861609.1 protein_id gnl|my_center|LOCUS_13160 6571 7323 gene locus_tag LOCUS_13170 6571 7323 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861608.1 protein_id gnl|my_center|LOCUS_13170 7392 8093 gene locus_tag LOCUS_13180 7392 8093 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416253.1 protein_id gnl|my_center|LOCUS_13180 8155 9480 gene locus_tag LOCUS_13190 gene rsmB 8155 9480 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861607.1 protein_id gnl|my_center|LOCUS_13190 9488 10519 gene locus_tag LOCUS_13200 gene rlmN 9488 10519 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431147.1 protein_id gnl|my_center|LOCUS_13200 10539 11291 gene locus_tag LOCUS_13210 10539 11291 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416261.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence075 1070 216 gene locus_tag LOCUS_13220 gene accD 1070 216 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424064.1 protein_id gnl|my_center|LOCUS_13220 2446 1085 gene locus_tag LOCUS_13230 gene accC 2446 1085 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435334.1 protein_id gnl|my_center|LOCUS_13230 2914 2462 gene locus_tag LOCUS_13240 gene accB 2914 2462 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428740.1 protein_id gnl|my_center|LOCUS_13240 3630 3184 gene locus_tag LOCUS_13250 3630 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435332.1 protein_id gnl|my_center|LOCUS_13250 3905 4183 gene locus_tag LOCUS_13260 3905 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424072.1 protein_id gnl|my_center|LOCUS_13260 5043 4312 gene locus_tag LOCUS_13270 5043 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373506.1 protein_id gnl|my_center|LOCUS_13270 5831 5187 gene locus_tag LOCUS_13280 gene trmB 5831 5187 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889910.1 protein_id gnl|my_center|LOCUS_13280 6289 5969 gene locus_tag LOCUS_13290 6289 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424083.1 protein_id gnl|my_center|LOCUS_13290 6990 6742 gene locus_tag LOCUS_13300 6990 6742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 7464 7021 gene locus_tag LOCUS_13310 7464 7021 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889914.1 protein_id gnl|my_center|LOCUS_13310 8353 7520 gene locus_tag LOCUS_13320 8353 7520 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435326.1 protein_id gnl|my_center|LOCUS_13320 9313 8627 gene locus_tag LOCUS_13330 9313 8627 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897077.1 protein_id gnl|my_center|LOCUS_13330 11805 9328 gene locus_tag LOCUS_13340 11805 9328 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861397.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence076 <1 603 gene locus_tag LOCUS_13350 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003432345.1:polysaccharide deacetylase family protein 1242 3908 gene locus_tag LOCUS_13360 1242 3908 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_13360 4333 5043 gene locus_tag LOCUS_13370 gene rgaR 4333 5043 CDS product two-component system response regulator RgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432343.1 protein_id gnl|my_center|LOCUS_13370 6107 7120 gene locus_tag LOCUS_13380 6107 7120 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903675.1 protein_id gnl|my_center|LOCUS_13380 7253 8551 gene locus_tag LOCUS_13390 7253 8551 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_13390 8910 8665 gene locus_tag LOCUS_13400 8910 8665 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891710.1 protein_id gnl|my_center|LOCUS_13400 9058 9924 gene locus_tag LOCUS_13410 9058 9924 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422120.1 protein_id gnl|my_center|LOCUS_13410 10464 9928 gene locus_tag LOCUS_13420 10464 9928 CDS product DUF4364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891708.1 protein_id gnl|my_center|LOCUS_13420 10858 10655 gene locus_tag LOCUS_13430 10858 10655 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422115.1 protein_id gnl|my_center|LOCUS_13430 11149 11913 gene locus_tag LOCUS_13440 11149 11913 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898387.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence077 19 1275 gene locus_tag LOCUS_13450 19 1275 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_13450 1344 2690 gene locus_tag LOCUS_13460 1344 2690 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861407.1 protein_id gnl|my_center|LOCUS_13460 2823 3902 gene locus_tag LOCUS_13470 2823 3902 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435274.1 protein_id gnl|my_center|LOCUS_13470 3992 4624 gene locus_tag LOCUS_13480 3992 4624 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428771.1 protein_id gnl|my_center|LOCUS_13480 4668 5201 gene locus_tag LOCUS_13490 4668 5201 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433028.1 protein_id gnl|my_center|LOCUS_13490 5250 5936 gene locus_tag LOCUS_13500 5250 5936 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435276.1 protein_id gnl|my_center|LOCUS_13500 6129 7004 gene locus_tag LOCUS_13510 6129 7004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861406.1 protein_id gnl|my_center|LOCUS_13510 7363 8667 gene locus_tag LOCUS_13520 7363 8667 CDS product acyl-CoA thioesterase/bile acid-CoA:amino acid N-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435280.1 protein_id gnl|my_center|LOCUS_13520 8851 10242 gene locus_tag LOCUS_13530 8851 10242 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902866.1 protein_id gnl|my_center|LOCUS_13530 10419 11006 gene locus_tag LOCUS_13540 10419 11006 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435286.1 protein_id gnl|my_center|LOCUS_13540 11039 11830 gene locus_tag LOCUS_13550 11039 11830 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861405.1 protein_id gnl|my_center|LOCUS_13550 >Feature sequence078 2204 1011 gene locus_tag LOCUS_13560 2204 1011 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895828.1 protein_id gnl|my_center|LOCUS_13560 3542 2280 gene locus_tag LOCUS_13570 3542 2280 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888596.1 protein_id gnl|my_center|LOCUS_13570 4576 3680 gene locus_tag LOCUS_13580 4576 3680 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860958.1 protein_id gnl|my_center|LOCUS_13580 4843 5847 gene locus_tag LOCUS_13590 4843 5847 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437541.1 protein_id gnl|my_center|LOCUS_13590 6733 6014 gene locus_tag LOCUS_13600 6733 6014 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437537.1 protein_id gnl|my_center|LOCUS_13600 7571 6816 gene locus_tag LOCUS_13610 gene nadE 7571 6816 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437535.1 protein_id gnl|my_center|LOCUS_13610 7750 8136 gene locus_tag LOCUS_13620 7750 8136 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437532.1 protein_id gnl|my_center|LOCUS_13620 8136 8513 gene locus_tag LOCUS_13630 8136 8513 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437529.1 protein_id gnl|my_center|LOCUS_13630 9243 8599 gene locus_tag LOCUS_13640 9243 8599 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895825.1 protein_id gnl|my_center|LOCUS_13640 9991 9548 gene locus_tag LOCUS_13650 9991 9548 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437525.1 protein_id gnl|my_center|LOCUS_13650 10754 10077 gene locus_tag LOCUS_13660 10754 10077 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437523.1 protein_id gnl|my_center|LOCUS_13660 12045 10762 gene locus_tag LOCUS_13670 gene hflX 12045 10762 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895824.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence079 303 3206 gene locus_tag LOCUS_13680 303 3206 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861510.1 protein_id gnl|my_center|LOCUS_13680 3239 3685 gene locus_tag LOCUS_13690 3239 3685 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890480.1 protein_id gnl|my_center|LOCUS_13690 3808 4110 gene locus_tag LOCUS_13700 3808 4110 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861509.1 protein_id gnl|my_center|LOCUS_13700 4291 5697 gene locus_tag LOCUS_13710 4291 5697 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897455.1 protein_id gnl|my_center|LOCUS_13710 6041 7099 gene locus_tag LOCUS_13720 6041 7099 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861508.1 protein_id gnl|my_center|LOCUS_13720 7198 7884 gene locus_tag LOCUS_13730 gene araD 7198 7884 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897453.1 protein_id gnl|my_center|LOCUS_13730 7902 8549 gene locus_tag LOCUS_13740 7902 8549 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861507.1 protein_id gnl|my_center|LOCUS_13740 10089 8722 gene locus_tag LOCUS_13750 10089 8722 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440276.1 protein_id gnl|my_center|LOCUS_13750 >Feature sequence080 <1 520 gene locus_tag LOCUS_13760 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003431108.1:16S rRNA (guanine(966)-N(2))-methyltransferase RsmD 522 1019 gene locus_tag LOCUS_13770 gene coaD 522 1019 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416314.1 protein_id gnl|my_center|LOCUS_13770 1023 1547 gene locus_tag LOCUS_13780 1023 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454870.1 protein_id gnl|my_center|LOCUS_13780 1891 2280 gene locus_tag LOCUS_13790 1891 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13790 2271 3809 gene locus_tag LOCUS_13800 2271 3809 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903255.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13800 3822 4109 gene locus_tag LOCUS_13810 3822 4109 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454867.1 protein_id gnl|my_center|LOCUS_13810 4242 5501 gene locus_tag LOCUS_13820 4242 5501 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897756.1 protein_id gnl|my_center|LOCUS_13820 5504 6244 gene locus_tag LOCUS_13830 5504 6244 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861599.1 protein_id gnl|my_center|LOCUS_13830 6600 6980 gene locus_tag LOCUS_13840 6600 6980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13840 7029 7877 gene locus_tag LOCUS_13850 7029 7877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13850 7975 8892 gene locus_tag LOCUS_13860 7975 8892 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861597.1 protein_id gnl|my_center|LOCUS_13860 8908 9717 gene locus_tag LOCUS_13870 8908 9717 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454862.1 protein_id gnl|my_center|LOCUS_13870 9775 11523 gene locus_tag LOCUS_13880 9775 11523 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861596.1 protein_id gnl|my_center|LOCUS_13880 >Feature sequence081 1707 361 gene locus_tag LOCUS_13890 gene rpoN 1707 361 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421965.1 protein_id gnl|my_center|LOCUS_13890 4420 1859 gene locus_tag LOCUS_13900 gene xdh 4420 1859 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891588.1 protein_id gnl|my_center|LOCUS_13900 5805 4414 gene locus_tag LOCUS_13910 gene hydA 5805 4414 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891590.1 protein_id gnl|my_center|LOCUS_13910 7197 6088 gene locus_tag LOCUS_13920 7197 6088 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891591.1 protein_id gnl|my_center|LOCUS_13920 8741 7389 gene locus_tag LOCUS_13930 8741 7389 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891593.1 protein_id gnl|my_center|LOCUS_13930 10268 8940 gene locus_tag LOCUS_13940 gene ssnA 10268 8940 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861868.1 protein_id gnl|my_center|LOCUS_13940 11879 10296 gene locus_tag LOCUS_13950 11879 10296 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893877.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence082 570 2282 gene locus_tag LOCUS_13960 gene ptsP 570 2282 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431795.1 protein_id gnl|my_center|LOCUS_13960 3739 3074 gene locus_tag LOCUS_13970 3739 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861667.1 protein_id gnl|my_center|LOCUS_13970 4083 5513 gene locus_tag LOCUS_13980 4083 5513 CDS product DUF4116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897920.1 protein_id gnl|my_center|LOCUS_13980 5881 6459 gene locus_tag LOCUS_13990 5881 6459 CDS product accessory gene regulator B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454130.1 protein_id gnl|my_center|LOCUS_13990 6489 6635 gene locus_tag LOCUS_14000 6489 6635 CDS product cyclic lactone autoinducer peptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426457.1 protein_id gnl|my_center|LOCUS_14000 6940 8319 gene locus_tag LOCUS_14010 gene scfB 6940 8319 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_14010 8348 8845 gene locus_tag LOCUS_14020 8348 8845 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454132.1 protein_id gnl|my_center|LOCUS_14020 9143 10807 gene locus_tag LOCUS_14030 9143 10807 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891005.1 protein_id gnl|my_center|LOCUS_14030 >Feature sequence083 306 2168 gene locus_tag LOCUS_14040 306 2168 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861068.1 protein_id gnl|my_center|LOCUS_14040 2501 3190 gene locus_tag LOCUS_14050 2501 3190 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861069.1 protein_id gnl|my_center|LOCUS_14050 3307 3981 gene locus_tag LOCUS_14060 3307 3981 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861070.1 protein_id gnl|my_center|LOCUS_14060 3998 5905 gene locus_tag LOCUS_14070 3998 5905 CDS product CotH kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861071.1 protein_id gnl|my_center|LOCUS_14070 6357 7046 gene locus_tag LOCUS_14080 6357 7046 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902228.1 protein_id gnl|my_center|LOCUS_14080 7482 8021 gene locus_tag LOCUS_14090 7482 8021 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418769.1 protein_id gnl|my_center|LOCUS_14090 8040 9083 gene locus_tag LOCUS_14100 8040 9083 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437017.1 protein_id gnl|my_center|LOCUS_14100 9085 9921 gene locus_tag LOCUS_14110 9085 9921 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432157.1 protein_id gnl|my_center|LOCUS_14110 10089 10700 gene locus_tag LOCUS_14120 10089 10700 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437015.1 protein_id gnl|my_center|LOCUS_14120 10700 11752 gene locus_tag LOCUS_14130 10700 11752 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895984.1 protein_id gnl|my_center|LOCUS_14130 >Feature sequence084 1590 1306 gene locus_tag LOCUS_14140 1590 1306 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420907.1 protein_id gnl|my_center|LOCUS_14140 3273 1783 gene locus_tag LOCUS_14150 gene cls 3273 1783 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435010.1 protein_id gnl|my_center|LOCUS_14150 4166 3291 gene locus_tag LOCUS_14160 4166 3291 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435007.1 protein_id gnl|my_center|LOCUS_14160 5491 4460 gene locus_tag LOCUS_14170 5491 4460 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435004.1 protein_id gnl|my_center|LOCUS_14170 5679 6569 gene locus_tag LOCUS_14180 5679 6569 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435002.1 protein_id gnl|my_center|LOCUS_14180 7547 6621 gene locus_tag LOCUS_14190 7547 6621 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860663.1 protein_id gnl|my_center|LOCUS_14190 8346 7762 gene locus_tag LOCUS_14200 gene pyrE 8346 7762 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420885.1 protein_id gnl|my_center|LOCUS_14200 9333 8431 gene locus_tag LOCUS_14210 9333 8431 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860662.1 protein_id gnl|my_center|LOCUS_14210 10018 9326 gene locus_tag LOCUS_14220 10018 9326 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434506.1 protein_id gnl|my_center|LOCUS_14220 10977 10057 gene locus_tag LOCUS_14230 gene pyrB 10977 10057 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434504.1 protein_id gnl|my_center|LOCUS_14230 <11915 11273 gene locus_tag LOCUS_14240 <11915 11273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003434503.1:C40 family peptidase >Feature sequence085 48 1271 gene locus_tag LOCUS_14250 gene dapG 48 1271 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438324.1 protein_id gnl|my_center|LOCUS_14250 1384 2118 gene locus_tag LOCUS_14260 1384 2118 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428224.1 protein_id gnl|my_center|LOCUS_14260 2241 4652 gene locus_tag LOCUS_14270 2241 4652 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438328.1 protein_id gnl|my_center|LOCUS_14270 4655 5713 gene locus_tag LOCUS_14280 gene mnmH 4655 5713 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861175.1 protein_id gnl|my_center|LOCUS_14280 5707 7041 gene locus_tag LOCUS_14290 gene rimO 5707 7041 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_14290 7028 7570 gene locus_tag LOCUS_14300 gene pgsA 7028 7570 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889106.1 protein_id gnl|my_center|LOCUS_14300 7858 8904 gene locus_tag LOCUS_14310 gene recA 7858 8904 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428218.1 protein_id gnl|my_center|LOCUS_14310 9059 10621 gene locus_tag LOCUS_14320 gene rny 9059 10621 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428216.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence086 3 785 gene locus_tag LOCUS_14330 gene flhF 3 785 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860708.1 protein_id gnl|my_center|LOCUS_14330 782 1660 gene locus_tag LOCUS_14340 782 1660 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860709.1 protein_id gnl|my_center|LOCUS_14340 1674 2375 gene locus_tag LOCUS_14350 1674 2375 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435969.1 protein_id gnl|my_center|LOCUS_14350 2391 2813 gene locus_tag LOCUS_14360 2391 2813 CDS product flagellar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860710.1 protein_id gnl|my_center|LOCUS_14360 2798 2983 gene locus_tag LOCUS_14370 2798 2983 CDS product flagellar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425206.1 protein_id gnl|my_center|LOCUS_14370 3024 3797 gene locus_tag LOCUS_14380 3024 3797 CDS product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860711.1 protein_id gnl|my_center|LOCUS_14380 3818 4579 gene locus_tag LOCUS_14390 3818 4579 CDS product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901767.1 protein_id gnl|my_center|LOCUS_14390 4602 5483 gene locus_tag LOCUS_14400 4602 5483 CDS product FliM/FliN family flagellar motor switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860712.1 protein_id gnl|my_center|LOCUS_14400 5486 5860 gene locus_tag LOCUS_14410 5486 5860 CDS product FliM/FliN family flagellar motor switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425190.1 protein_id gnl|my_center|LOCUS_14410 5892 7295 gene locus_tag LOCUS_14420 5892 7295 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860713.1 protein_id gnl|my_center|LOCUS_14420 7411 9348 gene locus_tag LOCUS_14430 gene htpG 7411 9348 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435963.1 protein_id gnl|my_center|LOCUS_14430 9736 10866 gene locus_tag LOCUS_14440 9736 10866 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435962.1 protein_id gnl|my_center|LOCUS_14440 >Feature sequence087 79 708 gene locus_tag LOCUS_14450 79 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426585.1 protein_id gnl|my_center|LOCUS_14450 1036 1545 gene locus_tag LOCUS_14460 gene ruvC 1036 1545 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_14460 1538 2140 gene locus_tag LOCUS_14470 gene ruvA 1538 2140 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426582.1 protein_id gnl|my_center|LOCUS_14470 2247 3266 gene locus_tag LOCUS_14480 gene ruvB 2247 3266 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_14480 3584 4609 gene locus_tag LOCUS_14490 gene queA 3584 4609 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_14490 4621 5106 gene locus_tag LOCUS_14500 4621 5106 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426576.1 protein_id gnl|my_center|LOCUS_14500 5185 6306 gene locus_tag LOCUS_14510 gene tgt 5185 6306 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_14510 6440 6733 gene locus_tag LOCUS_14520 gene yajC 6440 6733 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426573.1 protein_id gnl|my_center|LOCUS_14520 6791 7153 gene locus_tag LOCUS_14530 6791 7153 CDS product TIGR04086 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422821.1 protein_id gnl|my_center|LOCUS_14530 7219 7362 gene locus_tag LOCUS_14540 gene scfA 7219 7362 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_14540 7989 9884 gene locus_tag LOCUS_14550 7989 9884 CDS product cell wall-binding protein Cwp8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861692.1 protein_id gnl|my_center|LOCUS_14550 10346 11749 gene locus_tag LOCUS_14560 10346 11749 CDS product cell wall-binding protein Cwp9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861691.1 protein_id gnl|my_center|LOCUS_14560 >Feature sequence088 1483 143 gene locus_tag LOCUS_14570 1483 143 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860860.1 protein_id gnl|my_center|LOCUS_14570 3240 2149 gene locus_tag LOCUS_14580 3240 2149 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902002.1 protein_id gnl|my_center|LOCUS_14580 5927 4008 gene locus_tag LOCUS_14590 gene thrS 5927 4008 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888359.1 protein_id gnl|my_center|LOCUS_14590 7290 6688 gene locus_tag LOCUS_14600 7290 6688 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439009.1 protein_id gnl|my_center|LOCUS_14600 8288 7470 gene locus_tag LOCUS_14610 8288 7470 CDS product putative sporulation protein YtxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417993.1 protein_id gnl|my_center|LOCUS_14610 9052 8291 gene locus_tag LOCUS_14620 9052 8291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439005.1 protein_id gnl|my_center|LOCUS_14620 10519 9407 gene locus_tag LOCUS_14630 10519 9407 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860859.1 protein_id gnl|my_center|LOCUS_14630 10971 10645 gene locus_tag LOCUS_14640 10971 10645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14640 11648 10968 gene locus_tag LOCUS_14650 11648 10968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14650 >Feature sequence089 1547 48 gene locus_tag LOCUS_14660 1547 48 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423106.1 protein_id gnl|my_center|LOCUS_14660 2143 3567 gene locus_tag LOCUS_14670 2143 3567 CDS product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861530.1 protein_id gnl|my_center|LOCUS_14670 3602 5731 gene locus_tag LOCUS_14680 3602 5731 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861529.1 protein_id gnl|my_center|LOCUS_14680 5761 6183 gene locus_tag LOCUS_14690 5761 6183 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454636.1 protein_id gnl|my_center|LOCUS_14690 6202 7353 gene locus_tag LOCUS_14700 6202 7353 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861528.1 protein_id gnl|my_center|LOCUS_14700 7743 8315 gene locus_tag LOCUS_14710 7743 8315 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454633.1 protein_id gnl|my_center|LOCUS_14710 8379 9029 gene locus_tag LOCUS_14720 gene fsa 8379 9029 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423115.1 protein_id gnl|my_center|LOCUS_14720 >Feature sequence090 <1 609 gene locus_tag LOCUS_14730 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454751.1:molecular chaperone DnaJ 1575 2510 gene locus_tag LOCUS_14740 1575 2510 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416574.1 protein_id gnl|my_center|LOCUS_14740 2546 3919 gene locus_tag LOCUS_14750 2546 3919 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861563.1 protein_id gnl|my_center|LOCUS_14750 4874 4107 gene locus_tag LOCUS_14760 4874 4107 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861562.1 protein_id gnl|my_center|LOCUS_14760 6013 4904 gene locus_tag LOCUS_14770 gene ugpC 6013 4904 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861561.1 protein_id gnl|my_center|LOCUS_14770 6271 7008 gene locus_tag LOCUS_14780 gene cas6 6271 7008 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861560.1 protein_id gnl|my_center|LOCUS_14780 7013 8488 gene locus_tag LOCUS_14790 7013 8488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861559.1 protein_id gnl|my_center|LOCUS_14790 8508 9521 gene locus_tag LOCUS_14800 gene cas7i 8508 9521 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861558.1 protein_id gnl|my_center|LOCUS_14800 9537 10334 gene locus_tag LOCUS_14810 gene cas5 9537 10334 CDS product CRISPR-associated protein Cas5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861557.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence091 2652 205 gene locus_tag LOCUS_14820 2652 205 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425582.1 protein_id gnl|my_center|LOCUS_14820 3664 2639 gene locus_tag LOCUS_14830 3664 2639 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453979.1 protein_id gnl|my_center|LOCUS_14830 4174 3680 gene locus_tag LOCUS_14840 4174 3680 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421255.1 protein_id gnl|my_center|LOCUS_14840 4645 4181 gene locus_tag LOCUS_14850 4645 4181 CDS product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425587.1 protein_id gnl|my_center|LOCUS_14850 7026 5098 gene locus_tag LOCUS_14860 7026 5098 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887791.1 protein_id gnl|my_center|LOCUS_14860 10699 7268 gene locus_tag LOCUS_14870 10699 7268 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425597.1 protein_id gnl|my_center|LOCUS_14870 11421 11008 gene locus_tag LOCUS_14880 11421 11008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895151.1 protein_id gnl|my_center|LOCUS_14880 11572 11497 gene locus_tag LOCUS_t00070 11572 11497 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11661 11585 gene locus_tag LOCUS_t00080 11661 11585 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence092 743 171 gene locus_tag LOCUS_14890 743 171 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416728.1 protein_id gnl|my_center|LOCUS_14890 1038 772 gene locus_tag LOCUS_14900 1038 772 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454698.1 protein_id gnl|my_center|LOCUS_14900 1247 1038 gene locus_tag LOCUS_14910 1247 1038 CDS product spore coat associated protein CotJA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416732.1 protein_id gnl|my_center|LOCUS_14910 1516 2376 gene locus_tag LOCUS_14920 1516 2376 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416734.1 protein_id gnl|my_center|LOCUS_14920 2424 3452 gene locus_tag LOCUS_14930 2424 3452 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897592.1 protein_id gnl|my_center|LOCUS_14930 3823 4329 gene locus_tag LOCUS_14940 3823 4329 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_14940 4742 5410 gene locus_tag LOCUS_14950 4742 5410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903182.1 protein_id gnl|my_center|LOCUS_14950 5569 6075 gene locus_tag LOCUS_14960 5569 6075 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454691.1 protein_id gnl|my_center|LOCUS_14960 6203 7219 gene locus_tag LOCUS_14970 6203 7219 CDS product biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454690.1 protein_id gnl|my_center|LOCUS_14970 7572 8276 gene locus_tag LOCUS_14980 7572 8276 CDS product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454689.1 protein_id gnl|my_center|LOCUS_14980 8571 9050 gene locus_tag LOCUS_14990 8571 9050 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897585.1 protein_id gnl|my_center|LOCUS_14990 9685 10059 gene locus_tag LOCUS_15000 9685 10059 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454687.1 protein_id gnl|my_center|LOCUS_15000 10064 11089 gene locus_tag LOCUS_15010 10064 11089 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861541.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence093 1753 821 gene locus_tag LOCUS_15020 1753 821 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860744.1 protein_id gnl|my_center|LOCUS_15020 2390 1839 gene locus_tag LOCUS_15030 2390 1839 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434848.1 protein_id gnl|my_center|LOCUS_15030 3110 2619 gene locus_tag LOCUS_15040 3110 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427789.1 protein_id gnl|my_center|LOCUS_15040 3698 3138 gene locus_tag LOCUS_15050 3698 3138 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888208.1 protein_id gnl|my_center|LOCUS_15050 5007 3850 gene locus_tag LOCUS_15060 5007 3850 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963477.1 protein_id gnl|my_center|LOCUS_15060 5985 5044 gene locus_tag LOCUS_15070 5985 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888206.1 protein_id gnl|my_center|LOCUS_15070 6764 6072 gene locus_tag LOCUS_15080 6764 6072 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427805.1 protein_id gnl|my_center|LOCUS_15080 7685 6873 gene locus_tag LOCUS_15090 7685 6873 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417310.1 protein_id gnl|my_center|LOCUS_15090 8647 7736 gene locus_tag LOCUS_15100 8647 7736 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860742.1 protein_id gnl|my_center|LOCUS_15100 9437 8706 gene locus_tag LOCUS_15110 9437 8706 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860741.1 protein_id gnl|my_center|LOCUS_15110 9526 9777 gene locus_tag LOCUS_15120 9526 9777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417301.1 protein_id gnl|my_center|LOCUS_15120 10010 10429 gene locus_tag LOCUS_15130 10010 10429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434832.1 protein_id gnl|my_center|LOCUS_15130 >Feature sequence094 <1 586 gene locus_tag LOCUS_15140 <1 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861661.1:sigma 54-interacting transcriptional regulator 811 1977 gene locus_tag LOCUS_15150 811 1977 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861662.1 protein_id gnl|my_center|LOCUS_15150 2002 3444 gene locus_tag LOCUS_15160 gene nhaC 2002 3444 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903314.1 protein_id gnl|my_center|LOCUS_15160 3447 3716 gene locus_tag LOCUS_15170 3447 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897910.1 protein_id gnl|my_center|LOCUS_15170 5219 3792 gene locus_tag LOCUS_15180 5219 3792 CDS product cell wall-binding protein Cwp14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903316.1 protein_id gnl|my_center|LOCUS_15180 5591 6460 gene locus_tag LOCUS_15190 5591 6460 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454143.1 protein_id gnl|my_center|LOCUS_15190 7378 6572 gene locus_tag LOCUS_15200 7378 6572 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903317.1 protein_id gnl|my_center|LOCUS_15200 8624 7392 gene locus_tag LOCUS_15210 8624 7392 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890996.1 protein_id gnl|my_center|LOCUS_15210 10870 9083 gene locus_tag LOCUS_15220 gene aspS 10870 9083 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454140.1 protein_id gnl|my_center|LOCUS_15220 <11633 10944 gene locus_tag LOCUS_15230 <11633 10944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003422928.1:histidine--tRNA ligase >Feature sequence095 238 1149 gene locus_tag LOCUS_15240 238 1149 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439096.1 protein_id gnl|my_center|LOCUS_15240 1324 1821 gene locus_tag LOCUS_15250 1324 1821 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439097.1 protein_id gnl|my_center|LOCUS_15250 2565 2927 gene locus_tag LOCUS_15260 2565 2927 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439098.1 protein_id gnl|my_center|LOCUS_15260 3088 3609 gene locus_tag LOCUS_15270 3088 3609 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006874833.1 protein_id gnl|my_center|LOCUS_15270 3606 4091 gene locus_tag LOCUS_15280 3606 4091 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425085.1 protein_id gnl|my_center|LOCUS_15280 4134 4652 gene locus_tag LOCUS_15290 4134 4652 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439100.1 protein_id gnl|my_center|LOCUS_15290 4788 5747 gene locus_tag LOCUS_15300 4788 5747 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895564.1 protein_id gnl|my_center|LOCUS_15300 5773 7476 gene locus_tag LOCUS_15310 5773 7476 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425090.1 protein_id gnl|my_center|LOCUS_15310 7659 9791 gene locus_tag LOCUS_15320 7659 9791 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860851.1 protein_id gnl|my_center|LOCUS_15320 9804 10244 gene locus_tag LOCUS_15330 9804 10244 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439104.1 protein_id gnl|my_center|LOCUS_15330 10280 11083 gene locus_tag LOCUS_15340 10280 11083 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425096.1 protein_id gnl|my_center|LOCUS_15340 >Feature sequence096 <1 786 gene locus_tag LOCUS_15350 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861171.1:leucyl aminopeptidase 1125 877 gene locus_tag LOCUS_15360 1125 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 1814 1954 gene locus_tag LOCUS_15370 1814 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419462.1 protein_id gnl|my_center|LOCUS_15370 2449 2129 gene locus_tag LOCUS_15380 2449 2129 CDS product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428248.1 protein_id gnl|my_center|LOCUS_15380 3306 2569 gene locus_tag LOCUS_15390 3306 2569 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428245.1 protein_id gnl|my_center|LOCUS_15390 3521 5344 gene locus_tag LOCUS_15400 gene acd 3521 5344 CDS product N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861172.1 protein_id gnl|my_center|LOCUS_15400 5559 9857 gene locus_tag LOCUS_15410 5559 9857 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438301.1 protein_id gnl|my_center|LOCUS_15410 10061 10522 gene locus_tag LOCUS_15420 10061 10522 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_15420 >Feature sequence097 622 110 gene locus_tag LOCUS_15430 622 110 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861986.1 protein_id gnl|my_center|LOCUS_15430 2664 1714 gene locus_tag LOCUS_15440 2664 1714 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421448.1 protein_id gnl|my_center|LOCUS_15440 4138 2759 gene locus_tag LOCUS_15450 gene glmU 4138 2759 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898727.1 protein_id gnl|my_center|LOCUS_15450 4629 4351 gene locus_tag LOCUS_15460 gene spoVG 4629 4351 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421453.1 protein_id gnl|my_center|LOCUS_15460 5663 4785 gene locus_tag LOCUS_15470 gene purR 5663 4785 CDS product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425934.1 protein_id gnl|my_center|LOCUS_15470 5882 7234 gene locus_tag LOCUS_15480 gene murC 5882 7234 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425936.1 protein_id gnl|my_center|LOCUS_15480 8087 7290 gene locus_tag LOCUS_15490 8087 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425938.1 protein_id gnl|my_center|LOCUS_15490 9053 8157 gene locus_tag LOCUS_15500 9053 8157 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425940.1 protein_id gnl|my_center|LOCUS_15500 10354 9239 gene locus_tag LOCUS_15510 10354 9239 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861987.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence098 1197 181 gene locus_tag LOCUS_15520 gene gap 1197 181 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861329.1 protein_id gnl|my_center|LOCUS_15520 2298 1834 gene locus_tag LOCUS_15530 2298 1834 CDS product DUF4624 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439554.1 protein_id gnl|my_center|LOCUS_15530 3230 2622 gene locus_tag LOCUS_15540 3230 2622 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889720.1 protein_id gnl|my_center|LOCUS_15540 4013 3312 gene locus_tag LOCUS_15550 4013 3312 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454365.1 protein_id gnl|my_center|LOCUS_15550 4240 4506 gene locus_tag LOCUS_15560 4240 4506 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889719.1 protein_id gnl|my_center|LOCUS_15560 5028 4609 gene locus_tag LOCUS_15570 5028 4609 CDS product YjdF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861328.1 protein_id gnl|my_center|LOCUS_15570 6077 5295 gene locus_tag LOCUS_15580 6077 5295 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861327.1 protein_id gnl|my_center|LOCUS_15580 6903 6142 gene locus_tag LOCUS_15590 6903 6142 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896901.1 protein_id gnl|my_center|LOCUS_15590 7542 7408 gene locus_tag LOCUS_15600 7542 7408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 8781 7951 gene locus_tag LOCUS_15610 8781 7951 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896899.1 protein_id gnl|my_center|LOCUS_15610 10035 9133 gene locus_tag LOCUS_15620 10035 9133 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861326.1 protein_id gnl|my_center|LOCUS_15620 10546 10085 gene locus_tag LOCUS_15630 10546 10085 CDS product pyrimidine dimer DNA glycosylase/endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454381.1 protein_id gnl|my_center|LOCUS_15630 11053 10598 gene locus_tag LOCUS_15640 gene def 11053 10598 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423696.1 protein_id gnl|my_center|LOCUS_15640 11288 11025 gene locus_tag LOCUS_15650 11288 11025 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423694.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence099 946 1908 gene locus_tag LOCUS_15660 946 1908 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903505.1 protein_id gnl|my_center|LOCUS_15660 1987 2286 gene locus_tag LOCUS_15670 1987 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15670 2394 2615 gene locus_tag LOCUS_15680 2394 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15680 3449 3862 gene locus_tag LOCUS_15690 3449 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861846.1 protein_id gnl|my_center|LOCUS_15690 3930 4346 gene locus_tag LOCUS_15700 3930 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440086.1 protein_id gnl|my_center|LOCUS_15700 4347 4559 gene locus_tag LOCUS_15710 4347 4559 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861845.1 protein_id gnl|my_center|LOCUS_15710 4945 5115 gene locus_tag LOCUS_15720 4945 5115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 5658 6536 gene locus_tag LOCUS_15730 5658 6536 CDS product ketose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431312.1 protein_id gnl|my_center|LOCUS_15730 6572 8467 gene locus_tag LOCUS_15740 6572 8467 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861841.1 protein_id gnl|my_center|LOCUS_15740 8736 10643 gene locus_tag LOCUS_15750 8736 10643 CDS product transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861840.1 protein_id gnl|my_center|LOCUS_15750 10633 11082 gene locus_tag LOCUS_15760 10633 11082 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431315.1 protein_id gnl|my_center|LOCUS_15760 11072 11239 gene locus_tag LOCUS_15770 11072 11239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 >Feature sequence100 1520 981 gene locus_tag LOCUS_15780 1520 981 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433888.1 protein_id gnl|my_center|LOCUS_15780 2263 1523 gene locus_tag LOCUS_15790 2263 1523 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433887.1 protein_id gnl|my_center|LOCUS_15790 3314 2265 gene locus_tag LOCUS_15800 gene vorB 3314 2265 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433885.1 protein_id gnl|my_center|LOCUS_15800 3549 3331 gene locus_tag LOCUS_15810 3549 3331 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423406.1 protein_id gnl|my_center|LOCUS_15810 4685 3582 gene locus_tag LOCUS_15820 gene hisC 4685 3582 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897361.1 protein_id gnl|my_center|LOCUS_15820 6218 4788 gene locus_tag LOCUS_15830 6218 4788 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433880.1 protein_id gnl|my_center|LOCUS_15830 6876 8240 gene locus_tag LOCUS_15840 6876 8240 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433878.1 protein_id gnl|my_center|LOCUS_15840 8237 8917 gene locus_tag LOCUS_15850 8237 8917 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423398.1 protein_id gnl|my_center|LOCUS_15850 9818 9036 gene locus_tag LOCUS_15860 9818 9036 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861491.1 protein_id gnl|my_center|LOCUS_15860 11101 9935 gene locus_tag LOCUS_15870 11101 9935 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433873.1 protein_id gnl|my_center|LOCUS_15870 >Feature sequence101 324 1769 gene locus_tag LOCUS_15880 gene proS 324 1769 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895182.1 protein_id gnl|my_center|LOCUS_15880 2207 3688 gene locus_tag LOCUS_15890 gene gltX 2207 3688 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435581.1 protein_id gnl|my_center|LOCUS_15890 3909 4064 gene locus_tag LOCUS_15900 3909 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421202.1 protein_id gnl|my_center|LOCUS_15900 4209 4943 gene locus_tag LOCUS_15910 4209 4943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15910 4965 5606 gene locus_tag LOCUS_15920 4965 5606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15920 5591 6004 gene locus_tag LOCUS_15930 5591 6004 CDS product ribonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860630.1 protein_id gnl|my_center|LOCUS_15930 6110 6868 gene locus_tag LOCUS_15940 gene thyX 6110 6868 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421197.1 protein_id gnl|my_center|LOCUS_15940 6881 7618 gene locus_tag LOCUS_15950 gene rlmB 6881 7618 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887855.1 protein_id gnl|my_center|LOCUS_15950 7621 8148 gene locus_tag LOCUS_15960 7621 8148 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421194.1 protein_id gnl|my_center|LOCUS_15960 8213 8860 gene locus_tag LOCUS_15970 gene sigH 8213 8860 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892548.1 protein_id gnl|my_center|LOCUS_15970 8934 10127 gene locus_tag LOCUS_15980 gene tuf 8934 10127 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887863.1 protein_id gnl|my_center|LOCUS_15980 10499 10810 gene locus_tag LOCUS_15990 gene rpsJ 10499 10810 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860633.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence102 <1 2157 gene locus_tag LOCUS_16000 <1 2157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009902789.1:cation-translocating P-type ATPase 2423 3688 gene locus_tag LOCUS_16010 2423 3688 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439438.1 protein_id gnl|my_center|LOCUS_16010 3718 4608 gene locus_tag LOCUS_16020 3718 4608 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439436.1 protein_id gnl|my_center|LOCUS_16020 5099 5542 gene locus_tag LOCUS_16030 5099 5542 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428618.1 protein_id gnl|my_center|LOCUS_16030 5638 7389 gene locus_tag LOCUS_16040 gene ftsH 5638 7389 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428619.1 protein_id gnl|my_center|LOCUS_16040 7567 10269 gene locus_tag LOCUS_16050 7567 10269 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861344.1 protein_id gnl|my_center|LOCUS_16050 10303 11001 gene locus_tag LOCUS_16060 10303 11001 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439430.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence103 154 1545 gene locus_tag LOCUS_16070 154 1545 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436703.1 protein_id gnl|my_center|LOCUS_16070 1652 2692 gene locus_tag LOCUS_16080 1652 2692 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436700.1 protein_id gnl|my_center|LOCUS_16080 3181 3834 gene locus_tag LOCUS_16090 3181 3834 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902564.1 protein_id gnl|my_center|LOCUS_16090 3910 4119 gene locus_tag LOCUS_16100 3910 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429769.1 protein_id gnl|my_center|LOCUS_16100 4825 4259 gene locus_tag LOCUS_16110 4825 4259 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861247.1 protein_id gnl|my_center|LOCUS_16110 4986 5639 gene locus_tag LOCUS_16120 4986 5639 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436685.1 protein_id gnl|my_center|LOCUS_16120 5973 5797 gene locus_tag LOCUS_16130 5973 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420092.1 protein_id gnl|my_center|LOCUS_16130 6501 7445 gene locus_tag LOCUS_16140 6501 7445 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861248.1 protein_id gnl|my_center|LOCUS_16140 7467 8093 gene locus_tag LOCUS_16150 gene hisG 7467 8093 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436683.1 protein_id gnl|my_center|LOCUS_16150 8127 9176 gene locus_tag LOCUS_16160 gene hisC 8127 9176 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889400.1 protein_id gnl|my_center|LOCUS_16160 9179 9757 gene locus_tag LOCUS_16170 gene hisB 9179 9757 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436680.1 protein_id gnl|my_center|LOCUS_16170 9759 10364 gene locus_tag LOCUS_16180 gene hisH 9759 10364 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436678.1 protein_id gnl|my_center|LOCUS_16180 10361 11083 gene locus_tag LOCUS_16190 gene hisA 10361 11083 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436675.1 protein_id gnl|my_center|LOCUS_16190 >Feature sequence104 3047 1023 gene locus_tag LOCUS_16200 gene ligA 3047 1023 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_16200 4171 3233 gene locus_tag LOCUS_16210 4171 3233 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891785.1 protein_id gnl|my_center|LOCUS_16210 4695 4273 gene locus_tag LOCUS_16220 4695 4273 CDS product DUF3783 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861899.1 protein_id gnl|my_center|LOCUS_16220 4883 6166 gene locus_tag LOCUS_16230 4883 6166 CDS product conjugated bile salt MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861900.1 protein_id gnl|my_center|LOCUS_16230 6759 6244 gene locus_tag LOCUS_16240 6759 6244 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861901.1 protein_id gnl|my_center|LOCUS_16240 8135 6759 gene locus_tag LOCUS_16250 8135 6759 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417040.1 protein_id gnl|my_center|LOCUS_16250 8711 8160 gene locus_tag LOCUS_16260 8711 8160 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861903.1 protein_id gnl|my_center|LOCUS_16260 8963 8748 gene locus_tag LOCUS_16270 8963 8748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437324.1 protein_id gnl|my_center|LOCUS_16270 9765 8932 gene locus_tag LOCUS_16280 gene fdhD 9765 8932 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437321.1 protein_id gnl|my_center|LOCUS_16280 <11046 9814 gene locus_tag LOCUS_16290 <11046 9814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861905.1:formate dehydrogenase H subunit alpha, selenocysteine-containing >Feature sequence105 462 1103 gene locus_tag LOCUS_16300 462 1103 CDS product transaldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440006.1 protein_id gnl|my_center|LOCUS_16300 1129 2673 gene locus_tag LOCUS_16310 1129 2673 CDS product transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440007.1 protein_id gnl|my_center|LOCUS_16310 3499 2873 gene locus_tag LOCUS_16320 3499 2873 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440008.1 protein_id gnl|my_center|LOCUS_16320 4350 3634 gene locus_tag LOCUS_16330 4350 3634 CDS product pentose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891451.1 protein_id gnl|my_center|LOCUS_16330 4765 5979 gene locus_tag LOCUS_16340 4765 5979 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891452.1 protein_id gnl|my_center|LOCUS_16340 6596 7924 gene locus_tag LOCUS_16350 6596 7924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861826.1 protein_id gnl|my_center|LOCUS_16350 9242 8052 gene locus_tag LOCUS_16360 9242 8052 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861827.1 protein_id gnl|my_center|LOCUS_16360 10727 9348 gene locus_tag LOCUS_16370 10727 9348 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861828.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence106 259 3804 gene locus_tag LOCUS_16380 259 3804 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861061.1 protein_id gnl|my_center|LOCUS_16380 3989 5923 gene locus_tag LOCUS_16390 3989 5923 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 protein_id gnl|my_center|LOCUS_16390 6029 7024 gene locus_tag LOCUS_16400 6029 7024 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861062.1 protein_id gnl|my_center|LOCUS_16400 6996 7781 gene locus_tag LOCUS_16410 6996 7781 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888755.1 protein_id gnl|my_center|LOCUS_16410 7769 8467 gene locus_tag LOCUS_16420 7769 8467 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437066.1 protein_id gnl|my_center|LOCUS_16420 8590 9063 gene locus_tag LOCUS_16430 gene ybaK 8590 9063 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437064.1 protein_id gnl|my_center|LOCUS_16430 9260 10099 gene locus_tag LOCUS_16440 9260 10099 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437062.1 protein_id gnl|my_center|LOCUS_16440 10112 10660 gene locus_tag LOCUS_16450 10112 10660 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437060.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence107 150 686 gene locus_tag LOCUS_16460 150 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16460 1038 2951 gene locus_tag LOCUS_16470 1038 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861077.1 protein_id gnl|my_center|LOCUS_16470 2944 5163 gene locus_tag LOCUS_16480 2944 5163 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437942.1 protein_id gnl|my_center|LOCUS_16480 5272 6102 gene locus_tag LOCUS_16490 5272 6102 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428590.1 protein_id gnl|my_center|LOCUS_16490 6092 9559 gene locus_tag LOCUS_16500 gene addB 6092 9559 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861078.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence108 1130 465 gene locus_tag LOCUS_16510 1130 465 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889593.1 protein_id gnl|my_center|LOCUS_16510 2276 1164 gene locus_tag LOCUS_16520 gene ribD 2276 1164 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896839.1 protein_id gnl|my_center|LOCUS_16520 2718 5201 gene locus_tag LOCUS_16530 gene recQ 2718 5201 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861310.1 protein_id gnl|my_center|LOCUS_16530 5543 6844 gene locus_tag LOCUS_16540 gene thiC 5543 6844 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889633.1 protein_id gnl|my_center|LOCUS_16540 6898 7092 gene locus_tag LOCUS_16550 gene thiS 6898 7092 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430174.1 protein_id gnl|my_center|LOCUS_16550 7085 7888 gene locus_tag LOCUS_16560 gene thiF 7085 7888 CDS product thiamine biosynthesis protein ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454457.1 protein_id gnl|my_center|LOCUS_16560 7951 8721 gene locus_tag LOCUS_16570 7951 8721 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889636.1 protein_id gnl|my_center|LOCUS_16570 8738 9841 gene locus_tag LOCUS_16580 gene thiH 8738 9841 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896847.1 protein_id gnl|my_center|LOCUS_16580 9842 10531 gene locus_tag LOCUS_16590 9842 10531 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889638.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence109 362 452 gene locus_tag LOCUS_t00090 362 452 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 540 1328 gene locus_tag LOCUS_16600 540 1328 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860942.1 protein_id gnl|my_center|LOCUS_16600 1349 2089 gene locus_tag LOCUS_16610 1349 2089 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895795.1 protein_id gnl|my_center|LOCUS_16610 2265 2633 gene locus_tag LOCUS_16620 2265 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860944.1 protein_id gnl|my_center|LOCUS_16620 2725 4185 gene locus_tag LOCUS_16630 2725 4185 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860945.1 protein_id gnl|my_center|LOCUS_16630 4238 7267 gene locus_tag LOCUS_16640 4238 7267 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895801.1 protein_id gnl|my_center|LOCUS_16640 7344 9410 gene locus_tag LOCUS_16650 7344 9410 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860946.1 protein_id gnl|my_center|LOCUS_16650 10229 10759 gene locus_tag LOCUS_16660 10229 10759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 >Feature sequence110 <1 583 gene locus_tag LOCUS_16670 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861503.1:GGDEF domain-containing protein 2153 756 gene locus_tag LOCUS_16680 gene asnS 2153 756 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430444.1 protein_id gnl|my_center|LOCUS_16680 2826 2632 gene locus_tag LOCUS_16690 2826 2632 CDS product DUF3787 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890435.1 protein_id gnl|my_center|LOCUS_16690 4772 3099 gene locus_tag LOCUS_16700 gene cspC 4772 3099 CDS product bile acid germinant receptor pseudoprotease CspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433821.1 protein_id gnl|my_center|LOCUS_16700 8180 4782 gene locus_tag LOCUS_16710 gene cspBA 8180 4782 CDS product bifunctional germination protease/germinant receptor pseudoprotease CspBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903108.1 protein_id gnl|my_center|LOCUS_16710 9544 8348 gene locus_tag LOCUS_16720 9544 8348 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861504.1 protein_id gnl|my_center|LOCUS_16720 10386 9565 gene locus_tag LOCUS_16730 10386 9565 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_16730 >Feature sequence111 429 1973 gene locus_tag LOCUS_16740 429 1973 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861273.1 protein_id gnl|my_center|LOCUS_16740 2149 2517 gene locus_tag LOCUS_16750 2149 2517 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430051.1 protein_id gnl|my_center|LOCUS_16750 2519 3244 gene locus_tag LOCUS_16760 2519 3244 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436372.1 protein_id gnl|my_center|LOCUS_16760 3238 4002 gene locus_tag LOCUS_16770 3238 4002 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436375.1 protein_id gnl|my_center|LOCUS_16770 4224 5474 gene locus_tag LOCUS_16780 4224 5474 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902660.1 protein_id gnl|my_center|LOCUS_16780 5665 6549 gene locus_tag LOCUS_16790 5665 6549 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902661.1 protein_id gnl|my_center|LOCUS_16790 6670 6813 gene locus_tag LOCUS_16800 6670 6813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 6911 7528 gene locus_tag LOCUS_16810 6911 7528 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896772.1 protein_id gnl|my_center|LOCUS_16810 7636 10167 gene locus_tag LOCUS_16820 7636 10167 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861274.1 protein_id gnl|my_center|LOCUS_16820 >Feature sequence112 <1 714 gene locus_tag LOCUS_16830 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861808.1:PTS transporter subunit EIIC 743 1096 gene locus_tag LOCUS_16840 743 1096 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439961.1 protein_id gnl|my_center|LOCUS_16840 1127 2563 gene locus_tag LOCUS_16850 1127 2563 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021368039.1 protein_id gnl|my_center|LOCUS_16850 2955 3707 gene locus_tag LOCUS_16860 2955 3707 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427244.1 protein_id gnl|my_center|LOCUS_16860 3809 4729 gene locus_tag LOCUS_16870 3809 4729 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891391.1 protein_id gnl|my_center|LOCUS_16870 4732 6648 gene locus_tag LOCUS_16880 4732 6648 CDS product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861805.1 protein_id gnl|my_center|LOCUS_16880 6668 7537 gene locus_tag LOCUS_16890 6668 7537 CDS product tagatose-bisphosphate aldolase subunit GatY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861804.1 protein_id gnl|my_center|LOCUS_16890 8047 9510 gene locus_tag LOCUS_16900 8047 9510 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 protein_id gnl|my_center|LOCUS_16900 9514 10614 gene locus_tag LOCUS_16910 9514 10614 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948401.1 protein_id gnl|my_center|LOCUS_16910 >Feature sequence113 1608 2246 gene locus_tag LOCUS_16920 1608 2246 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416703.1 protein_id gnl|my_center|LOCUS_16920 2259 3095 gene locus_tag LOCUS_16930 2259 3095 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454708.1 protein_id gnl|my_center|LOCUS_16930 3156 5783 gene locus_tag LOCUS_16940 gene ppdK 3156 5783 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861547.1 protein_id gnl|my_center|LOCUS_16940 5997 6242 gene locus_tag LOCUS_16950 5997 6242 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454705.1 protein_id gnl|my_center|LOCUS_16950 7828 6518 gene locus_tag LOCUS_16960 7828 6518 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861546.1 protein_id gnl|my_center|LOCUS_16960 10096 7850 gene locus_tag LOCUS_16970 10096 7850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16970 <10666 10102 gene locus_tag LOCUS_16980 <10666 10102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861545.1:efflux RND transporter permease subunit note possible pseudo, frameshifted >Feature sequence114 980 189 gene locus_tag LOCUS_16990 980 189 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434107.1 protein_id gnl|my_center|LOCUS_16990 1672 1016 gene locus_tag LOCUS_17000 1672 1016 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434110.1 protein_id gnl|my_center|LOCUS_17000 2630 1665 gene locus_tag LOCUS_17010 2630 1665 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896423.1 protein_id gnl|my_center|LOCUS_17010 4076 3132 gene locus_tag LOCUS_17020 4076 3132 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434114.1 protein_id gnl|my_center|LOCUS_17020 4187 4654 gene locus_tag LOCUS_17030 4187 4654 CDS product DUF6194 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434115.1 protein_id gnl|my_center|LOCUS_17030 5423 4824 gene locus_tag LOCUS_17040 5423 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434118.1 protein_id gnl|my_center|LOCUS_17040 5669 6265 gene locus_tag LOCUS_17050 5669 6265 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427445.1 protein_id gnl|my_center|LOCUS_17050 7355 6363 gene locus_tag LOCUS_17060 7355 6363 CDS product NrtA/SsuA/CpmA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434121.1 protein_id gnl|my_center|LOCUS_17060 8087 7356 gene locus_tag LOCUS_17070 8087 7356 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893083.1 protein_id gnl|my_center|LOCUS_17070 8850 8080 gene locus_tag LOCUS_17080 8850 8080 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896415.1 protein_id gnl|my_center|LOCUS_17080 9645 8935 gene locus_tag LOCUS_17090 9645 8935 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434127.1 protein_id gnl|my_center|LOCUS_17090 9977 9825 gene locus_tag LOCUS_17100 9977 9825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 <10660 10003 gene locus_tag LOCUS_17110 <10660 10003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861233.1:ferrous iron transport protein B >Feature sequence115 596 210 gene locus_tag LOCUS_17120 596 210 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437838.1 protein_id gnl|my_center|LOCUS_17120 828 601 gene locus_tag LOCUS_17130 828 601 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421373.1 protein_id gnl|my_center|LOCUS_17130 1450 1013 gene locus_tag LOCUS_17140 1450 1013 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421374.1 protein_id gnl|my_center|LOCUS_17140 2491 1676 gene locus_tag LOCUS_17150 gene yqeB 2491 1676 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437839.1 protein_id gnl|my_center|LOCUS_17150 3421 2792 gene locus_tag LOCUS_17160 gene upp 3421 2792 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437840.1 protein_id gnl|my_center|LOCUS_17160 3909 3457 gene locus_tag LOCUS_17170 gene rpiB 3909 3457 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437841.1 protein_id gnl|my_center|LOCUS_17170 4375 3926 gene locus_tag LOCUS_17180 4375 3926 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437844.1 protein_id gnl|my_center|LOCUS_17180 5432 4392 gene locus_tag LOCUS_17190 5432 4392 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892045.1 protein_id gnl|my_center|LOCUS_17190 6141 5461 gene locus_tag LOCUS_17200 6141 5461 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425887.1 protein_id gnl|my_center|LOCUS_17200 7334 6270 gene locus_tag LOCUS_17210 gene prfA 7334 6270 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_17210 8226 7378 gene locus_tag LOCUS_17220 gene prmC 8226 7378 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437849.1 protein_id gnl|my_center|LOCUS_17220 9137 8244 gene locus_tag LOCUS_17230 9137 8244 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421392.1 protein_id gnl|my_center|LOCUS_17230 9482 9282 gene locus_tag LOCUS_17240 gene rpmE 9482 9282 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421397.1 protein_id gnl|my_center|LOCUS_17240 10615 9635 gene locus_tag LOCUS_17250 10615 9635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 >Feature sequence116 267 833 gene locus_tag LOCUS_17260 267 833 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423380.1 protein_id gnl|my_center|LOCUS_17260 843 965 gene locus_tag LOCUS_17270 843 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 1138 1599 gene locus_tag LOCUS_17280 1138 1599 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861494.1 protein_id gnl|my_center|LOCUS_17280 1667 3913 gene locus_tag LOCUS_17290 1667 3913 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433859.1 protein_id gnl|my_center|LOCUS_17290 3906 5738 gene locus_tag LOCUS_17300 3906 5738 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_17300 6463 7734 gene locus_tag LOCUS_17310 gene hflX 6463 7734 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861493.1 protein_id gnl|my_center|LOCUS_17310 7967 8464 gene locus_tag LOCUS_17320 7967 8464 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903083.1 protein_id gnl|my_center|LOCUS_17320 8514 9038 gene locus_tag LOCUS_17330 8514 9038 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897366.1 protein_id gnl|my_center|LOCUS_17330 >Feature sequence117 3221 666 gene locus_tag LOCUS_17340 3221 666 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861400.1 protein_id gnl|my_center|LOCUS_17340 3904 3218 gene locus_tag LOCUS_17350 3904 3218 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435313.1 protein_id gnl|my_center|LOCUS_17350 4889 3981 gene locus_tag LOCUS_17360 4889 3981 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897088.1 protein_id gnl|my_center|LOCUS_17360 5562 4891 gene locus_tag LOCUS_17370 5562 4891 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897090.1 protein_id gnl|my_center|LOCUS_17370 5824 6888 gene locus_tag LOCUS_17380 5824 6888 CDS product reductive dehalogenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889925.1 protein_id gnl|my_center|LOCUS_17380 7046 7732 gene locus_tag LOCUS_17390 7046 7732 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861401.1 protein_id gnl|my_center|LOCUS_17390 7722 8753 gene locus_tag LOCUS_17400 7722 8753 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861402.1 protein_id gnl|my_center|LOCUS_17400 8835 9500 gene locus_tag LOCUS_17410 8835 9500 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861403.1 protein_id gnl|my_center|LOCUS_17410 >Feature sequence118 777 1046 gene locus_tag LOCUS_17420 777 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17420 2721 2059 gene locus_tag LOCUS_17430 2721 2059 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454838.1 protein_id gnl|my_center|LOCUS_17430 5290 2738 gene locus_tag LOCUS_17440 5290 2738 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860821.1 protein_id gnl|my_center|LOCUS_17440 5718 5524 gene locus_tag LOCUS_17450 5718 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17450 5909 5730 gene locus_tag LOCUS_17460 5909 5730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 6171 5914 gene locus_tag LOCUS_17470 6171 5914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17470 6178 6351 gene locus_tag LOCUS_17480 6178 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 7178 6933 gene locus_tag LOCUS_17490 7178 6933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17490 7585 7361 gene locus_tag LOCUS_17500 7585 7361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17500 7824 7552 gene locus_tag LOCUS_17510 7824 7552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 8063 7818 gene locus_tag LOCUS_17520 8063 7818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17520 8532 8380 gene locus_tag LOCUS_17530 8532 8380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 >Feature sequence119 1750 1157 gene locus_tag LOCUS_17540 1750 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 3284 1815 gene locus_tag LOCUS_17550 3284 1815 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896350.1 protein_id gnl|my_center|LOCUS_17550 4790 3399 gene locus_tag LOCUS_17560 4790 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861213.1 protein_id gnl|my_center|LOCUS_17560 5237 4956 gene locus_tag LOCUS_17570 5237 4956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861212.1 protein_id gnl|my_center|LOCUS_17570 5470 7599 gene locus_tag LOCUS_17580 5470 7599 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438605.1 protein_id gnl|my_center|LOCUS_17580 8440 7841 gene locus_tag LOCUS_17590 8440 7841 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889235.1 protein_id gnl|my_center|LOCUS_17590 <10254 8458 gene locus_tag LOCUS_17600 <10254 8458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861210.1:helicase C-terminal domain-containing protein >Feature sequence120 <1 981 gene locus_tag LOCUS_17610 <1 981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454919.1:carbon starvation protein A 1247 1729 gene locus_tag LOCUS_17620 1247 1729 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431194.1 protein_id gnl|my_center|LOCUS_17620 1784 2563 gene locus_tag LOCUS_17630 1784 2563 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861615.1 protein_id gnl|my_center|LOCUS_17630 2870 3316 gene locus_tag LOCUS_17640 gene lspA 2870 3316 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454916.1 protein_id gnl|my_center|LOCUS_17640 3321 4232 gene locus_tag LOCUS_17650 3321 4232 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861614.1 protein_id gnl|my_center|LOCUS_17650 4592 5125 gene locus_tag LOCUS_17660 gene pyrR 4592 5125 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431186.1 protein_id gnl|my_center|LOCUS_17660 5410 6621 gene locus_tag LOCUS_17670 5410 6621 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897793.1 protein_id gnl|my_center|LOCUS_17670 6920 8572 gene locus_tag LOCUS_17680 6920 8572 CDS product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861613.1 protein_id gnl|my_center|LOCUS_17680 <10250 8787 gene locus_tag LOCUS_17690 <10250 8787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861612.1:NFACT RNA binding domain-containing protein >Feature sequence121 1259 927 gene locus_tag LOCUS_17700 1259 927 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889116.1 protein_id gnl|my_center|LOCUS_17700 1449 2579 gene locus_tag LOCUS_17710 1449 2579 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438374.1 protein_id gnl|my_center|LOCUS_17710 4605 2707 gene locus_tag LOCUS_17720 4605 2707 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428202.1 protein_id gnl|my_center|LOCUS_17720 4920 5696 gene locus_tag LOCUS_17730 4920 5696 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016729594.1 protein_id gnl|my_center|LOCUS_17730 6540 5788 gene locus_tag LOCUS_17740 6540 5788 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438367.1 protein_id gnl|my_center|LOCUS_17740 7651 6701 gene locus_tag LOCUS_17750 gene galT 7651 6701 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438360.1 protein_id gnl|my_center|LOCUS_17750 8036 9232 gene locus_tag LOCUS_17760 8036 9232 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438357.1 protein_id gnl|my_center|LOCUS_17760 10019 9567 gene locus_tag LOCUS_17770 10019 9567 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419561.1 protein_id gnl|my_center|LOCUS_17770 >Feature sequence122 <1 590 gene locus_tag LOCUS_17780 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009898685.1:tagatose-bisphosphate aldolase subunit GatY 916 2817 gene locus_tag LOCUS_17790 916 2817 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861973.1 protein_id gnl|my_center|LOCUS_17790 2820 3863 gene locus_tag LOCUS_17800 gene ypdE 2820 3863 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891992.1 protein_id gnl|my_center|LOCUS_17800 3878 4183 gene locus_tag LOCUS_17810 3878 4183 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421329.1 protein_id gnl|my_center|LOCUS_17810 4280 4615 gene locus_tag LOCUS_17820 4280 4615 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421322.1 protein_id gnl|my_center|LOCUS_17820 4647 5969 gene locus_tag LOCUS_17830 4647 5969 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861972.1 protein_id gnl|my_center|LOCUS_17830 6039 7049 gene locus_tag LOCUS_17840 6039 7049 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861971.1 protein_id gnl|my_center|LOCUS_17840 7054 8241 gene locus_tag LOCUS_17850 7054 8241 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437779.1 protein_id gnl|my_center|LOCUS_17850 9310 8438 gene locus_tag LOCUS_17860 9310 8438 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861970.1 protein_id gnl|my_center|LOCUS_17860 9544 9663 gene locus_tag LOCUS_17870 9544 9663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 9895 9704 gene locus_tag LOCUS_17880 9895 9704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421310.1 protein_id gnl|my_center|LOCUS_17880 >Feature sequence123 901 197 gene locus_tag LOCUS_17890 901 197 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426384.1 protein_id gnl|my_center|LOCUS_17890 2148 1084 gene locus_tag LOCUS_17900 2148 1084 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890975.1 protein_id gnl|my_center|LOCUS_17900 2849 2151 gene locus_tag LOCUS_17910 2849 2151 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890976.1 protein_id gnl|my_center|LOCUS_17910 3937 2840 gene locus_tag LOCUS_17920 3937 2840 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454156.1 protein_id gnl|my_center|LOCUS_17920 5504 4260 gene locus_tag LOCUS_17930 5504 4260 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861660.1 protein_id gnl|my_center|LOCUS_17930 5832 6620 gene locus_tag LOCUS_17940 5832 6620 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422952.1 protein_id gnl|my_center|LOCUS_17940 6620 7093 gene locus_tag LOCUS_17950 6620 7093 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454155.1 protein_id gnl|my_center|LOCUS_17950 7625 7185 gene locus_tag LOCUS_17960 7625 7185 CDS product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454154.1 protein_id gnl|my_center|LOCUS_17960 7933 7640 gene locus_tag LOCUS_17970 7933 7640 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422948.1 protein_id gnl|my_center|LOCUS_17970 8377 7976 gene locus_tag LOCUS_17980 8377 7976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426410.1 protein_id gnl|my_center|LOCUS_17980 >Feature sequence124 710 1618 gene locus_tag LOCUS_17990 gene trxB 710 1618 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434033.1 protein_id gnl|my_center|LOCUS_17990 3531 1708 gene locus_tag LOCUS_18000 gene typA 3531 1708 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430621.1 protein_id gnl|my_center|LOCUS_18000 3743 3985 gene locus_tag LOCUS_18010 3743 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897259.1 protein_id gnl|my_center|LOCUS_18010 4133 4324 gene locus_tag LOCUS_18020 4133 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424459.1 protein_id gnl|my_center|LOCUS_18020 4608 7109 gene locus_tag LOCUS_18030 4608 7109 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861457.1 protein_id gnl|my_center|LOCUS_18030 7269 7937 gene locus_tag LOCUS_18040 7269 7937 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424455.1 protein_id gnl|my_center|LOCUS_18040 7921 9198 gene locus_tag LOCUS_18050 7921 9198 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434036.1 protein_id gnl|my_center|LOCUS_18050 9599 9820 gene locus_tag LOCUS_18060 9599 9820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890241.1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence125 1170 457 gene locus_tag LOCUS_18070 gene rgbR 1170 457 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_18070 1971 1420 gene locus_tag LOCUS_18080 1971 1420 CDS product DUF2812 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896054.1 protein_id gnl|my_center|LOCUS_18080 2878 2075 gene locus_tag LOCUS_18090 gene zupT 2878 2075 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861091.1 protein_id gnl|my_center|LOCUS_18090 4192 3029 gene locus_tag LOCUS_18100 4192 3029 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861090.1 protein_id gnl|my_center|LOCUS_18100 5439 4252 gene locus_tag LOCUS_18110 5439 4252 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861089.1 protein_id gnl|my_center|LOCUS_18110 7502 5802 gene locus_tag LOCUS_18120 7502 5802 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438014.1 protein_id gnl|my_center|LOCUS_18120 8020 7745 gene locus_tag LOCUS_18130 8020 7745 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428537.1 protein_id gnl|my_center|LOCUS_18130 8672 8139 gene locus_tag LOCUS_18140 gene mobB 8672 8139 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888886.1 protein_id gnl|my_center|LOCUS_18140 9876 8695 gene locus_tag LOCUS_18150 9876 8695 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902263.1 protein_id gnl|my_center|LOCUS_18150 >Feature sequence126 2421 667 gene locus_tag LOCUS_18160 2421 667 CDS product GGDEF domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454514.1 protein_id gnl|my_center|LOCUS_18160 3969 3004 gene locus_tag LOCUS_18170 3969 3004 CDS product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861284.1 protein_id gnl|my_center|LOCUS_18170 4816 4061 gene locus_tag LOCUS_18180 4816 4061 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889549.1 protein_id gnl|my_center|LOCUS_18180 5769 4813 gene locus_tag LOCUS_18190 5769 4813 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861283.1 protein_id gnl|my_center|LOCUS_18190 6712 5759 gene locus_tag LOCUS_18200 6712 5759 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454520.1 protein_id gnl|my_center|LOCUS_18200 7940 6960 gene locus_tag LOCUS_18210 7940 6960 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889546.1 protein_id gnl|my_center|LOCUS_18210 9218 8016 gene locus_tag LOCUS_18220 9218 8016 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889545.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence127 <1 824 gene locus_tag LOCUS_18230 <1 824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009897312.1:XRE family transcriptional regulator 1909 941 gene locus_tag LOCUS_18240 1909 941 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861477.1 protein_id gnl|my_center|LOCUS_18240 2244 2432 gene locus_tag LOCUS_18250 2244 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861476.1 protein_id gnl|my_center|LOCUS_18250 2692 3891 gene locus_tag LOCUS_18260 2692 3891 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897308.1 protein_id gnl|my_center|LOCUS_18260 3943 4446 gene locus_tag LOCUS_18270 3943 4446 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893498.1 protein_id gnl|my_center|LOCUS_18270 4553 4870 gene locus_tag LOCUS_18280 4553 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430572.1 protein_id gnl|my_center|LOCUS_18280 5028 5987 gene locus_tag LOCUS_18290 5028 5987 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861475.1 protein_id gnl|my_center|LOCUS_18290 6102 6935 gene locus_tag LOCUS_18300 6102 6935 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861474.1 protein_id gnl|my_center|LOCUS_18300 7173 8498 gene locus_tag LOCUS_18310 7173 8498 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430579.1 protein_id gnl|my_center|LOCUS_18310 9001 8573 gene locus_tag LOCUS_18320 9001 8573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861473.1 protein_id gnl|my_center|LOCUS_18320 <9851 9092 gene locus_tag LOCUS_18330 <9851 9092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003430581.1:[FeFe] hydrogenase H-cluster radical SAM maturase HydG >Feature sequence128 1941 1438 gene locus_tag LOCUS_18340 1941 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18340 3504 2239 gene locus_tag LOCUS_18350 gene gluD 3504 2239 CDS product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420866.1 protein_id gnl|my_center|LOCUS_18350 4457 3633 gene locus_tag LOCUS_18360 4457 3633 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888021.1 protein_id gnl|my_center|LOCUS_18360 4730 5917 gene locus_tag LOCUS_18370 4730 5917 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434490.1 protein_id gnl|my_center|LOCUS_18370 7282 6056 gene locus_tag LOCUS_18380 7282 6056 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895268.1 protein_id gnl|my_center|LOCUS_18380 7730 7257 gene locus_tag LOCUS_18390 7730 7257 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860659.1 protein_id gnl|my_center|LOCUS_18390 9624 7723 gene locus_tag LOCUS_18400 gene cooS 9624 7723 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888019.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence129 1148 81 gene locus_tag LOCUS_18410 1148 81 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895264.1 protein_id gnl|my_center|LOCUS_18410 1433 1603 gene locus_tag LOCUS_18420 1433 1603 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888017.1 protein_id gnl|my_center|LOCUS_18420 2309 1779 gene locus_tag LOCUS_18430 2309 1779 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860658.1 protein_id gnl|my_center|LOCUS_18430 3089 2457 gene locus_tag LOCUS_18440 3089 2457 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_18440 3225 5138 gene locus_tag LOCUS_18450 3225 5138 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434478.1 protein_id gnl|my_center|LOCUS_18450 5154 6530 gene locus_tag LOCUS_18460 5154 6530 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425390.1 protein_id gnl|my_center|LOCUS_18460 7320 6670 gene locus_tag LOCUS_18470 7320 6670 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434477.1 protein_id gnl|my_center|LOCUS_18470 >Feature sequence130 141 275 gene locus_tag LOCUS_18480 141 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 403 828 gene locus_tag LOCUS_18490 403 828 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861830.1 protein_id gnl|my_center|LOCUS_18490 860 2047 gene locus_tag LOCUS_18500 860 2047 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440033.1 protein_id gnl|my_center|LOCUS_18500 2239 2643 gene locus_tag LOCUS_18510 2239 2643 CDS product DUF3139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440031.1 protein_id gnl|my_center|LOCUS_18510 3289 4149 gene locus_tag LOCUS_18520 3289 4149 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891460.1 protein_id gnl|my_center|LOCUS_18520 4139 4363 gene locus_tag LOCUS_18530 4139 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18530 4367 6010 gene locus_tag LOCUS_18540 4367 6010 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861829.1 protein_id gnl|my_center|LOCUS_18540 6030 7484 gene locus_tag LOCUS_18550 6030 7484 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440025.1 protein_id gnl|my_center|LOCUS_18550 >Feature sequence131 464 1408 gene locus_tag LOCUS_18560 464 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438046.1 protein_id gnl|my_center|LOCUS_18560 1624 2961 gene locus_tag LOCUS_18570 gene rsxC 1624 2961 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428488.1 protein_id gnl|my_center|LOCUS_18570 2984 3961 gene locus_tag LOCUS_18580 2984 3961 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428487.1 protein_id gnl|my_center|LOCUS_18580 3961 4530 gene locus_tag LOCUS_18590 3961 4530 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902280.1 protein_id gnl|my_center|LOCUS_18590 4543 5136 gene locus_tag LOCUS_18600 4543 5136 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_18600 5151 5726 gene locus_tag LOCUS_18610 gene rsxA 5151 5726 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_18610 5742 6713 gene locus_tag LOCUS_18620 5742 6713 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_18620 6933 7517 gene locus_tag LOCUS_18630 6933 7517 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428485.1 protein_id gnl|my_center|LOCUS_18630 7562 8221 gene locus_tag LOCUS_18640 gene radC 7562 8221 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888913.1 protein_id gnl|my_center|LOCUS_18640 8291 9352 gene locus_tag LOCUS_18650 8291 9352 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428483.1 protein_id gnl|my_center|LOCUS_18650 >Feature sequence132 1526 441 gene locus_tag LOCUS_18660 1526 441 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897227.1 protein_id gnl|my_center|LOCUS_18660 2875 1562 gene locus_tag LOCUS_18670 2875 1562 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897229.1 protein_id gnl|my_center|LOCUS_18670 5167 2876 gene locus_tag LOCUS_18680 5167 2876 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861447.1 protein_id gnl|my_center|LOCUS_18680 5951 5157 gene locus_tag LOCUS_18690 5951 5157 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861448.1 protein_id gnl|my_center|LOCUS_18690 6436 5990 gene locus_tag LOCUS_18700 6436 5990 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902988.1 protein_id gnl|my_center|LOCUS_18700 7914 6508 gene locus_tag LOCUS_18710 7914 6508 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890213.1 protein_id gnl|my_center|LOCUS_18710 9302 7932 gene locus_tag LOCUS_18720 gene hydA 9302 7932 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861449.1 protein_id gnl|my_center|LOCUS_18720 >Feature sequence133 2552 2872 gene locus_tag LOCUS_18730 2552 2872 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861350.1 protein_id gnl|my_center|LOCUS_18730 3567 2821 gene locus_tag LOCUS_18740 3567 2821 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897033.1 protein_id gnl|my_center|LOCUS_18740 7022 3585 gene locus_tag LOCUS_18750 7022 3585 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861349.1 protein_id gnl|my_center|LOCUS_18750 8536 7055 gene locus_tag LOCUS_18760 8536 7055 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897032.1 protein_id gnl|my_center|LOCUS_18760 <9636 8804 gene locus_tag LOCUS_18770 <9636 8804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003428643.1:prephenate dehydrogenase >Feature sequence134 <1 3795 gene locus_tag LOCUS_18780 <1 3795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860739.1:DUF4132 domain-containing protein 4717 3980 gene locus_tag LOCUS_18790 4717 3980 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434827.1 protein_id gnl|my_center|LOCUS_18790 5671 4736 gene locus_tag LOCUS_18800 5671 4736 CDS product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860738.1 protein_id gnl|my_center|LOCUS_18800 5879 8455 gene locus_tag LOCUS_18810 5879 8455 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860737.1 protein_id gnl|my_center|LOCUS_18810 8467 9138 gene locus_tag LOCUS_18820 8467 9138 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860736.1 protein_id gnl|my_center|LOCUS_18820 9165 9506 gene locus_tag LOCUS_18830 9165 9506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860735.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence135 <1 861 gene locus_tag LOCUS_18840 <1 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009897262.1:homoserine kinase 1048 2046 gene locus_tag LOCUS_18850 1048 2046 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430617.1 protein_id gnl|my_center|LOCUS_18850 2713 2201 gene locus_tag LOCUS_18860 2713 2201 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434028.1 protein_id gnl|my_center|LOCUS_18860 3233 4168 gene locus_tag LOCUS_18870 3233 4168 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430615.1 protein_id gnl|my_center|LOCUS_18870 6131 4260 gene locus_tag LOCUS_18880 6131 4260 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434025.1 protein_id gnl|my_center|LOCUS_18880 6321 7247 gene locus_tag LOCUS_18890 6321 7247 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893461.1 protein_id gnl|my_center|LOCUS_18890 7386 7532 gene locus_tag LOCUS_18900 7386 7532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 8161 7637 gene locus_tag LOCUS_18910 8161 7637 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890262.1 protein_id gnl|my_center|LOCUS_18910 8438 8214 gene locus_tag LOCUS_18920 8438 8214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434018.1 protein_id gnl|my_center|LOCUS_18920 >Feature sequence136 280 936 gene locus_tag LOCUS_18930 280 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425116.1 protein_id gnl|my_center|LOCUS_18930 2715 1444 gene locus_tag LOCUS_18940 gene sleC 2715 1444 CDS product spore cortex-lytic germination protein SleC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425119.1 protein_id gnl|my_center|LOCUS_18940 2960 3676 gene locus_tag LOCUS_18950 2960 3676 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901989.1 protein_id gnl|my_center|LOCUS_18950 3755 5065 gene locus_tag LOCUS_18960 3755 5065 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_18960 5165 5701 gene locus_tag LOCUS_18970 gene lepB 5165 5701 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425127.1 protein_id gnl|my_center|LOCUS_18970 5867 6403 gene locus_tag LOCUS_18980 gene lepB 5867 6403 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425129.1 protein_id gnl|my_center|LOCUS_18980 6413 7168 gene locus_tag LOCUS_18990 6413 7168 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860855.1 protein_id gnl|my_center|LOCUS_18990 7242 8909 gene locus_tag LOCUS_19000 7242 8909 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436982.1 protein_id gnl|my_center|LOCUS_19000 9251 >9444 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attactaggttgttaaatta >Feature sequence137 565 92 gene locus_tag LOCUS_19010 565 92 CDS product glycine/sarcosine/betaine reductase component B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428088.1 protein_id gnl|my_center|LOCUS_19010 1059 592 gene locus_tag LOCUS_19020 1059 592 CDS product glycine/sarcosine/betaine reductase component B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422094.1 protein_id gnl|my_center|LOCUS_19020 1832 1074 gene locus_tag LOCUS_19030 gene prdD 1832 1074 CDS product proline reductase cluster protein PrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428092.1 protein_id gnl|my_center|LOCUS_19030 2637 1912 gene locus_tag LOCUS_19040 gene prdB 2637 1912 CDS product D-proline reductase (dithiol) protein PrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861888.1 transl_except (pos:complement(2185..2187),aa:Sec) note codon on position 151 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_19040 2959 2675 gene locus_tag LOCUS_19050 2959 2675 CDS product CBO2463/CBO2479 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422102.1 protein_id gnl|my_center|LOCUS_19050 4920 3040 gene locus_tag LOCUS_19060 gene prdA 4920 3040 CDS product D-proline reductase (dithiol) proprotein PrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422104.1 protein_id gnl|my_center|LOCUS_19060 7109 5349 gene locus_tag LOCUS_19070 gene prdR 7109 5349 CDS product sigma-54 dependent transcriptional regulator PrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428097.1 protein_id gnl|my_center|LOCUS_19070 <9414 7516 gene locus_tag LOCUS_19080 <9414 7516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861889.1:Cys-Gln thioester bond-forming surface protein >Feature sequence138 <1 749 gene locus_tag LOCUS_19090 <1 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437011.1:diguanylate cyclase 739 2403 gene locus_tag LOCUS_19100 739 2403 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861073.1 protein_id gnl|my_center|LOCUS_19100 2452 3708 gene locus_tag LOCUS_19110 2452 3708 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437008.1 protein_id gnl|my_center|LOCUS_19110 3731 5812 gene locus_tag LOCUS_19120 3731 5812 CDS product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895990.1 protein_id gnl|my_center|LOCUS_19120 5849 6934 gene locus_tag LOCUS_19130 5849 6934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895992.1 protein_id gnl|my_center|LOCUS_19130 6988 8112 gene locus_tag LOCUS_19140 gene wecB 6988 8112 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437003.1 protein_id gnl|my_center|LOCUS_19140 8190 9164 gene locus_tag LOCUS_19150 8190 9164 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861074.1 protein_id gnl|my_center|LOCUS_19150 >Feature sequence139 1048 209 gene locus_tag LOCUS_19160 1048 209 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860838.1 protein_id gnl|my_center|LOCUS_19160 1830 1072 gene locus_tag LOCUS_19170 1830 1072 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434801.1 protein_id gnl|my_center|LOCUS_19170 2350 1877 gene locus_tag LOCUS_19180 2350 1877 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426364.1 protein_id gnl|my_center|LOCUS_19180 2786 2379 gene locus_tag LOCUS_19190 2786 2379 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860837.1 protein_id gnl|my_center|LOCUS_19190 3894 2842 gene locus_tag LOCUS_19200 3894 2842 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860836.1 protein_id gnl|my_center|LOCUS_19200 4290 4970 gene locus_tag LOCUS_19210 4290 4970 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426355.1 protein_id gnl|my_center|LOCUS_19210 5423 5103 gene locus_tag LOCUS_19220 gene sugE 5423 5103 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417824.1 protein_id gnl|my_center|LOCUS_19220 5805 6632 gene locus_tag LOCUS_19230 5805 6632 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860835.1 protein_id gnl|my_center|LOCUS_19230 7452 8126 gene locus_tag LOCUS_19240 7452 8126 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860834.1 protein_id gnl|my_center|LOCUS_19240 8114 9274 gene locus_tag LOCUS_19250 8114 9274 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021366129.1 protein_id gnl|my_center|LOCUS_19250 >Feature sequence140 492 614 gene locus_tag LOCUS_19260 492 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 611 1297 gene locus_tag LOCUS_19270 611 1297 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434895.1 protein_id gnl|my_center|LOCUS_19270 1284 2273 gene locus_tag LOCUS_19280 1284 2273 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434897.1 protein_id gnl|my_center|LOCUS_19280 2356 3042 gene locus_tag LOCUS_19290 2356 3042 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426034.1 protein_id gnl|my_center|LOCUS_19290 3042 5588 gene locus_tag LOCUS_19300 3042 5588 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892169.1 protein_id gnl|my_center|LOCUS_19300 6601 5744 gene locus_tag LOCUS_19310 6601 5744 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434903.1 protein_id gnl|my_center|LOCUS_19310 7287 6622 gene locus_tag LOCUS_19320 7287 6622 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_19320 8159 7287 gene locus_tag LOCUS_19330 8159 7287 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_19330 8327 9070 gene locus_tag LOCUS_19340 8327 9070 CDS product DUF3298 and DUF4163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426024.1 protein_id gnl|my_center|LOCUS_19340 >Feature sequence141 1006 542 gene locus_tag LOCUS_19350 1006 542 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860814.1 protein_id gnl|my_center|LOCUS_19350 2691 1270 gene locus_tag LOCUS_19360 gene nhaC 2691 1270 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426252.1 protein_id gnl|my_center|LOCUS_19360 3785 2721 gene locus_tag LOCUS_19370 gene orr 3785 2721 CDS product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860813.1 protein_id gnl|my_center|LOCUS_19370 5179 3770 gene locus_tag LOCUS_19380 5179 3770 CDS product GlmL-related ornithine degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895468.1 protein_id gnl|my_center|LOCUS_19380 7383 5179 gene locus_tag LOCUS_19390 gene oraE 7383 5179 CDS product D-ornithine 4,5-aminomutase subunit OraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895465.1 protein_id gnl|my_center|LOCUS_19390 7751 7377 gene locus_tag LOCUS_19400 7751 7377 CDS product ornithine aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434665.1 protein_id gnl|my_center|LOCUS_19400 9259 7829 gene locus_tag LOCUS_19410 gene ortB 9259 7829 CDS product 2-amino-4-oxopentanoate thiolase subunit OrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032507361.1 protein_id gnl|my_center|LOCUS_19410 >Feature sequence142 1314 643 gene locus_tag LOCUS_19420 1314 643 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423753.1 protein_id gnl|my_center|LOCUS_19420 1957 1346 gene locus_tag LOCUS_19430 1957 1346 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430270.1 protein_id gnl|my_center|LOCUS_19430 2798 1995 gene locus_tag LOCUS_19440 2798 1995 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439548.1 protein_id gnl|my_center|LOCUS_19440 4579 3272 gene locus_tag LOCUS_19450 4579 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861333.1 protein_id gnl|my_center|LOCUS_19450 5661 5221 gene locus_tag LOCUS_19460 5661 5221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893285.1 protein_id gnl|my_center|LOCUS_19460 6244 5867 gene locus_tag LOCUS_19470 6244 5867 CDS product C-GCAxxG-C-C family (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430265.1 protein_id gnl|my_center|LOCUS_19470 6854 6360 gene locus_tag LOCUS_19480 6854 6360 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439552.1 protein_id gnl|my_center|LOCUS_19480 <9199 7003 gene locus_tag LOCUS_19490 <9199 7003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861332.1:2-hydroxyacyl-CoA dehydratase >Feature sequence143 125 1525 gene locus_tag LOCUS_19500 125 1525 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861575.1 protein_id gnl|my_center|LOCUS_19500 2368 1649 gene locus_tag LOCUS_19510 2368 1649 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454804.1 protein_id gnl|my_center|LOCUS_19510 3173 2415 gene locus_tag LOCUS_19520 3173 2415 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897697.1 protein_id gnl|my_center|LOCUS_19520 4656 3304 gene locus_tag LOCUS_19530 4656 3304 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861576.1 protein_id gnl|my_center|LOCUS_19530 6303 4753 gene locus_tag LOCUS_19540 6303 4753 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890719.1 protein_id gnl|my_center|LOCUS_19540 7171 6356 gene locus_tag LOCUS_19550 7171 6356 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431027.1 protein_id gnl|my_center|LOCUS_19550 7674 7192 gene locus_tag LOCUS_19560 7674 7192 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897702.1 protein_id gnl|my_center|LOCUS_19560 8338 7958 gene locus_tag LOCUS_19570 8338 7958 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416451.1 protein_id gnl|my_center|LOCUS_19570 <9134 8433 gene locus_tag LOCUS_19580 <9134 8433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009890721.1:threonine ammonia-lyase >Feature sequence144 339 112 gene locus_tag LOCUS_19590 339 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373965.1 protein_id gnl|my_center|LOCUS_19590 497 339 gene locus_tag LOCUS_19600 497 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 653 841 gene locus_tag LOCUS_19610 653 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 959 819 gene locus_tag LOCUS_19620 959 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 1200 991 gene locus_tag LOCUS_19630 1200 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860993.1 protein_id gnl|my_center|LOCUS_19630 1610 1281 gene locus_tag LOCUS_19640 1610 1281 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860992.1 protein_id gnl|my_center|LOCUS_19640 2471 1680 gene locus_tag LOCUS_19650 2471 1680 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861756.1 protein_id gnl|my_center|LOCUS_19650 2700 2464 gene locus_tag LOCUS_19660 2700 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 2845 3210 gene locus_tag LOCUS_19670 2845 3210 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428913.1 protein_id gnl|my_center|LOCUS_19670 3365 3225 gene locus_tag LOCUS_19680 3365 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 3862 5310 gene locus_tag LOCUS_19690 3862 5310 CDS product SAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860985.1 protein_id gnl|my_center|LOCUS_19690 5580 7244 gene locus_tag LOCUS_19700 5580 7244 CDS product DUF4041 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860984.1 protein_id gnl|my_center|LOCUS_19700 7752 8870 gene locus_tag LOCUS_19710 7752 8870 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860983.1 protein_id gnl|my_center|LOCUS_19710 >Feature sequence145 301 1080 gene locus_tag LOCUS_19720 301 1080 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_19720 2211 1390 gene locus_tag LOCUS_19730 2211 1390 CDS product metallo-hydrolase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860919.1 protein_id gnl|my_center|LOCUS_19730 3704 2886 gene locus_tag LOCUS_19740 3704 2886 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860920.1 protein_id gnl|my_center|LOCUS_19740 3872 4453 gene locus_tag LOCUS_19750 3872 4453 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860921.1 protein_id gnl|my_center|LOCUS_19750 4450 4644 gene locus_tag LOCUS_19760 4450 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 6550 4808 gene locus_tag LOCUS_19770 6550 4808 CDS product metalloendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860923.1 protein_id gnl|my_center|LOCUS_19770 6979 8355 gene locus_tag LOCUS_19780 6979 8355 CDS product Trk family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888508.1 protein_id gnl|my_center|LOCUS_19780 >Feature sequence146 <1 1123 gene locus_tag LOCUS_19790 <1 1123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860952.1:molybdopterin-dependent oxidoreductase 1211 1546 gene locus_tag LOCUS_19800 gene spoIIAA 1211 1546 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418414.1 protein_id gnl|my_center|LOCUS_19800 1560 1988 gene locus_tag LOCUS_19810 gene spoIIAB 1560 1988 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418415.1 protein_id gnl|my_center|LOCUS_19810 2011 2775 gene locus_tag LOCUS_19820 gene sigF 2011 2775 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860953.1 protein_id gnl|my_center|LOCUS_19820 3055 3492 gene locus_tag LOCUS_19830 gene spoVAC 3055 3492 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418420.1 protein_id gnl|my_center|LOCUS_19830 3659 4672 gene locus_tag LOCUS_19840 gene spoVAD 3659 4672 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437476.1 protein_id gnl|my_center|LOCUS_19840 4686 5048 gene locus_tag LOCUS_19850 gene spoVAE 4686 5048 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418423.1 protein_id gnl|my_center|LOCUS_19850 5231 6247 gene locus_tag LOCUS_19860 5231 6247 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437479.1 protein_id gnl|my_center|LOCUS_19860 6622 7464 gene locus_tag LOCUS_19870 6622 7464 CDS product DUF3100 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437481.1 protein_id gnl|my_center|LOCUS_19870 7479 7943 gene locus_tag LOCUS_19880 7479 7943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437484.1 protein_id gnl|my_center|LOCUS_19880 >Feature sequence147 27 1025 gene locus_tag LOCUS_19890 27 1025 CDS product YhdH/YhfP family quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436791.1 protein_id gnl|my_center|LOCUS_19890 2071 1145 gene locus_tag LOCUS_19900 2071 1145 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436788.1 protein_id gnl|my_center|LOCUS_19900 2457 4061 gene locus_tag LOCUS_19910 2457 4061 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861711.1 protein_id gnl|my_center|LOCUS_19910 4877 6148 gene locus_tag LOCUS_19920 gene serS 4877 6148 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861710.1 protein_id gnl|my_center|LOCUS_19920 6562 8067 gene locus_tag LOCUS_19930 6562 8067 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861709.1 protein_id gnl|my_center|LOCUS_19930 8181 8879 gene locus_tag LOCUS_19940 8181 8879 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436119.1 protein_id gnl|my_center|LOCUS_19940 >Feature sequence148 658 1296 gene locus_tag LOCUS_19950 658 1296 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435129.1 protein_id gnl|my_center|LOCUS_19950 1323 2222 gene locus_tag LOCUS_19960 1323 2222 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435130.1 protein_id gnl|my_center|LOCUS_19960 3993 2329 gene locus_tag LOCUS_19970 3993 2329 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428989.1 protein_id gnl|my_center|LOCUS_19970 4285 4998 gene locus_tag LOCUS_19980 4285 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890174.1 protein_id gnl|my_center|LOCUS_19980 5157 5720 gene locus_tag LOCUS_19990 5157 5720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433003.1 protein_id gnl|my_center|LOCUS_19990 6117 7817 gene locus_tag LOCUS_20000 6117 7817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435136.1 protein_id gnl|my_center|LOCUS_20000 7987 8604 gene locus_tag LOCUS_20010 7987 8604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424290.1 protein_id gnl|my_center|LOCUS_20010 >Feature sequence149 <1 860 gene locus_tag LOCUS_20020 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860904.1:glycosylating toxin TcdA 1893 1195 gene locus_tag LOCUS_20030 gene tcdC 1893 1195 CDS product glycosylating toxin anti-sigma factor TcdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860905.1 protein_id gnl|my_center|LOCUS_20030 2319 2564 gene locus_tag LOCUS_20040 gene cdd1 2319 2564 CDS product protein Cdd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888450.1 protein_id gnl|my_center|LOCUS_20040 3051 2782 gene locus_tag LOCUS_20050 3051 2782 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426848.1 protein_id gnl|my_center|LOCUS_20050 4666 3929 gene locus_tag LOCUS_20060 4666 3929 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860906.1 protein_id gnl|my_center|LOCUS_20060 5439 4678 gene locus_tag LOCUS_20070 5439 4678 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860907.1 protein_id gnl|my_center|LOCUS_20070 6353 5439 gene locus_tag LOCUS_20080 6353 5439 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860908.1 protein_id gnl|my_center|LOCUS_20080 6524 7231 gene locus_tag LOCUS_20090 6524 7231 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888460.1 protein_id gnl|my_center|LOCUS_20090 7276 8619 gene locus_tag LOCUS_20100 7276 8619 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860909.1 protein_id gnl|my_center|LOCUS_20100 >Feature sequence150 1627 434 gene locus_tag LOCUS_20110 1627 434 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860903.1 protein_id gnl|my_center|LOCUS_20110 2946 1690 gene locus_tag LOCUS_20120 2946 1690 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021362269.1 protein_id gnl|my_center|LOCUS_20120 5057 4323 gene locus_tag LOCUS_20130 5057 4323 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860901.1 protein_id gnl|my_center|LOCUS_20130 6701 6063 gene locus_tag LOCUS_20140 6701 6063 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440185.1 protein_id gnl|my_center|LOCUS_20140 7561 6704 gene locus_tag LOCUS_20150 7561 6704 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860900.1 protein_id gnl|my_center|LOCUS_20150 7937 7563 gene locus_tag LOCUS_20160 7937 7563 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440181.1 protein_id gnl|my_center|LOCUS_20160 8450 8632 gene locus_tag LOCUS_20170 8450 8632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 >Feature sequence151 121 393 gene locus_tag LOCUS_20180 121 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 406 1311 gene locus_tag LOCUS_20190 gene truB 406 1311 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428232.1 protein_id gnl|my_center|LOCUS_20190 1442 2371 gene locus_tag LOCUS_20200 1442 2371 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438310.1 protein_id gnl|my_center|LOCUS_20200 2475 2732 gene locus_tag LOCUS_20210 gene rpsO 2475 2732 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419491.1 protein_id gnl|my_center|LOCUS_20210 2972 3817 gene locus_tag LOCUS_20220 2972 3817 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889099.1 protein_id gnl|my_center|LOCUS_20220 3942 6053 gene locus_tag LOCUS_20230 gene pnp 3942 6053 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_20230 6319 7062 gene locus_tag LOCUS_20240 6319 7062 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438319.1 protein_id gnl|my_center|LOCUS_20240 7220 8467 gene locus_tag LOCUS_20250 7220 8467 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438321.1 protein_id gnl|my_center|LOCUS_20250 >Feature sequence152 160 1848 gene locus_tag LOCUS_20260 gene lepA 160 1848 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416556.1 protein_id gnl|my_center|LOCUS_20260 1988 3334 gene locus_tag LOCUS_20270 1988 3334 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_20270 3567 4880 gene locus_tag LOCUS_20280 3567 4880 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897651.1 protein_id gnl|my_center|LOCUS_20280 5052 6227 gene locus_tag LOCUS_20290 gene hemW 5052 6227 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454756.1 protein_id gnl|my_center|LOCUS_20290 6330 7349 gene locus_tag LOCUS_20300 gene hrcA 6330 7349 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454754.1 protein_id gnl|my_center|LOCUS_20300 7379 7999 gene locus_tag LOCUS_20310 gene grpE 7379 7999 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454752.1 protein_id gnl|my_center|LOCUS_20310 >Feature sequence153 <1 574 gene locus_tag LOCUS_20320 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003438051.1:rod shape-determining protein MreC 589 1077 gene locus_tag LOCUS_20330 gene mreD 589 1077 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861127.1 protein_id gnl|my_center|LOCUS_20330 1089 4067 gene locus_tag LOCUS_20340 1089 4067 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861128.1 protein_id gnl|my_center|LOCUS_20340 4165 4848 gene locus_tag LOCUS_20350 4165 4848 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428479.1 protein_id gnl|my_center|LOCUS_20350 4872 5669 gene locus_tag LOCUS_20360 gene minD 4872 5669 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419057.1 protein_id gnl|my_center|LOCUS_20360 5687 5971 gene locus_tag LOCUS_20370 gene minE 5687 5971 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419058.1 protein_id gnl|my_center|LOCUS_20370 6056 7186 gene locus_tag LOCUS_20380 gene rodA 6056 7186 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888916.1 protein_id gnl|my_center|LOCUS_20380 7227 7640 gene locus_tag LOCUS_20390 7227 7640 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438060.1 protein_id gnl|my_center|LOCUS_20390 8124 8453 gene locus_tag LOCUS_20400 8124 8453 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419063.1 protein_id gnl|my_center|LOCUS_20400 >Feature sequence154 1549 2676 gene locus_tag LOCUS_20410 1549 2676 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888643.1 protein_id gnl|my_center|LOCUS_20410 4237 3053 gene locus_tag LOCUS_20420 4237 3053 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454238.1 protein_id gnl|my_center|LOCUS_20420 5632 4817 gene locus_tag LOCUS_20430 5632 4817 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860968.1 protein_id gnl|my_center|LOCUS_20430 7371 5929 gene locus_tag LOCUS_20440 7371 5929 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895854.1 protein_id gnl|my_center|LOCUS_20440 7884 7498 gene locus_tag LOCUS_20450 7884 7498 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_20450 8310 7921 gene locus_tag LOCUS_20460 8310 7921 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_20460 >Feature sequence155 1127 588 gene locus_tag LOCUS_20470 gene hpt 1127 588 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454045.1 protein_id gnl|my_center|LOCUS_20470 2762 1455 gene locus_tag LOCUS_20480 2762 1455 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021359871.1 protein_id gnl|my_center|LOCUS_20480 4953 3187 gene locus_tag LOCUS_20490 4953 3187 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861887.1 protein_id gnl|my_center|LOCUS_20490 5096 4959 gene locus_tag LOCUS_20500 5096 4959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 5743 5174 gene locus_tag LOCUS_20510 5743 5174 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422084.1 protein_id gnl|my_center|LOCUS_20510 6562 5927 gene locus_tag LOCUS_20520 6562 5927 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422086.1 protein_id gnl|my_center|LOCUS_20520 8111 7230 gene locus_tag LOCUS_20530 8111 7230 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891694.1 protein_id gnl|my_center|LOCUS_20530 >Feature sequence156 2198 1014 gene locus_tag LOCUS_20540 2198 1014 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897664.1 protein_id gnl|my_center|LOCUS_20540 3112 2207 gene locus_tag LOCUS_20550 3112 2207 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454768.1 protein_id gnl|my_center|LOCUS_20550 3300 4136 gene locus_tag LOCUS_20560 3300 4136 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861569.1 protein_id gnl|my_center|LOCUS_20560 4985 4278 gene locus_tag LOCUS_20570 4985 4278 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454770.1 protein_id gnl|my_center|LOCUS_20570 5232 5136 gene locus_tag LOCUS_t00100 5232 5136 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 6315 5476 gene locus_tag LOCUS_20580 6315 5476 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890693.1 protein_id gnl|my_center|LOCUS_20580 7238 6564 gene locus_tag LOCUS_20590 7238 6564 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416528.1 protein_id gnl|my_center|LOCUS_20590 7646 7275 gene locus_tag LOCUS_20600 7646 7275 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416526.1 protein_id gnl|my_center|LOCUS_20600 >Feature sequence157 262 1341 gene locus_tag LOCUS_20610 262 1341 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860887.1 protein_id gnl|my_center|LOCUS_20610 1665 2033 gene locus_tag LOCUS_20620 1665 2033 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860888.1 protein_id gnl|my_center|LOCUS_20620 2150 2947 gene locus_tag LOCUS_20630 2150 2947 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373267.1 protein_id gnl|my_center|LOCUS_20630 3346 4236 gene locus_tag LOCUS_20640 3346 4236 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902047.1 protein_id gnl|my_center|LOCUS_20640 4652 5041 gene locus_tag LOCUS_20650 4652 5041 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902048.1 protein_id gnl|my_center|LOCUS_20650 5213 5383 gene locus_tag LOCUS_20660 5213 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427864.1 protein_id gnl|my_center|LOCUS_20660 5757 6866 gene locus_tag LOCUS_20670 5757 6866 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902050.1 protein_id gnl|my_center|LOCUS_20670 7071 7559 gene locus_tag LOCUS_20680 7071 7559 CDS product DUF3841 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895664.1 protein_id gnl|my_center|LOCUS_20680 7645 8052 gene locus_tag LOCUS_20690 7645 8052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860890.1 protein_id gnl|my_center|LOCUS_20690 8053 8271 gene locus_tag LOCUS_20700 8053 8271 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860891.1 protein_id gnl|my_center|LOCUS_20700 >Feature sequence158 <1 1346 gene locus_tag LOCUS_20710 <1 1346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861652.1:HIRAN domain-containing protein 2888 1524 gene locus_tag LOCUS_20720 2888 1524 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455014.1 protein_id gnl|my_center|LOCUS_20720 4409 3066 gene locus_tag LOCUS_20730 4409 3066 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421552.1 protein_id gnl|my_center|LOCUS_20730 4912 5565 gene locus_tag LOCUS_20740 4912 5565 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861651.1 protein_id gnl|my_center|LOCUS_20740 5694 6977 gene locus_tag LOCUS_20750 gene brnQ 5694 6977 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455013.1 protein_id gnl|my_center|LOCUS_20750 >Feature sequence159 1256 483 gene locus_tag LOCUS_20760 gene recO 1256 483 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861552.1 protein_id gnl|my_center|LOCUS_20760 1377 1222 gene locus_tag LOCUS_20770 1377 1222 CDS product YqzL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416649.1 protein_id gnl|my_center|LOCUS_20770 2829 1450 gene locus_tag LOCUS_20780 gene mgtE 2829 1450 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432938.1 protein_id gnl|my_center|LOCUS_20780 3734 2841 gene locus_tag LOCUS_20790 gene era 3734 2841 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_20790 4199 3798 gene locus_tag LOCUS_20800 4199 3798 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890647.1 protein_id gnl|my_center|LOCUS_20800 5037 4318 gene locus_tag LOCUS_20810 5037 4318 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416641.1 protein_id gnl|my_center|LOCUS_20810 5504 5043 gene locus_tag LOCUS_20820 gene ybeY 5504 5043 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430894.1 protein_id gnl|my_center|LOCUS_20820 6577 5561 gene locus_tag LOCUS_20830 6577 5561 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_20830 6890 6615 gene locus_tag LOCUS_20840 6890 6615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20840 7958 7032 gene locus_tag LOCUS_20850 7958 7032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20850 8207 7971 gene locus_tag LOCUS_20860 8207 7971 CDS product YabP/YqfC family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890653.1 protein_id gnl|my_center|LOCUS_20860 >Feature sequence160 789 178 gene locus_tag LOCUS_20870 789 178 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435254.1 protein_id gnl|my_center|LOCUS_20870 1934 1020 gene locus_tag LOCUS_20880 1934 1020 CDS product PhzF family isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966716.1 protein_id gnl|my_center|LOCUS_20880 2190 2420 gene locus_tag LOCUS_20890 2190 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20890 2837 2661 gene locus_tag LOCUS_20900 2837 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416990.1 protein_id gnl|my_center|LOCUS_20900 3829 4119 gene locus_tag LOCUS_20910 3829 4119 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424145.1 protein_id gnl|my_center|LOCUS_20910 4094 4864 gene locus_tag LOCUS_20920 4094 4864 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893372.1 protein_id gnl|my_center|LOCUS_20920 4886 5899 gene locus_tag LOCUS_20930 4886 5899 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861411.1 protein_id gnl|my_center|LOCUS_20930 5868 6602 gene locus_tag LOCUS_20940 5868 6602 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435263.1 protein_id gnl|my_center|LOCUS_20940 >Feature sequence161 1608 259 gene locus_tag LOCUS_20950 gene pabB 1608 259 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438631.1 protein_id gnl|my_center|LOCUS_20950 2194 1610 gene locus_tag LOCUS_20960 2194 1610 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861216.1 protein_id gnl|my_center|LOCUS_20960 2937 2218 gene locus_tag LOCUS_20970 2937 2218 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896360.1 protein_id gnl|my_center|LOCUS_20970 3564 2965 gene locus_tag LOCUS_20980 3564 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20980 4028 3636 gene locus_tag LOCUS_20990 4028 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20990 4981 4172 gene locus_tag LOCUS_21000 4981 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438621.1 protein_id gnl|my_center|LOCUS_21000 6089 5223 gene locus_tag LOCUS_21010 6089 5223 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429405.1 protein_id gnl|my_center|LOCUS_21010 7298 6609 gene locus_tag LOCUS_21020 7298 6609 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889244.1 protein_id gnl|my_center|LOCUS_21020 7662 7291 gene locus_tag LOCUS_21030 7662 7291 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419862.1 protein_id gnl|my_center|LOCUS_21030 >Feature sequence162 137 811 gene locus_tag LOCUS_21040 137 811 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861306.1 protein_id gnl|my_center|LOCUS_21040 837 1673 gene locus_tag LOCUS_21050 837 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454474.1 protein_id gnl|my_center|LOCUS_21050 1689 2360 gene locus_tag LOCUS_21060 1689 2360 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889581.1 protein_id gnl|my_center|LOCUS_21060 2350 3582 gene locus_tag LOCUS_21070 2350 3582 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454470.1 protein_id gnl|my_center|LOCUS_21070 3732 4049 gene locus_tag LOCUS_21080 gene trxA 3732 4049 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430156.1 protein_id gnl|my_center|LOCUS_21080 4066 4944 gene locus_tag LOCUS_21090 4066 4944 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430157.1 protein_id gnl|my_center|LOCUS_21090 5214 5582 gene locus_tag LOCUS_21100 5214 5582 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430158.1 protein_id gnl|my_center|LOCUS_21100 5585 5956 gene locus_tag LOCUS_21110 5585 5956 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430159.1 protein_id gnl|my_center|LOCUS_21110 6556 6101 gene locus_tag LOCUS_21120 6556 6101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430160.1 protein_id gnl|my_center|LOCUS_21120 7860 6595 gene locus_tag LOCUS_21130 7860 6595 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430161.1 protein_id gnl|my_center|LOCUS_21130 >Feature sequence163 1553 594 gene locus_tag LOCUS_21140 1553 594 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454987.1 protein_id gnl|my_center|LOCUS_21140 3218 1659 gene locus_tag LOCUS_21150 3218 1659 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861635.1 protein_id gnl|my_center|LOCUS_21150 3437 4414 gene locus_tag LOCUS_21160 3437 4414 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861634.1 protein_id gnl|my_center|LOCUS_21160 4415 5386 gene locus_tag LOCUS_21170 4415 5386 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427052.1 protein_id gnl|my_center|LOCUS_21170 5538 7580 gene locus_tag LOCUS_21180 5538 7580 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454981.1 protein_id gnl|my_center|LOCUS_21180 >Feature sequence164 <1 727 gene locus_tag LOCUS_21190 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860868.1:ATP-binding protein 742 5952 gene locus_tag LOCUS_21200 742 5952 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860869.1 protein_id gnl|my_center|LOCUS_21200 7781 6177 gene locus_tag LOCUS_21210 7781 6177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 >Feature sequence165 1456 101 gene locus_tag LOCUS_21220 1456 101 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861617.1 protein_id gnl|my_center|LOCUS_21220 1751 1482 gene locus_tag LOCUS_21230 1751 1482 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416152.1 protein_id gnl|my_center|LOCUS_21230 4011 2041 gene locus_tag LOCUS_21240 4011 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 5669 4194 gene locus_tag LOCUS_21250 gene spoIVA 5669 4194 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454943.1 protein_id gnl|my_center|LOCUS_21250 7136 5841 gene locus_tag LOCUS_21260 7136 5841 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203404.1 protein_id gnl|my_center|LOCUS_21260 <8083 7320 gene locus_tag LOCUS_21270 <8083 7320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003426910.1:amino acid permease >Feature sequence166 329 1252 gene locus_tag LOCUS_21280 329 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860932.1 protein_id gnl|my_center|LOCUS_21280 1463 1257 gene locus_tag LOCUS_21290 1463 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418305.1 protein_id gnl|my_center|LOCUS_21290 1599 3353 gene locus_tag LOCUS_21300 1599 3353 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860933.1 protein_id gnl|my_center|LOCUS_21300 3371 4513 gene locus_tag LOCUS_21310 3371 4513 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860934.1 protein_id gnl|my_center|LOCUS_21310 5608 4685 gene locus_tag LOCUS_21320 5608 4685 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_21320 5834 6412 gene locus_tag LOCUS_21330 5834 6412 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818015.1 protein_id gnl|my_center|LOCUS_21330 6528 7439 gene locus_tag LOCUS_21340 6528 7439 CDS product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436909.1 protein_id gnl|my_center|LOCUS_21340 >Feature sequence167 1430 240 gene locus_tag LOCUS_21350 1430 240 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860897.1 protein_id gnl|my_center|LOCUS_21350 3401 1446 gene locus_tag LOCUS_21360 3401 1446 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860896.1 protein_id gnl|my_center|LOCUS_21360 5457 3418 gene locus_tag LOCUS_21370 5457 3418 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021370961.1 protein_id gnl|my_center|LOCUS_21370 6444 5794 gene locus_tag LOCUS_21380 6444 5794 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440167.1 protein_id gnl|my_center|LOCUS_21380 7642 7469 gene locus_tag LOCUS_21390 7642 7469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 >Feature sequence168 1272 370 gene locus_tag LOCUS_21400 1272 370 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454990.1 protein_id gnl|my_center|LOCUS_21400 1627 2805 gene locus_tag LOCUS_21410 1627 2805 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861636.1 protein_id gnl|my_center|LOCUS_21410 2814 3470 gene locus_tag LOCUS_21420 2814 3470 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861637.1 protein_id gnl|my_center|LOCUS_21420 3470 4135 gene locus_tag LOCUS_21430 3470 4135 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897858.1 protein_id gnl|my_center|LOCUS_21430 4240 5016 gene locus_tag LOCUS_21440 4240 5016 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890906.1 protein_id gnl|my_center|LOCUS_21440 5078 6412 gene locus_tag LOCUS_21450 5078 6412 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861638.1 protein_id gnl|my_center|LOCUS_21450 6909 7835 gene locus_tag LOCUS_21460 6909 7835 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861639.1 protein_id gnl|my_center|LOCUS_21460 >Feature sequence169 73 2076 gene locus_tag LOCUS_21470 73 2076 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861581.1 protein_id gnl|my_center|LOCUS_21470 2250 2891 gene locus_tag LOCUS_21480 2250 2891 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861582.1 protein_id gnl|my_center|LOCUS_21480 3002 3667 gene locus_tag LOCUS_21490 3002 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903230.1 protein_id gnl|my_center|LOCUS_21490 4155 3844 gene locus_tag LOCUS_21500 4155 3844 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431059.1 protein_id gnl|my_center|LOCUS_21500 5051 4233 gene locus_tag LOCUS_21510 5051 4233 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861584.1 protein_id gnl|my_center|LOCUS_21510 5675 5151 gene locus_tag LOCUS_21520 5675 5151 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861585.1 protein_id gnl|my_center|LOCUS_21520 6836 5694 gene locus_tag LOCUS_21530 6836 5694 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861586.1 protein_id gnl|my_center|LOCUS_21530 <7802 7116 gene locus_tag LOCUS_21540 <7802 7116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861587.1:FtsX-like permease family protein >Feature sequence170 642 85 gene locus_tag LOCUS_21550 642 85 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435154.1 protein_id gnl|my_center|LOCUS_21550 900 1598 gene locus_tag LOCUS_21560 900 1598 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902966.1 protein_id gnl|my_center|LOCUS_21560 1965 2117 gene locus_tag LOCUS_21570 1965 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 2621 3088 gene locus_tag LOCUS_21580 2621 3088 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435151.1 protein_id gnl|my_center|LOCUS_21580 3099 3314 gene locus_tag LOCUS_21590 3099 3314 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902968.1 protein_id gnl|my_center|LOCUS_21590 3755 3928 gene locus_tag LOCUS_21600 3755 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435150.1 protein_id gnl|my_center|LOCUS_21600 4369 4085 gene locus_tag LOCUS_21610 4369 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897202.1 protein_id gnl|my_center|LOCUS_21610 5497 4817 gene locus_tag LOCUS_21620 5497 4817 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897205.1 protein_id gnl|my_center|LOCUS_21620 7640 6768 gene locus_tag LOCUS_21630 7640 6768 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424273.1 protein_id gnl|my_center|LOCUS_21630 >Feature sequence171 802 137 gene locus_tag LOCUS_21640 802 137 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430699.1 protein_id gnl|my_center|LOCUS_21640 1278 832 gene locus_tag LOCUS_21650 gene rpiB 1278 832 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430700.1 protein_id gnl|my_center|LOCUS_21650 2373 1453 gene locus_tag LOCUS_21660 2373 1453 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_21660 3188 2376 gene locus_tag LOCUS_21670 3188 2376 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_21670 4311 3280 gene locus_tag LOCUS_21680 4311 3280 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861524.1 protein_id gnl|my_center|LOCUS_21680 5363 4311 gene locus_tag LOCUS_21690 5363 4311 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454628.1 protein_id gnl|my_center|LOCUS_21690 6767 5493 gene locus_tag LOCUS_21700 6767 5493 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861525.1 protein_id gnl|my_center|LOCUS_21700 7101 6826 gene locus_tag LOCUS_21710 7101 6826 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430711.1 protein_id gnl|my_center|LOCUS_21710 7620 7162 gene locus_tag LOCUS_21720 7620 7162 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861526.1 protein_id gnl|my_center|LOCUS_21720 >Feature sequence172 2149 1751 gene locus_tag LOCUS_21730 2149 1751 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426473.1 protein_id gnl|my_center|LOCUS_21730 3699 2152 gene locus_tag LOCUS_21740 3699 2152 CDS product GGDEF domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454122.1 protein_id gnl|my_center|LOCUS_21740 4838 4014 gene locus_tag LOCUS_21750 4838 4014 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861670.1 protein_id gnl|my_center|LOCUS_21750 5606 4962 gene locus_tag LOCUS_21760 gene uppS 5606 4962 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422884.1 protein_id gnl|my_center|LOCUS_21760 5745 6215 gene locus_tag LOCUS_21770 5745 6215 CDS product DUF4358 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891020.1 protein_id gnl|my_center|LOCUS_21770 7126 6338 gene locus_tag LOCUS_21780 7126 6338 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861671.1 protein_id gnl|my_center|LOCUS_21780 >Feature sequence173 78 1442 gene locus_tag LOCUS_21790 78 1442 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861389.1 protein_id gnl|my_center|LOCUS_21790 1455 2336 gene locus_tag LOCUS_21800 gene eutC 1455 2336 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897052.1 protein_id gnl|my_center|LOCUS_21800 2356 3009 gene locus_tag LOCUS_21810 gene eutL 2356 3009 CDS product ethanolamine utilization microcompartment protein EutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423987.1 protein_id gnl|my_center|LOCUS_21810 3020 3721 gene locus_tag LOCUS_21820 3020 3721 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435420.1 protein_id gnl|my_center|LOCUS_21820 3724 5193 gene locus_tag LOCUS_21830 3724 5193 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861390.1 protein_id gnl|my_center|LOCUS_21830 5289 5576 gene locus_tag LOCUS_21840 gene eutM 5289 5576 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423991.1 protein_id gnl|my_center|LOCUS_21840 5703 6464 gene locus_tag LOCUS_21850 5703 6464 CDS product ethanolamine corrinoid cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861391.1 protein_id gnl|my_center|LOCUS_21850 6477 7106 gene locus_tag LOCUS_21860 gene eutD 6477 7106 CDS product ethanolamine utilization phosphate acetyltransferase EutD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889877.1 protein_id gnl|my_center|LOCUS_21860 >Feature sequence174 1971 3326 gene locus_tag LOCUS_21870 1971 3326 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891344.1 protein_id gnl|my_center|LOCUS_21870 4433 3552 gene locus_tag LOCUS_21880 4433 3552 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898106.1 protein_id gnl|my_center|LOCUS_21880 5172 4420 gene locus_tag LOCUS_21890 5172 4420 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432043.1 protein_id gnl|my_center|LOCUS_21890 5439 5756 gene locus_tag LOCUS_21900 gene trxA 5439 5756 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453775.1 protein_id gnl|my_center|LOCUS_21900 7237 5963 gene locus_tag LOCUS_21910 7237 5963 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861788.1 protein_id gnl|my_center|LOCUS_21910 >Feature sequence175 38 712 gene locus_tag LOCUS_21920 38 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 816 2069 gene locus_tag LOCUS_21930 816 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440269.1 protein_id gnl|my_center|LOCUS_21930 3284 2223 gene locus_tag LOCUS_21940 gene ytvI 3284 2223 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440267.1 protein_id gnl|my_center|LOCUS_21940 3558 4298 gene locus_tag LOCUS_21950 3558 4298 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890462.1 protein_id gnl|my_center|LOCUS_21950 4310 6088 gene locus_tag LOCUS_21960 4310 6088 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893554.1 protein_id gnl|my_center|LOCUS_21960 6255 7172 gene locus_tag LOCUS_21970 gene pfkB 6255 7172 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861506.1 protein_id gnl|my_center|LOCUS_21970 >Feature sequence176 2247 343 gene locus_tag LOCUS_21980 2247 343 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860918.1 protein_id gnl|my_center|LOCUS_21980 4573 2648 gene locus_tag LOCUS_21990 4573 2648 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902098.1 protein_id gnl|my_center|LOCUS_21990 5553 5008 gene locus_tag LOCUS_22000 5553 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439271.1 protein_id gnl|my_center|LOCUS_22000 6219 5863 gene locus_tag LOCUS_22010 gene rplT 6219 5863 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429730.1 protein_id gnl|my_center|LOCUS_22010 6469 6275 gene locus_tag LOCUS_22020 gene rpmI 6469 6275 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429729.1 protein_id gnl|my_center|LOCUS_22020 6922 6497 gene locus_tag LOCUS_22030 gene infC 6922 6497 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860916.1 protein_id gnl|my_center|LOCUS_22030 >Feature sequence177 3333 1879 gene locus_tag LOCUS_22040 3333 1879 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861629.1 protein_id gnl|my_center|LOCUS_22040 3497 4366 gene locus_tag LOCUS_22050 3497 4366 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861630.1 protein_id gnl|my_center|LOCUS_22050 6651 4579 gene locus_tag LOCUS_22060 gene ptsG 6651 4579 CDS product glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861632.1 protein_id gnl|my_center|LOCUS_22060 <7560 6954 gene locus_tag LOCUS_22070 <7560 6954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861633.1:PRD domain-containing protein >Feature sequence178 1580 825 gene locus_tag LOCUS_22080 1580 825 CDS product DUF3298 and DUF4163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861251.1 protein_id gnl|my_center|LOCUS_22080 2492 1623 gene locus_tag LOCUS_22090 2492 1623 CDS product anti-sigma-V factor rsiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436661.1 protein_id gnl|my_center|LOCUS_22090 2986 2504 gene locus_tag LOCUS_22100 2986 2504 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436663.1 protein_id gnl|my_center|LOCUS_22100 3994 3038 gene locus_tag LOCUS_22110 3994 3038 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902572.1 protein_id gnl|my_center|LOCUS_22110 4896 4063 gene locus_tag LOCUS_22120 4896 4063 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902571.1 protein_id gnl|my_center|LOCUS_22120 6977 5649 gene locus_tag LOCUS_22130 6977 5649 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861250.1 protein_id gnl|my_center|LOCUS_22130 >Feature sequence179 1236 826 gene locus_tag LOCUS_22140 1236 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439126.1 protein_id gnl|my_center|LOCUS_22140 2834 1452 gene locus_tag LOCUS_22150 2834 1452 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860854.1 protein_id gnl|my_center|LOCUS_22150 3204 2845 gene locus_tag LOCUS_22160 3204 2845 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888340.1 protein_id gnl|my_center|LOCUS_22160 4188 3409 gene locus_tag LOCUS_22170 4188 3409 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888339.1 protein_id gnl|my_center|LOCUS_22170 5260 4649 gene locus_tag LOCUS_22180 5260 4649 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439113.1 protein_id gnl|my_center|LOCUS_22180 6341 5352 gene locus_tag LOCUS_22190 6341 5352 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439110.1 protein_id gnl|my_center|LOCUS_22190 7271 6408 gene locus_tag LOCUS_22200 7271 6408 CDS product DUF3298 and DUF4163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860853.1 protein_id gnl|my_center|LOCUS_22200 >Feature sequence180 639 1331 gene locus_tag LOCUS_22210 639 1331 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454566.1 protein_id gnl|my_center|LOCUS_22210 1306 1512 gene locus_tag LOCUS_22220 1306 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 1527 3587 gene locus_tag LOCUS_22230 1527 3587 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861512.1 protein_id gnl|my_center|LOCUS_22230 4116 3793 gene locus_tag LOCUS_22240 4116 3793 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861511.1 protein_id gnl|my_center|LOCUS_22240 4810 4109 gene locus_tag LOCUS_22250 4810 4109 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454563.1 protein_id gnl|my_center|LOCUS_22250 6473 5088 gene locus_tag LOCUS_22260 6473 5088 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893561.1 protein_id gnl|my_center|LOCUS_22260 7341 6919 gene locus_tag LOCUS_22270 7341 6919 CDS product DUF3284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454558.1 protein_id gnl|my_center|LOCUS_22270 >Feature sequence181 367 1479 gene locus_tag LOCUS_22280 367 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 2184 1642 gene locus_tag LOCUS_22290 2184 1642 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861314.1 protein_id gnl|my_center|LOCUS_22290 2616 2332 gene locus_tag LOCUS_22300 2616 2332 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454429.1 protein_id gnl|my_center|LOCUS_22300 3443 2679 gene locus_tag LOCUS_22310 3443 2679 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454428.1 protein_id gnl|my_center|LOCUS_22310 3991 3725 gene locus_tag LOCUS_22320 3991 3725 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430198.1 protein_id gnl|my_center|LOCUS_22320 4842 4033 gene locus_tag LOCUS_22330 4842 4033 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896869.1 protein_id gnl|my_center|LOCUS_22330 5155 5436 gene locus_tag LOCUS_22340 5155 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454426.1 protein_id gnl|my_center|LOCUS_22340 5700 5954 gene locus_tag LOCUS_22350 5700 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889672.1 protein_id gnl|my_center|LOCUS_22350 5999 6322 gene locus_tag LOCUS_22360 5999 6322 CDS product DUF6054 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861315.1 protein_id gnl|my_center|LOCUS_22360 7075 6881 gene locus_tag LOCUS_22370 7075 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454424.1 protein_id gnl|my_center|LOCUS_22370 >Feature sequence182 176 1072 gene locus_tag LOCUS_22380 176 1072 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439369.1 protein_id gnl|my_center|LOCUS_22380 1047 1874 gene locus_tag LOCUS_22390 gene panB 1047 1874 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439367.1 protein_id gnl|my_center|LOCUS_22390 1893 2741 gene locus_tag LOCUS_22400 gene panC 1893 2741 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902543.1 protein_id gnl|my_center|LOCUS_22400 3188 3334 gene locus_tag LOCUS_22410 3188 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439365.1 protein_id gnl|my_center|LOCUS_22410 4166 5080 gene locus_tag LOCUS_22420 4166 5080 CDS product DUF2935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439363.1 protein_id gnl|my_center|LOCUS_22420 5470 6081 gene locus_tag LOCUS_22430 5470 6081 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861240.1 protein_id gnl|my_center|LOCUS_22430 6852 6283 gene locus_tag LOCUS_22440 6852 6283 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896453.1 protein_id gnl|my_center|LOCUS_22440 <7372 6857 gene locus_tag LOCUS_22450 <7372 6857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861239.1:4Fe-4S binding protein >Feature sequence183 <1 1232 gene locus_tag LOCUS_22460 <1 1232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861771.1:type I-B CRISPR-associated protein Cas8b1/Cst1 1234 2148 gene locus_tag LOCUS_22470 gene cas7i 1234 2148 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861770.1 protein_id gnl|my_center|LOCUS_22470 2150 2851 gene locus_tag LOCUS_22480 gene cas5b 2150 2851 CDS product type I-B CRISPR-associated protein Cas5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439785.1 protein_id gnl|my_center|LOCUS_22480 2862 5183 gene locus_tag LOCUS_22490 2862 5183 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861769.1 protein_id gnl|my_center|LOCUS_22490 5231 5749 gene locus_tag LOCUS_22500 gene cas4 5231 5749 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180703501.1 protein_id gnl|my_center|LOCUS_22500 5752 6732 gene locus_tag LOCUS_22510 gene cas1b 5752 6732 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861768.1 protein_id gnl|my_center|LOCUS_22510 6735 7001 gene locus_tag LOCUS_22520 gene cas2 6735 7001 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439780.1 protein_id gnl|my_center|LOCUS_22520 7185 7345 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttatattaactaagtggtatgtaaat >Feature sequence184 <1 1470 gene locus_tag LOCUS_22530 <1 1470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454621.1:phosphoglucomutase 3371 1782 gene locus_tag LOCUS_22540 3371 1782 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021381512.1 protein_id gnl|my_center|LOCUS_22540 4056 3340 gene locus_tag LOCUS_22550 4056 3340 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454617.1 protein_id gnl|my_center|LOCUS_22550 5395 4595 gene locus_tag LOCUS_22560 5395 4595 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454616.1 protein_id gnl|my_center|LOCUS_22560 6440 5709 gene locus_tag LOCUS_22570 6440 5709 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890514.1 protein_id gnl|my_center|LOCUS_22570 7122 6427 gene locus_tag LOCUS_22580 7122 6427 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861522.1 protein_id gnl|my_center|LOCUS_22580 >Feature sequence185 168 1256 gene locus_tag LOCUS_22590 168 1256 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436120.1 protein_id gnl|my_center|LOCUS_22590 1564 2685 gene locus_tag LOCUS_22600 1564 2685 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436121.1 protein_id gnl|my_center|LOCUS_22600 2728 4278 gene locus_tag LOCUS_22610 2728 4278 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891132.1 protein_id gnl|my_center|LOCUS_22610 4350 5606 gene locus_tag LOCUS_22620 4350 5606 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436123.1 protein_id gnl|my_center|LOCUS_22620 >Feature sequence186 1825 479 gene locus_tag LOCUS_22630 gene glmM 1825 479 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860638.1 protein_id gnl|my_center|LOCUS_22630 2552 1995 gene locus_tag LOCUS_22640 2552 1995 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420711.1 protein_id gnl|my_center|LOCUS_22640 3305 2553 gene locus_tag LOCUS_22650 3305 2553 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420710.1 protein_id gnl|my_center|LOCUS_22650 4384 3305 gene locus_tag LOCUS_22660 4384 3305 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432442.1 protein_id gnl|my_center|LOCUS_22660 4628 4413 gene locus_tag LOCUS_22670 4628 4413 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_22670 5348 4671 gene locus_tag LOCUS_22680 5348 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420704.1 protein_id gnl|my_center|LOCUS_22680 6417 5338 gene locus_tag LOCUS_22690 gene buk 6417 5338 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420702.1 protein_id gnl|my_center|LOCUS_22690 <7281 6439 gene locus_tag LOCUS_22700 <7281 6439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003420701.1:phosphate butyryltransferase >Feature sequence187 186 647 gene locus_tag LOCUS_22710 186 647 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431991.1 protein_id gnl|my_center|LOCUS_22710 650 970 gene locus_tag LOCUS_22720 650 970 CDS product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422575.1 protein_id gnl|my_center|LOCUS_22720 986 2086 gene locus_tag LOCUS_22730 986 2086 CDS product PTS fructose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891322.1 protein_id gnl|my_center|LOCUS_22730 2206 4806 gene locus_tag LOCUS_22740 2206 4806 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861780.1 protein_id gnl|my_center|LOCUS_22740 5275 5610 gene locus_tag LOCUS_22750 5275 5610 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431984.1 protein_id gnl|my_center|LOCUS_22750 5747 7024 gene locus_tag LOCUS_22760 5747 7024 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903396.1 protein_id gnl|my_center|LOCUS_22760 >Feature sequence188 <1 1190 gene locus_tag LOCUS_22770 <1 1190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437698.1:DnaB-like helicase C-terminal domain-containing protein 1266 1541 gene locus_tag LOCUS_22780 1266 1541 CDS product Mor transcription activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437697.1 protein_id gnl|my_center|LOCUS_22780 2709 2939 gene locus_tag LOCUS_22790 2709 2939 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418105.1 protein_id gnl|my_center|LOCUS_22790 2932 3513 gene locus_tag LOCUS_22800 2932 3513 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860883.1 protein_id gnl|my_center|LOCUS_22800 4769 4092 gene locus_tag LOCUS_22810 4769 4092 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_22810 6322 4958 gene locus_tag LOCUS_22820 6322 4958 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021363290.1 protein_id gnl|my_center|LOCUS_22820 6450 6971 gene locus_tag LOCUS_22830 6450 6971 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860885.1 protein_id gnl|my_center|LOCUS_22830 >Feature sequence189 792 2522 gene locus_tag LOCUS_22840 792 2522 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889552.1 protein_id gnl|my_center|LOCUS_22840 2632 2713 gene locus_tag LOCUS_t00110 2632 2713 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3047 3562 gene locus_tag LOCUS_22850 3047 3562 CDS product HXXEE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861286.1 protein_id gnl|my_center|LOCUS_22850 4368 6842 gene locus_tag LOCUS_22860 gene gcvPA 4368 6842 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861287.1 protein_id gnl|my_center|LOCUS_22860 >Feature sequence190 405 2777 gene locus_tag LOCUS_22870 gene spoIIE 405 2777 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898719.1 protein_id gnl|my_center|LOCUS_22870 3128 5020 gene locus_tag LOCUS_22880 gene pepF 3128 5020 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861980.1 protein_id gnl|my_center|LOCUS_22880 5134 6099 gene locus_tag LOCUS_22890 gene galU 5134 6099 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892053.1 protein_id gnl|my_center|LOCUS_22890 >Feature sequence191 1866 1645 gene locus_tag LOCUS_22900 1866 1645 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427474.1 protein_id gnl|my_center|LOCUS_22900 2091 1879 gene locus_tag LOCUS_22910 2091 1879 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419939.1 protein_id gnl|my_center|LOCUS_22910 5309 2412 gene locus_tag LOCUS_22920 5309 2412 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861232.1 protein_id gnl|my_center|LOCUS_22920 6244 5636 gene locus_tag LOCUS_22930 6244 5636 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896408.1 protein_id gnl|my_center|LOCUS_22930 <7043 6504 gene locus_tag LOCUS_22940 <7043 6504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003419930.1:NADH peroxidase >Feature sequence192 1766 882 gene locus_tag LOCUS_22950 1766 882 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860957.1 protein_id gnl|my_center|LOCUS_22950 1994 3001 gene locus_tag LOCUS_22960 1994 3001 CDS product SpoIVB peptidase S55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437515.1 protein_id gnl|my_center|LOCUS_22960 3911 3213 gene locus_tag LOCUS_22970 gene yunB 3911 3213 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418439.1 protein_id gnl|my_center|LOCUS_22970 4125 6692 gene locus_tag LOCUS_22980 4125 6692 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860956.1 protein_id gnl|my_center|LOCUS_22980 >Feature sequence193 206 1531 gene locus_tag LOCUS_22990 206 1531 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902958.1 protein_id gnl|my_center|LOCUS_22990 1552 2091 gene locus_tag LOCUS_23000 1552 2091 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902956.1 protein_id gnl|my_center|LOCUS_23000 2110 3501 gene locus_tag LOCUS_23010 2110 3501 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861436.1 protein_id gnl|my_center|LOCUS_23010 3516 4607 gene locus_tag LOCUS_23020 gene ytvI 3516 4607 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902953.1 protein_id gnl|my_center|LOCUS_23020 5378 6412 gene locus_tag LOCUS_23030 gene argC 5378 6412 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861435.1 protein_id gnl|my_center|LOCUS_23030 >Feature sequence194 <1 1368 gene locus_tag LOCUS_23040 <1 1368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004453976.1:DNA repair protein RadA 1371 2441 gene locus_tag LOCUS_23050 gene disA 1371 2441 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453975.1 protein_id gnl|my_center|LOCUS_23050 2530 3624 gene locus_tag LOCUS_23060 2530 3624 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860623.1 protein_id gnl|my_center|LOCUS_23060 3753 5930 gene locus_tag LOCUS_23070 3753 5930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860624.1 protein_id gnl|my_center|LOCUS_23070 6805 6116 gene locus_tag LOCUS_23080 6805 6116 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453971.1 protein_id gnl|my_center|LOCUS_23080 >Feature sequence195 87 395 gene locus_tag LOCUS_23090 gene rplX 87 395 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427723.1 protein_id gnl|my_center|LOCUS_23090 425 967 gene locus_tag LOCUS_23100 gene rplE 425 967 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435673.1 protein_id gnl|my_center|LOCUS_23100 985 1170 gene locus_tag LOCUS_23110 985 1170 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_23110 1203 1601 gene locus_tag LOCUS_23120 gene rpsH 1203 1601 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_23120 1632 2174 gene locus_tag LOCUS_23130 gene rplF 1632 2174 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_23130 2210 2578 gene locus_tag LOCUS_23140 gene rplR 2210 2578 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421141.1 protein_id gnl|my_center|LOCUS_23140 2599 3108 gene locus_tag LOCUS_23150 gene rpsE 2599 3108 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421138.1 protein_id gnl|my_center|LOCUS_23150 3123 3308 gene locus_tag LOCUS_23160 gene rpmD 3123 3308 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421137.1 protein_id gnl|my_center|LOCUS_23160 3341 3784 gene locus_tag LOCUS_23170 gene rplO 3341 3784 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421135.1 protein_id gnl|my_center|LOCUS_23170 3828 5096 gene locus_tag LOCUS_23180 gene secY 3828 5096 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427725.1 protein_id gnl|my_center|LOCUS_23180 5113 5763 gene locus_tag LOCUS_23190 5113 5763 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860634.1 protein_id gnl|my_center|LOCUS_23190 5764 6510 gene locus_tag LOCUS_23200 gene map 5764 6510 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421130.1 protein_id gnl|my_center|LOCUS_23200 6532 6801 gene locus_tag LOCUS_23210 6532 6801 CDS product KOW domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895197.1 protein_id gnl|my_center|LOCUS_23210 >Feature sequence196 147 2234 gene locus_tag LOCUS_23220 gene topA 147 2234 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892959.1 protein_id gnl|my_center|LOCUS_23220 2399 3184 gene locus_tag LOCUS_23230 gene codY 2399 3184 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438268.1 protein_id gnl|my_center|LOCUS_23230 3291 4556 gene locus_tag LOCUS_23240 3291 4556 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861165.1 protein_id gnl|my_center|LOCUS_23240 4587 5357 gene locus_tag LOCUS_23250 4587 5357 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438272.1 protein_id gnl|my_center|LOCUS_23250 5466 5912 gene locus_tag LOCUS_23260 5466 5912 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419409.1 protein_id gnl|my_center|LOCUS_23260 >Feature sequence197 1324 812 gene locus_tag LOCUS_23270 1324 812 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860676.1 protein_id gnl|my_center|LOCUS_23270 1774 2250 gene locus_tag LOCUS_23280 gene purE 1774 2250 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425290.1 protein_id gnl|my_center|LOCUS_23280 2256 2954 gene locus_tag LOCUS_23290 2256 2954 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420966.1 protein_id gnl|my_center|LOCUS_23290 2966 4333 gene locus_tag LOCUS_23300 gene purF 2966 4333 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425288.1 protein_id gnl|my_center|LOCUS_23300 4327 5403 gene locus_tag LOCUS_23310 gene purM 4327 5403 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895312.1 protein_id gnl|my_center|LOCUS_23310 5397 5990 gene locus_tag LOCUS_23320 gene purN 5397 5990 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436064.1 protein_id gnl|my_center|LOCUS_23320 >Feature sequence198 <1 778 gene locus_tag LOCUS_23330 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860822.1:HAMP domain-containing sensor histidine kinase 3619 959 gene locus_tag LOCUS_23340 3619 959 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860821.1 protein_id gnl|my_center|LOCUS_23340 4299 3616 gene locus_tag LOCUS_23350 4299 3616 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888282.1 protein_id gnl|my_center|LOCUS_23350 5581 4643 gene locus_tag LOCUS_23360 gene blaCDD 5581 4643 CDS product CDD family class D beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021358847.1 protein_id gnl|my_center|LOCUS_23360 5822 5658 gene locus_tag LOCUS_23370 5822 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 <6777 6122 gene locus_tag LOCUS_23380 <6777 6122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860818.1:3'-5' exonuclease >Feature sequence199 791 150 gene locus_tag LOCUS_23390 791 150 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437445.1 protein_id gnl|my_center|LOCUS_23390 1837 1034 gene locus_tag LOCUS_23400 1837 1034 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860949.1 protein_id gnl|my_center|LOCUS_23400 3165 1993 gene locus_tag LOCUS_23410 gene thiI 3165 1993 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_23410 4365 3214 gene locus_tag LOCUS_23420 4365 3214 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895806.1 protein_id gnl|my_center|LOCUS_23420 5735 5013 gene locus_tag LOCUS_23430 5735 5013 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860947.1 protein_id gnl|my_center|LOCUS_23430 6471 5794 gene locus_tag LOCUS_23440 6471 5794 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888558.1 protein_id gnl|my_center|LOCUS_23440 >Feature sequence200 304 843 gene locus_tag LOCUS_23450 gene spoVT 304 843 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892063.1 protein_id gnl|my_center|LOCUS_23450 963 2576 gene locus_tag LOCUS_23460 963 2576 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_23460 2683 4131 gene locus_tag LOCUS_23470 gene mazG 2683 4131 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894031.1 protein_id gnl|my_center|LOCUS_23470 4220 4498 gene locus_tag LOCUS_23480 4220 4498 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421415.1 protein_id gnl|my_center|LOCUS_23480 4570 4812 gene locus_tag LOCUS_23490 4570 4812 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421412.1 protein_id gnl|my_center|LOCUS_23490 4874 5128 gene locus_tag LOCUS_23500 4874 5128 CDS product YabP/YqfC family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421411.1 protein_id gnl|my_center|LOCUS_23500 5129 5662 gene locus_tag LOCUS_23510 5129 5662 CDS product spore cortex biosynthesis protein YabQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425904.1 protein_id gnl|my_center|LOCUS_23510 5668 5952 gene locus_tag LOCUS_23520 5668 5952 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437861.1 protein_id gnl|my_center|LOCUS_23520 >Feature sequence201 2778 640 gene locus_tag LOCUS_23530 gene vanT 2778 640 CDS product serine racemase VanT catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893196.1 protein_id gnl|my_center|LOCUS_23530 3602 2796 gene locus_tag LOCUS_23540 3602 2796 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436406.1 protein_id gnl|my_center|LOCUS_23540 4699 3599 gene locus_tag LOCUS_23550 gene vanG 4699 3599 CDS product D-alanine--D-serine ligase VanG-Cd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861276.1 protein_id gnl|my_center|LOCUS_23550 6102 4960 gene locus_tag LOCUS_23560 6102 4960 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021367800.1 protein_id gnl|my_center|LOCUS_23560 <6682 6092 gene locus_tag LOCUS_23570 <6682 6092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436401.1:vancomycin resistance response regulator transcriptoin factor VanR-G-Cd >Feature sequence202 <1 925 gene locus_tag LOCUS_23580 <1 925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003434075.1:solute carrier family 23 protein 998 2392 gene locus_tag LOCUS_23590 998 2392 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897237.1 protein_id gnl|my_center|LOCUS_23590 2454 2924 gene locus_tag LOCUS_23600 2454 2924 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434079.1 protein_id gnl|my_center|LOCUS_23600 2927 5143 gene locus_tag LOCUS_23610 2927 5143 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861450.1 protein_id gnl|my_center|LOCUS_23610 5226 5897 gene locus_tag LOCUS_23620 5226 5897 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424384.1 protein_id gnl|my_center|LOCUS_23620 >Feature sequence203 3127 1169 gene locus_tag LOCUS_23630 3127 1169 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399687.1 protein_id gnl|my_center|LOCUS_23630 3699 3127 gene locus_tag LOCUS_23640 3699 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 4294 3722 gene locus_tag LOCUS_23650 4294 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 4682 4347 gene locus_tag LOCUS_23660 4682 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 5863 4697 gene locus_tag LOCUS_23670 5863 4697 CDS product DUF2800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144597911.1 protein_id gnl|my_center|LOCUS_23670 6312 5875 gene locus_tag LOCUS_23680 6312 5875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 6526 6383 gene locus_tag LOCUS_23690 6526 6383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 >Feature sequence204 <1 2073 gene locus_tag LOCUS_23700 <1 2073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009903830.1:homocysteine S-methyltransferase family protein 3507 2278 gene locus_tag LOCUS_23710 3507 2278 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429165.1 protein_id gnl|my_center|LOCUS_23710 4108 5022 gene locus_tag LOCUS_23720 4108 5022 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862006.1 protein_id gnl|my_center|LOCUS_23720 5046 5681 gene locus_tag LOCUS_23730 5046 5681 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435816.1 protein_id gnl|my_center|LOCUS_23730 >Feature sequence205 1683 64 gene locus_tag LOCUS_23740 1683 64 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430205.1 protein_id gnl|my_center|LOCUS_23740 2210 1992 gene locus_tag LOCUS_23750 2210 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23750 2501 2692 gene locus_tag LOCUS_23760 2501 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430208.1 protein_id gnl|my_center|LOCUS_23760 3593 2781 gene locus_tag LOCUS_23770 3593 2781 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430209.1 protein_id gnl|my_center|LOCUS_23770 4015 5166 gene locus_tag LOCUS_23780 4015 5166 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861316.1 protein_id gnl|my_center|LOCUS_23780 5284 5922 gene locus_tag LOCUS_23790 5284 5922 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454419.1 protein_id gnl|my_center|LOCUS_23790 >Feature sequence206 981 1343 gene locus_tag LOCUS_23800 981 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022618372.1 protein_id gnl|my_center|LOCUS_23800 1327 2043 gene locus_tag LOCUS_23810 1327 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861156.1 protein_id gnl|my_center|LOCUS_23810 2063 2482 gene locus_tag LOCUS_23820 2063 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889019.1 protein_id gnl|my_center|LOCUS_23820 2472 2996 gene locus_tag LOCUS_23830 2472 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861157.1 protein_id gnl|my_center|LOCUS_23830 3308 3865 gene locus_tag LOCUS_23840 gene efp 3308 3865 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_23840 3957 4412 gene locus_tag LOCUS_23850 3957 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428343.1 protein_id gnl|my_center|LOCUS_23850 4575 5285 gene locus_tag LOCUS_23860 gene rnc 4575 5285 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_23860 5339 6409 gene locus_tag LOCUS_23870 5339 6409 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438208.1 protein_id gnl|my_center|LOCUS_23870 >Feature sequence207 2498 213 gene locus_tag LOCUS_23880 2498 213 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861487.1 protein_id gnl|my_center|LOCUS_23880 3175 2495 gene locus_tag LOCUS_23890 gene pgmB 3175 2495 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433900.1 protein_id gnl|my_center|LOCUS_23890 5283 3400 gene locus_tag LOCUS_23900 5283 3400 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897348.1 protein_id gnl|my_center|LOCUS_23900 6362 5541 gene locus_tag LOCUS_23910 6362 5541 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897350.1 protein_id gnl|my_center|LOCUS_23910 >Feature sequence208 2599 1238 gene locus_tag LOCUS_23920 2599 1238 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454780.1 protein_id gnl|my_center|LOCUS_23920 2772 3716 gene locus_tag LOCUS_23930 gene manA 2772 3716 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454782.1 protein_id gnl|my_center|LOCUS_23930 6273 3835 gene locus_tag LOCUS_23940 6273 3835 CDS product sporulation-associated two-component system sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454784.1 protein_id gnl|my_center|LOCUS_23940 >Feature sequence209 594 728 gene locus_tag LOCUS_23950 594 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889851.1 protein_id gnl|my_center|LOCUS_23950 962 1399 gene locus_tag LOCUS_23960 962 1399 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889849.1 protein_id gnl|my_center|LOCUS_23960 1538 2326 gene locus_tag LOCUS_23970 1538 2326 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435466.1 protein_id gnl|my_center|LOCUS_23970 2371 2829 gene locus_tag LOCUS_23980 2371 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861382.1 protein_id gnl|my_center|LOCUS_23980 3280 2930 gene locus_tag LOCUS_23990 3280 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428670.1 protein_id gnl|my_center|LOCUS_23990 3665 3282 gene locus_tag LOCUS_24000 3665 3282 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428669.1 protein_id gnl|my_center|LOCUS_24000 4556 4173 gene locus_tag LOCUS_24010 4556 4173 CDS product PBECR2 nuclease fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428668.1 protein_id gnl|my_center|LOCUS_24010 4905 5396 gene locus_tag LOCUS_24020 4905 5396 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428667.1 protein_id gnl|my_center|LOCUS_24020 6273 5539 gene locus_tag LOCUS_24030 6273 5539 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861381.1 protein_id gnl|my_center|LOCUS_24030 >Feature sequence210 342 1364 gene locus_tag LOCUS_24040 342 1364 CDS product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429564.1 protein_id gnl|my_center|LOCUS_24040 1424 2431 gene locus_tag LOCUS_24050 gene gap 1424 2431 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421962.1 protein_id gnl|my_center|LOCUS_24050 2653 3855 gene locus_tag LOCUS_24060 2653 3855 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429565.1 protein_id gnl|my_center|LOCUS_24060 3881 4624 gene locus_tag LOCUS_24070 gene tpiA 3881 4624 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861867.1 protein_id gnl|my_center|LOCUS_24070 4636 6165 gene locus_tag LOCUS_24080 gene gpmI 4636 6165 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861866.1 protein_id gnl|my_center|LOCUS_24080 >Feature sequence211 176 1051 gene locus_tag LOCUS_24090 gene dpsA 176 1051 CDS product dipicolinate synthase subunit DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439770.1 protein_id gnl|my_center|LOCUS_24090 1054 1644 gene locus_tag LOCUS_24100 1054 1644 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429956.1 protein_id gnl|my_center|LOCUS_24100 2051 1851 gene locus_tag LOCUS_24110 2051 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861763.1 protein_id gnl|my_center|LOCUS_24110 2555 5209 gene locus_tag LOCUS_24120 gene adhE 2555 5209 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861762.1 protein_id gnl|my_center|LOCUS_24120 >Feature sequence212 1570 1202 gene locus_tag LOCUS_24130 1570 1202 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419333.1 protein_id gnl|my_center|LOCUS_24130 2953 1673 gene locus_tag LOCUS_24140 gene ftsY 2953 1673 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861159.1 protein_id gnl|my_center|LOCUS_24140 <6382 2980 gene locus_tag LOCUS_24150 <6382 2980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861158.1:chromosome segregation protein SMC >Feature sequence213 2089 797 gene locus_tag LOCUS_24160 gene brnQ 2089 797 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861162.1 protein_id gnl|my_center|LOCUS_24160 3374 2478 gene locus_tag LOCUS_24170 gene ylqF 3374 2478 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861161.1 protein_id gnl|my_center|LOCUS_24170 4045 3695 gene locus_tag LOCUS_24180 gene rplS 4045 3695 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419350.1 protein_id gnl|my_center|LOCUS_24180 4925 4230 gene locus_tag LOCUS_24190 gene trmD 4925 4230 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438222.1 protein_id gnl|my_center|LOCUS_24190 5449 4934 gene locus_tag LOCUS_24200 gene rimM 5449 4934 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889030.1 protein_id gnl|my_center|LOCUS_24200 5784 5557 gene locus_tag LOCUS_24210 5784 5557 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419342.1 protein_id gnl|my_center|LOCUS_24210 6121 5849 gene locus_tag LOCUS_24220 gene rpsP 6121 5849 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419338.1 protein_id gnl|my_center|LOCUS_24220 >Feature sequence214 917 210 gene locus_tag LOCUS_24230 917 210 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434049.1 protein_id gnl|my_center|LOCUS_24230 1170 2315 gene locus_tag LOCUS_24240 1170 2315 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861454.1 protein_id gnl|my_center|LOCUS_24240 3805 2429 gene locus_tag LOCUS_24250 3805 2429 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897252.1 protein_id gnl|my_center|LOCUS_24250 4251 5597 gene locus_tag LOCUS_24260 4251 5597 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_24260 >Feature sequence215 1738 1007 gene locus_tag LOCUS_24270 1738 1007 CDS product FliH/SctL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225549855.1 protein_id gnl|my_center|LOCUS_24270 2801 1731 gene locus_tag LOCUS_24280 gene fliG 2801 1731 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860698.1 protein_id gnl|my_center|LOCUS_24280 4364 2814 gene locus_tag LOCUS_24290 gene fliF 4364 2814 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436009.1 protein_id gnl|my_center|LOCUS_24290 4706 4518 gene locus_tag LOCUS_24300 4706 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24300 5120 4716 gene locus_tag LOCUS_24310 gene flgC 5120 4716 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425244.1 protein_id gnl|my_center|LOCUS_24310 5445 5128 gene locus_tag LOCUS_24320 gene flgB 5445 5128 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860696.1 protein_id gnl|my_center|LOCUS_24320 >Feature sequence216 394 906 gene locus_tag LOCUS_24330 394 906 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_24330 980 3187 gene locus_tag LOCUS_24340 980 3187 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422921.1 protein_id gnl|my_center|LOCUS_24340 3212 3661 gene locus_tag LOCUS_24350 gene dtd 3212 3661 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426448.1 protein_id gnl|my_center|LOCUS_24350 3676 4290 gene locus_tag LOCUS_24360 3676 4290 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454137.1 protein_id gnl|my_center|LOCUS_24360 4381 5937 gene locus_tag LOCUS_24370 4381 5937 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_24370 >Feature sequence217 365 904 gene locus_tag LOCUS_24380 365 904 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434284.1 protein_id gnl|my_center|LOCUS_24380 1589 1104 gene locus_tag LOCUS_24390 1589 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434280.1 protein_id gnl|my_center|LOCUS_24390 2123 1914 gene locus_tag LOCUS_24400 2123 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 2494 2871 gene locus_tag LOCUS_24410 2494 2871 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421988.1 protein_id gnl|my_center|LOCUS_24410 3267 5072 gene locus_tag LOCUS_24420 3267 5072 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861870.1 protein_id gnl|my_center|LOCUS_24420 5149 5688 gene locus_tag LOCUS_24430 5149 5688 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272031.1 protein_id gnl|my_center|LOCUS_24430 >Feature sequence218 1598 576 gene locus_tag LOCUS_24440 1598 576 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429728.1 protein_id gnl|my_center|LOCUS_24440 3231 1633 gene locus_tag LOCUS_24450 3231 1633 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860915.1 protein_id gnl|my_center|LOCUS_24450 4538 3273 gene locus_tag LOCUS_24460 4538 3273 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895721.1 protein_id gnl|my_center|LOCUS_24460 <6054 4680 gene locus_tag LOCUS_24470 <6054 4680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860914.1:ester cyclase >Feature sequence219 2046 1879 gene locus_tag LOCUS_24480 2046 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419648.1 protein_id gnl|my_center|LOCUS_24480 2519 2073 gene locus_tag LOCUS_24490 2519 2073 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902432.1 protein_id gnl|my_center|LOCUS_24490 3061 2633 gene locus_tag LOCUS_24500 3061 2633 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419646.1 protein_id gnl|my_center|LOCUS_24500 4139 3075 gene locus_tag LOCUS_24510 4139 3075 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861188.1 protein_id gnl|my_center|LOCUS_24510 4587 4144 gene locus_tag LOCUS_24520 4587 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896258.1 protein_id gnl|my_center|LOCUS_24520 5276 4836 gene locus_tag LOCUS_24530 5276 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428183.1 protein_id gnl|my_center|LOCUS_24530 5578 5381 gene locus_tag LOCUS_24540 5578 5381 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861187.1 protein_id gnl|my_center|LOCUS_24540 >Feature sequence220 352 750 gene locus_tag LOCUS_24550 gene rpsK 352 750 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_24550 782 1405 gene locus_tag LOCUS_24560 gene rpsD 782 1405 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421121.1 protein_id gnl|my_center|LOCUS_24560 1483 2430 gene locus_tag LOCUS_24570 1483 2430 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427733.1 protein_id gnl|my_center|LOCUS_24570 2451 2792 gene locus_tag LOCUS_24580 gene rplQ 2451 2792 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421117.1 protein_id gnl|my_center|LOCUS_24580 2912 3745 gene locus_tag LOCUS_24590 2912 3745 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435660.1 protein_id gnl|my_center|LOCUS_24590 3733 4599 gene locus_tag LOCUS_24600 3733 4599 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435657.1 protein_id gnl|my_center|LOCUS_24600 4593 5396 gene locus_tag LOCUS_24610 4593 5396 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860635.1 protein_id gnl|my_center|LOCUS_24610 >Feature sequence221 1167 712 gene locus_tag LOCUS_24620 1167 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24620 1539 1225 gene locus_tag LOCUS_24630 1539 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24630 2942 1887 gene locus_tag LOCUS_24640 gene ispG 2942 1887 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861462.1 protein_id gnl|my_center|LOCUS_24640 4129 3125 gene locus_tag LOCUS_24650 gene rseP 4129 3125 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430605.1 protein_id gnl|my_center|LOCUS_24650 5296 4142 gene locus_tag LOCUS_24660 5296 4142 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_24660 5663 5460 gene locus_tag LOCUS_24670 5663 5460 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890274.1 protein_id gnl|my_center|LOCUS_24670 >Feature sequence222 1347 535 gene locus_tag LOCUS_24680 1347 535 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897160.1 protein_id gnl|my_center|LOCUS_24680 2002 1373 gene locus_tag LOCUS_24690 2002 1373 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897162.1 protein_id gnl|my_center|LOCUS_24690 4001 2346 gene locus_tag LOCUS_24700 gene ilvD 4001 2346 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861428.1 protein_id gnl|my_center|LOCUS_24700 4641 4342 gene locus_tag LOCUS_24710 4641 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435203.1 protein_id gnl|my_center|LOCUS_24710 4900 5580 gene locus_tag LOCUS_24720 4900 5580 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893393.1 protein_id gnl|my_center|LOCUS_24720 5947 5690 gene locus_tag LOCUS_24730 5947 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435199.1 protein_id gnl|my_center|LOCUS_24730 >Feature sequence223 220 1725 gene locus_tag LOCUS_24740 220 1725 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437136.1 protein_id gnl|my_center|LOCUS_24740 2115 3212 gene locus_tag LOCUS_24750 gene dinB 2115 3212 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860981.1 protein_id gnl|my_center|LOCUS_24750 3475 4611 gene locus_tag LOCUS_24760 3475 4611 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437132.1 protein_id gnl|my_center|LOCUS_24760 >Feature sequence224 305 1234 gene locus_tag LOCUS_24770 gene glsA 305 1234 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417962.1 protein_id gnl|my_center|LOCUS_24770 1332 1895 gene locus_tag LOCUS_24780 1332 1895 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417965.1 protein_id gnl|my_center|LOCUS_24780 2383 3219 gene locus_tag LOCUS_24790 2383 3219 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_24790 3503 4498 gene locus_tag LOCUS_24800 3503 4498 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895580.1 protein_id gnl|my_center|LOCUS_24800 5159 4755 gene locus_tag LOCUS_24810 5159 4755 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895581.1 protein_id gnl|my_center|LOCUS_24810 >Feature sequence225 <1 832 gene locus_tag LOCUS_24820 <1 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_021361893.1:alpha/beta hydrolase 2105 3760 gene locus_tag LOCUS_24830 2105 3760 CDS product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861418.1 protein_id gnl|my_center|LOCUS_24830 3819 4571 gene locus_tag LOCUS_24840 3819 4571 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861417.1 protein_id gnl|my_center|LOCUS_24840 4782 4916 gene locus_tag LOCUS_24850 4782 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433020.1 protein_id gnl|my_center|LOCUS_24850 5540 5833 gene locus_tag LOCUS_24860 5540 5833 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889969.1 protein_id gnl|my_center|LOCUS_24860 >Feature sequence226 275 1261 gene locus_tag LOCUS_24870 275 1261 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896952.1 protein_id gnl|my_center|LOCUS_24870 1597 3078 gene locus_tag LOCUS_24880 1597 3078 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896953.1 protein_id gnl|my_center|LOCUS_24880 3104 4075 gene locus_tag LOCUS_24890 3104 4075 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 protein_id gnl|my_center|LOCUS_24890 4933 4331 gene locus_tag LOCUS_24900 4933 4331 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861340.1 protein_id gnl|my_center|LOCUS_24900 >Feature sequence227 1345 359 gene locus_tag LOCUS_24910 1345 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24910 1800 1369 gene locus_tag LOCUS_24920 1800 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24920 2476 3687 gene locus_tag LOCUS_24930 2476 3687 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021365553.1 protein_id gnl|my_center|LOCUS_24930 3779 4294 gene locus_tag LOCUS_24940 3779 4294 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433890.1 protein_id gnl|my_center|LOCUS_24940 <5812 4561 gene locus_tag LOCUS_24950 <5812 4561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861490.1:acetate--CoA ligase family protein >Feature sequence228 2358 1888 gene locus_tag LOCUS_24960 gene rpsG 2358 1888 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421180.1 protein_id gnl|my_center|LOCUS_24960 2904 2482 gene locus_tag LOCUS_24970 gene rpsL 2904 2482 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_24970 3717 3193 gene locus_tag LOCUS_24980 3717 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24980 <5785 3892 gene locus_tag LOCUS_24990 <5785 3892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003429485.1:DNA-directed RNA polymerase subunit beta' note possible pseudo, internal stop codon >Feature sequence229 <1 738 gene locus_tag LOCUS_25000 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009893310.1:3-dehydroquinate synthase 738 2051 gene locus_tag LOCUS_25010 gene aroA 738 2051 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861345.1 protein_id gnl|my_center|LOCUS_25010 2029 3108 gene locus_tag LOCUS_25020 gene aroC 2029 3108 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_25020 3111 4307 gene locus_tag LOCUS_25030 gene pheA 3111 4307 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_25030 4354 5163 gene locus_tag LOCUS_25040 gene aroE 4354 5163 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439416.1 protein_id gnl|my_center|LOCUS_25040 5175 5708 gene locus_tag LOCUS_25050 5175 5708 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439413.1 protein_id gnl|my_center|LOCUS_25050 >Feature sequence230 1184 390 gene locus_tag LOCUS_25060 1184 390 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437555.1 protein_id gnl|my_center|LOCUS_25060 2337 1195 gene locus_tag LOCUS_25070 2337 1195 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437554.1 protein_id gnl|my_center|LOCUS_25070 3609 2377 gene locus_tag LOCUS_25080 3609 2377 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860960.1 protein_id gnl|my_center|LOCUS_25080 5086 3746 gene locus_tag LOCUS_25090 5086 3746 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437552.1 protein_id gnl|my_center|LOCUS_25090 >Feature sequence231 <1 993 gene locus_tag LOCUS_25100 <1 993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454447.1:GTP pyrophosphokinase 1123 1626 gene locus_tag LOCUS_25110 1123 1626 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861311.1 protein_id gnl|my_center|LOCUS_25110 1674 2045 gene locus_tag LOCUS_25120 1674 2045 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454444.1 protein_id gnl|my_center|LOCUS_25120 2224 2562 gene locus_tag LOCUS_25130 2224 2562 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420397.1 protein_id gnl|my_center|LOCUS_25130 3029 3532 gene locus_tag LOCUS_25140 3029 3532 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893248.1 protein_id gnl|my_center|LOCUS_25140 3579 4538 gene locus_tag LOCUS_25150 gene moaA 3579 4538 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889647.1 protein_id gnl|my_center|LOCUS_25150 4542 5012 gene locus_tag LOCUS_25160 gene moaC 4542 5012 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454438.1 protein_id gnl|my_center|LOCUS_25160 5048 5479 gene locus_tag LOCUS_25170 5048 5479 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454437.1 protein_id gnl|my_center|LOCUS_25170 >Feature sequence232 14 119 gene locus_tag LOCUS_r00010 14 119 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1521 337 gene locus_tag LOCUS_25180 1521 337 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892490.1 protein_id gnl|my_center|LOCUS_25180 1894 4245 gene locus_tag LOCUS_25190 1894 4245 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436320.1 protein_id gnl|my_center|LOCUS_25190 4267 4806 gene locus_tag LOCUS_25200 gene nrdG 4267 4806 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432598.1 protein_id gnl|my_center|LOCUS_25200 >Feature sequence233 606 448 gene locus_tag LOCUS_25210 606 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454815.1 protein_id gnl|my_center|LOCUS_25210 2335 965 gene locus_tag LOCUS_25220 2335 965 CDS product cell wall-binding protein Cwp29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861578.1 protein_id gnl|my_center|LOCUS_25220 3200 2901 gene locus_tag LOCUS_25230 3200 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 3534 3659 gene locus_tag LOCUS_25240 3534 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25240 4810 4142 gene locus_tag LOCUS_25250 4810 4142 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861580.1 protein_id gnl|my_center|LOCUS_25250 >Feature sequence234 3 2360 gene locus_tag LOCUS_25260 3 2360 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861289.1 protein_id gnl|my_center|LOCUS_25260 2763 2446 gene locus_tag LOCUS_25270 2763 2446 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454504.1 protein_id gnl|my_center|LOCUS_25270 4618 3347 gene locus_tag LOCUS_25280 4618 3347 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896806.1 protein_id gnl|my_center|LOCUS_25280 >Feature sequence235 1892 942 gene locus_tag LOCUS_25290 1892 942 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861264.1 protein_id gnl|my_center|LOCUS_25290 2988 1894 gene locus_tag LOCUS_25300 2988 1894 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861263.1 protein_id gnl|my_center|LOCUS_25300 3463 3732 gene locus_tag LOCUS_25310 3463 3732 CDS product CD3324 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436543.1 protein_id gnl|my_center|LOCUS_25310 3850 4602 gene locus_tag LOCUS_25320 3850 4602 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861262.1 protein_id gnl|my_center|LOCUS_25320 <5331 4805 gene locus_tag LOCUS_25330 <5331 4805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861261.1:histidinol dehydrogenase >Feature sequence236 1936 1226 gene locus_tag LOCUS_25340 gene rgbR 1936 1226 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_25340 2950 2375 gene locus_tag LOCUS_25350 2950 2375 CDS product DUF1062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898497.1 protein_id gnl|my_center|LOCUS_25350 3521 3243 gene locus_tag LOCUS_25360 3521 3243 CDS product CD3324 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437274.1 protein_id gnl|my_center|LOCUS_25360 4591 3830 gene locus_tag LOCUS_25370 4591 3830 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898500.1 protein_id gnl|my_center|LOCUS_25370 <5325 4760 gene locus_tag LOCUS_25380 <5325 4760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861926.1:collagen-like exosporium glycoprotein BclA3 >Feature sequence237 108 941 gene locus_tag LOCUS_25390 108 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 2466 1378 gene locus_tag LOCUS_25400 2466 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425141.1 protein_id gnl|my_center|LOCUS_25400 2591 3319 gene locus_tag LOCUS_25410 2591 3319 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421079.1 protein_id gnl|my_center|LOCUS_25410 4011 3520 gene locus_tag LOCUS_25420 4011 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888171.1 protein_id gnl|my_center|LOCUS_25420 4465 4022 gene locus_tag LOCUS_25430 4465 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425143.1 protein_id gnl|my_center|LOCUS_25430 5294 4455 gene locus_tag LOCUS_25440 5294 4455 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_25440 >Feature sequence238 323 685 gene locus_tag LOCUS_25450 323 685 CDS product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861030.1 protein_id gnl|my_center|LOCUS_25450 678 1115 gene locus_tag LOCUS_25460 678 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373960.1 protein_id gnl|my_center|LOCUS_25460 1108 1284 gene locus_tag LOCUS_25470 1108 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861031.1 protein_id gnl|my_center|LOCUS_25470 1285 2595 gene locus_tag LOCUS_25480 1285 2595 CDS product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861032.1 protein_id gnl|my_center|LOCUS_25480 2612 3082 gene locus_tag LOCUS_25490 2612 3082 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429851.1 protein_id gnl|my_center|LOCUS_25490 3154 3594 gene locus_tag LOCUS_25500 3154 3594 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429853.1 protein_id gnl|my_center|LOCUS_25500 3669 3788 gene locus_tag LOCUS_25510 3669 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 3935 4096 gene locus_tag LOCUS_25520 3935 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429855.1 protein_id gnl|my_center|LOCUS_25520 >Feature sequence239 248 964 gene locus_tag LOCUS_25530 248 964 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861605.1 protein_id gnl|my_center|LOCUS_25530 936 3272 gene locus_tag LOCUS_25540 936 3272 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861604.1 protein_id gnl|my_center|LOCUS_25540 <5295 3589 gene locus_tag LOCUS_25550 <5295 3589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861603.1:mannosylglycerate hydrolase >Feature sequence240 1741 872 gene locus_tag LOCUS_25560 1741 872 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898391.1 protein_id gnl|my_center|LOCUS_25560 2552 1899 gene locus_tag LOCUS_25570 gene phoU 2552 1899 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432348.1 protein_id gnl|my_center|LOCUS_25570 3344 2580 gene locus_tag LOCUS_25580 gene pstB 3344 2580 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432349.1 protein_id gnl|my_center|LOCUS_25580 4187 3363 gene locus_tag LOCUS_25590 gene pstA 4187 3363 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432350.1 protein_id gnl|my_center|LOCUS_25590 5106 4189 gene locus_tag LOCUS_25600 gene pstC 5106 4189 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454007.1 protein_id gnl|my_center|LOCUS_25600 >Feature sequence241 481 5 gene locus_tag LOCUS_25610 481 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902980.1 protein_id gnl|my_center|LOCUS_25610 2305 680 gene locus_tag LOCUS_25620 2305 680 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429004.1 protein_id gnl|my_center|LOCUS_25620 3662 2643 gene locus_tag LOCUS_25630 3662 2643 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435117.1 protein_id gnl|my_center|LOCUS_25630 4228 3659 gene locus_tag LOCUS_25640 gene mocA 4228 3659 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890188.1 protein_id gnl|my_center|LOCUS_25640 5057 4335 gene locus_tag LOCUS_25650 gene yqeC 5057 4335 CDS product selenium cofactor biosynthesis protein YqeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861443.1 protein_id gnl|my_center|LOCUS_25650 >Feature sequence242 984 193 gene locus_tag LOCUS_25660 984 193 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861281.1 protein_id gnl|my_center|LOCUS_25660 2100 1012 gene locus_tag LOCUS_25670 2100 1012 CDS product cysteine protease StiP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861280.1 protein_id gnl|my_center|LOCUS_25670 3392 2154 gene locus_tag LOCUS_25680 3392 2154 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454526.1 protein_id gnl|my_center|LOCUS_25680 4446 3370 gene locus_tag LOCUS_25690 4446 3370 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861279.1 protein_id gnl|my_center|LOCUS_25690 <5247 4510 gene locus_tag LOCUS_25700 <5247 4510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003430084.1:toxic anion resistance protein >Feature sequence243 232 660 gene locus_tag LOCUS_25710 232 660 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861766.1 protein_id gnl|my_center|LOCUS_25710 1894 1115 gene locus_tag LOCUS_25720 1894 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898073.1 protein_id gnl|my_center|LOCUS_25720 2218 2763 gene locus_tag LOCUS_25730 2218 2763 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891255.1 protein_id gnl|my_center|LOCUS_25730 2795 3931 gene locus_tag LOCUS_25740 2795 3931 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861765.1 protein_id gnl|my_center|LOCUS_25740 >Feature sequence244 648 956 gene locus_tag LOCUS_25750 648 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426603.1 protein_id gnl|my_center|LOCUS_25750 2908 1118 gene locus_tag LOCUS_25760 2908 1118 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426617.1 protein_id gnl|my_center|LOCUS_25760 4635 2908 gene locus_tag LOCUS_25770 4635 2908 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897981.1 protein_id gnl|my_center|LOCUS_25770 5047 4880 gene locus_tag LOCUS_25780 5047 4880 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454067.1 protein_id gnl|my_center|LOCUS_25780 >Feature sequence245 271 1512 gene locus_tag LOCUS_25790 271 1512 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861026.1 protein_id gnl|my_center|LOCUS_25790 1518 2957 gene locus_tag LOCUS_25800 1518 2957 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861027.1 protein_id gnl|my_center|LOCUS_25800 2947 4344 gene locus_tag LOCUS_25810 2947 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 4359 4559 gene locus_tag LOCUS_25820 4359 4559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 4625 5188 gene locus_tag LOCUS_25830 4625 5188 CDS product phage scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861028.1 protein_id gnl|my_center|LOCUS_25830 >Feature sequence246 2629 209 gene locus_tag LOCUS_25840 2629 209 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434290.1 protein_id gnl|my_center|LOCUS_25840 3635 2715 gene locus_tag LOCUS_25850 3635 2715 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434289.1 protein_id gnl|my_center|LOCUS_25850 4245 5171 gene locus_tag LOCUS_25860 4245 5171 CDS product conserved phage C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861872.1 protein_id gnl|my_center|LOCUS_25860 >Feature sequence247 1016 2380 gene locus_tag LOCUS_25870 1016 2380 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890430.1 protein_id gnl|my_center|LOCUS_25870 2402 2893 gene locus_tag LOCUS_25880 2402 2893 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861502.1 protein_id gnl|my_center|LOCUS_25880 3166 3837 gene locus_tag LOCUS_25890 3166 3837 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430452.1 protein_id gnl|my_center|LOCUS_25890 3907 4788 gene locus_tag LOCUS_25900 3907 4788 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021359411.1 protein_id gnl|my_center|LOCUS_25900 >Feature sequence248 53 802 gene locus_tag LOCUS_25910 gene fabG 53 802 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_25910 856 1080 gene locus_tag LOCUS_25920 gene acpP 856 1080 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419132.1 protein_id gnl|my_center|LOCUS_25920 1109 2347 gene locus_tag LOCUS_25930 gene fabF 1109 2347 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438103.1 protein_id gnl|my_center|LOCUS_25930 2573 4291 gene locus_tag LOCUS_25940 2573 4291 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896103.1 protein_id gnl|my_center|LOCUS_25940 >Feature sequence249 127 303 gene locus_tag LOCUS_25950 127 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429374.1 protein_id gnl|my_center|LOCUS_25950 729 490 gene locus_tag LOCUS_25960 729 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861209.1 protein_id gnl|my_center|LOCUS_25960 1683 874 gene locus_tag LOCUS_25970 1683 874 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429371.1 protein_id gnl|my_center|LOCUS_25970 2467 4701 gene locus_tag LOCUS_25980 2467 4701 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861208.1 protein_id gnl|my_center|LOCUS_25980 >Feature sequence250 3199 1610 gene locus_tag LOCUS_25990 3199 1610 CDS product cell wall-binding protein Cwp12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861687.1 protein_id gnl|my_center|LOCUS_25990 5013 3418 gene locus_tag LOCUS_26000 5013 3418 CDS product cell wall-binding protein Cwp11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861688.1 protein_id gnl|my_center|LOCUS_26000 >Feature sequence251 28 534 gene locus_tag LOCUS_26010 28 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861186.1 protein_id gnl|my_center|LOCUS_26010 774 1904 gene locus_tag LOCUS_26020 774 1904 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288357.1 protein_id gnl|my_center|LOCUS_26020 3958 2390 gene locus_tag LOCUS_26030 gene ilvB 3958 2390 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436643.1 protein_id gnl|my_center|LOCUS_26030 4994 4005 gene locus_tag LOCUS_26040 gene ilvC 4994 4005 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861252.1 protein_id gnl|my_center|LOCUS_26040 >Feature sequence252 <1 783 gene locus_tag LOCUS_26050 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003434581.1:23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD 1069 854 gene locus_tag LOCUS_26060 1069 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 1295 2329 gene locus_tag LOCUS_26070 1295 2329 CDS product YHYH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860808.1 protein_id gnl|my_center|LOCUS_26070 2416 2619 gene locus_tag LOCUS_26080 2416 2619 CDS product DUF4236 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426228.1 protein_id gnl|my_center|LOCUS_26080 2790 3950 gene locus_tag LOCUS_26090 2790 3950 CDS product cell wall-binding protein Cwp27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860809.1 protein_id gnl|my_center|LOCUS_26090 4210 4350 gene locus_tag LOCUS_26100 4210 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434654.1 protein_id gnl|my_center|LOCUS_26100 >Feature sequence253 894 718 gene locus_tag LOCUS_26110 894 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435444.1 protein_id gnl|my_center|LOCUS_26110 1222 1356 gene locus_tag LOCUS_26120 1222 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26120 1396 2820 gene locus_tag LOCUS_26130 1396 2820 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861384.1 protein_id gnl|my_center|LOCUS_26130 3015 3815 gene locus_tag LOCUS_26140 3015 3815 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861383.1 protein_id gnl|my_center|LOCUS_26140 4315 4109 gene locus_tag LOCUS_26150 4315 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 4659 4456 gene locus_tag LOCUS_26160 4659 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 >Feature sequence254 921 211 gene locus_tag LOCUS_26170 921 211 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895627.1 protein_id gnl|my_center|LOCUS_26170 3416 1305 gene locus_tag LOCUS_26180 3416 1305 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860878.1 protein_id gnl|my_center|LOCUS_26180 4158 3406 gene locus_tag LOCUS_26190 4158 3406 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895631.1 protein_id gnl|my_center|LOCUS_26190 >Feature sequence255 1881 433 gene locus_tag LOCUS_26200 1881 433 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861839.1 protein_id gnl|my_center|LOCUS_26200 3173 2286 gene locus_tag LOCUS_26210 3173 2286 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431317.1 protein_id gnl|my_center|LOCUS_26210 3722 3273 gene locus_tag LOCUS_26220 3722 3273 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431315.1 protein_id gnl|my_center|LOCUS_26220 <5046 3712 gene locus_tag LOCUS_26230 <5046 3712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861840.1:transcription antiterminator >Feature sequence256 386 562 gene locus_tag LOCUS_26240 gene rpmF 386 562 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419113.1 protein_id gnl|my_center|LOCUS_26240 769 1326 gene locus_tag LOCUS_26250 gene fapR 769 1326 CDS product transcription factor FapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419115.1 protein_id gnl|my_center|LOCUS_26250 1337 2359 gene locus_tag LOCUS_26260 gene plsX 1337 2359 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428446.1 protein_id gnl|my_center|LOCUS_26260 2385 3371 gene locus_tag LOCUS_26270 2385 3371 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438099.1 protein_id gnl|my_center|LOCUS_26270 3480 4409 gene locus_tag LOCUS_26280 gene fabK 3480 4409 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419125.1 protein_id gnl|my_center|LOCUS_26280 >Feature sequence257 704 1528 gene locus_tag LOCUS_26290 gene pdaA 704 1528 CDS product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438596.1 protein_id gnl|my_center|LOCUS_26290 2410 1625 gene locus_tag LOCUS_26300 2410 1625 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438593.1 protein_id gnl|my_center|LOCUS_26300 2644 2510 gene locus_tag LOCUS_26310 2644 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429381.1 protein_id gnl|my_center|LOCUS_26310 2875 3240 gene locus_tag LOCUS_26320 2875 3240 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429379.1 protein_id gnl|my_center|LOCUS_26320 3318 3872 gene locus_tag LOCUS_26330 3318 3872 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234256.1 protein_id gnl|my_center|LOCUS_26330 4092 4766 gene locus_tag LOCUS_26340 4092 4766 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429376.1 protein_id gnl|my_center|LOCUS_26340 >Feature sequence258 670 197 gene locus_tag LOCUS_26350 670 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 1840 1160 gene locus_tag LOCUS_26360 1840 1160 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432361.1 protein_id gnl|my_center|LOCUS_26360 3917 1890 gene locus_tag LOCUS_26370 3917 1890 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021374131.1 protein_id gnl|my_center|LOCUS_26370 4653 4036 gene locus_tag LOCUS_26380 4653 4036 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417201.1 protein_id gnl|my_center|LOCUS_26380 >Feature sequence259 351 545 gene locus_tag LOCUS_26390 351 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 670 1512 gene locus_tag LOCUS_26400 670 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433843.1 protein_id gnl|my_center|LOCUS_26400 1751 2059 gene locus_tag LOCUS_26410 1751 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 2419 3057 gene locus_tag LOCUS_26420 2419 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 3447 3650 gene locus_tag LOCUS_26430 3447 3650 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004613735.1 protein_id gnl|my_center|LOCUS_26430 3728 4081 gene locus_tag LOCUS_26440 3728 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 4153 4785 gene locus_tag LOCUS_26450 4153 4785 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433837.1 protein_id gnl|my_center|LOCUS_26450 >Feature sequence260 953 1774 gene locus_tag LOCUS_26460 953 1774 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454798.1 protein_id gnl|my_center|LOCUS_26460 2151 3467 gene locus_tag LOCUS_26470 gene argH 2151 3467 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890714.1 protein_id gnl|my_center|LOCUS_26470 3716 4054 gene locus_tag LOCUS_26480 3716 4054 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890712.1 protein_id gnl|my_center|LOCUS_26480 <4973 4181 gene locus_tag LOCUS_26490 <4973 4181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454794.1:D-alanyl-D-alanine carboxypeptidase family protein >Feature sequence261 381 73 gene locus_tag LOCUS_26500 gene ortA 381 73 CDS product 2-amino-4-oxopentanoate thiolase subunit OrtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860811.1 protein_id gnl|my_center|LOCUS_26500 1592 525 gene locus_tag LOCUS_26510 gene ord 1592 525 CDS product 2,4-diaminopentanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895461.1 protein_id gnl|my_center|LOCUS_26510 3248 1848 gene locus_tag LOCUS_26520 3248 1848 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860810.1 protein_id gnl|my_center|LOCUS_26520 <4950 3764 gene locus_tag LOCUS_26530 <4950 3764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681239.1:DUF2075 domain-containing protein >Feature sequence262 1770 1102 gene locus_tag LOCUS_26540 1770 1102 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965298.1 protein_id gnl|my_center|LOCUS_26540 4078 2675 gene locus_tag LOCUS_26550 4078 2675 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861836.1 protein_id gnl|my_center|LOCUS_26550 4788 4117 gene locus_tag LOCUS_26560 gene pgmB 4788 4117 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861837.1 protein_id gnl|my_center|LOCUS_26560 >Feature sequence263 864 208 gene locus_tag LOCUS_26570 864 208 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454888.1 protein_id gnl|my_center|LOCUS_26570 1548 919 gene locus_tag LOCUS_26580 1548 919 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903260.1 protein_id gnl|my_center|LOCUS_26580 2320 1679 gene locus_tag LOCUS_26590 2320 1679 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454892.1 protein_id gnl|my_center|LOCUS_26590 3000 2329 gene locus_tag LOCUS_26600 gene rpe 3000 2329 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431138.1 protein_id gnl|my_center|LOCUS_26600 3889 3005 gene locus_tag LOCUS_26610 gene rsgA 3889 3005 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893669.1 protein_id gnl|my_center|LOCUS_26610 4724 3987 gene locus_tag LOCUS_26620 4724 3987 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_26620 >Feature sequence264 1 486 gene locus_tag LOCUS_26630 1 486 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454702.1 protein_id gnl|my_center|LOCUS_26630 740 597 gene locus_tag LOCUS_26640 740 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26640 2825 972 gene locus_tag LOCUS_26650 2825 972 CDS product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861544.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26650 2938 3369 gene locus_tag LOCUS_26660 gene dut 2938 3369 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454700.1 protein_id gnl|my_center|LOCUS_26660 3629 4819 gene locus_tag LOCUS_26670 3629 4819 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903185.1 protein_id gnl|my_center|LOCUS_26670 >Feature sequence265 201 1250 gene locus_tag LOCUS_26680 201 1250 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 protein_id gnl|my_center|LOCUS_26680 1747 1400 gene locus_tag LOCUS_26690 1747 1400 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861374.1 protein_id gnl|my_center|LOCUS_26690 <4853 2379 gene locus_tag LOCUS_26700 <4853 2379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948729.1:SdrD B-like domain-containing protein note possible pseudo, internal stop codon >Feature sequence266 1811 2578 gene locus_tag LOCUS_26710 1811 2578 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416661.1 protein_id gnl|my_center|LOCUS_26710 2861 3058 gene locus_tag LOCUS_26720 2861 3058 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416663.1 protein_id gnl|my_center|LOCUS_26720 3087 4163 gene locus_tag LOCUS_26730 gene vorB 3087 4163 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890635.1 protein_id gnl|my_center|LOCUS_26730 >Feature sequence267 3091 332 gene locus_tag LOCUS_26740 3091 332 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893200.1 protein_id gnl|my_center|LOCUS_26740 3710 3081 gene locus_tag LOCUS_26750 3710 3081 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430074.1 protein_id gnl|my_center|LOCUS_26750 4374 3796 gene locus_tag LOCUS_26760 4374 3796 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454531.1 protein_id gnl|my_center|LOCUS_26760 >Feature sequence268 <1 2123 gene locus_tag LOCUS_26770 <1 2123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003435194.1:ATP-dependent chaperone ClpB 3747 2320 gene locus_tag LOCUS_26780 3747 2320 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861429.1 protein_id gnl|my_center|LOCUS_26780 >Feature sequence269 <1 782 gene locus_tag LOCUS_26790 <1 782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860832.1:ABC transporter permease 2449 1025 gene locus_tag LOCUS_26800 2449 1025 CDS product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434751.1 protein_id gnl|my_center|LOCUS_26800 3160 2468 gene locus_tag LOCUS_26810 3160 2468 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434748.1 protein_id gnl|my_center|LOCUS_26810 3991 3212 gene locus_tag LOCUS_26820 3991 3212 CDS product lantibiotic immunity ABC transporter MutG family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860831.1 protein_id gnl|my_center|LOCUS_26820 4566 3988 gene locus_tag LOCUS_26830 4566 3988 CDS product lantibiotic immunity ABC transporter MutE/EpiE family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888312.1 protein_id gnl|my_center|LOCUS_26830 >Feature sequence270 1032 229 gene locus_tag LOCUS_26840 gene proC 1032 229 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898446.1 protein_id gnl|my_center|LOCUS_26840 3726 1357 gene locus_tag LOCUS_26850 3726 1357 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903701.1 protein_id gnl|my_center|LOCUS_26850 4639 3731 gene locus_tag LOCUS_26860 4639 3731 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432388.1 protein_id gnl|my_center|LOCUS_26860 >Feature sequence271 16 121 gene locus_tag LOCUS_r00020 16 121 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 303 911 gene locus_tag LOCUS_26870 303 911 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888175.1 protein_id gnl|my_center|LOCUS_26870 2225 1452 gene locus_tag LOCUS_26880 2225 1452 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860729.1 protein_id gnl|my_center|LOCUS_26880 2973 2236 gene locus_tag LOCUS_26890 2973 2236 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895383.1 protein_id gnl|my_center|LOCUS_26890 3889 2966 gene locus_tag LOCUS_26900 3889 2966 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860730.1 protein_id gnl|my_center|LOCUS_26900 <4748 4046 gene locus_tag LOCUS_26910 <4748 4046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009888178.1:HAMP domain-containing sensor histidine kinase >Feature sequence272 983 561 gene locus_tag LOCUS_26920 983 561 CDS product PTS mannose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432377.1 protein_id gnl|my_center|LOCUS_26920 1478 999 gene locus_tag LOCUS_26930 1478 999 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898441.1 protein_id gnl|my_center|LOCUS_26930 4366 1610 gene locus_tag LOCUS_26940 4366 1610 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861895.1 protein_id gnl|my_center|LOCUS_26940 >Feature sequence273 617 213 gene locus_tag LOCUS_26950 617 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26950 1585 653 gene locus_tag LOCUS_26960 1585 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26960 3328 1682 gene locus_tag LOCUS_26970 3328 1682 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453968.1 protein_id gnl|my_center|LOCUS_26970 4516 3350 gene locus_tag LOCUS_26980 4516 3350 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901552.1 protein_id gnl|my_center|LOCUS_26980 >Feature sequence274 853 182 gene locus_tag LOCUS_26990 853 182 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861699.1 protein_id gnl|my_center|LOCUS_26990 1264 2154 gene locus_tag LOCUS_27000 gene garR 1264 2154 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861698.1 protein_id gnl|my_center|LOCUS_27000 2290 3672 gene locus_tag LOCUS_27010 2290 3672 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454077.1 protein_id gnl|my_center|LOCUS_27010 >Feature sequence275 <1 1104 gene locus_tag LOCUS_27020 <1 1104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861135.1:sigma 54-interacting transcriptional regulator 1455 1700 gene locus_tag LOCUS_27030 1455 1700 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428433.1 protein_id gnl|my_center|LOCUS_27030 1735 2460 gene locus_tag LOCUS_27040 1735 2460 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438111.1 protein_id gnl|my_center|LOCUS_27040 2482 3795 gene locus_tag LOCUS_27050 2482 3795 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438113.1 protein_id gnl|my_center|LOCUS_27050 4001 4540 gene locus_tag LOCUS_27060 4001 4540 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861137.1 protein_id gnl|my_center|LOCUS_27060 >Feature sequence276 165 395 gene locus_tag LOCUS_27070 165 395 CDS product DUF2922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437662.1 protein_id gnl|my_center|LOCUS_27070 408 557 gene locus_tag LOCUS_27080 408 557 CDS product YvrJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429511.1 protein_id gnl|my_center|LOCUS_27080 814 1251 gene locus_tag LOCUS_27090 814 1251 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437661.1 protein_id gnl|my_center|LOCUS_27090 1508 2401 gene locus_tag LOCUS_27100 1508 2401 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860879.1 protein_id gnl|my_center|LOCUS_27100 2579 3403 gene locus_tag LOCUS_27110 2579 3403 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895633.1 protein_id gnl|my_center|LOCUS_27110 3529 4110 gene locus_tag LOCUS_27120 3529 4110 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888409.1 protein_id gnl|my_center|LOCUS_27120 4214 4390 gene locus_tag LOCUS_27130 4214 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429517.1 protein_id gnl|my_center|LOCUS_27130 >Feature sequence277 1 672 gene locus_tag LOCUS_27140 1 672 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424529.1 protein_id gnl|my_center|LOCUS_27140 685 1464 gene locus_tag LOCUS_27150 685 1464 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434000.1 protein_id gnl|my_center|LOCUS_27150 2288 4099 gene locus_tag LOCUS_27160 2288 4099 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861465.1 protein_id gnl|my_center|LOCUS_27160 >Feature sequence278 234 143 gene locus_tag LOCUS_t00120 234 143 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 690 235 gene locus_tag LOCUS_27170 690 235 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421624.1 protein_id gnl|my_center|LOCUS_27170 2282 1011 gene locus_tag LOCUS_27180 gene serS 2282 1011 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435562.1 protein_id gnl|my_center|LOCUS_27180 3622 2741 gene locus_tag LOCUS_27190 3622 2741 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860622.1 protein_id gnl|my_center|LOCUS_27190 4143 3634 gene locus_tag LOCUS_27200 4143 3634 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435561.1 protein_id gnl|my_center|LOCUS_27200 4378 4273 gene locus_tag LOCUS_r00030 4378 4273 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence279 <1 1382 gene locus_tag LOCUS_27210 <1 1382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009892173.1:carbamoyl-phosphate synthase large subunit 1640 2689 gene locus_tag LOCUS_27220 gene carA 1640 2689 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429883.1 protein_id gnl|my_center|LOCUS_27220 2882 4498 gene locus_tag LOCUS_27230 2882 4498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27230 >Feature sequence280 1 1341 gene locus_tag LOCUS_27240 1 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 1595 2257 gene locus_tag LOCUS_27250 1595 2257 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439746.1 protein_id gnl|my_center|LOCUS_27250 2628 4037 gene locus_tag LOCUS_27260 2628 4037 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898068.1 protein_id gnl|my_center|LOCUS_27260 4152 4427 gene locus_tag LOCUS_27270 4152 4427 CDS product Nif11-like leader peptide family natural product precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439731.1 protein_id gnl|my_center|LOCUS_27270 >Feature sequence281 1402 605 gene locus_tag LOCUS_27280 1402 605 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435466.1 protein_id gnl|my_center|LOCUS_27280 1659 1402 gene locus_tag LOCUS_27290 1659 1402 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861047.1 protein_id gnl|my_center|LOCUS_27290 1909 1679 gene locus_tag LOCUS_27300 1909 1679 CDS product hemolysin XhlA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861046.1 protein_id gnl|my_center|LOCUS_27300 2078 1941 gene locus_tag LOCUS_27310 2078 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 2378 2079 gene locus_tag LOCUS_27320 2378 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 3607 2375 gene locus_tag LOCUS_27330 3607 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 3823 3641 gene locus_tag LOCUS_27340 3823 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861045.1 protein_id gnl|my_center|LOCUS_27340 4119 3823 gene locus_tag LOCUS_27350 4119 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861044.1 protein_id gnl|my_center|LOCUS_27350 >Feature sequence282 1593 529 gene locus_tag LOCUS_27360 1593 529 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897674.1 protein_id gnl|my_center|LOCUS_27360 2960 1698 gene locus_tag LOCUS_27370 2960 1698 CDS product PTS fructose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454776.1 protein_id gnl|my_center|LOCUS_27370 3302 2985 gene locus_tag LOCUS_27380 3302 2985 CDS product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416512.1 protein_id gnl|my_center|LOCUS_27380 3816 3361 gene locus_tag LOCUS_27390 3816 3361 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897677.1 protein_id gnl|my_center|LOCUS_27390 <4539 3831 gene locus_tag LOCUS_27400 <4539 3831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009897679.1:BglG family transcription antiterminator >Feature sequence283 14 1141 gene locus_tag LOCUS_27410 14 1141 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430454.1 protein_id gnl|my_center|LOCUS_27410 1271 1723 gene locus_tag LOCUS_27420 1271 1723 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890423.1 protein_id gnl|my_center|LOCUS_27420 1883 2686 gene locus_tag LOCUS_27430 1883 2686 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861501.1 protein_id gnl|my_center|LOCUS_27430 2744 3340 gene locus_tag LOCUS_27440 2744 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27440 3394 3630 gene locus_tag LOCUS_27450 3394 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27450 3649 4497 gene locus_tag LOCUS_27460 3649 4497 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423346.1 protein_id gnl|my_center|LOCUS_27460 >Feature sequence284 702 46 gene locus_tag LOCUS_27470 702 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426728.1 protein_id gnl|my_center|LOCUS_27470 1429 728 gene locus_tag LOCUS_27480 1429 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 2238 2717 gene locus_tag LOCUS_27490 2238 2717 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439159.1 protein_id gnl|my_center|LOCUS_27490 2714 3493 gene locus_tag LOCUS_27500 2714 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860913.1 protein_id gnl|my_center|LOCUS_27500 4243 3743 gene locus_tag LOCUS_27510 4243 3743 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895705.1 protein_id gnl|my_center|LOCUS_27510 >Feature sequence285 320 1675 gene locus_tag LOCUS_27520 320 1675 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438549.1 protein_id gnl|my_center|LOCUS_27520 2443 1793 gene locus_tag LOCUS_27530 2443 1793 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429358.1 protein_id gnl|my_center|LOCUS_27530 2956 2528 gene locus_tag LOCUS_27540 2956 2528 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861207.1 protein_id gnl|my_center|LOCUS_27540 3108 3656 gene locus_tag LOCUS_27550 3108 3656 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861206.1 protein_id gnl|my_center|LOCUS_27550 3776 4480 gene locus_tag LOCUS_27560 3776 4480 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861205.1 protein_id gnl|my_center|LOCUS_27560 >Feature sequence286 2073 862 gene locus_tag LOCUS_27570 2073 862 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437948.1 protein_id gnl|my_center|LOCUS_27570 <4487 2119 gene locus_tag LOCUS_27580 <4487 2119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861079.1:helicase-exonuclease AddAB subunit AddA >Feature sequence287 164 2110 gene locus_tag LOCUS_27590 gene feoB 164 2110 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903695.1 protein_id gnl|my_center|LOCUS_27590 3344 2289 gene locus_tag LOCUS_27600 3344 2289 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432374.1 protein_id gnl|my_center|LOCUS_27600 4192 3392 gene locus_tag LOCUS_27610 4192 3392 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432375.1 protein_id gnl|my_center|LOCUS_27610 >Feature sequence288 42 206 gene locus_tag LOCUS_27620 42 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 888 337 gene locus_tag LOCUS_27630 888 337 CDS product tryptophan transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435247.1 protein_id gnl|my_center|LOCUS_27630 2136 1738 gene locus_tag LOCUS_27640 2136 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861413.1 protein_id gnl|my_center|LOCUS_27640 2977 2492 gene locus_tag LOCUS_27650 2977 2492 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897134.1 protein_id gnl|my_center|LOCUS_27650 3892 3710 gene locus_tag LOCUS_27660 3892 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27660 4270 4446 gene locus_tag LOCUS_27670 4270 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897136.1 protein_id gnl|my_center|LOCUS_27670 >Feature sequence289 398 1153 gene locus_tag LOCUS_27680 398 1153 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889131.1 protein_id gnl|my_center|LOCUS_27680 1724 1296 gene locus_tag LOCUS_27690 1724 1296 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889129.1 protein_id gnl|my_center|LOCUS_27690 2345 2145 gene locus_tag LOCUS_27700 2345 2145 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419624.1 protein_id gnl|my_center|LOCUS_27700 3682 2528 gene locus_tag LOCUS_27710 3682 2528 CDS product amidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902426.1 protein_id gnl|my_center|LOCUS_27710 >Feature sequence290 900 1298 gene locus_tag LOCUS_27720 900 1298 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428144.1 protein_id gnl|my_center|LOCUS_27720 1724 1515 gene locus_tag LOCUS_27730 1724 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428145.1 protein_id gnl|my_center|LOCUS_27730 1965 1756 gene locus_tag LOCUS_27740 1965 1756 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428146.1 protein_id gnl|my_center|LOCUS_27740 2264 2683 gene locus_tag LOCUS_27750 2264 2683 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438466.1 protein_id gnl|my_center|LOCUS_27750 2911 3366 gene locus_tag LOCUS_27760 2911 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419674.1 protein_id gnl|my_center|LOCUS_27760 3833 3573 gene locus_tag LOCUS_27770 3833 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419670.1 protein_id gnl|my_center|LOCUS_27770 >Feature sequence291 <1 842 gene locus_tag LOCUS_27780 <1 842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009888533.1:formate--tetrahydrofolate ligase 947 1579 gene locus_tag LOCUS_27790 947 1579 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432265.1 protein_id gnl|my_center|LOCUS_27790 1671 2543 gene locus_tag LOCUS_27800 1671 2543 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902122.1 protein_id gnl|my_center|LOCUS_27800 2580 3254 gene locus_tag LOCUS_27810 2580 3254 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436912.1 protein_id gnl|my_center|LOCUS_27810 3290 4171 gene locus_tag LOCUS_27820 3290 4171 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436920.1 protein_id gnl|my_center|LOCUS_27820 >Feature sequence292 839 114 gene locus_tag LOCUS_27830 839 114 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_27830 1025 1708 gene locus_tag LOCUS_27840 1025 1708 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_27840 2063 1872 gene locus_tag LOCUS_27850 2063 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27850 3143 2082 gene locus_tag LOCUS_27860 3143 2082 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948301.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27860 <4379 3734 gene locus_tag LOCUS_27870 <4379 3734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003433939.1:amino acid ABC transporter ATP-binding protein >Feature sequence293 2701 2174 gene locus_tag LOCUS_27880 2701 2174 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426928.1 protein_id gnl|my_center|LOCUS_27880 3521 2736 gene locus_tag LOCUS_27890 3521 2736 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897805.1 protein_id gnl|my_center|LOCUS_27890 3788 3531 gene locus_tag LOCUS_27900 3788 3531 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416163.1 protein_id gnl|my_center|LOCUS_27900 4265 3807 gene locus_tag LOCUS_27910 gene sepF 4265 3807 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416162.1 protein_id gnl|my_center|LOCUS_27910 >Feature sequence294 1057 311 gene locus_tag LOCUS_27920 1057 311 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439090.1 protein_id gnl|my_center|LOCUS_27920 2579 1269 gene locus_tag LOCUS_27930 2579 1269 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439092.1 protein_id gnl|my_center|LOCUS_27930 3062 2592 gene locus_tag LOCUS_27940 3062 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417884.1 protein_id gnl|my_center|LOCUS_27940 3917 3066 gene locus_tag LOCUS_27950 3917 3066 CDS product DUF3100 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439094.1 protein_id gnl|my_center|LOCUS_27950 >Feature sequence295 1894 1115 gene locus_tag LOCUS_27960 1894 1115 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888532.1 protein_id gnl|my_center|LOCUS_27960 4133 2214 gene locus_tag LOCUS_27970 gene cooS 4133 2214 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860935.1 protein_id gnl|my_center|LOCUS_27970 >Feature sequence296 1329 217 gene locus_tag LOCUS_27980 1329 217 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861441.1 protein_id gnl|my_center|LOCUS_27980 1670 2047 gene locus_tag LOCUS_27990 1670 2047 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428999.1 protein_id gnl|my_center|LOCUS_27990 2747 2484 gene locus_tag LOCUS_28000 2747 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897212.1 protein_id gnl|my_center|LOCUS_28000 3062 3637 gene locus_tag LOCUS_28010 3062 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424324.1 protein_id gnl|my_center|LOCUS_28010 >Feature sequence297 1264 695 gene locus_tag LOCUS_28020 1264 695 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860876.1 protein_id gnl|my_center|LOCUS_28020 2629 1616 gene locus_tag LOCUS_28030 2629 1616 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434500.1 protein_id gnl|my_center|LOCUS_28030 4086 3241 gene locus_tag LOCUS_28040 4086 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 4177 4025 gene locus_tag LOCUS_28050 4177 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 >Feature sequence298 <1 588 gene locus_tag LOCUS_28060 <1 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003433949.1:hydroxylamine reductase note possible pseudo, frameshifted 585 1547 gene locus_tag LOCUS_28070 585 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28070 1918 2823 gene locus_tag LOCUS_28080 1918 2823 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903063.1 protein_id gnl|my_center|LOCUS_28080 2947 3900 gene locus_tag LOCUS_28090 gene msrA 2947 3900 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373555.1 protein_id gnl|my_center|LOCUS_28090 >Feature sequence299 1409 720 gene locus_tag LOCUS_28100 1409 720 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861304.1 protein_id gnl|my_center|LOCUS_28100 1980 1417 gene locus_tag LOCUS_28110 1980 1417 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454478.1 protein_id gnl|my_center|LOCUS_28110 2950 1982 gene locus_tag LOCUS_28120 2950 1982 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454479.1 protein_id gnl|my_center|LOCUS_28120 3459 4088 gene locus_tag LOCUS_28130 3459 4088 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861303.1 protein_id gnl|my_center|LOCUS_28130 >Feature sequence300 1861 1304 gene locus_tag LOCUS_28140 1861 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440252.1 protein_id gnl|my_center|LOCUS_28140 3415 1889 gene locus_tag LOCUS_28150 3415 1889 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897439.1 protein_id gnl|my_center|LOCUS_28150 4148 3795 gene locus_tag LOCUS_28160 4148 3795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 >Feature sequence301 <1 928 gene locus_tag LOCUS_28170 <1 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436749.1:DUF362 domain-containing protein 981 2246 gene locus_tag LOCUS_28180 981 2246 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861243.1 protein_id gnl|my_center|LOCUS_28180 3764 2532 gene locus_tag LOCUS_28190 3764 2532 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429753.1 protein_id gnl|my_center|LOCUS_28190 <4305 3767 gene locus_tag LOCUS_28200 <4305 3767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436744.1:ABC transporter ATP-binding protein >Feature sequence302 1076 66 gene locus_tag LOCUS_28210 1076 66 CDS product DUF4116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437564.1 protein_id gnl|my_center|LOCUS_28210 1564 1908 gene locus_tag LOCUS_28220 1564 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437561.1 protein_id gnl|my_center|LOCUS_28220 3616 2240 gene locus_tag LOCUS_28230 3616 2240 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437559.1 protein_id gnl|my_center|LOCUS_28230 <4300 3715 gene locus_tag LOCUS_28240 <4300 3715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437556.1:electron transfer flavoprotein subunit alpha/FixB family protein >Feature sequence303 58 483 gene locus_tag LOCUS_28250 58 483 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860828.1 protein_id gnl|my_center|LOCUS_28250 551 1330 gene locus_tag LOCUS_28260 551 1330 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434727.1 protein_id gnl|my_center|LOCUS_28260 2202 1576 gene locus_tag LOCUS_28270 2202 1576 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895513.1 protein_id gnl|my_center|LOCUS_28270 2602 2345 gene locus_tag LOCUS_28280 2602 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860829.1 protein_id gnl|my_center|LOCUS_28280 2928 3440 gene locus_tag LOCUS_28290 2928 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860830.1 protein_id gnl|my_center|LOCUS_28290 >Feature sequence304 1377 202 gene locus_tag LOCUS_28300 1377 202 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861235.1 protein_id gnl|my_center|LOCUS_28300 1644 2120 gene locus_tag LOCUS_28310 1644 2120 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861236.1 protein_id gnl|my_center|LOCUS_28310 2411 3295 gene locus_tag LOCUS_28320 2411 3295 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889336.1 protein_id gnl|my_center|LOCUS_28320 3769 4176 gene locus_tag LOCUS_28330 3769 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 >Feature sequence305 <1 604 gene locus_tag LOCUS_28340 <1 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009889567.1:DUF969 domain-containing protein 626 1558 gene locus_tag LOCUS_28350 626 1558 CDS product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433654.1 protein_id gnl|my_center|LOCUS_28350 1579 2220 gene locus_tag LOCUS_28360 gene pcp 1579 2220 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861300.1 protein_id gnl|my_center|LOCUS_28360 2672 2340 gene locus_tag LOCUS_28370 2672 2340 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420359.1 protein_id gnl|my_center|LOCUS_28370 2937 3557 gene locus_tag LOCUS_28380 2937 3557 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454488.1 protein_id gnl|my_center|LOCUS_28380 >Feature sequence306 <1 1418 gene locus_tag LOCUS_28390 <1 1418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003435264.1:DNA mismatch repair protein MutS 1429 3396 gene locus_tag LOCUS_28400 gene mutL 1429 3396 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861409.1 protein_id gnl|my_center|LOCUS_28400 >Feature sequence307 431 1003 gene locus_tag LOCUS_28410 431 1003 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454936.1 protein_id gnl|my_center|LOCUS_28410 1438 1166 gene locus_tag LOCUS_28420 1438 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 2437 1565 gene locus_tag LOCUS_28430 2437 1565 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426922.1 protein_id gnl|my_center|LOCUS_28430 <4186 2733 gene locus_tag LOCUS_28440 <4186 2733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454939.1:isoleucine--tRNA ligase >Feature sequence308 440 1333 gene locus_tag LOCUS_28450 440 1333 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896496.1 protein_id gnl|my_center|LOCUS_28450 1333 2727 gene locus_tag LOCUS_28460 gene gltA 1333 2727 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420072.1 protein_id gnl|my_center|LOCUS_28460 >Feature sequence309 <1 696 gene locus_tag LOCUS_28470 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003433830.1:anaerobic sulfite reductase subunit AsrA 697 1488 gene locus_tag LOCUS_28480 gene asrB 697 1488 CDS product anaerobic sulfite reductase subunit AsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433831.1 protein_id gnl|my_center|LOCUS_28480 1501 2472 gene locus_tag LOCUS_28490 gene asrC 1501 2472 CDS product sulfite reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433832.1 protein_id gnl|my_center|LOCUS_28490 2529 3305 gene locus_tag LOCUS_28500 2529 3305 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433833.1 protein_id gnl|my_center|LOCUS_28500 >Feature sequence310 228 578 gene locus_tag LOCUS_28510 228 578 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431114.1 protein_id gnl|my_center|LOCUS_28510 597 2240 gene locus_tag LOCUS_28520 597 2240 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454872.1 protein_id gnl|my_center|LOCUS_28520 >Feature sequence311 1055 300 gene locus_tag LOCUS_28530 gene dapB 1055 300 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861884.1 protein_id gnl|my_center|LOCUS_28530 1495 2484 gene locus_tag LOCUS_28540 1495 2484 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903661.1 protein_id gnl|my_center|LOCUS_28540 3556 2840 gene locus_tag LOCUS_28550 gene dapD 3556 2840 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428057.1 protein_id gnl|my_center|LOCUS_28550 >Feature sequence312 686 1510 gene locus_tag LOCUS_28560 686 1510 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905410.1 protein_id gnl|my_center|LOCUS_28560 1550 2080 gene locus_tag LOCUS_28570 gene lepB 1550 2080 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861178.1 protein_id gnl|my_center|LOCUS_28570 3943 2162 gene locus_tag LOCUS_28580 3943 2162 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861177.1 protein_id gnl|my_center|LOCUS_28580 >Feature sequence313 1802 1044 gene locus_tag LOCUS_28590 1802 1044 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430913.1 protein_id gnl|my_center|LOCUS_28590 2768 1821 gene locus_tag LOCUS_28600 gene prmA 2768 1821 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861555.1 protein_id gnl|my_center|LOCUS_28600 <4109 3210 gene locus_tag LOCUS_28610 <4109 3210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861556.1:CRISPR-associated helicase/endonuclease Cas3 >Feature sequence314 1915 2757 gene locus_tag LOCUS_28620 1915 2757 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440056.1 protein_id gnl|my_center|LOCUS_28620 >Feature sequence315 556 1992 gene locus_tag LOCUS_28630 556 1992 CDS product YceG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861277.1 protein_id gnl|my_center|LOCUS_28630 3958 2084 gene locus_tag LOCUS_28640 gene asnB 3958 2084 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436426.1 protein_id gnl|my_center|LOCUS_28640 >Feature sequence316 77 298 gene locus_tag LOCUS_28650 77 298 CDS product spore coat associated protein CotJA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429541.1 protein_id gnl|my_center|LOCUS_28650 298 561 gene locus_tag LOCUS_28660 298 561 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438891.1 protein_id gnl|my_center|LOCUS_28660 623 1195 gene locus_tag LOCUS_28670 623 1195 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438889.1 protein_id gnl|my_center|LOCUS_28670 1351 1533 gene locus_tag LOCUS_28680 1351 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 2176 1826 gene locus_tag LOCUS_28690 2176 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 2493 3026 gene locus_tag LOCUS_28700 2493 3026 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_28700 3252 3440 gene locus_tag LOCUS_28710 3252 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 3638 3793 gene locus_tag LOCUS_28720 3638 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 >Feature sequence317 288 1784 gene locus_tag LOCUS_28730 288 1784 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861266.1 protein_id gnl|my_center|LOCUS_28730 1807 2757 gene locus_tag LOCUS_28740 1807 2757 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896747.1 protein_id gnl|my_center|LOCUS_28740 2778 3740 gene locus_tag LOCUS_28750 2778 3740 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436527.1 protein_id gnl|my_center|LOCUS_28750 >Feature sequence318 784 104 gene locus_tag LOCUS_28760 784 104 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860894.1 protein_id gnl|my_center|LOCUS_28760 1707 781 gene locus_tag LOCUS_28770 1707 781 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860893.1 protein_id gnl|my_center|LOCUS_28770 2697 1780 gene locus_tag LOCUS_28780 2697 1780 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895668.1 protein_id gnl|my_center|LOCUS_28780 3386 2697 gene locus_tag LOCUS_28790 3386 2697 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895666.1 protein_id gnl|my_center|LOCUS_28790 >Feature sequence319 235 396 gene locus_tag LOCUS_28800 235 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 573 785 gene locus_tag LOCUS_28810 573 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28810 1011 1763 gene locus_tag LOCUS_28820 1011 1763 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861855.1 protein_id gnl|my_center|LOCUS_28820 1753 2919 gene locus_tag LOCUS_28830 1753 2919 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861856.1 protein_id gnl|my_center|LOCUS_28830 >Feature sequence320 1552 371 gene locus_tag LOCUS_28840 1552 371 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432439.1 protein_id gnl|my_center|LOCUS_28840 2388 1549 gene locus_tag LOCUS_28850 gene cdaA 2388 1549 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420697.1 protein_id gnl|my_center|LOCUS_28850 3446 3371 gene locus_tag LOCUS_t00130 3446 3371 tRNA product tRNA-Pyl inference COORDINATES:profile:Aragorn:1.2.38 3529 3455 gene locus_tag LOCUS_t00140 3529 3455 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3616 3540 gene locus_tag LOCUS_t00150 3616 3540 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 3697 3622 gene locus_tag LOCUS_t00160 3697 3622 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3776 3703 gene locus_tag LOCUS_t00170 3776 3703 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3865 3791 gene locus_tag LOCUS_t00180 3865 3791 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence321 216 1040 gene locus_tag LOCUS_28860 216 1040 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896763.1 protein_id gnl|my_center|LOCUS_28860 1052 2251 gene locus_tag LOCUS_28870 1052 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896764.1 protein_id gnl|my_center|LOCUS_28870 2260 3072 gene locus_tag LOCUS_28880 2260 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896765.1 protein_id gnl|my_center|LOCUS_28880 >Feature sequence322 <1 1267 gene locus_tag LOCUS_28890 <1 1267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009898004.1:calcium-translocating P-type ATPase, PMCA-type 1517 1332 gene locus_tag LOCUS_28900 1517 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 1892 3070 gene locus_tag LOCUS_28910 1892 3070 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426667.1 protein_id gnl|my_center|LOCUS_28910 3400 3807 gene locus_tag LOCUS_28920 3400 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28920 >Feature sequence323 838 1290 gene locus_tag LOCUS_28930 838 1290 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897772.1 protein_id gnl|my_center|LOCUS_28930 1293 1601 gene locus_tag LOCUS_28940 1293 1601 CDS product fructose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454881.1 protein_id gnl|my_center|LOCUS_28940 1715 2821 gene locus_tag LOCUS_28950 1715 2821 CDS product PTS fructose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893660.1 protein_id gnl|my_center|LOCUS_28950 >Feature sequence324 1876 809 gene locus_tag LOCUS_28960 gene rsgA 1876 809 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861937.1 protein_id gnl|my_center|LOCUS_28960 2274 1873 gene locus_tag LOCUS_28970 2274 1873 CDS product RNHCP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436247.1 protein_id gnl|my_center|LOCUS_28970 3220 3396 gene locus_tag LOCUS_28980 3220 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416990.1 protein_id gnl|my_center|LOCUS_28980 >Feature sequence325 <1 352 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attaactatatggaatgtaaat 2384 1389 gene locus_tag LOCUS_28990 2384 1389 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431031.1 protein_id gnl|my_center|LOCUS_28990 <3810 2505 gene locus_tag LOCUS_29000 <3810 2505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454813.1:aspartate 4-decarboxylase >Feature sequence326 <1 652 gene locus_tag LOCUS_29010 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009897328.1:amino acid ABC transporter permease 888 1550 gene locus_tag LOCUS_29020 888 1550 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433934.1 protein_id gnl|my_center|LOCUS_29020 1610 2407 gene locus_tag LOCUS_29030 1610 2407 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433936.1 protein_id gnl|my_center|LOCUS_29030 2540 3715 gene locus_tag LOCUS_29040 2540 3715 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897326.1 protein_id gnl|my_center|LOCUS_29040 >Feature sequence327 1088 2446 gene locus_tag LOCUS_29050 1088 2446 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435100.1 protein_id gnl|my_center|LOCUS_29050 2553 3347 gene locus_tag LOCUS_29060 2553 3347 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902983.1 protein_id gnl|my_center|LOCUS_29060 >Feature sequence328 1477 491 gene locus_tag LOCUS_29070 1477 491 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453964.1 protein_id gnl|my_center|LOCUS_29070 2464 1502 gene locus_tag LOCUS_29080 2464 1502 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887810.1 protein_id gnl|my_center|LOCUS_29080 3455 2502 gene locus_tag LOCUS_29090 3455 2502 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453966.1 protein_id gnl|my_center|LOCUS_29090 >Feature sequence329 >Feature sequence330 744 1520 gene locus_tag LOCUS_29100 744 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 2192 2959 gene locus_tag LOCUS_29110 gene aroD 2192 2959 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897376.1 protein_id gnl|my_center|LOCUS_29110 >Feature sequence331 497 1933 gene locus_tag LOCUS_29120 497 1933 CDS product cell wall-binding protein Cwp28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897130.1 protein_id gnl|my_center|LOCUS_29120 2181 3617 gene locus_tag LOCUS_29130 gene miaB 2181 3617 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435252.1 protein_id gnl|my_center|LOCUS_29130 >Feature sequence332 <1 2694 gene locus_tag LOCUS_29140 <1 2694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003434104.1:PAS domain-containing sensor histidine kinase 2803 3411 gene locus_tag LOCUS_29150 2803 3411 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427435.1 protein_id gnl|my_center|LOCUS_29150 >Feature sequence333 135 3470 gene locus_tag LOCUS_29160 135 3470 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948403.1 protein_id gnl|my_center|LOCUS_29160 >Feature sequence334 328 798 gene locus_tag LOCUS_29170 328 798 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435609.1 protein_id gnl|my_center|LOCUS_29170 992 2278 gene locus_tag LOCUS_29180 gene tig 992 2278 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417090.1 protein_id gnl|my_center|LOCUS_29180 2428 3012 gene locus_tag LOCUS_29190 gene clpP 2428 3012 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_29190 >Feature sequence335 2464 2336 gene locus_tag LOCUS_29200 2464 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 3066 2506 gene locus_tag LOCUS_29210 3066 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 >Feature sequence336 <1 1258 gene locus_tag LOCUS_29220 <1 1258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861602.1:BglG family transcription antiterminator 2279 1518 gene locus_tag LOCUS_29230 2279 1518 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890775.1 protein_id gnl|my_center|LOCUS_29230 2498 2974 gene locus_tag LOCUS_29240 2498 2974 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903256.1 protein_id gnl|my_center|LOCUS_29240 3072 3224 gene locus_tag LOCUS_29250 3072 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 3572 3384 gene locus_tag LOCUS_29260 gene rpmB 3572 3384 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416297.1 protein_id gnl|my_center|LOCUS_29260 >Feature sequence337 84 206 gene locus_tag LOCUS_29270 84 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 203 1048 gene locus_tag LOCUS_29280 203 1048 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861875.1 protein_id gnl|my_center|LOCUS_29280 1048 2076 gene locus_tag LOCUS_29290 1048 2076 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434295.1 protein_id gnl|my_center|LOCUS_29290 2079 3092 gene locus_tag LOCUS_29300 2079 3092 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861874.1 protein_id gnl|my_center|LOCUS_29300 >Feature sequence338 2146 266 gene locus_tag LOCUS_29310 2146 266 CDS product cell wall-binding protein Cwp10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861689.1 protein_id gnl|my_center|LOCUS_29310 <3625 2356 gene locus_tag LOCUS_29320 <3625 2356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861690.1:M60 family metallopeptidase >Feature sequence339 1352 198 gene locus_tag LOCUS_29330 gene nagA 1352 198 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903776.1 protein_id gnl|my_center|LOCUS_29330 2160 1435 gene locus_tag LOCUS_29340 2160 1435 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437811.1 protein_id gnl|my_center|LOCUS_29340 2429 3358 gene locus_tag LOCUS_29350 gene pfkB 2429 3358 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861975.1 protein_id gnl|my_center|LOCUS_29350 >Feature sequence340 156 1196 gene locus_tag LOCUS_29360 156 1196 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433978.1 protein_id gnl|my_center|LOCUS_29360 1577 1828 gene locus_tag LOCUS_29370 1577 1828 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433976.1 protein_id gnl|my_center|LOCUS_29370 1843 3051 gene locus_tag LOCUS_29380 gene hydF 1843 3051 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433974.1 protein_id gnl|my_center|LOCUS_29380 >Feature sequence341 1120 281 gene locus_tag LOCUS_29390 1120 281 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439450.1 protein_id gnl|my_center|LOCUS_29390 1729 1133 gene locus_tag LOCUS_29400 1729 1133 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439452.1 protein_id gnl|my_center|LOCUS_29400 2430 1780 gene locus_tag LOCUS_29410 gene cmk 2430 1780 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439454.1 protein_id gnl|my_center|LOCUS_29410 3459 2476 gene locus_tag LOCUS_29420 3459 2476 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439456.1 protein_id gnl|my_center|LOCUS_29420 >Feature sequence342 206 1057 gene locus_tag LOCUS_29430 206 1057 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436717.1 protein_id gnl|my_center|LOCUS_29430 2803 1190 gene locus_tag LOCUS_29440 gene ggt 2803 1190 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436720.1 protein_id gnl|my_center|LOCUS_29440 <3530 3028 gene locus_tag LOCUS_29450 <3530 3028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861244.1:ABC transporter permease >Feature sequence343 294 73 gene locus_tag LOCUS_29460 294 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 770 363 gene locus_tag LOCUS_29470 gene ssb 770 363 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861748.1 protein_id gnl|my_center|LOCUS_29470 959 786 gene locus_tag LOCUS_29480 959 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 1899 1018 gene locus_tag LOCUS_29490 1899 1018 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861750.1 protein_id gnl|my_center|LOCUS_29490 2498 1914 gene locus_tag LOCUS_29500 2498 1914 CDS product ERF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861751.1 protein_id gnl|my_center|LOCUS_29500 2816 2508 gene locus_tag LOCUS_29510 2816 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29510 3344 3099 gene locus_tag LOCUS_29520 3344 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 >Feature sequence344 583 1872 gene locus_tag LOCUS_29530 583 1872 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893249.1 protein_id gnl|my_center|LOCUS_29530 1926 3005 gene locus_tag LOCUS_29540 1926 3005 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896855.1 protein_id gnl|my_center|LOCUS_29540 3026 3394 gene locus_tag LOCUS_29550 3026 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 >Feature sequence345 269 2209 gene locus_tag LOCUS_29560 gene infB 269 2209 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438306.1 protein_id gnl|my_center|LOCUS_29560 2252 2632 gene locus_tag LOCUS_29570 gene rbfA 2252 2632 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428234.1 protein_id gnl|my_center|LOCUS_29570 2625 3293 gene locus_tag LOCUS_29580 2625 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 >Feature sequence346 656 1873 gene locus_tag LOCUS_29590 656 1873 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429993.1 protein_id gnl|my_center|LOCUS_29590 1990 2472 gene locus_tag LOCUS_29600 gene cdeM 1990 2472 CDS product exosporium morphogenetic protein CdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436550.1 protein_id gnl|my_center|LOCUS_29600 >Feature sequence347 416 2077 gene locus_tag LOCUS_29610 416 2077 CDS product glycine rich domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021391917.1 protein_id gnl|my_center|LOCUS_29610 2091 2384 gene locus_tag LOCUS_29620 2091 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861044.1 protein_id gnl|my_center|LOCUS_29620 2384 2566 gene locus_tag LOCUS_29630 2384 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861045.1 protein_id gnl|my_center|LOCUS_29630 2599 2790 gene locus_tag LOCUS_29640 2599 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 2804 3436 gene locus_tag LOCUS_29650 2804 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 >Feature sequence348 3379 2210 gene locus_tag LOCUS_29660 3379 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902759.1 protein_id gnl|my_center|LOCUS_29660 >Feature sequence349 627 310 gene locus_tag LOCUS_29670 627 310 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898152.1 protein_id gnl|my_center|LOCUS_29670 875 2788 gene locus_tag LOCUS_29680 875 2788 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861809.1 protein_id gnl|my_center|LOCUS_29680 <3448 2911 gene locus_tag LOCUS_29690 <3448 2911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861810.1:glycerate kinase >Feature sequence350 172 1494 gene locus_tag LOCUS_29700 172 1494 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893260.1 protein_id gnl|my_center|LOCUS_29700 1773 3059 gene locus_tag LOCUS_29710 gene grdG 1773 3059 CDS product sarcosine reductase complex component B subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454406.1 protein_id gnl|my_center|LOCUS_29710 >Feature sequence351 <1 1230 gene locus_tag LOCUS_29720 <1 1230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_021414170.1:DUF5009 domain-containing protein >Feature sequence352 661 840 gene locus_tag LOCUS_29730 661 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861045.1 protein_id gnl|my_center|LOCUS_29730 881 1111 gene locus_tag LOCUS_29740 881 1111 CDS product hemolysin XhlA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861046.1 protein_id gnl|my_center|LOCUS_29740 1131 1388 gene locus_tag LOCUS_29750 1131 1388 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861047.1 protein_id gnl|my_center|LOCUS_29750 1649 2512 gene locus_tag LOCUS_29760 1649 2512 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946804.1 protein_id gnl|my_center|LOCUS_29760 2591 3403 gene locus_tag LOCUS_29770 2591 3403 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861048.1 protein_id gnl|my_center|LOCUS_29770 >Feature sequence353 1 642 gene locus_tag LOCUS_29780 1 642 CDS product lantibiotic immunity ABC transporter MutE/EpiE family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896246.1 protein_id gnl|my_center|LOCUS_29780 644 1402 gene locus_tag LOCUS_29790 644 1402 CDS product lantibiotic immunity ABC transporter MutG family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861184.1 protein_id gnl|my_center|LOCUS_29790 1537 2925 gene locus_tag LOCUS_29800 1537 2925 CDS product two-component system sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861185.1 protein_id gnl|my_center|LOCUS_29800 >Feature sequence354 1664 669 gene locus_tag LOCUS_29810 1664 669 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861011.1 protein_id gnl|my_center|LOCUS_29810 1885 1676 gene locus_tag LOCUS_29820 1885 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861010.1 protein_id gnl|my_center|LOCUS_29820 2592 1903 gene locus_tag LOCUS_29830 2592 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 2882 2706 gene locus_tag LOCUS_29840 2882 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 3138 2998 gene locus_tag LOCUS_29850 3138 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861003.1 protein_id gnl|my_center|LOCUS_29850 >Feature sequence355 1507 269 gene locus_tag LOCUS_29860 1507 269 CDS product conserved phage C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860882.1 protein_id gnl|my_center|LOCUS_29860 2233 1976 gene locus_tag LOCUS_29870 2233 1976 CDS product Mor transcription activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895643.1 protein_id gnl|my_center|LOCUS_29870 2388 2248 gene locus_tag LOCUS_29880 2388 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 2813 3034 gene locus_tag LOCUS_29890 2813 3034 CDS product DUF1659 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437342.1 protein_id gnl|my_center|LOCUS_29890 >Feature sequence356 813 1019 gene locus_tag LOCUS_29900 813 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 1600 1172 gene locus_tag LOCUS_29910 1600 1172 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902921.1 protein_id gnl|my_center|LOCUS_29910 3014 2076 gene locus_tag LOCUS_29920 3014 2076 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889978.1 protein_id gnl|my_center|LOCUS_29920 >Feature sequence357 915 394 gene locus_tag LOCUS_29930 915 394 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454764.1 protein_id gnl|my_center|LOCUS_29930 1514 1780 gene locus_tag LOCUS_29940 gene rpsT 1514 1780 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890686.1 protein_id gnl|my_center|LOCUS_29940 3010 1967 gene locus_tag LOCUS_29950 gene holA 3010 1967 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430958.1 protein_id gnl|my_center|LOCUS_29950 >Feature sequence358 259 948 gene locus_tag LOCUS_29960 gene nadD 259 948 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416411.1 protein_id gnl|my_center|LOCUS_29960 949 1521 gene locus_tag LOCUS_29970 gene yqeK 949 1521 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431048.1 protein_id gnl|my_center|LOCUS_29970 1638 1988 gene locus_tag LOCUS_29980 gene rsfS 1638 1988 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416416.1 protein_id gnl|my_center|LOCUS_29980 >Feature sequence359 109 420 gene locus_tag LOCUS_29990 109 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 1535 513 gene locus_tag LOCUS_30000 1535 513 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454684.1 protein_id gnl|my_center|LOCUS_30000 2046 1864 gene locus_tag LOCUS_30010 2046 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454683.1 protein_id gnl|my_center|LOCUS_30010 2359 2778 gene locus_tag LOCUS_30020 2359 2778 CDS product DUF3785 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454682.1 protein_id gnl|my_center|LOCUS_30020 >Feature sequence360 3237 2194 gene locus_tag LOCUS_30030 gene carA 3237 2194 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862004.1 protein_id gnl|my_center|LOCUS_30030 >Feature sequence361 417 761 gene locus_tag LOCUS_30040 417 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 836 1474 gene locus_tag LOCUS_30050 836 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 1507 1734 gene locus_tag LOCUS_30060 1507 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 1760 2320 gene locus_tag LOCUS_30070 1760 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424324.1 protein_id gnl|my_center|LOCUS_30070 2332 3000 gene locus_tag LOCUS_30080 2332 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 >Feature sequence362 2611 1823 gene locus_tag LOCUS_30090 2611 1823 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860631.1 protein_id gnl|my_center|LOCUS_30090 >Feature sequence363 49 426 gene locus_tag LOCUS_30100 49 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 769 1722 gene locus_tag LOCUS_30110 gene gpr 769 1722 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430954.1 protein_id gnl|my_center|LOCUS_30110 1740 2759 gene locus_tag LOCUS_30120 1740 2759 CDS product stage II sporulation protein P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897656.1 protein_id gnl|my_center|LOCUS_30120 2790 3041 gene locus_tag LOCUS_30130 2790 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861565.1 protein_id gnl|my_center|LOCUS_30130 >Feature sequence364 <1 1063 gene locus_tag LOCUS_30140 <1 1063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009898047.1:UxaA family hydrolase >Feature sequence365 <1 742 gene locus_tag LOCUS_30150 <1 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861834.1:beta-glucoside-specific PTS transporter subunit IIABC 803 2230 gene locus_tag LOCUS_30160 803 2230 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021359802.1 protein_id gnl|my_center|LOCUS_30160 >Feature sequence366 <1 1087 gene locus_tag LOCUS_30170 <1 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861825.1:iron-containing alcohol dehydrogenase 1100 1912 gene locus_tag LOCUS_30180 1100 1912 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861824.1 protein_id gnl|my_center|LOCUS_30180 2007 2429 gene locus_tag LOCUS_30190 2007 2429 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440003.1 protein_id gnl|my_center|LOCUS_30190 >Feature sequence367 213 872 gene locus_tag LOCUS_30200 gene cprR 213 872 CDS product two-component system response regulator CprR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437316.1 protein_id gnl|my_center|LOCUS_30200 1083 2141 gene locus_tag LOCUS_30210 1083 2141 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429718.1 protein_id gnl|my_center|LOCUS_30210 >Feature sequence368 3153 1906 gene locus_tag LOCUS_30220 3153 1906 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893258.1 protein_id gnl|my_center|LOCUS_30220 >Feature sequence369 229 936 gene locus_tag LOCUS_30230 229 936 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861674.1 protein_id gnl|my_center|LOCUS_30230 >Feature sequence370 60 761 gene locus_tag LOCUS_30240 60 761 CDS product DUF4253 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439543.1 protein_id gnl|my_center|LOCUS_30240 1047 1850 gene locus_tag LOCUS_30250 gene larE 1047 1850 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896918.1 protein_id gnl|my_center|LOCUS_30250 1905 3053 gene locus_tag LOCUS_30260 1905 3053 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423769.1 protein_id gnl|my_center|LOCUS_30260 >Feature sequence371 1213 245 gene locus_tag LOCUS_30270 gene spoIIIAA 1213 245 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438117.1 protein_id gnl|my_center|LOCUS_30270 <3299 1437 gene locus_tag LOCUS_30280 <3299 1437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003438115.1:fructose-1,6-bisphosphatase >Feature sequence372 1499 21 gene locus_tag LOCUS_30290 1499 21 CDS product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437727.1 protein_id gnl|my_center|LOCUS_30290 2270 1518 gene locus_tag LOCUS_30300 gene cobK 2270 1518 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437730.1 protein_id gnl|my_center|LOCUS_30300 2992 2267 gene locus_tag LOCUS_30310 gene cobJ 2992 2267 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903755.1 protein_id gnl|my_center|LOCUS_30310 >Feature sequence373 1023 565 gene locus_tag LOCUS_30320 1023 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 1882 1238 gene locus_tag LOCUS_30330 1882 1238 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012145.1 protein_id gnl|my_center|LOCUS_30330 2431 1886 gene locus_tag LOCUS_30340 2431 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 3017 2574 gene locus_tag LOCUS_30350 3017 2574 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963871.1 protein_id gnl|my_center|LOCUS_30350 >Feature sequence374 149 27 gene locus_tag LOCUS_30360 149 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 215 441 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttatattaactaagtggtatgtaaat 1936 833 gene locus_tag LOCUS_30370 1936 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30370 2565 2047 gene locus_tag LOCUS_30380 2565 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30380 >Feature sequence375 869 291 gene locus_tag LOCUS_30390 869 291 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424276.1 protein_id gnl|my_center|LOCUS_30390 1643 927 gene locus_tag LOCUS_30400 1643 927 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435147.1 protein_id gnl|my_center|LOCUS_30400 1834 2919 gene locus_tag LOCUS_30410 1834 2919 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861439.1 protein_id gnl|my_center|LOCUS_30410 >Feature sequence376 874 1260 gene locus_tag LOCUS_30420 874 1260 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417583.1 protein_id gnl|my_center|LOCUS_30420 1263 3062 gene locus_tag LOCUS_30430 1263 3062 CDS product BlaR1 family beta-lactam sensor/signal transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860827.1 protein_id gnl|my_center|LOCUS_30430 >Feature sequence377 266 1075 gene locus_tag LOCUS_30440 266 1075 CDS product DUF2232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861241.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30440 1605 1760 gene locus_tag LOCUS_30450 1605 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 1711 2919 gene locus_tag LOCUS_30460 gene tyrS 1711 2919 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889364.1 protein_id gnl|my_center|LOCUS_30460 >Feature sequence378 <1 989 gene locus_tag LOCUS_30470 <1 989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003439447.1:putative manganese transporter 1295 2992 gene locus_tag LOCUS_30480 gene ade 1295 2992 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439445.1 protein_id gnl|my_center|LOCUS_30480 >Feature sequence379 2638 251 gene locus_tag LOCUS_30490 2638 251 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860727.1 protein_id gnl|my_center|LOCUS_30490 3026 2661 gene locus_tag LOCUS_30500 3026 2661 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_30500 >Feature sequence380 102 962 gene locus_tag LOCUS_30510 102 962 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860817.1 protein_id gnl|my_center|LOCUS_30510 >Feature sequence381 560 360 gene locus_tag LOCUS_30520 560 360 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423148.1 protein_id gnl|my_center|LOCUS_30520 961 785 gene locus_tag LOCUS_30530 961 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890506.1 protein_id gnl|my_center|LOCUS_30530 1484 1284 gene locus_tag LOCUS_30540 1484 1284 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423163.1 protein_id gnl|my_center|LOCUS_30540 1836 1486 gene locus_tag LOCUS_30550 1836 1486 CDS product DUF3796 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861520.1 protein_id gnl|my_center|LOCUS_30550 1998 2231 gene locus_tag LOCUS_30560 1998 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 2445 2687 gene locus_tag LOCUS_30570 2445 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 >Feature sequence382 1423 383 gene locus_tag LOCUS_30580 1423 383 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416156.1 protein_id gnl|my_center|LOCUS_30580 1804 2439 gene locus_tag LOCUS_30590 1804 2439 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861616.1 protein_id gnl|my_center|LOCUS_30590 >Feature sequence383 <1 1060 gene locus_tag LOCUS_30600 <1 1060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003244294.1:L-rhamnose isomerase 1071 1886 gene locus_tag LOCUS_30610 gene rhaD 1071 1886 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179764.1 protein_id gnl|my_center|LOCUS_30610 >Feature sequence384 450 199 gene locus_tag LOCUS_30620 450 199 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861047.1 protein_id gnl|my_center|LOCUS_30620 1079 462 gene locus_tag LOCUS_30630 1079 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 1906 1091 gene locus_tag LOCUS_30640 1906 1091 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861048.1 protein_id gnl|my_center|LOCUS_30640 2796 2095 gene locus_tag LOCUS_30650 2796 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 3012 2830 gene locus_tag LOCUS_30660 3012 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861045.1 protein_id gnl|my_center|LOCUS_30660 >Feature sequence385 984 67 gene locus_tag LOCUS_30670 984 67 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861974.1 protein_id gnl|my_center|LOCUS_30670 1461 2624 gene locus_tag LOCUS_30680 1461 2624 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898687.1 protein_id gnl|my_center|LOCUS_30680 >Feature sequence386 170 583 gene locus_tag LOCUS_30690 170 583 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905693.1 protein_id gnl|my_center|LOCUS_30690 774 1991 gene locus_tag LOCUS_30700 774 1991 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861431.1 protein_id gnl|my_center|LOCUS_30700 2153 2851 gene locus_tag LOCUS_30710 2153 2851 CDS product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861432.1 protein_id gnl|my_center|LOCUS_30710 >Feature sequence387 1335 565 gene locus_tag LOCUS_30720 1335 565 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897796.1 protein_id gnl|my_center|LOCUS_30720 2542 1340 gene locus_tag LOCUS_30730 2542 1340 CDS product LytS/YhcK type 5TM receptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454923.1 protein_id gnl|my_center|LOCUS_30730 >Feature sequence388 1145 639 gene locus_tag LOCUS_30740 gene folK 1145 639 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438641.1 protein_id gnl|my_center|LOCUS_30740 1503 1138 gene locus_tag LOCUS_30750 gene folB 1503 1138 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861219.1 protein_id gnl|my_center|LOCUS_30750 2305 1514 gene locus_tag LOCUS_30760 gene folP 2305 1514 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438639.1 protein_id gnl|my_center|LOCUS_30760 2941 2369 gene locus_tag LOCUS_30770 gene folE 2941 2369 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429416.1 protein_id gnl|my_center|LOCUS_30770 >Feature sequence389 2195 1428 gene locus_tag LOCUS_30780 2195 1428 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436725.1 protein_id gnl|my_center|LOCUS_30780 >Feature sequence390 <2992 1134 gene locus_tag LOCUS_30790 <2992 1134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861444.1:molybdopterin-dependent oxidoreductase >Feature sequence391 35 328 gene locus_tag LOCUS_30800 35 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 355 951 gene locus_tag LOCUS_30810 355 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 1147 1362 gene locus_tag LOCUS_30820 1147 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 1591 1920 gene locus_tag LOCUS_30830 1591 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 >Feature sequence392 305 757 gene locus_tag LOCUS_30840 305 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861515.1 protein_id gnl|my_center|LOCUS_30840 809 970 gene locus_tag LOCUS_30850 809 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454578.1 protein_id gnl|my_center|LOCUS_30850 1762 1298 gene locus_tag LOCUS_30860 1762 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861514.1 protein_id gnl|my_center|LOCUS_30860 2215 1898 gene locus_tag LOCUS_30870 2215 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897465.1 protein_id gnl|my_center|LOCUS_30870 2794 2498 gene locus_tag LOCUS_30880 2794 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861513.1 protein_id gnl|my_center|LOCUS_30880 >Feature sequence393 157 1506 gene locus_tag LOCUS_30890 157 1506 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435635.1 protein_id gnl|my_center|LOCUS_30890 1662 2741 gene locus_tag LOCUS_30900 1662 2741 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435637.1 protein_id gnl|my_center|LOCUS_30900 >Feature sequence394 315 479 gene locus_tag LOCUS_30910 315 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424195.1 protein_id gnl|my_center|LOCUS_30910 1548 703 gene locus_tag LOCUS_30920 1548 703 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861415.1 protein_id gnl|my_center|LOCUS_30920 1801 1619 gene locus_tag LOCUS_30930 1801 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 2043 2195 gene locus_tag LOCUS_30940 2043 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 2619 2419 gene locus_tag LOCUS_30950 2619 2419 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431034.1 protein_id gnl|my_center|LOCUS_30950 >Feature sequence395 <1 1594 gene locus_tag LOCUS_30960 <1 1594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861812.1:PTS 2-O-a-mannosyl-D-glycerate transporter subunit IIABC >Feature sequence396 969 1382 gene locus_tag LOCUS_30970 969 1382 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438867.1 protein_id gnl|my_center|LOCUS_30970 1455 1991 gene locus_tag LOCUS_30980 1455 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 2151 2816 gene locus_tag LOCUS_30990 2151 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 >Feature sequence397 <1 610 gene locus_tag LOCUS_31000 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002485364.1:ABC transporter ATP-binding protein 611 1399 gene locus_tag LOCUS_31010 611 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 2133 1495 gene locus_tag LOCUS_31020 2133 1495 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861906.1 protein_id gnl|my_center|LOCUS_31020 2789 2160 gene locus_tag LOCUS_31030 2789 2160 CDS product DUF3786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437313.1 protein_id gnl|my_center|LOCUS_31030 >Feature sequence398 1538 252 gene locus_tag LOCUS_31040 1538 252 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861628.1 protein_id gnl|my_center|LOCUS_31040 2818 1553 gene locus_tag LOCUS_31050 2818 1553 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454972.1 protein_id gnl|my_center|LOCUS_31050 >Feature sequence399 799 1446 gene locus_tag LOCUS_31060 799 1446 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454801.1 protein_id gnl|my_center|LOCUS_31060 >Feature sequence400 682 476 gene locus_tag LOCUS_31070 682 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435950.1 protein_id gnl|my_center|LOCUS_31070 1480 1085 gene locus_tag LOCUS_31080 1480 1085 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860716.1 protein_id gnl|my_center|LOCUS_31080 1621 2013 gene locus_tag LOCUS_31090 1621 2013 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435954.1 protein_id gnl|my_center|LOCUS_31090 2529 2113 gene locus_tag LOCUS_31100 2529 2113 CDS product DUF3788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888119.1 protein_id gnl|my_center|LOCUS_31100 >Feature sequence401 2286 211 gene locus_tag LOCUS_31110 gene flhA 2286 211 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860707.1 protein_id gnl|my_center|LOCUS_31110 2606 2295 gene locus_tag LOCUS_31120 2606 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31120 >Feature sequence402 1104 928 gene locus_tag LOCUS_31130 1104 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 <2859 1276 gene locus_tag LOCUS_31140 <2859 1276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000039472.1:DNA polymerase >Feature sequence403 510 1061 gene locus_tag LOCUS_31150 510 1061 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454500.1 protein_id gnl|my_center|LOCUS_31150 1887 1600 gene locus_tag LOCUS_31160 1887 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 2296 >2852 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttacataccacttagttaatataaaac >Feature sequence404 963 265 gene locus_tag LOCUS_31170 963 265 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_31170 2701 1337 gene locus_tag LOCUS_31180 2701 1337 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426910.1 protein_id gnl|my_center|LOCUS_31180 >Feature sequence405 <1 1019 gene locus_tag LOCUS_31190 <1 1019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_021365081.1:endonuclease III 1213 1683 gene locus_tag LOCUS_31200 gene trmL 1213 1683 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_31200 1719 2567 gene locus_tag LOCUS_31210 1719 2567 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438997.1 protein_id gnl|my_center|LOCUS_31210 >Feature sequence406 554 405 gene locus_tag LOCUS_31220 554 405 CDS product CD1871A family CXXC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889347.1 protein_id gnl|my_center|LOCUS_31220 1131 547 gene locus_tag LOCUS_31230 1131 547 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439354.1 protein_id gnl|my_center|LOCUS_31230 >Feature sequence407 208 1077 gene locus_tag LOCUS_31240 208 1077 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860910.1 protein_id gnl|my_center|LOCUS_31240 1923 2588 gene locus_tag LOCUS_31250 1923 2588 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439170.1 protein_id gnl|my_center|LOCUS_31250 >Feature sequence408 1298 48 gene locus_tag LOCUS_31260 gene cme 1298 48 CDS product multidrug efflux MFS transporter Cme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434293.1 protein_id gnl|my_center|LOCUS_31260 2130 1384 gene locus_tag LOCUS_31270 2130 1384 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891631.1 protein_id gnl|my_center|LOCUS_31270 <2833 2245 gene locus_tag LOCUS_31280 <2833 2245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_021373739.1:serine hydrolase >Feature sequence409 <1 581 gene locus_tag LOCUS_31290 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860734.1:collagen-like exosporium glycoprotein BclA1 2414 816 gene locus_tag LOCUS_31300 2414 816 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434813.1 protein_id gnl|my_center|LOCUS_31300 >Feature sequence410 589 194 gene locus_tag LOCUS_31310 589 194 CDS product DUF6110 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438917.1 protein_id gnl|my_center|LOCUS_31310 1623 1811 gene locus_tag LOCUS_31320 1623 1811 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860871.1 protein_id gnl|my_center|LOCUS_31320 2436 1996 gene locus_tag LOCUS_31330 2436 1996 CDS product DUF3788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438911.1 protein_id gnl|my_center|LOCUS_31330 >Feature sequence411 2206 884 gene locus_tag LOCUS_31340 2206 884 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439084.1 protein_id gnl|my_center|LOCUS_31340 >Feature sequence412 <2775 1568 gene locus_tag LOCUS_31350 <2775 1568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003435429.1:histidine kinase N-terminal domain-containing protein >Feature sequence413 1807 596 gene locus_tag LOCUS_31360 gene spoIIIAE 1807 596 CDS product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438121.1 protein_id gnl|my_center|LOCUS_31360 2272 1886 gene locus_tag LOCUS_31370 gene spoIIIAD 2272 1886 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428424.1 protein_id gnl|my_center|LOCUS_31370 2485 2288 gene locus_tag LOCUS_31380 gene spoIIIAC 2485 2288 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888937.1 protein_id gnl|my_center|LOCUS_31380 >Feature sequence414 >Feature sequence415 1257 2000 gene locus_tag LOCUS_31390 1257 2000 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860717.1 protein_id gnl|my_center|LOCUS_31390 >Feature sequence416 908 54 gene locus_tag LOCUS_31400 908 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 1035 1214 gene locus_tag LOCUS_31410 1035 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 1665 1222 gene locus_tag LOCUS_31420 1665 1222 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861737.1 protein_id gnl|my_center|LOCUS_31420 1898 1683 gene locus_tag LOCUS_31430 1898 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 2170 1997 gene locus_tag LOCUS_31440 2170 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 2450 2268 gene locus_tag LOCUS_31450 2450 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 >Feature sequence417 785 21 gene locus_tag LOCUS_31460 785 21 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434038.1 protein_id gnl|my_center|LOCUS_31460 1059 1733 gene locus_tag LOCUS_31470 gene fsa 1059 1733 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430626.1 protein_id gnl|my_center|LOCUS_31470 <2693 1855 gene locus_tag LOCUS_31480 <2693 1855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009903012.1:SLC13 family permease >Feature sequence418 <1 764 gene locus_tag LOCUS_31490 <1 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009889591.1:bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II 869 1330 gene locus_tag LOCUS_31500 gene ribE 869 1330 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454467.1 protein_id gnl|my_center|LOCUS_31500 <2686 1550 gene locus_tag LOCUS_31510 <2686 1550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861309.1:alanine/glycine:cation symporter family protein >Feature sequence419 1894 1625 gene locus_tag LOCUS_31520 gene fliQ 1894 1625 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435976.1 protein_id gnl|my_center|LOCUS_31520 2572 1907 gene locus_tag LOCUS_31530 gene fliP 2572 1907 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435977.1 protein_id gnl|my_center|LOCUS_31530 >Feature sequence420 139 1209 gene locus_tag LOCUS_31540 139 1209 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861183.1 protein_id gnl|my_center|LOCUS_31540 1311 1847 gene locus_tag LOCUS_31550 1311 1847 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428196.1 protein_id gnl|my_center|LOCUS_31550 >Feature sequence421 <1 1001 gene locus_tag LOCUS_31560 <1 1001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004453998.1:oligoendopeptidase F 1253 2095 gene locus_tag LOCUS_31570 1253 2095 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_31570 >Feature sequence422 150 803 gene locus_tag LOCUS_31580 150 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 >Feature sequence423 767 1195 gene locus_tag LOCUS_31590 767 1195 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461015.1 protein_id gnl|my_center|LOCUS_31590 1282 2373 gene locus_tag LOCUS_31600 1282 2373 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963975.1 protein_id gnl|my_center|LOCUS_31600 >Feature sequence424 593 1297 gene locus_tag LOCUS_31610 593 1297 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890711.1 protein_id gnl|my_center|LOCUS_31610 1485 2435 gene locus_tag LOCUS_31620 gene selD 1485 2435 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077699367.1 protein_id gnl|my_center|LOCUS_31620 >Feature sequence425 1841 783 gene locus_tag LOCUS_31630 gene buk 1841 783 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890632.1 protein_id gnl|my_center|LOCUS_31630 2537 1998 gene locus_tag LOCUS_31640 2537 1998 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430880.1 protein_id gnl|my_center|LOCUS_31640 >Feature sequence426 291 809 gene locus_tag LOCUS_31650 291 809 CDS product GrdB-related putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860643.1 protein_id gnl|my_center|LOCUS_31650 905 1864 gene locus_tag LOCUS_31660 905 1864 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895213.1 protein_id gnl|my_center|LOCUS_31660 1913 2506 gene locus_tag LOCUS_31670 1913 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31670 >Feature sequence427 267 61 gene locus_tag LOCUS_31680 267 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 1303 281 gene locus_tag LOCUS_31690 1303 281 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861295.1 protein_id gnl|my_center|LOCUS_31690 1878 2054 gene locus_tag LOCUS_31700 1878 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889562.1 protein_id gnl|my_center|LOCUS_31700 2210 2091 gene locus_tag LOCUS_31710 2210 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 >Feature sequence428 201 710 gene locus_tag LOCUS_31720 201 710 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432371.1 protein_id gnl|my_center|LOCUS_31720 788 949 gene locus_tag LOCUS_31730 788 949 CDS product aspartyl-phosphate phosphatase Spo0E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891746.1 protein_id gnl|my_center|LOCUS_31730 1100 1765 gene locus_tag LOCUS_31740 1100 1765 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453991.1 protein_id gnl|my_center|LOCUS_31740 >Feature sequence429 648 91 gene locus_tag LOCUS_31750 648 91 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889920.1 protein_id gnl|my_center|LOCUS_31750 1725 838 gene locus_tag LOCUS_31760 1725 838 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435316.1 protein_id gnl|my_center|LOCUS_31760 >Feature sequence430 1856 996 gene locus_tag LOCUS_31770 gene argB 1856 996 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435171.1 protein_id gnl|my_center|LOCUS_31770 2548 1871 gene locus_tag LOCUS_31780 2548 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 >Feature sequence431 44 769 gene locus_tag LOCUS_31790 44 769 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454491.1 protein_id gnl|my_center|LOCUS_31790 773 2176 gene locus_tag LOCUS_31800 773 2176 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861297.1 protein_id gnl|my_center|LOCUS_31800 >Feature sequence432 349 1233 gene locus_tag LOCUS_31810 349 1233 CDS product DUF4300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860938.1 protein_id gnl|my_center|LOCUS_31810 2325 1546 gene locus_tag LOCUS_31820 gene hisJ 2325 1546 CDS product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895786.1 protein_id gnl|my_center|LOCUS_31820 >Feature sequence433 1310 1128 gene locus_tag LOCUS_31830 1310 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 1543 2403 gene locus_tag LOCUS_31840 1543 2403 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435320.1 protein_id gnl|my_center|LOCUS_31840 >Feature sequence434 474 283 gene locus_tag LOCUS_31850 474 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31850 953 579 gene locus_tag LOCUS_31860 953 579 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861518.1 protein_id gnl|my_center|LOCUS_31860 1757 2245 gene locus_tag LOCUS_31870 1757 2245 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861519.1 protein_id gnl|my_center|LOCUS_31870 >Feature sequence435 <1 1009 gene locus_tag LOCUS_31880 <1 1009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009888868.1:acetyl-CoA C-acetyltransferase 1204 2106 gene locus_tag LOCUS_31890 1204 2106 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861083.1 protein_id gnl|my_center|LOCUS_31890 >Feature sequence436 114 959 gene locus_tag LOCUS_31900 114 959 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454385.1 protein_id gnl|my_center|LOCUS_31900 956 1639 gene locus_tag LOCUS_31910 956 1639 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454384.1 protein_id gnl|my_center|LOCUS_31910 >Feature sequence437 511 137 gene locus_tag LOCUS_31920 511 137 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424232.1 protein_id gnl|my_center|LOCUS_31920 878 1282 gene locus_tag LOCUS_31930 878 1282 CDS product replication/maintenance protein RepL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861430.1 protein_id gnl|my_center|LOCUS_31930 1299 1895 gene locus_tag LOCUS_31940 1299 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435191.1 protein_id gnl|my_center|LOCUS_31940 >Feature sequence438 1664 372 gene locus_tag LOCUS_31950 gene brnQ 1664 372 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902388.1 protein_id gnl|my_center|LOCUS_31950 >Feature sequence439 962 378 gene locus_tag LOCUS_31960 962 378 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861294.1 protein_id gnl|my_center|LOCUS_31960 <1977 1284 gene locus_tag LOCUS_31970 <1977 1284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861293.1:glycerophosphodiester phosphodiesterase >Feature sequence440 <1926 1199 gene locus_tag LOCUS_31980 <1926 1199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009890217.1:diaminopropionate ammonia-lyase