>Feature sequence001 40 543 gene locus_tag LOCUS_00010 40 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 540 1040 gene locus_tag LOCUS_00020 540 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1190 1810 gene locus_tag LOCUS_00030 1190 1810 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902061.1 protein_id gnl|my_center|LOCUS_00030 1807 2601 gene locus_tag LOCUS_00040 1807 2601 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902062.1 protein_id gnl|my_center|LOCUS_00040 2645 3652 gene locus_tag LOCUS_00050 2645 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674024.1 protein_id gnl|my_center|LOCUS_00050 3649 4476 gene locus_tag LOCUS_00060 3649 4476 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021650009.1 protein_id gnl|my_center|LOCUS_00060 4628 5197 gene locus_tag LOCUS_00070 4628 5197 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261028.1 protein_id gnl|my_center|LOCUS_00070 5184 5924 gene locus_tag LOCUS_00080 5184 5924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 6380 7327 gene locus_tag LOCUS_00090 6380 7327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 7388 8782 gene locus_tag LOCUS_00100 7388 8782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 9361 10308 gene locus_tag LOCUS_00110 9361 10308 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108799.1 protein_id gnl|my_center|LOCUS_00110 10309 11745 gene locus_tag LOCUS_00120 10309 11745 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202144.1 protein_id gnl|my_center|LOCUS_00120 12148 13266 gene locus_tag LOCUS_00130 gene vioA 12148 13266 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose aminotransferase VioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998544.1 protein_id gnl|my_center|LOCUS_00130 13272 14549 gene locus_tag LOCUS_00140 13272 14549 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202935.1 protein_id gnl|my_center|LOCUS_00140 14552 15799 gene locus_tag LOCUS_00150 14552 15799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 15905 16162 gene locus_tag LOCUS_00160 15905 16162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 16293 16685 gene locus_tag LOCUS_00170 16293 16685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00170 16887 22046 gene locus_tag LOCUS_00180 16887 22046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 22051 23106 gene locus_tag LOCUS_00190 22051 23106 CDS product AbiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207803.1 protein_id gnl|my_center|LOCUS_00190 25035 23593 gene locus_tag LOCUS_00200 25035 23593 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435380.1 protein_id gnl|my_center|LOCUS_00200 25293 25784 gene locus_tag LOCUS_00210 25293 25784 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262000.1 protein_id gnl|my_center|LOCUS_00210 26319 25795 gene locus_tag LOCUS_00220 26319 25795 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948594.1 protein_id gnl|my_center|LOCUS_00220 26442 26855 gene locus_tag LOCUS_00230 26442 26855 CDS product heme-degrading domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155435762.1 protein_id gnl|my_center|LOCUS_00230 26906 27937 gene locus_tag LOCUS_00240 26906 27937 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930537.1 protein_id gnl|my_center|LOCUS_00240 28562 28176 gene locus_tag LOCUS_00250 28562 28176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 29136 28576 gene locus_tag LOCUS_00260 29136 28576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 29566 29126 gene locus_tag LOCUS_00270 29566 29126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 31729 30449 gene locus_tag LOCUS_00280 31729 30449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 31927 33195 gene locus_tag LOCUS_00290 31927 33195 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_00290 33199 33846 gene locus_tag LOCUS_00300 33199 33846 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016982.1 protein_id gnl|my_center|LOCUS_00300 34503 33910 gene locus_tag LOCUS_00310 34503 33910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 34639 35895 gene locus_tag LOCUS_00320 34639 35895 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102011.1 protein_id gnl|my_center|LOCUS_00320 35885 36196 gene locus_tag LOCUS_00330 35885 36196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 36897 36208 gene locus_tag LOCUS_00340 36897 36208 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355232.1 protein_id gnl|my_center|LOCUS_00340 37568 36894 gene locus_tag LOCUS_00350 37568 36894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 38392 37571 gene locus_tag LOCUS_00360 38392 37571 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432375.1 protein_id gnl|my_center|LOCUS_00360 39134 38394 gene locus_tag LOCUS_00370 39134 38394 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453987.1 protein_id gnl|my_center|LOCUS_00370 39657 39136 gene locus_tag LOCUS_00380 39657 39136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 40054 39644 gene locus_tag LOCUS_00390 40054 39644 CDS product PTS N-acetylglucosamine transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074477.1 protein_id gnl|my_center|LOCUS_00390 40266 41372 gene locus_tag LOCUS_00400 40266 41372 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721658.1 protein_id gnl|my_center|LOCUS_00400 41425 42171 gene locus_tag LOCUS_00410 41425 42171 CDS product GntR family transcriptional regulator, LSA1692 subfamily inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675001.1 protein_id gnl|my_center|LOCUS_00410 43096 42251 gene locus_tag LOCUS_00420 43096 42251 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434794.1 protein_id gnl|my_center|LOCUS_00420 43194 43772 gene locus_tag LOCUS_00430 43194 43772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 43838 44536 gene locus_tag LOCUS_00440 43838 44536 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816590.1 protein_id gnl|my_center|LOCUS_00440 44530 45237 gene locus_tag LOCUS_00450 44530 45237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922087.1 protein_id gnl|my_center|LOCUS_00450 45239 45595 gene locus_tag LOCUS_00460 45239 45595 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119149.1 protein_id gnl|my_center|LOCUS_00460 45732 46184 gene locus_tag LOCUS_00470 gene spxA 45732 46184 CDS product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703607.1 protein_id gnl|my_center|LOCUS_00470 46767 46204 gene locus_tag LOCUS_00480 46767 46204 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922294.1 protein_id gnl|my_center|LOCUS_00480 46821 47603 gene locus_tag LOCUS_00490 46821 47603 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673194.1 protein_id gnl|my_center|LOCUS_00490 47594 48409 gene locus_tag LOCUS_00500 47594 48409 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079106.1 protein_id gnl|my_center|LOCUS_00500 >Feature sequence002 1475 216 gene locus_tag LOCUS_00510 gene ftsA 1475 216 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731981.1 protein_id gnl|my_center|LOCUS_00510 2327 1563 gene locus_tag LOCUS_00520 2327 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 3245 2331 gene locus_tag LOCUS_00530 gene murB 3245 2331 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437038.1 protein_id gnl|my_center|LOCUS_00530 4331 3255 gene locus_tag LOCUS_00540 gene murG 4331 3255 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476139.1 protein_id gnl|my_center|LOCUS_00540 6074 4509 gene locus_tag LOCUS_00550 6074 4509 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_00550 6208 6071 gene locus_tag LOCUS_00560 6208 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 7493 6330 gene locus_tag LOCUS_00570 7493 6330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 8907 7513 gene locus_tag LOCUS_00580 8907 7513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 10282 8912 gene locus_tag LOCUS_00590 10282 8912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 11102 10293 gene locus_tag LOCUS_00600 11102 10293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 11833 11099 gene locus_tag LOCUS_00610 gene cps4B 11833 11099 CDS product capsular polysaccharide biosynthesis protein Cps4B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922734.1 protein_id gnl|my_center|LOCUS_00610 13600 11846 gene locus_tag LOCUS_00620 13600 11846 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582944.1 protein_id gnl|my_center|LOCUS_00620 14052 13588 gene locus_tag LOCUS_00630 14052 13588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 15163 14042 gene locus_tag LOCUS_00640 gene nirJ2 15163 14042 CDS product putative heme d1 biosynthesis radical SAM protein NirJ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966080.1 protein_id gnl|my_center|LOCUS_00640 15635 15213 gene locus_tag LOCUS_00650 15635 15213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 15970 15632 gene locus_tag LOCUS_00660 15970 15632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 16894 16043 gene locus_tag LOCUS_00670 16894 16043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 18064 16904 gene locus_tag LOCUS_00680 18064 16904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 18855 18067 gene locus_tag LOCUS_00690 18855 18067 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_00690 20455 18905 gene locus_tag LOCUS_00700 20455 18905 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292875.1 protein_id gnl|my_center|LOCUS_00700 21612 20434 gene locus_tag LOCUS_00710 21612 20434 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039964.1 protein_id gnl|my_center|LOCUS_00710 22114 21602 gene locus_tag LOCUS_00720 22114 21602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 23280 22117 gene locus_tag LOCUS_00730 23280 22117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 24461 23268 gene locus_tag LOCUS_00740 24461 23268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 25480 24458 gene locus_tag LOCUS_00750 25480 24458 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107732.1 protein_id gnl|my_center|LOCUS_00750 26555 25461 gene locus_tag LOCUS_00760 26555 25461 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_00760 27756 26560 gene locus_tag LOCUS_00770 27756 26560 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107241.1 protein_id gnl|my_center|LOCUS_00770 28041 27850 gene locus_tag LOCUS_00780 28041 27850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 28392 28099 gene locus_tag LOCUS_00790 28392 28099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 28884 28654 gene locus_tag LOCUS_00800 28884 28654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00800 29767 28877 gene locus_tag LOCUS_00810 29767 28877 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454111.1 protein_id gnl|my_center|LOCUS_00810 30860 29757 gene locus_tag LOCUS_00820 30860 29757 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224434606.1 protein_id gnl|my_center|LOCUS_00820 32014 30884 gene locus_tag LOCUS_00830 32014 30884 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242735.1 protein_id gnl|my_center|LOCUS_00830 33149 32046 gene locus_tag LOCUS_00840 gene epsG 33149 32046 CDS product biofilm exopolysaccharide biosynthesis protein EpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228259.1 protein_id gnl|my_center|LOCUS_00840 34123 33146 gene locus_tag LOCUS_00850 34123 33146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 35034 34120 gene locus_tag LOCUS_00860 35034 34120 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048420.1 protein_id gnl|my_center|LOCUS_00860 35839 35021 gene locus_tag LOCUS_00870 35839 35021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 36465 35851 gene locus_tag LOCUS_00880 36465 35851 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202264.1 protein_id gnl|my_center|LOCUS_00880 37003 36491 gene locus_tag LOCUS_00890 37003 36491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 39352 37793 gene locus_tag LOCUS_00900 39352 37793 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202160.1 protein_id gnl|my_center|LOCUS_00900 40507 39515 gene locus_tag LOCUS_00910 gene spoVE 40507 39515 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753520.1 protein_id gnl|my_center|LOCUS_00910 41966 40626 gene locus_tag LOCUS_00920 gene murD 41966 40626 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860120.1 protein_id gnl|my_center|LOCUS_00920 42945 41968 gene locus_tag LOCUS_00930 gene mraY 42945 41968 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_00930 43314 43045 gene locus_tag LOCUS_00940 43314 43045 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546482.1 protein_id gnl|my_center|LOCUS_00940 >Feature sequence003 166 879 gene locus_tag LOCUS_00950 166 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 886 1785 gene locus_tag LOCUS_00960 886 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 1799 3580 gene locus_tag LOCUS_00970 1799 3580 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_00970 3660 3986 gene locus_tag LOCUS_00980 3660 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 4015 4845 gene locus_tag LOCUS_00990 4015 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 4917 5180 gene locus_tag LOCUS_01000 4917 5180 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681231.1 protein_id gnl|my_center|LOCUS_01000 5170 5481 gene locus_tag LOCUS_01010 5170 5481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 5572 6015 gene locus_tag LOCUS_01020 5572 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 5930 8281 gene locus_tag LOCUS_01030 5930 8281 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_01030 8269 9015 gene locus_tag LOCUS_01040 8269 9015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 9357 9028 gene locus_tag LOCUS_01050 9357 9028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 9700 9350 gene locus_tag LOCUS_01060 9700 9350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 9780 11381 gene locus_tag LOCUS_01070 9780 11381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 11389 11754 gene locus_tag LOCUS_01080 11389 11754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 12370 11777 gene locus_tag LOCUS_01090 12370 11777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 12539 13798 gene locus_tag LOCUS_01100 12539 13798 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272568.1 protein_id gnl|my_center|LOCUS_01100 13791 14105 gene locus_tag LOCUS_01110 13791 14105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 14123 14719 gene locus_tag LOCUS_01120 14123 14719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 15010 15954 gene locus_tag LOCUS_01130 15010 15954 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109323.1 protein_id gnl|my_center|LOCUS_01130 16013 16516 gene locus_tag LOCUS_01140 16013 16516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 16537 17034 gene locus_tag LOCUS_01150 16537 17034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 17252 17824 gene locus_tag LOCUS_01160 17252 17824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 17837 18457 gene locus_tag LOCUS_01170 17837 18457 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902061.1 protein_id gnl|my_center|LOCUS_01170 18454 19236 gene locus_tag LOCUS_01180 18454 19236 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902062.1 protein_id gnl|my_center|LOCUS_01180 19226 20320 gene locus_tag LOCUS_01190 19226 20320 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392196.1 protein_id gnl|my_center|LOCUS_01190 20334 21428 gene locus_tag LOCUS_01200 20334 21428 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476426.1 protein_id gnl|my_center|LOCUS_01200 21433 22581 gene locus_tag LOCUS_01210 21433 22581 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_01210 22568 23995 gene locus_tag LOCUS_01220 22568 23995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 23995 25041 gene locus_tag LOCUS_01230 23995 25041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 25206 25685 gene locus_tag LOCUS_01240 25206 25685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 26037 27152 gene locus_tag LOCUS_01250 26037 27152 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690973.1 protein_id gnl|my_center|LOCUS_01250 27121 28284 gene locus_tag LOCUS_01260 27121 28284 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068376.1 protein_id gnl|my_center|LOCUS_01260 28310 30034 gene locus_tag LOCUS_01270 28310 30034 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068374.1 protein_id gnl|my_center|LOCUS_01270 30038 30892 gene locus_tag LOCUS_01280 30038 30892 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003838868.1 protein_id gnl|my_center|LOCUS_01280 30907 32304 gene locus_tag LOCUS_01290 30907 32304 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091276.1 protein_id gnl|my_center|LOCUS_01290 32877 33032 gene locus_tag LOCUS_01300 32877 33032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 33282 34094 gene locus_tag LOCUS_01310 33282 34094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 34445 34894 gene locus_tag LOCUS_01320 34445 34894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 34960 35280 gene locus_tag LOCUS_01330 34960 35280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 35356 35796 gene locus_tag LOCUS_01340 35356 35796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 36266 36640 gene locus_tag LOCUS_01350 36266 36640 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_01350 36785 37303 gene locus_tag LOCUS_01360 36785 37303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 37316 38386 gene locus_tag LOCUS_01370 37316 38386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 39443 38901 gene locus_tag LOCUS_01380 39443 38901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 >Feature sequence004 306 1250 gene locus_tag LOCUS_01390 306 1250 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427733.1 protein_id gnl|my_center|LOCUS_01390 1283 1645 gene locus_tag LOCUS_01400 gene rplQ 1283 1645 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331490.1 protein_id gnl|my_center|LOCUS_01400 1736 2566 gene locus_tag LOCUS_01410 1736 2566 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549050.1 protein_id gnl|my_center|LOCUS_01410 2542 3393 gene locus_tag LOCUS_01420 2542 3393 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406513.1 protein_id gnl|my_center|LOCUS_01420 3386 4186 gene locus_tag LOCUS_01430 3386 4186 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186526.1 protein_id gnl|my_center|LOCUS_01430 4186 4923 gene locus_tag LOCUS_01440 gene truA 4186 4923 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477893.1 protein_id gnl|my_center|LOCUS_01440 4910 5788 gene locus_tag LOCUS_01450 4910 5788 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764454.1 protein_id gnl|my_center|LOCUS_01450 5971 7173 gene locus_tag LOCUS_01460 5971 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 7166 8071 gene locus_tag LOCUS_01470 7166 8071 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785146.1 protein_id gnl|my_center|LOCUS_01470 8090 9538 gene locus_tag LOCUS_01480 8090 9538 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989392.1 protein_id gnl|my_center|LOCUS_01480 10333 9620 gene locus_tag LOCUS_01490 10333 9620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 10296 10499 gene locus_tag LOCUS_01500 10296 10499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 11511 10819 gene locus_tag LOCUS_01510 gene rgbR 11511 10819 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_01510 11675 12454 gene locus_tag LOCUS_01520 11675 12454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 12444 12965 gene locus_tag LOCUS_01530 12444 12965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 12962 13564 gene locus_tag LOCUS_01540 12962 13564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 13539 14018 gene locus_tag LOCUS_01550 13539 14018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 15475 14063 gene locus_tag LOCUS_01560 15475 14063 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890696.1 protein_id gnl|my_center|LOCUS_01560 15695 15979 gene locus_tag LOCUS_01570 15695 15979 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461958.1 protein_id gnl|my_center|LOCUS_01570 16058 17056 gene locus_tag LOCUS_01580 16058 17056 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462034.1 protein_id gnl|my_center|LOCUS_01580 17071 17328 gene locus_tag LOCUS_01590 17071 17328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 17341 17658 gene locus_tag LOCUS_01600 17341 17658 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272757.1 protein_id gnl|my_center|LOCUS_01600 17659 18075 gene locus_tag LOCUS_01610 17659 18075 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476020.1 protein_id gnl|my_center|LOCUS_01610 19520 18102 gene locus_tag LOCUS_01620 19520 18102 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890696.1 protein_id gnl|my_center|LOCUS_01620 19741 19944 gene locus_tag LOCUS_01630 19741 19944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 19958 20176 gene locus_tag LOCUS_01640 19958 20176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 22037 20184 gene locus_tag LOCUS_01650 22037 20184 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048250.1 protein_id gnl|my_center|LOCUS_01650 22486 22079 gene locus_tag LOCUS_01660 22486 22079 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_01660 22724 24649 gene locus_tag LOCUS_01670 22724 24649 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948184.1 protein_id gnl|my_center|LOCUS_01670 24649 25644 gene locus_tag LOCUS_01680 24649 25644 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127350626.1 protein_id gnl|my_center|LOCUS_01680 25648 26346 gene locus_tag LOCUS_01690 25648 26346 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_01690 26438 27025 gene locus_tag LOCUS_01700 26438 27025 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058223026.1 protein_id gnl|my_center|LOCUS_01700 27855 27043 gene locus_tag LOCUS_01710 27855 27043 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078448.1 protein_id gnl|my_center|LOCUS_01710 28000 29226 gene locus_tag LOCUS_01720 28000 29226 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262741.1 protein_id gnl|my_center|LOCUS_01720 31113 29236 gene locus_tag LOCUS_01730 31113 29236 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372958.1 protein_id gnl|my_center|LOCUS_01730 31198 31569 gene locus_tag LOCUS_01740 31198 31569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 31572 33092 gene locus_tag LOCUS_01750 gene cls 31572 33092 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461555.1 protein_id gnl|my_center|LOCUS_01750 33192 34853 gene locus_tag LOCUS_01760 gene argS 33192 34853 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227570.1 protein_id gnl|my_center|LOCUS_01760 34866 35213 gene locus_tag LOCUS_01770 34866 35213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 35764 35423 gene locus_tag LOCUS_01780 35764 35423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 >Feature sequence005 1538 1747 gene locus_tag LOCUS_01790 1538 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 1787 2065 gene locus_tag LOCUS_01800 1787 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 2071 2235 gene locus_tag LOCUS_01810 2071 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 2889 2269 gene locus_tag LOCUS_01820 2889 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 3472 2882 gene locus_tag LOCUS_01830 3472 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 3645 4322 gene locus_tag LOCUS_01840 3645 4322 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434299.1 protein_id gnl|my_center|LOCUS_01840 4312 6018 gene locus_tag LOCUS_01850 4312 6018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 6094 7563 gene locus_tag LOCUS_01860 6094 7563 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964714.1 protein_id gnl|my_center|LOCUS_01860 7697 8572 gene locus_tag LOCUS_01870 7697 8572 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764890.1 protein_id gnl|my_center|LOCUS_01870 8644 9531 gene locus_tag LOCUS_01880 8644 9531 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_01880 9855 11717 gene locus_tag LOCUS_01890 gene glgB 9855 11717 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398803.1 protein_id gnl|my_center|LOCUS_01890 11746 14142 gene locus_tag LOCUS_01900 11746 14142 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964971.1 protein_id gnl|my_center|LOCUS_01900 14238 15017 gene locus_tag LOCUS_01910 14238 15017 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167184.1 protein_id gnl|my_center|LOCUS_01910 15204 17297 gene locus_tag LOCUS_01920 gene pulA 15204 17297 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921725.1 protein_id gnl|my_center|LOCUS_01920 17311 17865 gene locus_tag LOCUS_01930 gene pth 17311 17865 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254063.1 protein_id gnl|my_center|LOCUS_01930 17874 20069 gene locus_tag LOCUS_01940 17874 20069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01940 20172 21305 gene locus_tag LOCUS_01950 20172 21305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01950 21399 21956 gene locus_tag LOCUS_01960 21399 21956 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020421.1 protein_id gnl|my_center|LOCUS_01960 22021 22632 gene locus_tag LOCUS_01970 22021 22632 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966689.1 protein_id gnl|my_center|LOCUS_01970 22632 22985 gene locus_tag LOCUS_01980 22632 22985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 23457 22999 gene locus_tag LOCUS_01990 23457 22999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 24105 23512 gene locus_tag LOCUS_02000 24105 23512 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227979.1 protein_id gnl|my_center|LOCUS_02000 24200 25081 gene locus_tag LOCUS_02010 24200 25081 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762183.1 protein_id gnl|my_center|LOCUS_02010 25069 25299 gene locus_tag LOCUS_02020 25069 25299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02020 25287 25514 gene locus_tag LOCUS_02030 25287 25514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02030 27091 25538 gene locus_tag LOCUS_02040 27091 25538 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033562369.1 protein_id gnl|my_center|LOCUS_02040 27198 27653 gene locus_tag LOCUS_02050 27198 27653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 28357 27695 gene locus_tag LOCUS_02060 28357 27695 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722644.1 protein_id gnl|my_center|LOCUS_02060 29427 28324 gene locus_tag LOCUS_02070 29427 28324 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922534.1 protein_id gnl|my_center|LOCUS_02070 29697 29894 gene locus_tag LOCUS_02080 gene cspC 29697 29894 CDS product cold shock protein CspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001990088.1 protein_id gnl|my_center|LOCUS_02080 30085 32718 gene locus_tag LOCUS_02090 gene secA 30085 32718 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228033.1 protein_id gnl|my_center|LOCUS_02090 32718 33815 gene locus_tag LOCUS_02100 gene prfB 32718 33815 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096001716.1 protein_id gnl|my_center|LOCUS_02100 33826 34683 gene locus_tag LOCUS_02110 33826 34683 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435320.1 protein_id gnl|my_center|LOCUS_02110 35129 34926 gene locus_tag LOCUS_02120 35129 34926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 >Feature sequence006 <1 818 gene locus_tag LOCUS_02130 <1 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965428.1:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase 818 1099 gene locus_tag LOCUS_02140 818 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 1314 3914 gene locus_tag LOCUS_02150 1314 3914 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546265.1 protein_id gnl|my_center|LOCUS_02150 4095 4649 gene locus_tag LOCUS_02160 4095 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 4898 5545 gene locus_tag LOCUS_02170 4898 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 5754 5578 gene locus_tag LOCUS_02180 5754 5578 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877678.1 protein_id gnl|my_center|LOCUS_02180 6075 5896 gene locus_tag LOCUS_02190 6075 5896 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080635.1 protein_id gnl|my_center|LOCUS_02190 6451 6272 gene locus_tag LOCUS_02200 6451 6272 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080635.1 protein_id gnl|my_center|LOCUS_02200 6561 7421 gene locus_tag LOCUS_02210 6561 7421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 7470 8138 gene locus_tag LOCUS_02220 gene cmk 7470 8138 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361264.1 protein_id gnl|my_center|LOCUS_02220 8140 9444 gene locus_tag LOCUS_02230 gene der 8140 9444 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165530.1 protein_id gnl|my_center|LOCUS_02230 9457 10461 gene locus_tag LOCUS_02240 9457 10461 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899188.1 protein_id gnl|my_center|LOCUS_02240 10501 10743 gene locus_tag LOCUS_02250 10501 10743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 10845 11354 gene locus_tag LOCUS_02260 10845 11354 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232214.1 protein_id gnl|my_center|LOCUS_02260 11368 11535 gene locus_tag LOCUS_02270 gene rpmF 11368 11535 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984764.1 protein_id gnl|my_center|LOCUS_02270 11692 12123 gene locus_tag LOCUS_02280 gene mraZ 11692 12123 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700457.1 protein_id gnl|my_center|LOCUS_02280 12133 13077 gene locus_tag LOCUS_02290 gene rsmH 12133 13077 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286642.1 protein_id gnl|my_center|LOCUS_02290 13067 13363 gene locus_tag LOCUS_02300 13067 13363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 13363 15498 gene locus_tag LOCUS_02310 gene pbpB 13363 15498 CDS product penicillin-binding protein 2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968930.1 protein_id gnl|my_center|LOCUS_02310 15544 17445 gene locus_tag LOCUS_02320 15544 17445 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266234.1 protein_id gnl|my_center|LOCUS_02320 17607 18893 gene locus_tag LOCUS_02330 17607 18893 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_02330 18923 20236 gene locus_tag LOCUS_02340 gene rlmD 18923 20236 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615206.1 protein_id gnl|my_center|LOCUS_02340 20253 20498 gene locus_tag LOCUS_02350 20253 20498 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761253.1 protein_id gnl|my_center|LOCUS_02350 20566 20871 gene locus_tag LOCUS_02360 20566 20871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 20932 23985 gene locus_tag LOCUS_02370 gene dnaE 20932 23985 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673716.1 protein_id gnl|my_center|LOCUS_02370 23999 26611 gene locus_tag LOCUS_02380 gene polA 23999 26611 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412819.1 protein_id gnl|my_center|LOCUS_02380 26621 27433 gene locus_tag LOCUS_02390 gene mutM 26621 27433 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288323.1 protein_id gnl|my_center|LOCUS_02390 27435 28382 gene locus_tag LOCUS_02400 27435 28382 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_02400 28382 28960 gene locus_tag LOCUS_02410 gene coaE 28382 28960 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288324.1 protein_id gnl|my_center|LOCUS_02410 28953 30200 gene locus_tag LOCUS_02420 28953 30200 CDS product replication initiation and membrane attachment family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989742.1 protein_id gnl|my_center|LOCUS_02420 30211 31119 gene locus_tag LOCUS_02430 gene dnaI 30211 31119 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355760.1 protein_id gnl|my_center|LOCUS_02430 31218 32177 gene locus_tag LOCUS_02440 gene pfkA 31218 32177 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706225.1 protein_id gnl|my_center|LOCUS_02440 >Feature sequence007 467 291 gene locus_tag LOCUS_02450 467 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 1544 624 gene locus_tag LOCUS_02460 1544 624 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_02460 1723 3057 gene locus_tag LOCUS_02470 1723 3057 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094940979.1 protein_id gnl|my_center|LOCUS_02470 3401 3075 gene locus_tag LOCUS_02480 3401 3075 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855295.1 protein_id gnl|my_center|LOCUS_02480 3515 4063 gene locus_tag LOCUS_02490 3515 4063 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787224.1 protein_id gnl|my_center|LOCUS_02490 5266 4205 gene locus_tag LOCUS_02500 gene mcrC 5266 4205 CDS product 5-methylcytosine-specific restriction endonuclease system specificity protein McrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922381.1 protein_id gnl|my_center|LOCUS_02500 7649 5259 gene locus_tag LOCUS_02510 7649 5259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 8040 7774 gene locus_tag LOCUS_02520 gene rpsO 8040 7774 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701713.1 protein_id gnl|my_center|LOCUS_02520 8911 8159 gene locus_tag LOCUS_02530 gene yaaA 8911 8159 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458998.1 protein_id gnl|my_center|LOCUS_02530 9771 8920 gene locus_tag LOCUS_02540 9771 8920 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721781.1 protein_id gnl|my_center|LOCUS_02540 10613 9858 gene locus_tag LOCUS_02550 10613 9858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 11772 10624 gene locus_tag LOCUS_02560 11772 10624 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048302.1 protein_id gnl|my_center|LOCUS_02560 12626 11856 gene locus_tag LOCUS_02570 12626 11856 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785293.1 protein_id gnl|my_center|LOCUS_02570 13393 12638 gene locus_tag LOCUS_02580 13393 12638 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861262.1 protein_id gnl|my_center|LOCUS_02580 14634 13501 gene locus_tag LOCUS_02590 14634 13501 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869908.1 protein_id gnl|my_center|LOCUS_02590 15872 14691 gene locus_tag LOCUS_02600 15872 14691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 16073 16816 gene locus_tag LOCUS_02610 gene gpmA 16073 16816 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670958.1 protein_id gnl|my_center|LOCUS_02610 16989 17159 gene locus_tag LOCUS_02620 16989 17159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 17985 17152 gene locus_tag LOCUS_02630 17985 17152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 18859 18056 gene locus_tag LOCUS_02640 18859 18056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 19776 18964 gene locus_tag LOCUS_02650 19776 18964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056248.1 protein_id gnl|my_center|LOCUS_02650 20272 19895 gene locus_tag LOCUS_02660 20272 19895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 20926 20363 gene locus_tag LOCUS_02670 20926 20363 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_02670 21195 21049 gene locus_tag LOCUS_02680 21195 21049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 22711 21323 gene locus_tag LOCUS_02690 gene purB 22711 21323 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423489.1 protein_id gnl|my_center|LOCUS_02690 26474 22713 gene locus_tag LOCUS_02700 26474 22713 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_02700 27736 26486 gene locus_tag LOCUS_02710 gene purD 27736 26486 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436062.1 protein_id gnl|my_center|LOCUS_02710 29280 27757 gene locus_tag LOCUS_02720 gene purH 29280 27757 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436063.1 protein_id gnl|my_center|LOCUS_02720 29878 29282 gene locus_tag LOCUS_02730 gene purN 29878 29282 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436064.1 protein_id gnl|my_center|LOCUS_02730 30897 29872 gene locus_tag LOCUS_02740 gene purM 30897 29872 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262435.1 protein_id gnl|my_center|LOCUS_02740 <31550 30913 gene locus_tag LOCUS_02750 <31550 30913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003420966.1:phosphoribosylaminoimidazolesuccinocarboxamide synthase >Feature sequence008 79 3 gene locus_tag LOCUS_t00010 79 3 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 161 85 gene locus_tag LOCUS_t00020 161 85 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 304 216 gene locus_tag LOCUS_t00030 304 216 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 388 314 gene locus_tag LOCUS_t00040 388 314 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2676 838 gene locus_tag LOCUS_02760 2676 838 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948299.1 protein_id gnl|my_center|LOCUS_02760 3511 2660 gene locus_tag LOCUS_02770 3511 2660 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808911.1 protein_id gnl|my_center|LOCUS_02770 4554 3511 gene locus_tag LOCUS_02780 4554 3511 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_02780 5098 4565 gene locus_tag LOCUS_02790 5098 4565 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418769.1 protein_id gnl|my_center|LOCUS_02790 5237 5743 gene locus_tag LOCUS_02800 5237 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 6615 5782 gene locus_tag LOCUS_02810 6615 5782 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_02810 7008 6628 gene locus_tag LOCUS_02820 7008 6628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 8487 7018 gene locus_tag LOCUS_02830 8487 7018 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965086.1 protein_id gnl|my_center|LOCUS_02830 8843 8553 gene locus_tag LOCUS_02840 8843 8553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 9598 8918 gene locus_tag LOCUS_02850 gene rnc 9598 8918 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262927.1 protein_id gnl|my_center|LOCUS_02850 10574 9600 gene locus_tag LOCUS_02860 gene plsX 10574 9600 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905085.1 protein_id gnl|my_center|LOCUS_02860 12632 10614 gene locus_tag LOCUS_02870 gene recG 12632 10614 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244692.1 protein_id gnl|my_center|LOCUS_02870 13926 12730 gene locus_tag LOCUS_02880 13926 12730 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021366129.1 protein_id gnl|my_center|LOCUS_02880 14594 13914 gene locus_tag LOCUS_02890 14594 13914 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860834.1 protein_id gnl|my_center|LOCUS_02890 15590 14679 gene locus_tag LOCUS_02900 15590 14679 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027102.1 protein_id gnl|my_center|LOCUS_02900 15813 16106 gene locus_tag LOCUS_02910 15813 16106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 16093 16476 gene locus_tag LOCUS_02920 16093 16476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 16853 16548 gene locus_tag LOCUS_02930 16853 16548 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275642.1 protein_id gnl|my_center|LOCUS_02930 17633 16989 gene locus_tag LOCUS_02940 17633 16989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 17779 18753 gene locus_tag LOCUS_02950 17779 18753 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861460.1 protein_id gnl|my_center|LOCUS_02950 19318 18776 gene locus_tag LOCUS_02960 19318 18776 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888695.1 protein_id gnl|my_center|LOCUS_02960 19845 19315 gene locus_tag LOCUS_02970 19845 19315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 20514 19849 gene locus_tag LOCUS_02980 20514 19849 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475996.1 protein_id gnl|my_center|LOCUS_02980 21492 20575 gene locus_tag LOCUS_02990 21492 20575 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966232.1 protein_id gnl|my_center|LOCUS_02990 22780 21503 gene locus_tag LOCUS_03000 gene celB 22780 21503 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242539.1 protein_id gnl|my_center|LOCUS_03000 23300 22797 gene locus_tag LOCUS_03010 23300 22797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 24716 23313 gene locus_tag LOCUS_03020 24716 23313 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964714.1 protein_id gnl|my_center|LOCUS_03020 25721 24840 gene locus_tag LOCUS_03030 25721 24840 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354705.1 protein_id gnl|my_center|LOCUS_03030 26124 25771 gene locus_tag LOCUS_03040 26124 25771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018213024.1 protein_id gnl|my_center|LOCUS_03040 28098 26185 gene locus_tag LOCUS_03050 28098 26185 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964880.1 protein_id gnl|my_center|LOCUS_03050 29123 28149 gene locus_tag LOCUS_03060 29123 28149 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476338.1 protein_id gnl|my_center|LOCUS_03060 29788 29126 gene locus_tag LOCUS_03070 gene rpiA 29788 29126 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964740.1 protein_id gnl|my_center|LOCUS_03070 30798 29791 gene locus_tag LOCUS_03080 30798 29791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 >Feature sequence009 82 1566 gene locus_tag LOCUS_03090 82 1566 CDS product CotH kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533131.1 protein_id gnl|my_center|LOCUS_03090 1576 3663 gene locus_tag LOCUS_03100 1576 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760433.1 protein_id gnl|my_center|LOCUS_03100 3663 4775 gene locus_tag LOCUS_03110 3663 4775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 4741 6144 gene locus_tag LOCUS_03120 4741 6144 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274807.1 protein_id gnl|my_center|LOCUS_03120 6159 8660 gene locus_tag LOCUS_03130 6159 8660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 8884 15063 gene locus_tag LOCUS_03140 8884 15063 CDS product beta-N-acetylglucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390210.1 protein_id gnl|my_center|LOCUS_03140 15361 16038 gene locus_tag LOCUS_03150 15361 16038 CDS product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681060.1 protein_id gnl|my_center|LOCUS_03150 16038 16493 gene locus_tag LOCUS_03160 16038 16493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03160 16505 17056 gene locus_tag LOCUS_03170 16505 17056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03170 17068 17709 gene locus_tag LOCUS_03180 gene pcp 17068 17709 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681058.1 protein_id gnl|my_center|LOCUS_03180 18171 17743 gene locus_tag LOCUS_03190 18171 17743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 18996 18184 gene locus_tag LOCUS_03200 18996 18184 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972486.1 protein_id gnl|my_center|LOCUS_03200 20525 19026 gene locus_tag LOCUS_03210 20525 19026 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477450.1 protein_id gnl|my_center|LOCUS_03210 21209 20529 gene locus_tag LOCUS_03220 21209 20529 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430452.1 protein_id gnl|my_center|LOCUS_03220 21697 21221 gene locus_tag LOCUS_03230 21697 21221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 23783 21915 gene locus_tag LOCUS_03240 23783 21915 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03240 24016 23798 gene locus_tag LOCUS_03250 24016 23798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 24170 24523 gene locus_tag LOCUS_03260 24170 24523 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459353.1 protein_id gnl|my_center|LOCUS_03260 24683 25246 gene locus_tag LOCUS_03270 24683 25246 CDS product CadD family cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485755.1 protein_id gnl|my_center|LOCUS_03270 26162 25287 gene locus_tag LOCUS_03280 26162 25287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 26897 26232 gene locus_tag LOCUS_03290 26897 26232 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811882.1 protein_id gnl|my_center|LOCUS_03290 27013 28827 gene locus_tag LOCUS_03300 gene hcp 27013 28827 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966037.1 protein_id gnl|my_center|LOCUS_03300 28838 29410 gene locus_tag LOCUS_03310 28838 29410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964077.1 protein_id gnl|my_center|LOCUS_03310 29412 29897 gene locus_tag LOCUS_03320 29412 29897 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964078.1 protein_id gnl|my_center|LOCUS_03320 30192 29962 gene locus_tag LOCUS_03330 30192 29962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 >Feature sequence010 <1 518 gene locus_tag LOCUS_03340 <1 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000446816.1:AraC family transcriptional regulator 1882 539 gene locus_tag LOCUS_03350 1882 539 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021843.1 protein_id gnl|my_center|LOCUS_03350 2918 2016 gene locus_tag LOCUS_03360 2918 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 3043 3573 gene locus_tag LOCUS_03370 gene rnmV 3043 3573 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692835.1 protein_id gnl|my_center|LOCUS_03370 3560 4099 gene locus_tag LOCUS_03380 3560 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 4096 4902 gene locus_tag LOCUS_03390 gene rsmA 4096 4902 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226751.1 protein_id gnl|my_center|LOCUS_03390 4929 5672 gene locus_tag LOCUS_03400 gene yabG 4929 5672 CDS product sporulation peptidase YabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173738.1 protein_id gnl|my_center|LOCUS_03400 5677 6525 gene locus_tag LOCUS_03410 gene ispE 5677 6525 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772104.1 protein_id gnl|my_center|LOCUS_03410 6629 8008 gene locus_tag LOCUS_03420 gene glmU 6629 8008 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071041.1 protein_id gnl|my_center|LOCUS_03420 8018 8974 gene locus_tag LOCUS_03430 8018 8974 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903312.1 protein_id gnl|my_center|LOCUS_03430 9388 9104 gene locus_tag LOCUS_03440 9388 9104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 9517 9744 gene locus_tag LOCUS_03450 9517 9744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 10149 10388 gene locus_tag LOCUS_03460 10149 10388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 10676 12013 gene locus_tag LOCUS_03470 10676 12013 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865312.1 protein_id gnl|my_center|LOCUS_03470 12180 12341 gene locus_tag LOCUS_03480 12180 12341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 12433 13596 gene locus_tag LOCUS_03490 12433 13596 CDS product 4Fe-4S cluster-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460830.1 protein_id gnl|my_center|LOCUS_03490 13565 14608 gene locus_tag LOCUS_03500 13565 14608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 14641 15528 gene locus_tag LOCUS_03510 14641 15528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 15869 15642 gene locus_tag LOCUS_03520 15869 15642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 16186 16013 gene locus_tag LOCUS_03530 16186 16013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 16612 16770 gene locus_tag LOCUS_03540 16612 16770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 19517 16938 gene locus_tag LOCUS_03550 19517 16938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 19748 21139 gene locus_tag LOCUS_03560 19748 21139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 21635 21165 gene locus_tag LOCUS_03570 21635 21165 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768302.1 protein_id gnl|my_center|LOCUS_03570 21793 22506 gene locus_tag LOCUS_03580 21793 22506 CDS product RibD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460575.1 protein_id gnl|my_center|LOCUS_03580 22976 22515 gene locus_tag LOCUS_03590 22976 22515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 23424 22990 gene locus_tag LOCUS_03600 23424 22990 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437661.1 protein_id gnl|my_center|LOCUS_03600 25313 23550 gene locus_tag LOCUS_03610 25313 23550 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_03610 25450 26262 gene locus_tag LOCUS_03620 25450 26262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 >Feature sequence011 1900 146 gene locus_tag LOCUS_03630 1900 146 CDS product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948795.1 protein_id gnl|my_center|LOCUS_03630 2566 2051 gene locus_tag LOCUS_03640 gene lepB 2566 2051 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425127.1 protein_id gnl|my_center|LOCUS_03640 3315 2596 gene locus_tag LOCUS_03650 gene sigF 3315 2596 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230458.1 protein_id gnl|my_center|LOCUS_03650 3745 3305 gene locus_tag LOCUS_03660 gene spoIIAB 3745 3305 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230452.1 protein_id gnl|my_center|LOCUS_03660 4068 3745 gene locus_tag LOCUS_03670 gene spoIIAA 4068 3745 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357811.1 protein_id gnl|my_center|LOCUS_03670 4207 5349 gene locus_tag LOCUS_03680 gene dacF 4207 5349 CDS product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398637.1 protein_id gnl|my_center|LOCUS_03680 5857 5372 gene locus_tag LOCUS_03690 5857 5372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 6854 5946 gene locus_tag LOCUS_03700 6854 5946 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448350.1 protein_id gnl|my_center|LOCUS_03700 6990 7175 gene locus_tag LOCUS_03710 6990 7175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 7573 7172 gene locus_tag LOCUS_03720 7573 7172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 8205 7657 gene locus_tag LOCUS_03730 8205 7657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 8828 8247 gene locus_tag LOCUS_03740 8828 8247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 8963 9130 gene locus_tag LOCUS_03750 8963 9130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 9501 9163 gene locus_tag LOCUS_03760 9501 9163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 9612 10982 gene locus_tag LOCUS_03770 9612 10982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 11204 11431 gene locus_tag LOCUS_03780 11204 11431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 11976 11458 gene locus_tag LOCUS_03790 gene nusG 11976 11458 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003024800.1 protein_id gnl|my_center|LOCUS_03790 13999 12095 gene locus_tag LOCUS_03800 13999 12095 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476102.1 protein_id gnl|my_center|LOCUS_03800 14407 15090 gene locus_tag LOCUS_03810 14407 15090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 15093 15866 gene locus_tag LOCUS_03820 gene cps4B 15093 15866 CDS product capsular polysaccharide biosynthesis protein Cps4B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922734.1 protein_id gnl|my_center|LOCUS_03820 15867 16592 gene locus_tag LOCUS_03830 15867 16592 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966321.1 protein_id gnl|my_center|LOCUS_03830 16595 17560 gene locus_tag LOCUS_03840 16595 17560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 17934 17584 gene locus_tag LOCUS_03850 17934 17584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 18776 17937 gene locus_tag LOCUS_03860 18776 17937 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582540.1 protein_id gnl|my_center|LOCUS_03860 18908 19255 gene locus_tag LOCUS_03870 18908 19255 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949095.1 protein_id gnl|my_center|LOCUS_03870 20236 19283 gene locus_tag LOCUS_03880 gene fmt 20236 19283 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439455.1 protein_id gnl|my_center|LOCUS_03880 20603 20319 gene locus_tag LOCUS_03890 20603 20319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 21343 20600 gene locus_tag LOCUS_03900 21343 20600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 22344 21388 gene locus_tag LOCUS_03910 gene gpr 22344 21388 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662627.1 protein_id gnl|my_center|LOCUS_03910 22470 22730 gene locus_tag LOCUS_03920 gene rpsT 22470 22730 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976241.1 protein_id gnl|my_center|LOCUS_03920 22769 24544 gene locus_tag LOCUS_03930 gene pepF 22769 24544 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967010.1 protein_id gnl|my_center|LOCUS_03930 25045 25887 gene locus_tag LOCUS_03940 25045 25887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 >Feature sequence012 3878 3090 gene locus_tag LOCUS_03950 3878 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369000.1 protein_id gnl|my_center|LOCUS_03950 4747 3878 gene locus_tag LOCUS_03960 4747 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 6318 4756 gene locus_tag LOCUS_03970 6318 4756 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966722.1 protein_id gnl|my_center|LOCUS_03970 7149 6331 gene locus_tag LOCUS_03980 7149 6331 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964017.1 protein_id gnl|my_center|LOCUS_03980 8289 7525 gene locus_tag LOCUS_03990 8289 7525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03990 10080 8299 gene locus_tag LOCUS_04000 10080 8299 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098732.1 protein_id gnl|my_center|LOCUS_04000 10657 10043 gene locus_tag LOCUS_04010 10657 10043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 11575 10721 gene locus_tag LOCUS_04020 11575 10721 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627941.1 protein_id gnl|my_center|LOCUS_04020 12431 11568 gene locus_tag LOCUS_04030 gene agaW 12431 11568 CDS product PTS N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387359.1 protein_id gnl|my_center|LOCUS_04030 12927 12433 gene locus_tag LOCUS_04040 12927 12433 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632643.1 protein_id gnl|my_center|LOCUS_04040 13377 12949 gene locus_tag LOCUS_04050 13377 12949 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002301685.1 protein_id gnl|my_center|LOCUS_04050 13755 14567 gene locus_tag LOCUS_04060 13755 14567 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185874.1 protein_id gnl|my_center|LOCUS_04060 14592 15230 gene locus_tag LOCUS_04070 14592 15230 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028272.1 protein_id gnl|my_center|LOCUS_04070 15333 16334 gene locus_tag LOCUS_04080 15333 16334 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161491.1 protein_id gnl|my_center|LOCUS_04080 16341 16973 gene locus_tag LOCUS_04090 16341 16973 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167287.1 protein_id gnl|my_center|LOCUS_04090 17058 17405 gene locus_tag LOCUS_04100 17058 17405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 18428 17418 gene locus_tag LOCUS_04110 18428 17418 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942020.1 protein_id gnl|my_center|LOCUS_04110 19051 18482 gene locus_tag LOCUS_04120 19051 18482 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924169.1 protein_id gnl|my_center|LOCUS_04120 19186 20787 gene locus_tag LOCUS_04130 gene pckA 19186 20787 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392169.1 protein_id gnl|my_center|LOCUS_04130 21405 20821 gene locus_tag LOCUS_04140 21405 20821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 22288 21446 gene locus_tag LOCUS_04150 22288 21446 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_04150 23000 22326 gene locus_tag LOCUS_04160 23000 22326 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964265.1 protein_id gnl|my_center|LOCUS_04160 24292 23132 gene locus_tag LOCUS_04170 24292 23132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 25283 24384 gene locus_tag LOCUS_04180 25283 24384 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017051.1 protein_id gnl|my_center|LOCUS_04180 <25787 25283 gene locus_tag LOCUS_04190 <25787 25283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003434727.1:EFR1 family ferrodoxin >Feature sequence013 737 405 gene locus_tag LOCUS_04200 737 405 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207878.1 protein_id gnl|my_center|LOCUS_04200 1467 1557 gene locus_tag LOCUS_t00050 1467 1557 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1565 1641 gene locus_tag LOCUS_t00060 1565 1641 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2236 1703 gene locus_tag LOCUS_04210 2236 1703 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986429.1 protein_id gnl|my_center|LOCUS_04210 3985 2693 gene locus_tag LOCUS_04220 3985 2693 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070090119.1 protein_id gnl|my_center|LOCUS_04220 4296 5273 gene locus_tag LOCUS_04230 4296 5273 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_04230 5334 6254 gene locus_tag LOCUS_04240 5334 6254 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949138.1 protein_id gnl|my_center|LOCUS_04240 6342 7475 gene locus_tag LOCUS_04250 gene mnmA 6342 7475 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943733.1 protein_id gnl|my_center|LOCUS_04250 7475 9670 gene locus_tag LOCUS_04260 7475 9670 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528083.1 protein_id gnl|my_center|LOCUS_04260 10091 12700 gene locus_tag LOCUS_04270 gene alaS 10091 12700 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811825.1 protein_id gnl|my_center|LOCUS_04270 12757 13008 gene locus_tag LOCUS_04280 12757 13008 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225903.1 protein_id gnl|my_center|LOCUS_04280 13010 13429 gene locus_tag LOCUS_04290 gene ruvX 13010 13429 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830837.1 protein_id gnl|my_center|LOCUS_04290 13442 13801 gene locus_tag LOCUS_04300 13442 13801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 13846 14940 gene locus_tag LOCUS_04310 13846 14940 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004801600.1 protein_id gnl|my_center|LOCUS_04310 15064 16113 gene locus_tag LOCUS_04320 gene mltG 15064 16113 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572132.1 protein_id gnl|my_center|LOCUS_04320 16115 16705 gene locus_tag LOCUS_04330 16115 16705 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990144.1 protein_id gnl|my_center|LOCUS_04330 16710 17645 gene locus_tag LOCUS_04340 16710 17645 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742806.1 protein_id gnl|my_center|LOCUS_04340 17629 18873 gene locus_tag LOCUS_04350 17629 18873 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229802.1 protein_id gnl|my_center|LOCUS_04350 18873 19493 gene locus_tag LOCUS_04360 gene udk 18873 19493 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537078.1 protein_id gnl|my_center|LOCUS_04360 19550 20035 gene locus_tag LOCUS_04370 gene greA 19550 20035 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431312.1 protein_id gnl|my_center|LOCUS_04370 20409 20053 gene locus_tag LOCUS_04380 20409 20053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 20459 21094 gene locus_tag LOCUS_04390 20459 21094 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233805.1 protein_id gnl|my_center|LOCUS_04390 21925 21131 gene locus_tag LOCUS_04400 21925 21131 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157662.1 protein_id gnl|my_center|LOCUS_04400 22847 21918 gene locus_tag LOCUS_04410 22847 21918 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549276.1 protein_id gnl|my_center|LOCUS_04410 23852 22857 gene locus_tag LOCUS_04420 23852 22857 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289394.1 protein_id gnl|my_center|LOCUS_04420 25016 24222 gene locus_tag LOCUS_04430 25016 24222 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_04430 25124 25501 gene locus_tag LOCUS_04440 25124 25501 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964778.1 protein_id gnl|my_center|LOCUS_04440 >Feature sequence014 1625 606 gene locus_tag LOCUS_04450 1625 606 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434897.1 protein_id gnl|my_center|LOCUS_04450 2281 1610 gene locus_tag LOCUS_04460 2281 1610 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948494.1 protein_id gnl|my_center|LOCUS_04460 2764 2327 gene locus_tag LOCUS_04470 2764 2327 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836809.1 protein_id gnl|my_center|LOCUS_04470 4365 2803 gene locus_tag LOCUS_04480 4365 2803 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055295205.1 protein_id gnl|my_center|LOCUS_04480 5132 4917 gene locus_tag LOCUS_04490 5132 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 6881 5241 gene locus_tag LOCUS_04500 6881 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 8524 6917 gene locus_tag LOCUS_04510 8524 6917 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222033.1 protein_id gnl|my_center|LOCUS_04510 9618 8527 gene locus_tag LOCUS_04520 9618 8527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 10136 9756 gene locus_tag LOCUS_04530 10136 9756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 10426 10193 gene locus_tag LOCUS_04540 10426 10193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 10778 10434 gene locus_tag LOCUS_04550 10778 10434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 11559 10801 gene locus_tag LOCUS_04560 11559 10801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 11974 12150 gene locus_tag LOCUS_04570 11974 12150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 14877 13399 gene locus_tag LOCUS_04580 14877 13399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 15622 15275 gene locus_tag LOCUS_04590 15622 15275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 16034 15762 gene locus_tag LOCUS_04600 16034 15762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 16375 16169 gene locus_tag LOCUS_04610 16375 16169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 16846 16637 gene locus_tag LOCUS_04620 16846 16637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 17167 16985 gene locus_tag LOCUS_04630 17167 16985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 18552 17458 gene locus_tag LOCUS_04640 18552 17458 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166240.1 protein_id gnl|my_center|LOCUS_04640 19329 18799 gene locus_tag LOCUS_04650 19329 18799 CDS product DUF4065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905421.1 protein_id gnl|my_center|LOCUS_04650 19701 19348 gene locus_tag LOCUS_04660 19701 19348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 20757 20083 gene locus_tag LOCUS_04670 20757 20083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 21613 20915 gene locus_tag LOCUS_04680 21613 20915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 22168 21719 gene locus_tag LOCUS_04690 22168 21719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 22312 22527 gene locus_tag LOCUS_04700 22312 22527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 22882 22517 gene locus_tag LOCUS_04710 22882 22517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 23133 22906 gene locus_tag LOCUS_04720 23133 22906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 23488 23135 gene locus_tag LOCUS_04730 23488 23135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 24668 23490 gene locus_tag LOCUS_04740 24668 23490 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_04740 >Feature sequence015 178 675 gene locus_tag LOCUS_04750 178 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 687 1199 gene locus_tag LOCUS_04760 687 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 1377 2231 gene locus_tag LOCUS_04770 1377 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 2280 3206 gene locus_tag LOCUS_04780 2280 3206 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837185.1 protein_id gnl|my_center|LOCUS_04780 3229 4149 gene locus_tag LOCUS_04790 3229 4149 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875981.1 protein_id gnl|my_center|LOCUS_04790 4142 5182 gene locus_tag LOCUS_04800 4142 5182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 5582 6223 gene locus_tag LOCUS_04810 5582 6223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 6240 7430 gene locus_tag LOCUS_04820 6240 7430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 7632 9032 gene locus_tag LOCUS_04830 7632 9032 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895005.1 protein_id gnl|my_center|LOCUS_04830 9117 10109 gene locus_tag LOCUS_04840 9117 10109 CDS product UDP-glucose--(galactosyl) LPS alpha1,2-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346019.1 protein_id gnl|my_center|LOCUS_04840 10209 10988 gene locus_tag LOCUS_04850 gene rfbF 10209 10988 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816687.1 protein_id gnl|my_center|LOCUS_04850 10990 12054 gene locus_tag LOCUS_04860 gene rfbG 10990 12054 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 protein_id gnl|my_center|LOCUS_04860 12042 12971 gene locus_tag LOCUS_04870 12042 12971 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545190.1 protein_id gnl|my_center|LOCUS_04870 12955 13524 gene locus_tag LOCUS_04880 gene rfbC 12955 13524 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_04880 13517 14791 gene locus_tag LOCUS_04890 13517 14791 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208594.1 protein_id gnl|my_center|LOCUS_04890 14951 16183 gene locus_tag LOCUS_04900 14951 16183 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204864755.1 protein_id gnl|my_center|LOCUS_04900 16189 17232 gene locus_tag LOCUS_04910 16189 17232 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288210.1 protein_id gnl|my_center|LOCUS_04910 17244 18050 gene locus_tag LOCUS_04920 17244 18050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 18185 18460 gene locus_tag LOCUS_04930 18185 18460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112566.1 protein_id gnl|my_center|LOCUS_04930 18489 19478 gene locus_tag LOCUS_04940 18489 19478 CDS product DUF4065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993737.1 protein_id gnl|my_center|LOCUS_04940 21007 20120 gene locus_tag LOCUS_04950 21007 20120 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130101.1 protein_id gnl|my_center|LOCUS_04950 22586 21114 gene locus_tag LOCUS_04960 22586 21114 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964714.1 protein_id gnl|my_center|LOCUS_04960 <24212 22601 gene locus_tag LOCUS_04970 <24212 22601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012027425.1:beta-glucoside-specific PTS transporter subunit IIABC >Feature sequence016 412 825 gene locus_tag LOCUS_04980 412 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 900 1838 gene locus_tag LOCUS_04990 900 1838 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057287.1 protein_id gnl|my_center|LOCUS_04990 1838 2953 gene locus_tag LOCUS_05000 1838 2953 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389793.1 protein_id gnl|my_center|LOCUS_05000 2940 4088 gene locus_tag LOCUS_05010 2940 4088 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296167.1 protein_id gnl|my_center|LOCUS_05010 4094 4597 gene locus_tag LOCUS_05020 4094 4597 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964725.1 protein_id gnl|my_center|LOCUS_05020 4735 6213 gene locus_tag LOCUS_05030 4735 6213 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387645.1 protein_id gnl|my_center|LOCUS_05030 6365 6823 gene locus_tag LOCUS_05040 gene tadA 6365 6823 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434328.1 protein_id gnl|my_center|LOCUS_05040 6885 8729 gene locus_tag LOCUS_05050 gene dnaX 6885 8729 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829412.1 protein_id gnl|my_center|LOCUS_05050 8739 9332 gene locus_tag LOCUS_05060 gene recR 8739 9332 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387203.1 protein_id gnl|my_center|LOCUS_05060 9365 9526 gene locus_tag LOCUS_05070 9365 9526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 9595 10299 gene locus_tag LOCUS_05080 9595 10299 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965071.1 protein_id gnl|my_center|LOCUS_05080 10431 11051 gene locus_tag LOCUS_05090 gene tmk 10431 11051 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243137.1 protein_id gnl|my_center|LOCUS_05090 11048 11989 gene locus_tag LOCUS_05100 gene holB 11048 11989 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700662.1 protein_id gnl|my_center|LOCUS_05100 12002 12811 gene locus_tag LOCUS_05110 12002 12811 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832240.1 protein_id gnl|my_center|LOCUS_05110 12814 13542 gene locus_tag LOCUS_05120 12814 13542 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166255.1 protein_id gnl|my_center|LOCUS_05120 13539 14393 gene locus_tag LOCUS_05130 gene rsmI 13539 14393 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243457.1 protein_id gnl|my_center|LOCUS_05130 14527 15837 gene locus_tag LOCUS_05140 gene pdaC 14527 15837 CDS product peptidoglycan-N-acetylmuramic acid deacetylase PdaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245023.1 protein_id gnl|my_center|LOCUS_05140 16429 16818 gene locus_tag LOCUS_05150 16429 16818 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243451.1 protein_id gnl|my_center|LOCUS_05150 17089 19014 gene locus_tag LOCUS_05160 gene metG 17089 19014 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_05160 19094 19594 gene locus_tag LOCUS_05170 19094 19594 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226648.1 protein_id gnl|my_center|LOCUS_05170 19697 19843 gene locus_tag LOCUS_05180 19697 19843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 20453 19863 gene locus_tag LOCUS_05190 20453 19863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 20602 23145 gene locus_tag LOCUS_05200 20602 23145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 23236 23877 gene locus_tag LOCUS_05210 23236 23877 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016483.1 protein_id gnl|my_center|LOCUS_05210 >Feature sequence017 100 1527 gene locus_tag LOCUS_05220 100 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 1617 2435 gene locus_tag LOCUS_05230 1617 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 2445 3158 gene locus_tag LOCUS_05240 2445 3158 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963831.1 protein_id gnl|my_center|LOCUS_05240 3503 3255 gene locus_tag LOCUS_05250 3503 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 4006 5484 gene locus_tag LOCUS_05260 gene trpE 4006 5484 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880347.1 protein_id gnl|my_center|LOCUS_05260 5465 6037 gene locus_tag LOCUS_05270 5465 6037 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966439.1 protein_id gnl|my_center|LOCUS_05270 6030 7037 gene locus_tag LOCUS_05280 gene trpD 6030 7037 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943017.1 protein_id gnl|my_center|LOCUS_05280 7052 7849 gene locus_tag LOCUS_05290 gene trpC 7052 7849 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 protein_id gnl|my_center|LOCUS_05290 7839 8435 gene locus_tag LOCUS_05300 7839 8435 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966436.1 protein_id gnl|my_center|LOCUS_05300 8425 9606 gene locus_tag LOCUS_05310 gene trpB 8425 9606 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101492.1 protein_id gnl|my_center|LOCUS_05310 9599 10366 gene locus_tag LOCUS_05320 gene trpA 9599 10366 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640398.1 protein_id gnl|my_center|LOCUS_05320 10781 12007 gene locus_tag LOCUS_05330 10781 12007 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_05330 12048 12713 gene locus_tag LOCUS_05340 12048 12713 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809652.1 protein_id gnl|my_center|LOCUS_05340 12818 14665 gene locus_tag LOCUS_05350 12818 14665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 14658 15356 gene locus_tag LOCUS_05360 14658 15356 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966938.1 protein_id gnl|my_center|LOCUS_05360 15810 15397 gene locus_tag LOCUS_05370 15810 15397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 15881 16375 gene locus_tag LOCUS_05380 15881 16375 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_05380 16430 17761 gene locus_tag LOCUS_05390 16430 17761 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_05390 17765 19252 gene locus_tag LOCUS_05400 17765 19252 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016113.1 protein_id gnl|my_center|LOCUS_05400 20157 19300 gene locus_tag LOCUS_05410 20157 19300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 20443 20150 gene locus_tag LOCUS_05420 20443 20150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 21572 20430 gene locus_tag LOCUS_05430 21572 20430 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546519.1 protein_id gnl|my_center|LOCUS_05430 22079 21621 gene locus_tag LOCUS_05440 22079 21621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 22255 22731 gene locus_tag LOCUS_05450 22255 22731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 >Feature sequence018 20 850 gene locus_tag LOCUS_05460 20 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 853 1056 gene locus_tag LOCUS_05470 853 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 1622 2125 gene locus_tag LOCUS_05480 1622 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 2141 2629 gene locus_tag LOCUS_05490 2141 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 2802 3623 gene locus_tag LOCUS_05500 2802 3623 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986980.1 protein_id gnl|my_center|LOCUS_05500 3620 4666 gene locus_tag LOCUS_05510 3620 4666 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966353.1 protein_id gnl|my_center|LOCUS_05510 4670 6271 gene locus_tag LOCUS_05520 gene pgcA 4670 6271 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244986.1 protein_id gnl|my_center|LOCUS_05520 6271 7551 gene locus_tag LOCUS_05530 6271 7551 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966338.1 protein_id gnl|my_center|LOCUS_05530 7551 8594 gene locus_tag LOCUS_05540 gene gmd 7551 8594 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288198.1 protein_id gnl|my_center|LOCUS_05540 8587 9522 gene locus_tag LOCUS_05550 8587 9522 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_05550 9527 10690 gene locus_tag LOCUS_05560 9527 10690 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261147.1 protein_id gnl|my_center|LOCUS_05560 10687 12063 gene locus_tag LOCUS_05570 10687 12063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 12694 13860 gene locus_tag LOCUS_05580 12694 13860 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203519.1 protein_id gnl|my_center|LOCUS_05580 13847 15259 gene locus_tag LOCUS_05590 13847 15259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 15625 16857 gene locus_tag LOCUS_05600 15625 16857 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204864755.1 protein_id gnl|my_center|LOCUS_05600 16863 17909 gene locus_tag LOCUS_05610 16863 17909 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288210.1 protein_id gnl|my_center|LOCUS_05610 17878 18045 gene locus_tag LOCUS_05620 17878 18045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 18246 18725 gene locus_tag LOCUS_05630 18246 18725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 18715 19146 gene locus_tag LOCUS_05640 18715 19146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 19136 22312 gene locus_tag LOCUS_05650 19136 22312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 22372 22944 gene locus_tag LOCUS_05660 22372 22944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 >Feature sequence019 896 1402 gene locus_tag LOCUS_05670 896 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 1392 1670 gene locus_tag LOCUS_05680 1392 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 2553 4478 gene locus_tag LOCUS_05690 2553 4478 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910350.1 protein_id gnl|my_center|LOCUS_05690 4496 7465 gene locus_tag LOCUS_05700 4496 7465 CDS product type III restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033406.1 protein_id gnl|my_center|LOCUS_05700 7629 11891 gene locus_tag LOCUS_05710 7629 11891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 12387 12533 gene locus_tag LOCUS_05720 12387 12533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 12936 14924 gene locus_tag LOCUS_05730 12936 14924 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547409.1 protein_id gnl|my_center|LOCUS_05730 14939 16675 gene locus_tag LOCUS_05740 14939 16675 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289508.1 protein_id gnl|my_center|LOCUS_05740 17045 16857 gene locus_tag LOCUS_05750 17045 16857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05750 18768 20207 gene locus_tag LOCUS_05760 18768 20207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 20730 22145 gene locus_tag LOCUS_05770 20730 22145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109060.1 protein_id gnl|my_center|LOCUS_05770 22848 22723 gene locus_tag LOCUS_05780 22848 22723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 >Feature sequence020 1198 353 gene locus_tag LOCUS_05790 1198 353 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964760.1 protein_id gnl|my_center|LOCUS_05790 2720 1254 gene locus_tag LOCUS_05800 2720 1254 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387645.1 protein_id gnl|my_center|LOCUS_05800 3472 2738 gene locus_tag LOCUS_05810 3472 2738 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355660.1 protein_id gnl|my_center|LOCUS_05810 4768 3476 gene locus_tag LOCUS_05820 gene celB 4768 3476 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384702.1 protein_id gnl|my_center|LOCUS_05820 5083 6147 gene locus_tag LOCUS_05830 5083 6147 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_05830 6587 6186 gene locus_tag LOCUS_05840 6587 6186 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068146.1 protein_id gnl|my_center|LOCUS_05840 7123 6614 gene locus_tag LOCUS_05850 7123 6614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 7818 7132 gene locus_tag LOCUS_05860 7818 7132 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358908.1 protein_id gnl|my_center|LOCUS_05860 9257 7920 gene locus_tag LOCUS_05870 9257 7920 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_05870 9802 9362 gene locus_tag LOCUS_05880 9802 9362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 9937 12306 gene locus_tag LOCUS_05890 9937 12306 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861289.1 protein_id gnl|my_center|LOCUS_05890 12363 13679 gene locus_tag LOCUS_05900 12363 13679 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096861.1 protein_id gnl|my_center|LOCUS_05900 14219 13710 gene locus_tag LOCUS_05910 14219 13710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 14319 14771 gene locus_tag LOCUS_05920 14319 14771 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494335.1 protein_id gnl|my_center|LOCUS_05920 15186 14782 gene locus_tag LOCUS_05930 15186 14782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 16461 15238 gene locus_tag LOCUS_05940 16461 15238 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_05940 16690 19020 gene locus_tag LOCUS_05950 16690 19020 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109494.1 protein_id gnl|my_center|LOCUS_05950 19416 19039 gene locus_tag LOCUS_05960 19416 19039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 21991 19427 gene locus_tag LOCUS_05970 21991 19427 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_05970 >Feature sequence021 2156 1284 gene locus_tag LOCUS_05980 2156 1284 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785992.1 protein_id gnl|my_center|LOCUS_05980 3638 2196 gene locus_tag LOCUS_05990 3638 2196 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861817.1 protein_id gnl|my_center|LOCUS_05990 4150 3722 gene locus_tag LOCUS_06000 4150 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06000 4389 4144 gene locus_tag LOCUS_06010 4389 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06010 5043 4459 gene locus_tag LOCUS_06020 5043 4459 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861294.1 protein_id gnl|my_center|LOCUS_06020 5686 5060 gene locus_tag LOCUS_06030 5686 5060 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930809.1 protein_id gnl|my_center|LOCUS_06030 5792 5956 gene locus_tag LOCUS_06040 5792 5956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 7129 5924 gene locus_tag LOCUS_06050 7129 5924 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 protein_id gnl|my_center|LOCUS_06050 7880 7143 gene locus_tag LOCUS_06060 7880 7143 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529927.1 protein_id gnl|my_center|LOCUS_06060 9070 7883 gene locus_tag LOCUS_06070 9070 7883 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 protein_id gnl|my_center|LOCUS_06070 9819 9223 gene locus_tag LOCUS_06080 9819 9223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 10823 9948 gene locus_tag LOCUS_06090 10823 9948 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289172.1 protein_id gnl|my_center|LOCUS_06090 11624 10884 gene locus_tag LOCUS_06100 11624 10884 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583389.1 protein_id gnl|my_center|LOCUS_06100 12456 11716 gene locus_tag LOCUS_06110 12456 11716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 14034 12574 gene locus_tag LOCUS_06120 14034 12574 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918342.1 protein_id gnl|my_center|LOCUS_06120 15921 14140 gene locus_tag LOCUS_06130 15921 14140 CDS product mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861961.1 protein_id gnl|my_center|LOCUS_06130 16670 15921 gene locus_tag LOCUS_06140 16670 15921 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167184.1 protein_id gnl|my_center|LOCUS_06140 18182 16713 gene locus_tag LOCUS_06150 18182 16713 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964065.1 protein_id gnl|my_center|LOCUS_06150 18949 18359 gene locus_tag LOCUS_06160 18949 18359 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547369.1 protein_id gnl|my_center|LOCUS_06160 20123 18942 gene locus_tag LOCUS_06170 20123 18942 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003392901.1 protein_id gnl|my_center|LOCUS_06170 20222 20557 gene locus_tag LOCUS_06180 20222 20557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 >Feature sequence022 1298 513 gene locus_tag LOCUS_06190 1298 513 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065531.1 protein_id gnl|my_center|LOCUS_06190 1410 1901 gene locus_tag LOCUS_06200 1410 1901 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966038.1 protein_id gnl|my_center|LOCUS_06200 1951 2433 gene locus_tag LOCUS_06210 1951 2433 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809539.1 protein_id gnl|my_center|LOCUS_06210 3448 2435 gene locus_tag LOCUS_06220 3448 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 3633 4793 gene locus_tag LOCUS_06230 3633 4793 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722638.1 protein_id gnl|my_center|LOCUS_06230 4975 6315 gene locus_tag LOCUS_06240 4975 6315 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674723.1 protein_id gnl|my_center|LOCUS_06240 6392 6751 gene locus_tag LOCUS_06250 6392 6751 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963932.1 protein_id gnl|my_center|LOCUS_06250 6744 7436 gene locus_tag LOCUS_06260 6744 7436 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990639.1 protein_id gnl|my_center|LOCUS_06260 7512 8354 gene locus_tag LOCUS_06270 7512 8354 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548408.1 protein_id gnl|my_center|LOCUS_06270 8514 10364 gene locus_tag LOCUS_06280 8514 10364 CDS product glucose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254503.1 protein_id gnl|my_center|LOCUS_06280 10377 11789 gene locus_tag LOCUS_06290 10377 11789 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732872.1 protein_id gnl|my_center|LOCUS_06290 11801 12658 gene locus_tag LOCUS_06300 11801 12658 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254502.1 protein_id gnl|my_center|LOCUS_06300 12693 13244 gene locus_tag LOCUS_06310 12693 13244 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548397.1 protein_id gnl|my_center|LOCUS_06310 13241 14281 gene locus_tag LOCUS_06320 13241 14281 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963520.1 protein_id gnl|my_center|LOCUS_06320 14256 14792 gene locus_tag LOCUS_06330 14256 14792 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966606.1 protein_id gnl|my_center|LOCUS_06330 16562 14820 gene locus_tag LOCUS_06340 16562 14820 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065725.1 protein_id gnl|my_center|LOCUS_06340 18366 16555 gene locus_tag LOCUS_06350 18366 16555 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460630.1 protein_id gnl|my_center|LOCUS_06350 19065 18448 gene locus_tag LOCUS_06360 19065 18448 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305518.1 protein_id gnl|my_center|LOCUS_06360 20108 19200 gene locus_tag LOCUS_06370 20108 19200 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812829.1 protein_id gnl|my_center|LOCUS_06370 >Feature sequence023 124 49 gene locus_tag LOCUS_t00070 124 49 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 205 132 gene locus_tag LOCUS_t00080 205 132 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 856 335 gene locus_tag LOCUS_06380 856 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 1612 905 gene locus_tag LOCUS_06390 1612 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 2346 1702 gene locus_tag LOCUS_06400 2346 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 3769 2327 gene locus_tag LOCUS_06410 3769 2327 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964815.1 protein_id gnl|my_center|LOCUS_06410 4425 3769 gene locus_tag LOCUS_06420 4425 3769 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964814.1 protein_id gnl|my_center|LOCUS_06420 5378 4512 gene locus_tag LOCUS_06430 5378 4512 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704391.1 protein_id gnl|my_center|LOCUS_06430 6131 5487 gene locus_tag LOCUS_06440 6131 5487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 7447 6131 gene locus_tag LOCUS_06450 7447 6131 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048276.1 protein_id gnl|my_center|LOCUS_06450 8694 7588 gene locus_tag LOCUS_06460 8694 7588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 9002 8712 gene locus_tag LOCUS_06470 9002 8712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 9357 9016 gene locus_tag LOCUS_06480 9357 9016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 9533 9408 gene locus_tag LOCUS_06490 9533 9408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 9951 9697 gene locus_tag LOCUS_06500 9951 9697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 11012 9948 gene locus_tag LOCUS_06510 11012 9948 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_06510 11341 11147 gene locus_tag LOCUS_06520 11341 11147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 13160 11367 gene locus_tag LOCUS_06530 13160 11367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 13952 13170 gene locus_tag LOCUS_06540 13952 13170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 15012 13945 gene locus_tag LOCUS_06550 15012 13945 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861040.1 protein_id gnl|my_center|LOCUS_06550 15421 15014 gene locus_tag LOCUS_06560 15421 15014 CDS product DUF2634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861039.1 protein_id gnl|my_center|LOCUS_06560 15918 15424 gene locus_tag LOCUS_06570 15918 15424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 16870 15911 gene locus_tag LOCUS_06580 16870 15911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 17615 16872 gene locus_tag LOCUS_06590 17615 16872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 <20001 17617 gene locus_tag LOCUS_06600 <20001 17617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861036.1:tape measure protein >Feature sequence024 1147 944 gene locus_tag LOCUS_06610 gene gerE 1147 944 CDS product spore germination transcription factor GerE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003184172.1 protein_id gnl|my_center|LOCUS_06610 2955 1189 gene locus_tag LOCUS_06620 gene uvrC 2955 1189 CDS product excinuclease ABC subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544275.1 protein_id gnl|my_center|LOCUS_06620 5267 2955 gene locus_tag LOCUS_06630 5267 2955 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229541.1 protein_id gnl|my_center|LOCUS_06630 6081 5269 gene locus_tag LOCUS_06640 6081 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 6192 6962 gene locus_tag LOCUS_06650 6192 6962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 7521 7057 gene locus_tag LOCUS_06660 7521 7057 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_06660 8434 7511 gene locus_tag LOCUS_06670 8434 7511 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_06670 8906 8421 gene locus_tag LOCUS_06680 gene lspA 8906 8421 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989666.1 protein_id gnl|my_center|LOCUS_06680 9640 8984 gene locus_tag LOCUS_06690 9640 8984 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436685.1 protein_id gnl|my_center|LOCUS_06690 9780 10322 gene locus_tag LOCUS_06700 9780 10322 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861247.1 protein_id gnl|my_center|LOCUS_06700 10377 11264 gene locus_tag LOCUS_06710 gene metF 10377 11264 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_06710 11257 11889 gene locus_tag LOCUS_06720 11257 11889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 11871 13847 gene locus_tag LOCUS_06730 11871 13847 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06730 13875 14225 gene locus_tag LOCUS_06740 13875 14225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06740 15642 14455 gene locus_tag LOCUS_06750 15642 14455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 16371 15739 gene locus_tag LOCUS_06760 16371 15739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06760 16968 16399 gene locus_tag LOCUS_06770 16968 16399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 17635 16961 gene locus_tag LOCUS_06780 17635 16961 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416112.1 protein_id gnl|my_center|LOCUS_06780 18584 17628 gene locus_tag LOCUS_06790 18584 17628 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230035.1 protein_id gnl|my_center|LOCUS_06790 19505 18585 gene locus_tag LOCUS_06800 gene yqfD 19505 18585 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047998.1 protein_id gnl|my_center|LOCUS_06800 19693 19502 gene locus_tag LOCUS_06810 19693 19502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 >Feature sequence025 610 2349 gene locus_tag LOCUS_06820 gene ezrA 610 2349 CDS product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377294.1 protein_id gnl|my_center|LOCUS_06820 2405 3541 gene locus_tag LOCUS_06830 2405 3541 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638992.1 protein_id gnl|my_center|LOCUS_06830 3545 4741 gene locus_tag LOCUS_06840 gene thiI 3545 4741 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989282.1 protein_id gnl|my_center|LOCUS_06840 4818 5039 gene locus_tag LOCUS_06850 4818 5039 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124489.1 protein_id gnl|my_center|LOCUS_06850 5137 5355 gene locus_tag LOCUS_06860 gene sspB 5137 5355 CDS product beta type acid-soluble spore protein SspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233287.1 protein_id gnl|my_center|LOCUS_06860 5673 6017 gene locus_tag LOCUS_06870 5673 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 6020 6232 gene locus_tag LOCUS_06880 6020 6232 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066331.1 protein_id gnl|my_center|LOCUS_06880 6299 6421 gene locus_tag LOCUS_06890 6299 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 6663 7859 gene locus_tag LOCUS_06900 6663 7859 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223511.1 protein_id gnl|my_center|LOCUS_06900 7939 8880 gene locus_tag LOCUS_06910 7939 8880 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545136.1 protein_id gnl|my_center|LOCUS_06910 8867 10531 gene locus_tag LOCUS_06920 8867 10531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807777.1 protein_id gnl|my_center|LOCUS_06920 10682 11503 gene locus_tag LOCUS_06930 10682 11503 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_06930 12599 11517 gene locus_tag LOCUS_06940 12599 11517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 12746 13417 gene locus_tag LOCUS_06950 12746 13417 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781961.1 protein_id gnl|my_center|LOCUS_06950 13417 14814 gene locus_tag LOCUS_06960 13417 14814 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839519.1 protein_id gnl|my_center|LOCUS_06960 14814 15386 gene locus_tag LOCUS_06970 14814 15386 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948791.1 protein_id gnl|my_center|LOCUS_06970 15400 18345 gene locus_tag LOCUS_06980 15400 18345 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183129.1 protein_id gnl|my_center|LOCUS_06980 18356 19339 gene locus_tag LOCUS_06990 gene ftsY 18356 19339 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007650.1 protein_id gnl|my_center|LOCUS_06990 >Feature sequence026 2737 3858 gene locus_tag LOCUS_07000 2737 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 4858 3848 gene locus_tag LOCUS_07010 4858 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 5616 4927 gene locus_tag LOCUS_07020 5616 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 5930 8089 gene locus_tag LOCUS_07030 gene nrdD 5930 8089 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187775.1 protein_id gnl|my_center|LOCUS_07030 8092 8607 gene locus_tag LOCUS_07040 gene nrdG 8092 8607 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_07040 8935 8807 gene locus_tag LOCUS_07050 8935 8807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 9630 10244 gene locus_tag LOCUS_07060 9630 10244 CDS product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964116.1 protein_id gnl|my_center|LOCUS_07060 10241 11113 gene locus_tag LOCUS_07070 10241 11113 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964117.1 protein_id gnl|my_center|LOCUS_07070 11113 11883 gene locus_tag LOCUS_07080 gene soj 11113 11883 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_07080 11873 12787 gene locus_tag LOCUS_07090 11873 12787 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562946.1 protein_id gnl|my_center|LOCUS_07090 12941 14623 gene locus_tag LOCUS_07100 12941 14623 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_07100 14979 15725 gene locus_tag LOCUS_07110 14979 15725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 15728 16405 gene locus_tag LOCUS_07120 15728 16405 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704149.1 protein_id gnl|my_center|LOCUS_07120 16374 17372 gene locus_tag LOCUS_07130 16374 17372 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476418.1 protein_id gnl|my_center|LOCUS_07130 17572 18279 gene locus_tag LOCUS_07140 17572 18279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 >Feature sequence027 3645 3190 gene locus_tag LOCUS_07150 3645 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 4545 3646 gene locus_tag LOCUS_07160 gene galU 4545 3646 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890959.1 protein_id gnl|my_center|LOCUS_07160 5191 4559 gene locus_tag LOCUS_07170 5191 4559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 6188 5193 gene locus_tag LOCUS_07180 6188 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 7186 6206 gene locus_tag LOCUS_07190 gene ansB 7186 6206 CDS product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262105.1 protein_id gnl|my_center|LOCUS_07190 9980 7314 gene locus_tag LOCUS_07200 gene ppdK 9980 7314 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_07200 11703 10102 gene locus_tag LOCUS_07210 11703 10102 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966292.1 protein_id gnl|my_center|LOCUS_07210 11834 12214 gene locus_tag LOCUS_07220 11834 12214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 13063 12227 gene locus_tag LOCUS_07230 13063 12227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 13864 13073 gene locus_tag LOCUS_07240 13864 13073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 15211 13937 gene locus_tag LOCUS_07250 15211 13937 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_07250 15357 16364 gene locus_tag LOCUS_07260 gene asnA 15357 16364 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476128.1 protein_id gnl|my_center|LOCUS_07260 >Feature sequence028 396 88 gene locus_tag LOCUS_07270 396 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 907 377 gene locus_tag LOCUS_07280 gene nrdG 907 377 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432598.1 protein_id gnl|my_center|LOCUS_07280 3156 907 gene locus_tag LOCUS_07290 3156 907 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459055.1 protein_id gnl|my_center|LOCUS_07290 4779 3340 gene locus_tag LOCUS_07300 4779 3340 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098239.1 protein_id gnl|my_center|LOCUS_07300 6526 4898 gene locus_tag LOCUS_07310 6526 4898 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860933.1 protein_id gnl|my_center|LOCUS_07310 7814 6567 gene locus_tag LOCUS_07320 7814 6567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 8382 7807 gene locus_tag LOCUS_07330 8382 7807 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966371.1 protein_id gnl|my_center|LOCUS_07330 9221 8379 gene locus_tag LOCUS_07340 9221 8379 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671202.1 protein_id gnl|my_center|LOCUS_07340 10073 9258 gene locus_tag LOCUS_07350 10073 9258 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261394.1 protein_id gnl|my_center|LOCUS_07350 11333 10359 gene locus_tag LOCUS_07360 11333 10359 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 protein_id gnl|my_center|LOCUS_07360 12239 11388 gene locus_tag LOCUS_07370 12239 11388 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047035641.1 protein_id gnl|my_center|LOCUS_07370 12510 12253 gene locus_tag LOCUS_07380 12510 12253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 15677 12666 gene locus_tag LOCUS_07390 15677 12666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 16513 16133 gene locus_tag LOCUS_07400 16513 16133 CDS product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699888.1 protein_id gnl|my_center|LOCUS_07400 17458 16541 gene locus_tag LOCUS_07410 17458 16541 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286670.1 protein_id gnl|my_center|LOCUS_07410 >Feature sequence029 1480 2 gene locus_tag LOCUS_07420 1480 2 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963812.1 protein_id gnl|my_center|LOCUS_07420 5704 1616 gene locus_tag LOCUS_07430 5704 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 7481 6015 gene locus_tag LOCUS_07440 7481 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 10955 7719 gene locus_tag LOCUS_07450 10955 7719 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721622.1 protein_id gnl|my_center|LOCUS_07450 11661 10957 gene locus_tag LOCUS_07460 11661 10957 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171779440.1 protein_id gnl|my_center|LOCUS_07460 11904 12509 gene locus_tag LOCUS_07470 11904 12509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 13757 12510 gene locus_tag LOCUS_07480 13757 12510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 14524 13757 gene locus_tag LOCUS_07490 14524 13757 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963489.1 protein_id gnl|my_center|LOCUS_07490 15824 14526 gene locus_tag LOCUS_07500 15824 14526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 16336 15938 gene locus_tag LOCUS_07510 16336 15938 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068146.1 protein_id gnl|my_center|LOCUS_07510 16907 16548 gene locus_tag LOCUS_07520 gene rplT 16907 16548 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289310.1 protein_id gnl|my_center|LOCUS_07520 >Feature sequence030 <1 786 gene locus_tag LOCUS_07530 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000476408.1:alpha-amylase 892 1065 gene locus_tag LOCUS_07540 892 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 1696 1187 gene locus_tag LOCUS_07550 gene spmB 1696 1187 CDS product spore maturation protein SpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029514.1 protein_id gnl|my_center|LOCUS_07550 2261 1689 gene locus_tag LOCUS_07560 2261 1689 CDS product spore maturation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427659.1 protein_id gnl|my_center|LOCUS_07560 3267 2254 gene locus_tag LOCUS_07570 gene dacB 3267 2254 CDS product D-alanyl-D-alanine carboxypeptidase DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252638.1 protein_id gnl|my_center|LOCUS_07570 3442 4617 gene locus_tag LOCUS_07580 3442 4617 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460692.1 protein_id gnl|my_center|LOCUS_07580 4659 5462 gene locus_tag LOCUS_07590 gene aacC 4659 5462 CDS product BA2930 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009879231.1 protein_id gnl|my_center|LOCUS_07590 5728 6330 gene locus_tag LOCUS_07600 5728 6330 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948000.1 protein_id gnl|my_center|LOCUS_07600 6343 6798 gene locus_tag LOCUS_07610 6343 6798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 7107 7850 gene locus_tag LOCUS_07620 7107 7850 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830978.1 protein_id gnl|my_center|LOCUS_07620 7918 8151 gene locus_tag LOCUS_07630 7918 8151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 8424 8951 gene locus_tag LOCUS_07640 8424 8951 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771271.1 protein_id gnl|my_center|LOCUS_07640 8944 10695 gene locus_tag LOCUS_07650 gene thrS 8944 10695 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830850.1 protein_id gnl|my_center|LOCUS_07650 10763 11647 gene locus_tag LOCUS_07660 10763 11647 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732924.1 protein_id gnl|my_center|LOCUS_07660 11707 12384 gene locus_tag LOCUS_07670 11707 12384 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359485.1 protein_id gnl|my_center|LOCUS_07670 12462 13340 gene locus_tag LOCUS_07680 12462 13340 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183318.1 protein_id gnl|my_center|LOCUS_07680 13341 13811 gene locus_tag LOCUS_07690 gene folA 13341 13811 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502023.1 protein_id gnl|my_center|LOCUS_07690 13828 14544 gene locus_tag LOCUS_07700 13828 14544 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616588.1 protein_id gnl|my_center|LOCUS_07700 14614 14946 gene locus_tag LOCUS_07710 14614 14946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 15492 15040 gene locus_tag LOCUS_07720 15492 15040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 <16464 15489 gene locus_tag LOCUS_07730 <16464 15489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000775401.1:RsmB/NOP family class I SAM-dependent RNA methyltransferase >Feature sequence031 167 367 gene locus_tag LOCUS_07740 167 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 367 1746 gene locus_tag LOCUS_07750 367 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 2411 1923 gene locus_tag LOCUS_07760 2411 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 3116 2430 gene locus_tag LOCUS_07770 3116 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 3433 3822 gene locus_tag LOCUS_07780 3433 3822 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_07780 3843 4427 gene locus_tag LOCUS_07790 3843 4427 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397458.1 protein_id gnl|my_center|LOCUS_07790 4628 5149 gene locus_tag LOCUS_07800 4628 5149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 5587 5171 gene locus_tag LOCUS_07810 5587 5171 CDS product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840640.1 protein_id gnl|my_center|LOCUS_07810 6403 5756 gene locus_tag LOCUS_07820 6403 5756 CDS product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414378.1 protein_id gnl|my_center|LOCUS_07820 6902 6393 gene locus_tag LOCUS_07830 gene trmL 6902 6393 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538147.1 protein_id gnl|my_center|LOCUS_07830 7490 6903 gene locus_tag LOCUS_07840 7490 6903 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357527.1 protein_id gnl|my_center|LOCUS_07840 7689 7516 gene locus_tag LOCUS_07850 7689 7516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 7622 8143 gene locus_tag LOCUS_07860 7622 8143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07860 8197 8367 gene locus_tag LOCUS_07870 8197 8367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 9126 8374 gene locus_tag LOCUS_07880 9126 8374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 9896 9150 gene locus_tag LOCUS_07890 9896 9150 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821952.1 protein_id gnl|my_center|LOCUS_07890 10428 10117 gene locus_tag LOCUS_07900 10428 10117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 10722 10456 gene locus_tag LOCUS_07910 10722 10456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 11344 10724 gene locus_tag LOCUS_07920 11344 10724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 12644 11592 gene locus_tag LOCUS_07930 12644 11592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 13171 12644 gene locus_tag LOCUS_07940 13171 12644 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 protein_id gnl|my_center|LOCUS_07940 13636 14334 gene locus_tag LOCUS_07950 gene rgbR 13636 14334 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_07950 14345 15133 gene locus_tag LOCUS_07960 14345 15133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 15138 15980 gene locus_tag LOCUS_07970 15138 15980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 >Feature sequence032 1825 5 gene locus_tag LOCUS_07980 gene asnB 1825 5 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288533.1 protein_id gnl|my_center|LOCUS_07980 2368 1979 gene locus_tag LOCUS_07990 2368 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 2811 2392 gene locus_tag LOCUS_08000 gene cwlJ 2811 2392 CDS product cell wall hydrolase CwlJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246500.1 protein_id gnl|my_center|LOCUS_08000 3070 4197 gene locus_tag LOCUS_08010 3070 4197 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922500.1 protein_id gnl|my_center|LOCUS_08010 4212 5321 gene locus_tag LOCUS_08020 gene glgD 4212 5321 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965536.1 protein_id gnl|my_center|LOCUS_08020 5321 6751 gene locus_tag LOCUS_08030 gene glgA 5321 6751 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836716.1 protein_id gnl|my_center|LOCUS_08030 6868 7281 gene locus_tag LOCUS_08040 6868 7281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 7294 8073 gene locus_tag LOCUS_08050 7294 8073 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785293.1 protein_id gnl|my_center|LOCUS_08050 8139 8666 gene locus_tag LOCUS_08060 8139 8666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 8859 10196 gene locus_tag LOCUS_08070 gene cysS 8859 10196 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476233.1 protein_id gnl|my_center|LOCUS_08070 10196 10579 gene locus_tag LOCUS_08080 10196 10579 CDS product ribonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860630.1 protein_id gnl|my_center|LOCUS_08080 10611 11336 gene locus_tag LOCUS_08090 gene rlmB 10611 11336 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399684.1 protein_id gnl|my_center|LOCUS_08090 11354 11956 gene locus_tag LOCUS_08100 11354 11956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 12009 12158 gene locus_tag LOCUS_08110 gene rpmG 12009 12158 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700682.1 protein_id gnl|my_center|LOCUS_08110 12170 12358 gene locus_tag LOCUS_08120 12170 12358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 12360 12914 gene locus_tag LOCUS_08130 gene nusG 12360 12914 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726896.1 protein_id gnl|my_center|LOCUS_08130 13263 14690 gene locus_tag LOCUS_08140 13263 14690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 14754 15230 gene locus_tag LOCUS_08150 14754 15230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 15285 16076 gene locus_tag LOCUS_08160 15285 16076 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965719.1 protein_id gnl|my_center|LOCUS_08160 >Feature sequence033 163 2181 gene locus_tag LOCUS_08170 163 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 2184 2384 gene locus_tag LOCUS_08180 2184 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 2493 2690 gene locus_tag LOCUS_08190 2493 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 2824 2594 gene locus_tag LOCUS_08200 2824 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 3092 3871 gene locus_tag LOCUS_08210 3092 3871 CDS product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965841.1 protein_id gnl|my_center|LOCUS_08210 4073 8098 gene locus_tag LOCUS_08220 4073 8098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 8099 10642 gene locus_tag LOCUS_08230 8099 10642 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021984.1 protein_id gnl|my_center|LOCUS_08230 11010 11963 gene locus_tag LOCUS_08240 11010 11963 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023905931.1 protein_id gnl|my_center|LOCUS_08240 12985 12035 gene locus_tag LOCUS_08250 12985 12035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 13217 14140 gene locus_tag LOCUS_08260 13217 14140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 14596 15534 gene locus_tag LOCUS_08270 14596 15534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 >Feature sequence034 1473 691 gene locus_tag LOCUS_08280 1473 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 1809 1522 gene locus_tag LOCUS_08290 1809 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 2485 2189 gene locus_tag LOCUS_08300 2485 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 3061 2534 gene locus_tag LOCUS_08310 3061 2534 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948551.1 protein_id gnl|my_center|LOCUS_08310 4523 3156 gene locus_tag LOCUS_08320 4523 3156 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986917.1 protein_id gnl|my_center|LOCUS_08320 4899 4633 gene locus_tag LOCUS_08330 4899 4633 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194330.1 protein_id gnl|my_center|LOCUS_08330 6542 4902 gene locus_tag LOCUS_08340 6542 4902 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047904.1 protein_id gnl|my_center|LOCUS_08340 7217 6552 gene locus_tag LOCUS_08350 7217 6552 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939481.1 protein_id gnl|my_center|LOCUS_08350 7898 7314 gene locus_tag LOCUS_08360 7898 7314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 8050 8895 gene locus_tag LOCUS_08370 8050 8895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 9076 8954 gene locus_tag LOCUS_08380 9076 8954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 10496 9102 gene locus_tag LOCUS_08390 gene gltA 10496 9102 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_08390 11344 10496 gene locus_tag LOCUS_08400 11344 10496 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048249.1 protein_id gnl|my_center|LOCUS_08400 14286 11521 gene locus_tag LOCUS_08410 14286 11521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 14579 15361 gene locus_tag LOCUS_08420 14579 15361 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892977.1 protein_id gnl|my_center|LOCUS_08420 >Feature sequence035 <1 936 gene locus_tag LOCUS_08430 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048370.1:glycine--tRNA ligase 952 2709 gene locus_tag LOCUS_08440 gene dnaG 952 2709 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230066.1 protein_id gnl|my_center|LOCUS_08440 2713 3969 gene locus_tag LOCUS_08450 2713 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 3971 4663 gene locus_tag LOCUS_08460 3971 4663 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006551.1 protein_id gnl|my_center|LOCUS_08460 4650 5402 gene locus_tag LOCUS_08470 4650 5402 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475994.1 protein_id gnl|my_center|LOCUS_08470 6297 5446 gene locus_tag LOCUS_08480 6297 5446 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723815.1 protein_id gnl|my_center|LOCUS_08480 7290 6379 gene locus_tag LOCUS_08490 7290 6379 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246170.1 protein_id gnl|my_center|LOCUS_08490 7652 7308 gene locus_tag LOCUS_08500 7652 7308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 7782 9152 gene locus_tag LOCUS_08510 7782 9152 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121678890.1 protein_id gnl|my_center|LOCUS_08510 9152 10012 gene locus_tag LOCUS_08520 9152 10012 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990126.1 protein_id gnl|my_center|LOCUS_08520 10254 9985 gene locus_tag LOCUS_08530 10254 9985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 11367 10312 gene locus_tag LOCUS_08540 gene ispG 11367 10312 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194540.1 protein_id gnl|my_center|LOCUS_08540 11918 11391 gene locus_tag LOCUS_08550 11918 11391 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949081.1 protein_id gnl|my_center|LOCUS_08550 12405 11929 gene locus_tag LOCUS_08560 12405 11929 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903083.1 protein_id gnl|my_center|LOCUS_08560 12566 13972 gene locus_tag LOCUS_08570 12566 13972 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052123.1 protein_id gnl|my_center|LOCUS_08570 14005 14664 gene locus_tag LOCUS_08580 14005 14664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 15634 14681 gene locus_tag LOCUS_08590 15634 14681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 >Feature sequence036 701 1015 gene locus_tag LOCUS_08600 701 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 996 1334 gene locus_tag LOCUS_08610 996 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 1458 1772 gene locus_tag LOCUS_08620 1458 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 2431 1826 gene locus_tag LOCUS_08630 gene rpsD 2431 1826 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989757.1 protein_id gnl|my_center|LOCUS_08630 4411 2645 gene locus_tag LOCUS_08640 4411 2645 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679450.1 protein_id gnl|my_center|LOCUS_08640 4594 5301 gene locus_tag LOCUS_08650 gene pyrF 4594 5301 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083500.1 protein_id gnl|my_center|LOCUS_08650 5316 5948 gene locus_tag LOCUS_08660 gene pyrE 5316 5948 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232105.1 protein_id gnl|my_center|LOCUS_08660 6051 7187 gene locus_tag LOCUS_08670 gene proB 6051 7187 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583199.1 protein_id gnl|my_center|LOCUS_08670 7184 8410 gene locus_tag LOCUS_08680 7184 8410 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583659.1 protein_id gnl|my_center|LOCUS_08680 8641 9723 gene locus_tag LOCUS_08690 8641 9723 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545648.1 protein_id gnl|my_center|LOCUS_08690 9738 10094 gene locus_tag LOCUS_08700 9738 10094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 10084 12603 gene locus_tag LOCUS_08710 10084 12603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 12698 13150 gene locus_tag LOCUS_08720 12698 13150 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048563.1 protein_id gnl|my_center|LOCUS_08720 13150 15378 gene locus_tag LOCUS_08730 13150 15378 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433859.1 protein_id gnl|my_center|LOCUS_08730 >Feature sequence037 538 1380 gene locus_tag LOCUS_08740 538 1380 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953624.1 protein_id gnl|my_center|LOCUS_08740 1391 1747 gene locus_tag LOCUS_08750 1391 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 2347 1772 gene locus_tag LOCUS_08760 2347 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 2467 4389 gene locus_tag LOCUS_08770 2467 4389 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393552.1 protein_id gnl|my_center|LOCUS_08770 4509 5606 gene locus_tag LOCUS_08780 4509 5606 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891610.1 protein_id gnl|my_center|LOCUS_08780 5867 7375 gene locus_tag LOCUS_08790 5867 7375 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057658.1 protein_id gnl|my_center|LOCUS_08790 7386 7781 gene locus_tag LOCUS_08800 7386 7781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 8410 7817 gene locus_tag LOCUS_08810 8410 7817 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419930.1 protein_id gnl|my_center|LOCUS_08810 9094 8465 gene locus_tag LOCUS_08820 9094 8465 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965893.1 protein_id gnl|my_center|LOCUS_08820 9210 11201 gene locus_tag LOCUS_08830 9210 11201 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986666.1 protein_id gnl|my_center|LOCUS_08830 11302 11763 gene locus_tag LOCUS_08840 11302 11763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 11845 13026 gene locus_tag LOCUS_08850 11845 13026 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898600.1 protein_id gnl|my_center|LOCUS_08850 13031 13405 gene locus_tag LOCUS_08860 13031 13405 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869964.1 protein_id gnl|my_center|LOCUS_08860 13540 14643 gene locus_tag LOCUS_08870 13540 14643 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002373195.1 protein_id gnl|my_center|LOCUS_08870 14736 15509 gene locus_tag LOCUS_08880 14736 15509 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_08880 >Feature sequence038 54 206 gene locus_tag LOCUS_08890 54 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 880 278 gene locus_tag LOCUS_08900 880 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 1110 898 gene locus_tag LOCUS_08910 1110 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 1306 1136 gene locus_tag LOCUS_08920 1306 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 2512 1631 gene locus_tag LOCUS_08930 gene blaCDD 2512 1631 CDS product CDD family class D beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021358847.1 protein_id gnl|my_center|LOCUS_08930 5025 2572 gene locus_tag LOCUS_08940 gene gyrA 5025 2572 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282864.1 protein_id gnl|my_center|LOCUS_08940 6966 5041 gene locus_tag LOCUS_08950 gene gyrB 6966 5041 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_08950 8063 6966 gene locus_tag LOCUS_08960 gene recF 8063 6966 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288363.1 protein_id gnl|my_center|LOCUS_08960 8269 8063 gene locus_tag LOCUS_08970 gene yaaA 8269 8063 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583899.1 protein_id gnl|my_center|LOCUS_08970 9581 8475 gene locus_tag LOCUS_08980 gene dnaN 9581 8475 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831813.1 protein_id gnl|my_center|LOCUS_08980 11058 9712 gene locus_tag LOCUS_08990 gene dnaA 11058 9712 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873974.1 protein_id gnl|my_center|LOCUS_08990 11532 11666 gene locus_tag LOCUS_09000 11532 11666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 11705 12043 gene locus_tag LOCUS_09010 gene rnpA 11705 12043 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754611.1 protein_id gnl|my_center|LOCUS_09010 12044 12943 gene locus_tag LOCUS_09020 gene spoIIIJ 12044 12943 CDS product YidC family membrane integrase SpoIIIJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727738.1 protein_id gnl|my_center|LOCUS_09020 12953 13555 gene locus_tag LOCUS_09030 12953 13555 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243764.1 protein_id gnl|my_center|LOCUS_09030 13674 13955 gene locus_tag LOCUS_09040 13674 13955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 13960 14316 gene locus_tag LOCUS_09050 gene adhR 13960 14316 CDS product aldehyde stress transcriptional regulator AdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398725.1 protein_id gnl|my_center|LOCUS_09050 14418 15341 gene locus_tag LOCUS_09060 14418 15341 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966232.1 protein_id gnl|my_center|LOCUS_09060 >Feature sequence039 2730 1036 gene locus_tag LOCUS_09070 2730 1036 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721939.1 protein_id gnl|my_center|LOCUS_09070 4014 2956 gene locus_tag LOCUS_09080 4014 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 4597 4007 gene locus_tag LOCUS_09090 gene dpaB 4597 4007 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244650.1 protein_id gnl|my_center|LOCUS_09090 5333 4584 gene locus_tag LOCUS_09100 5333 4584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 5713 5396 gene locus_tag LOCUS_09110 5713 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 5821 6345 gene locus_tag LOCUS_09120 5821 6345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 6999 6445 gene locus_tag LOCUS_09130 6999 6445 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836767.1 protein_id gnl|my_center|LOCUS_09130 7200 7808 gene locus_tag LOCUS_09140 7200 7808 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287046.1 protein_id gnl|my_center|LOCUS_09140 7810 8997 gene locus_tag LOCUS_09150 gene coaBC 7810 8997 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047883.1 protein_id gnl|my_center|LOCUS_09150 8991 9773 gene locus_tag LOCUS_09160 8991 9773 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814936.1 protein_id gnl|my_center|LOCUS_09160 10491 9796 gene locus_tag LOCUS_09170 10491 9796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 11054 10545 gene locus_tag LOCUS_09180 11054 10545 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434028.1 protein_id gnl|my_center|LOCUS_09180 12514 11102 gene locus_tag LOCUS_09190 gene malQ 12514 11102 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003028948.1 protein_id gnl|my_center|LOCUS_09190 13157 12516 gene locus_tag LOCUS_09200 13157 12516 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964931.1 protein_id gnl|my_center|LOCUS_09200 13648 13319 gene locus_tag LOCUS_09210 13648 13319 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_09210 13743 14264 gene locus_tag LOCUS_09220 13743 14264 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002785057.1 protein_id gnl|my_center|LOCUS_09220 15147 14278 gene locus_tag LOCUS_09230 15147 14278 CDS product damage-control phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249335.1 protein_id gnl|my_center|LOCUS_09230 >Feature sequence040 614 1351 gene locus_tag LOCUS_09240 614 1351 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775085.1 protein_id gnl|my_center|LOCUS_09240 1620 2372 gene locus_tag LOCUS_09250 gene fabG 1620 2372 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_09250 2372 4285 gene locus_tag LOCUS_09260 2372 4285 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455018.1 protein_id gnl|my_center|LOCUS_09260 4282 5268 gene locus_tag LOCUS_09270 4282 5268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 5287 6657 gene locus_tag LOCUS_09280 5287 6657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 6751 7269 gene locus_tag LOCUS_09290 6751 7269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 8127 7402 gene locus_tag LOCUS_09300 8127 7402 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948970.1 protein_id gnl|my_center|LOCUS_09300 9014 8127 gene locus_tag LOCUS_09310 9014 8127 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861062.1 protein_id gnl|my_center|LOCUS_09310 10780 9032 gene locus_tag LOCUS_09320 10780 9032 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_09320 12589 10790 gene locus_tag LOCUS_09330 gene nuoF 12589 10790 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868905.1 protein_id gnl|my_center|LOCUS_09330 12969 12601 gene locus_tag LOCUS_09340 12969 12601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082448.1 protein_id gnl|my_center|LOCUS_09340 13499 12966 gene locus_tag LOCUS_09350 13499 12966 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869297.1 protein_id gnl|my_center|LOCUS_09350 14203 13499 gene locus_tag LOCUS_09360 14203 13499 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_09360 14531 14205 gene locus_tag LOCUS_09370 14531 14205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583278.1 protein_id gnl|my_center|LOCUS_09370 <15099 14536 gene locus_tag LOCUS_09380 <15099 14536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583277.1:[Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein >Feature sequence041 559 107 gene locus_tag LOCUS_09390 gene dtd 559 107 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071581519.1 protein_id gnl|my_center|LOCUS_09390 639 1904 gene locus_tag LOCUS_09400 639 1904 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812943.1 protein_id gnl|my_center|LOCUS_09400 2755 1919 gene locus_tag LOCUS_09410 2755 1919 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925959.1 protein_id gnl|my_center|LOCUS_09410 3668 2742 gene locus_tag LOCUS_09420 gene miaA 3668 2742 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504940.1 protein_id gnl|my_center|LOCUS_09420 5509 3668 gene locus_tag LOCUS_09430 gene mutL 5509 3668 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732291.1 protein_id gnl|my_center|LOCUS_09430 8027 5514 gene locus_tag LOCUS_09440 gene mutS 8027 5514 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990113.1 protein_id gnl|my_center|LOCUS_09440 8595 8101 gene locus_tag LOCUS_09450 gene cotE 8595 8101 CDS product outer spore coat protein CotE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288799.1 protein_id gnl|my_center|LOCUS_09450 10217 8703 gene locus_tag LOCUS_09460 10217 8703 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272361.1 protein_id gnl|my_center|LOCUS_09460 10621 10292 gene locus_tag LOCUS_09470 10621 10292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 12056 10611 gene locus_tag LOCUS_09480 gene miaB 12056 10611 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244831.1 protein_id gnl|my_center|LOCUS_09480 12437 12192 gene locus_tag LOCUS_09490 12437 12192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 12788 12528 gene locus_tag LOCUS_09500 gene spoVS 12788 12528 CDS product stage V sporulation protein SpoVS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154135.1 protein_id gnl|my_center|LOCUS_09500 13610 12834 gene locus_tag LOCUS_09510 gene ymdB 13610 12834 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 protein_id gnl|my_center|LOCUS_09510 <15002 13649 gene locus_tag LOCUS_09520 <15002 13649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003721904.1:ribonuclease Y >Feature sequence042 <1 1152 gene locus_tag LOCUS_09530 <1 1152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011101388.1:PRD domain-containing protein 1166 1486 gene locus_tag LOCUS_09540 gene lacF 1166 1486 CDS product PTS lactose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263056.1 protein_id gnl|my_center|LOCUS_09540 1487 3127 gene locus_tag LOCUS_09550 1487 3127 CDS product lactose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027021.1 protein_id gnl|my_center|LOCUS_09550 3129 4532 gene locus_tag LOCUS_09560 gene lacG 3129 4532 CDS product 6-phospho-beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288636.1 protein_id gnl|my_center|LOCUS_09560 4532 6676 gene locus_tag LOCUS_09570 4532 6676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 6688 7965 gene locus_tag LOCUS_09580 gene galK 6688 7965 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263235.1 protein_id gnl|my_center|LOCUS_09580 7979 8953 gene locus_tag LOCUS_09590 gene galE 7979 8953 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966243.1 protein_id gnl|my_center|LOCUS_09590 9217 10146 gene locus_tag LOCUS_09600 9217 10146 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068551.1 protein_id gnl|my_center|LOCUS_09600 10323 11423 gene locus_tag LOCUS_09610 10323 11423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 11433 12785 gene locus_tag LOCUS_09620 11433 12785 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_09620 12782 13822 gene locus_tag LOCUS_09630 12782 13822 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966178.1 protein_id gnl|my_center|LOCUS_09630 14024 14428 gene locus_tag LOCUS_09640 14024 14428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 >Feature sequence043 5279 3054 gene locus_tag LOCUS_09650 5279 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 6431 5292 gene locus_tag LOCUS_09660 6431 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 8680 6443 gene locus_tag LOCUS_09670 8680 6443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 10421 8703 gene locus_tag LOCUS_09680 10421 8703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 10696 10454 gene locus_tag LOCUS_09690 10696 10454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 12246 10708 gene locus_tag LOCUS_09700 12246 10708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 >Feature sequence044 1878 490 gene locus_tag LOCUS_09710 1878 490 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_09710 2958 1972 gene locus_tag LOCUS_09720 2958 1972 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_09720 3639 3085 gene locus_tag LOCUS_09730 3639 3085 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816608.1 protein_id gnl|my_center|LOCUS_09730 4471 4136 gene locus_tag LOCUS_09740 gene gpsB 4471 4136 CDS product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622430.1 protein_id gnl|my_center|LOCUS_09740 4668 5264 gene locus_tag LOCUS_09750 gene recU 4668 5264 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155594.1 protein_id gnl|my_center|LOCUS_09750 5254 7962 gene locus_tag LOCUS_09760 5254 7962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 8629 7985 gene locus_tag LOCUS_09770 gene nth 8629 7985 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831179.1 protein_id gnl|my_center|LOCUS_09770 9215 8622 gene locus_tag LOCUS_09780 gene dnaD 9215 8622 CDS product DNA replication protein DnaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728542.1 protein_id gnl|my_center|LOCUS_09780 9708 9220 gene locus_tag LOCUS_09790 9708 9220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 10499 9792 gene locus_tag LOCUS_09800 10499 9792 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047881.1 protein_id gnl|my_center|LOCUS_09800 10846 10574 gene locus_tag LOCUS_09810 10846 10574 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640587.1 protein_id gnl|my_center|LOCUS_09810 12484 11009 gene locus_tag LOCUS_09820 gene spoIVA 12484 11009 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230572.1 protein_id gnl|my_center|LOCUS_09820 12666 13343 gene locus_tag LOCUS_09830 12666 13343 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_09830 13929 13366 gene locus_tag LOCUS_09840 13929 13366 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948277.1 protein_id gnl|my_center|LOCUS_09840 14480 13926 gene locus_tag LOCUS_09850 14480 13926 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802804.1 protein_id gnl|my_center|LOCUS_09850 >Feature sequence045 877 206 gene locus_tag LOCUS_09860 877 206 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902949.1 protein_id gnl|my_center|LOCUS_09860 2030 951 gene locus_tag LOCUS_09870 2030 951 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356285.1 protein_id gnl|my_center|LOCUS_09870 2200 3018 gene locus_tag LOCUS_09880 gene sufC 2200 3018 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929160.1 protein_id gnl|my_center|LOCUS_09880 3018 3911 gene locus_tag LOCUS_09890 3018 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 3911 5137 gene locus_tag LOCUS_09900 3911 5137 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824500.1 protein_id gnl|my_center|LOCUS_09900 5121 5549 gene locus_tag LOCUS_09910 gene sufU 5121 5549 CDS product iron-sulfur cluster assembly scaffold protein SufU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009523.1 protein_id gnl|my_center|LOCUS_09910 5560 6423 gene locus_tag LOCUS_09920 5560 6423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09920 6454 6966 gene locus_tag LOCUS_09930 6454 6966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09930 6959 7495 gene locus_tag LOCUS_09940 6959 7495 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881124.1 protein_id gnl|my_center|LOCUS_09940 7558 8967 gene locus_tag LOCUS_09950 7558 8967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 9061 11640 gene locus_tag LOCUS_09960 9061 11640 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949094.1 protein_id gnl|my_center|LOCUS_09960 11671 12324 gene locus_tag LOCUS_09970 11671 12324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 12309 13151 gene locus_tag LOCUS_09980 12309 13151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 13194 13679 gene locus_tag LOCUS_09990 13194 13679 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428667.1 protein_id gnl|my_center|LOCUS_09990 13864 14034 gene locus_tag LOCUS_10000 13864 14034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 14279 14206 gene locus_tag LOCUS_t00090 14279 14206 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 14362 14287 gene locus_tag LOCUS_t00100 14362 14287 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence046 <1 1128 gene locus_tag LOCUS_10010 <1 1128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003246556.1:Tex family protein 1140 1871 gene locus_tag LOCUS_10020 1140 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 2810 1902 gene locus_tag LOCUS_10030 gene cysK 2810 1902 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965533.1 protein_id gnl|my_center|LOCUS_10030 2934 4250 gene locus_tag LOCUS_10040 2934 4250 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234223.1 protein_id gnl|my_center|LOCUS_10040 4259 5077 gene locus_tag LOCUS_10050 4259 5077 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074572.1 protein_id gnl|my_center|LOCUS_10050 5145 6593 gene locus_tag LOCUS_10060 5145 6593 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930948.1 protein_id gnl|my_center|LOCUS_10060 7867 6629 gene locus_tag LOCUS_10070 7867 6629 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891452.1 protein_id gnl|my_center|LOCUS_10070 8585 7923 gene locus_tag LOCUS_10080 8585 7923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 8728 9150 gene locus_tag LOCUS_10090 8728 9150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 9293 10576 gene locus_tag LOCUS_10100 9293 10576 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101818.1 protein_id gnl|my_center|LOCUS_10100 11192 10623 gene locus_tag LOCUS_10110 gene def 11192 10623 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957048.1 protein_id gnl|my_center|LOCUS_10110 11466 11254 gene locus_tag LOCUS_10120 11466 11254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 11577 11843 gene locus_tag LOCUS_10130 11577 11843 CDS product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456562.1 protein_id gnl|my_center|LOCUS_10130 11846 13087 gene locus_tag LOCUS_10140 11846 13087 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758411.1 protein_id gnl|my_center|LOCUS_10140 13121 13423 gene locus_tag LOCUS_10150 13121 13423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 13413 13595 gene locus_tag LOCUS_10160 13413 13595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 13597 13944 gene locus_tag LOCUS_10170 13597 13944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 >Feature sequence047 <1 1446 gene locus_tag LOCUS_10180 <1 1446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010990062.1:DNA topoisomerase III 2019 1462 gene locus_tag LOCUS_10190 2019 1462 CDS product DUF4352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903684.1 protein_id gnl|my_center|LOCUS_10190 3155 2088 gene locus_tag LOCUS_10200 3155 2088 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989529.1 protein_id gnl|my_center|LOCUS_10200 3212 3625 gene locus_tag LOCUS_10210 3212 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722815.1 protein_id gnl|my_center|LOCUS_10210 4510 3626 gene locus_tag LOCUS_10220 4510 3626 CDS product radical SAM mobile pair protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679438.1 protein_id gnl|my_center|LOCUS_10220 5427 4507 gene locus_tag LOCUS_10230 5427 4507 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814554.1 protein_id gnl|my_center|LOCUS_10230 5885 5424 gene locus_tag LOCUS_10240 5885 5424 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814104.1 protein_id gnl|my_center|LOCUS_10240 7056 5998 gene locus_tag LOCUS_10250 gene recA 7056 5998 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287328.1 protein_id gnl|my_center|LOCUS_10250 7552 7094 gene locus_tag LOCUS_10260 7552 7094 CDS product nicotinamide-nucleotide amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013447851.1 protein_id gnl|my_center|LOCUS_10260 8145 7552 gene locus_tag LOCUS_10270 gene pgsA 8145 7552 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723921.1 protein_id gnl|my_center|LOCUS_10270 9131 8145 gene locus_tag LOCUS_10280 9131 8145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 10605 9460 gene locus_tag LOCUS_10290 gene fucO 10605 9460 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288246.1 protein_id gnl|my_center|LOCUS_10290 13307 11739 gene locus_tag LOCUS_10300 13307 11739 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000607108.1 protein_id gnl|my_center|LOCUS_10300 13993 14247 gene locus_tag LOCUS_10310 13993 14247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 >Feature sequence048 661 1995 gene locus_tag LOCUS_10320 gene mnmE 661 1995 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131240.1 protein_id gnl|my_center|LOCUS_10320 1961 2224 gene locus_tag LOCUS_10330 1961 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 2233 3132 gene locus_tag LOCUS_10340 2233 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 4459 3116 gene locus_tag LOCUS_10350 4459 3116 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963782.1 protein_id gnl|my_center|LOCUS_10350 5796 4576 gene locus_tag LOCUS_10360 5796 4576 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272444.1 protein_id gnl|my_center|LOCUS_10360 6562 5789 gene locus_tag LOCUS_10370 6562 5789 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678767.1 protein_id gnl|my_center|LOCUS_10370 7517 6729 gene locus_tag LOCUS_10380 7517 6729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 7867 7517 gene locus_tag LOCUS_10390 7867 7517 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222779.1 protein_id gnl|my_center|LOCUS_10390 8016 9908 gene locus_tag LOCUS_10400 8016 9908 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861809.1 protein_id gnl|my_center|LOCUS_10400 9919 10503 gene locus_tag LOCUS_10410 9919 10503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 10580 10900 gene locus_tag LOCUS_10420 10580 10900 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722125.1 protein_id gnl|my_center|LOCUS_10420 10949 11272 gene locus_tag LOCUS_10430 10949 11272 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425440.1 protein_id gnl|my_center|LOCUS_10430 11297 12664 gene locus_tag LOCUS_10440 gene celB 11297 12664 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901597.1 protein_id gnl|my_center|LOCUS_10440 12685 13206 gene locus_tag LOCUS_10450 12685 13206 CDS product GrdB-related putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860643.1 protein_id gnl|my_center|LOCUS_10450 13264 14220 gene locus_tag LOCUS_10460 13264 14220 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895213.1 protein_id gnl|my_center|LOCUS_10460 >Feature sequence049 198 1085 gene locus_tag LOCUS_10470 198 1085 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102012.1 protein_id gnl|my_center|LOCUS_10470 1184 2398 gene locus_tag LOCUS_10480 1184 2398 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002351560.1 protein_id gnl|my_center|LOCUS_10480 3253 3882 gene locus_tag LOCUS_10490 3253 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 4293 5261 gene locus_tag LOCUS_10500 4293 5261 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803888.1 protein_id gnl|my_center|LOCUS_10500 5308 6639 gene locus_tag LOCUS_10510 5308 6639 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020392.1 protein_id gnl|my_center|LOCUS_10510 6721 6954 gene locus_tag LOCUS_10520 6721 6954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 7480 7118 gene locus_tag LOCUS_10530 7480 7118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 8450 7716 gene locus_tag LOCUS_10540 8450 7716 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898159.1 protein_id gnl|my_center|LOCUS_10540 8657 10543 gene locus_tag LOCUS_10550 gene mngA 8657 10543 CDS product PTS 2-O-a-mannosyl-D-glycerate transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861812.1 protein_id gnl|my_center|LOCUS_10550 10554 13124 gene locus_tag LOCUS_10560 gene mngB 10554 13124 CDS product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861811.1 protein_id gnl|my_center|LOCUS_10560 >Feature sequence050 246 37 gene locus_tag LOCUS_10570 246 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 602 198 gene locus_tag LOCUS_10580 602 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 1426 620 gene locus_tag LOCUS_10590 1426 620 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896027.1 protein_id gnl|my_center|LOCUS_10590 2062 1556 gene locus_tag LOCUS_10600 2062 1556 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399375.1 protein_id gnl|my_center|LOCUS_10600 2448 2116 gene locus_tag LOCUS_10610 2448 2116 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272275.1 protein_id gnl|my_center|LOCUS_10610 3473 2445 gene locus_tag LOCUS_10620 3473 2445 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948151.1 protein_id gnl|my_center|LOCUS_10620 4152 3487 gene locus_tag LOCUS_10630 4152 3487 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_10630 4642 4244 gene locus_tag LOCUS_10640 4642 4244 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477396.1 protein_id gnl|my_center|LOCUS_10640 5392 4655 gene locus_tag LOCUS_10650 5392 4655 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020462.1 protein_id gnl|my_center|LOCUS_10650 5729 5379 gene locus_tag LOCUS_10660 5729 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 6714 5833 gene locus_tag LOCUS_10670 6714 5833 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_10670 6910 7269 gene locus_tag LOCUS_10680 6910 7269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 7330 7677 gene locus_tag LOCUS_10690 7330 7677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 8810 7698 gene locus_tag LOCUS_10700 8810 7698 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062822309.1 protein_id gnl|my_center|LOCUS_10700 8928 9428 gene locus_tag LOCUS_10710 8928 9428 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064860.1 protein_id gnl|my_center|LOCUS_10710 9467 10348 gene locus_tag LOCUS_10720 9467 10348 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289172.1 protein_id gnl|my_center|LOCUS_10720 10405 10480 gene locus_tag LOCUS_t00110 10405 10480 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 10765 10690 gene locus_tag LOCUS_t00120 10765 10690 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 10825 12237 gene locus_tag LOCUS_10730 gene gltX 10825 12237 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_10730 13409 12426 gene locus_tag LOCUS_10740 13409 12426 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964851.1 protein_id gnl|my_center|LOCUS_10740 14090 13461 gene locus_tag LOCUS_10750 14090 13461 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548076.1 protein_id gnl|my_center|LOCUS_10750 >Feature sequence051 1246 917 gene locus_tag LOCUS_10760 1246 917 CDS product YlxQ family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020853.1 protein_id gnl|my_center|LOCUS_10760 1463 1206 gene locus_tag LOCUS_10770 gene rulR 1463 1206 CDS product glucose-induced regulator RulR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967250.1 protein_id gnl|my_center|LOCUS_10770 2798 1476 gene locus_tag LOCUS_10780 gene nusA 2798 1476 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_10780 3279 2812 gene locus_tag LOCUS_10790 gene rimP 3279 2812 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231915.1 protein_id gnl|my_center|LOCUS_10790 7694 3378 gene locus_tag LOCUS_10800 7694 3378 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204669935.1 protein_id gnl|my_center|LOCUS_10800 8830 7757 gene locus_tag LOCUS_10810 gene rseP 8830 7757 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583162.1 protein_id gnl|my_center|LOCUS_10810 9981 8830 gene locus_tag LOCUS_10820 gene dxr 9981 8830 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790373.1 protein_id gnl|my_center|LOCUS_10820 10766 9984 gene locus_tag LOCUS_10830 gene cdsA 10766 9984 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231924.1 protein_id gnl|my_center|LOCUS_10830 11518 10766 gene locus_tag LOCUS_10840 11518 10766 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473699.1 protein_id gnl|my_center|LOCUS_10840 12174 11629 gene locus_tag LOCUS_10850 gene frr 12174 11629 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 protein_id gnl|my_center|LOCUS_10850 12892 12176 gene locus_tag LOCUS_10860 gene pyrH 12892 12176 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565806.1 protein_id gnl|my_center|LOCUS_10860 13968 13081 gene locus_tag LOCUS_10870 gene tsf 13968 13081 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356760.1 protein_id gnl|my_center|LOCUS_10870 >Feature sequence052 1957 1307 gene locus_tag LOCUS_10880 gene pgmB 1957 1307 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387394.1 protein_id gnl|my_center|LOCUS_10880 4636 1973 gene locus_tag LOCUS_10890 4636 1973 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189781.1 protein_id gnl|my_center|LOCUS_10890 5577 4870 gene locus_tag LOCUS_10900 gene treR 5577 4870 CDS product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405408.1 protein_id gnl|my_center|LOCUS_10900 5793 6563 gene locus_tag LOCUS_10910 5793 6563 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963763.1 protein_id gnl|my_center|LOCUS_10910 6635 6979 gene locus_tag LOCUS_10920 6635 6979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 7149 8207 gene locus_tag LOCUS_10930 7149 8207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 9274 8225 gene locus_tag LOCUS_10940 9274 8225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 9484 9409 gene locus_tag LOCUS_t00130 9484 9409 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 9779 9970 gene locus_tag LOCUS_10950 9779 9970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 10120 10045 gene locus_tag LOCUS_t00140 10120 10045 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 10259 10807 gene locus_tag LOCUS_10960 10259 10807 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461300.1 protein_id gnl|my_center|LOCUS_10960 11177 10836 gene locus_tag LOCUS_10970 11177 10836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 11460 11663 gene locus_tag LOCUS_10980 11460 11663 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563620.1 protein_id gnl|my_center|LOCUS_10980 11764 12558 gene locus_tag LOCUS_10990 11764 12558 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582683.1 protein_id gnl|my_center|LOCUS_10990 >Feature sequence053 49 414 gene locus_tag LOCUS_11000 49 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 1169 507 gene locus_tag LOCUS_11010 1169 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 1340 1888 gene locus_tag LOCUS_11020 1340 1888 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564519.1 protein_id gnl|my_center|LOCUS_11020 1885 3510 gene locus_tag LOCUS_11030 1885 3510 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486487.1 protein_id gnl|my_center|LOCUS_11030 4951 3539 gene locus_tag LOCUS_11040 4951 3539 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048735.1 protein_id gnl|my_center|LOCUS_11040 6578 5046 gene locus_tag LOCUS_11050 gene celB 6578 5046 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242539.1 protein_id gnl|my_center|LOCUS_11050 8449 6575 gene locus_tag LOCUS_11060 gene licR 8449 6575 CDS product transcriptional regulator LicR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243034.1 protein_id gnl|my_center|LOCUS_11060 9838 8528 gene locus_tag LOCUS_11070 gene licC 9838 8528 CDS product PTS lichenan transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243273.1 protein_id gnl|my_center|LOCUS_11070 10050 10556 gene locus_tag LOCUS_11080 10050 10556 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355209.1 protein_id gnl|my_center|LOCUS_11080 10553 11806 gene locus_tag LOCUS_11090 gene hemW 10553 11806 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181861.1 protein_id gnl|my_center|LOCUS_11090 12755 11835 gene locus_tag LOCUS_11100 12755 11835 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966649.1 protein_id gnl|my_center|LOCUS_11100 <13967 13071 gene locus_tag LOCUS_11110 <13967 13071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011921815.1:PTS system trehalose-specific EIIBC component >Feature sequence054 <1 1191 gene locus_tag LOCUS_11120 <1 1191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003228330.1:2,3-bisphosphoglycerate-independent phosphoglycerate mutase 1191 1706 gene locus_tag LOCUS_11130 1191 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 1715 2575 gene locus_tag LOCUS_11140 1715 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 2986 2633 gene locus_tag LOCUS_11150 2986 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 3208 3915 gene locus_tag LOCUS_11160 3208 3915 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181710.1 protein_id gnl|my_center|LOCUS_11160 3920 4879 gene locus_tag LOCUS_11170 gene pfkA 3920 4879 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821163.1 protein_id gnl|my_center|LOCUS_11170 4892 5677 gene locus_tag LOCUS_11180 4892 5677 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594240.1 protein_id gnl|my_center|LOCUS_11180 5689 6750 gene locus_tag LOCUS_11190 gene hisC 5689 6750 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905826.1 protein_id gnl|my_center|LOCUS_11190 7486 6758 gene locus_tag LOCUS_11200 gene yaaA 7486 6758 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458998.1 protein_id gnl|my_center|LOCUS_11200 7552 8559 gene locus_tag LOCUS_11210 7552 8559 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387246.1 protein_id gnl|my_center|LOCUS_11210 12288 8587 gene locus_tag LOCUS_11220 gene addA 12288 8587 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989936.1 protein_id gnl|my_center|LOCUS_11220 <13827 12278 gene locus_tag LOCUS_11230 <13827 12278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861078.1:helicase-exonuclease AddAB subunit AddB >Feature sequence055 2032 59 gene locus_tag LOCUS_11240 gene uvrB 2032 59 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 protein_id gnl|my_center|LOCUS_11240 3615 2158 gene locus_tag LOCUS_11250 3615 2158 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101574.1 protein_id gnl|my_center|LOCUS_11250 4594 3836 gene locus_tag LOCUS_11260 4594 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 5594 4629 gene locus_tag LOCUS_11270 5594 4629 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715326.1 protein_id gnl|my_center|LOCUS_11270 6502 5681 gene locus_tag LOCUS_11280 6502 5681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 6638 7504 gene locus_tag LOCUS_11290 gene yidA 6638 7504 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243315.1 protein_id gnl|my_center|LOCUS_11290 7519 8400 gene locus_tag LOCUS_11300 7519 8400 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354705.1 protein_id gnl|my_center|LOCUS_11300 9564 8455 gene locus_tag LOCUS_11310 gene nspC 9564 8455 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461405.1 protein_id gnl|my_center|LOCUS_11310 10766 9564 gene locus_tag LOCUS_11320 10766 9564 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088780.1 protein_id gnl|my_center|LOCUS_11320 11627 10767 gene locus_tag LOCUS_11330 gene speB 11627 10767 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888724.1 protein_id gnl|my_center|LOCUS_11330 12468 11617 gene locus_tag LOCUS_11340 gene speE 12468 11617 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808145.1 protein_id gnl|my_center|LOCUS_11340 <13220 12471 gene locus_tag LOCUS_11350 <13220 12471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808143.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme >Feature sequence056 3 1904 gene locus_tag LOCUS_11360 3 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 1907 2512 gene locus_tag LOCUS_11370 1907 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 3048 4277 gene locus_tag LOCUS_11380 3048 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 4252 4671 gene locus_tag LOCUS_11390 4252 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 4720 4905 gene locus_tag LOCUS_11400 4720 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 5087 6604 gene locus_tag LOCUS_11410 5087 6604 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964065.1 protein_id gnl|my_center|LOCUS_11410 7708 6683 gene locus_tag LOCUS_11420 gene rfbB 7708 6683 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_11420 8284 7709 gene locus_tag LOCUS_11430 gene rfbC 8284 7709 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286442.1 protein_id gnl|my_center|LOCUS_11430 9177 8296 gene locus_tag LOCUS_11440 gene rfbA 9177 8296 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857520.1 protein_id gnl|my_center|LOCUS_11440 10459 9332 gene locus_tag LOCUS_11450 10459 9332 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948530.1 protein_id gnl|my_center|LOCUS_11450 10658 11500 gene locus_tag LOCUS_11460 10658 11500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 12035 12211 gene locus_tag LOCUS_11470 12035 12211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 >Feature sequence057 282 1055 gene locus_tag LOCUS_11480 282 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 1495 2316 gene locus_tag LOCUS_11490 1495 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 4082 2958 gene locus_tag LOCUS_11500 4082 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 4488 4779 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttaacatcaacattatatgtatttaaat 5565 5711 gene locus_tag LOCUS_11510 5565 5711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 6197 5847 gene locus_tag LOCUS_tm00010 6197 5847 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 6645 6199 gene locus_tag LOCUS_11520 gene smpB 6645 6199 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815658.1 protein_id gnl|my_center|LOCUS_11520 8933 6666 gene locus_tag LOCUS_11530 gene rnr 8933 6666 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391086.1 protein_id gnl|my_center|LOCUS_11530 9212 8982 gene locus_tag LOCUS_11540 9212 8982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 9788 9306 gene locus_tag LOCUS_11550 9788 9306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 11457 9781 gene locus_tag LOCUS_11560 11457 9781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 11563 12705 gene locus_tag LOCUS_11570 11563 12705 CDS product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440077.1 protein_id gnl|my_center|LOCUS_11570 >Feature sequence058 <1 605 gene locus_tag LOCUS_11580 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003435927.1:ABC transporter permease 3515 711 gene locus_tag LOCUS_11590 3515 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 4385 3612 gene locus_tag LOCUS_11600 4385 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 4572 4817 gene locus_tag LOCUS_11610 4572 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 5431 4841 gene locus_tag LOCUS_11620 5431 4841 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830164.1 protein_id gnl|my_center|LOCUS_11620 6069 5428 gene locus_tag LOCUS_11630 gene rpe 6069 5428 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166502.1 protein_id gnl|my_center|LOCUS_11630 6937 6062 gene locus_tag LOCUS_11640 gene rsgA 6937 6062 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232060.1 protein_id gnl|my_center|LOCUS_11640 8926 6947 gene locus_tag LOCUS_11650 gene pknB 8926 6947 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614552.1 protein_id gnl|my_center|LOCUS_11650 9665 8928 gene locus_tag LOCUS_11660 gene prpC 9665 8928 CDS product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 protein_id gnl|my_center|LOCUS_11660 10693 9665 gene locus_tag LOCUS_11670 gene rlmN 10693 9665 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356987.1 protein_id gnl|my_center|LOCUS_11670 11948 10695 gene locus_tag LOCUS_11680 gene rsmB 11948 10695 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249665.1 protein_id gnl|my_center|LOCUS_11680 <12847 11961 gene locus_tag LOCUS_11690 <12847 11961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001830152.1:primosomal protein N' >Feature sequence059 227 42 gene locus_tag LOCUS_11700 227 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 849 250 gene locus_tag LOCUS_11710 gene pgpB 849 250 CDS product phosphatidylglycerophosphatase PgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399336.1 protein_id gnl|my_center|LOCUS_11710 1481 936 gene locus_tag LOCUS_11720 gene cysE 1481 936 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476500.1 protein_id gnl|my_center|LOCUS_11720 2789 1797 gene locus_tag LOCUS_11730 2789 1797 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964797.1 protein_id gnl|my_center|LOCUS_11730 2907 3197 gene locus_tag LOCUS_11740 2907 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 4428 3226 gene locus_tag LOCUS_11750 4428 3226 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272771.1 protein_id gnl|my_center|LOCUS_11750 5674 4430 gene locus_tag LOCUS_11760 5674 4430 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928471.1 protein_id gnl|my_center|LOCUS_11760 7460 5799 gene locus_tag LOCUS_11770 7460 5799 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913630.1 protein_id gnl|my_center|LOCUS_11770 8452 7478 gene locus_tag LOCUS_11780 8452 7478 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519085.1 protein_id gnl|my_center|LOCUS_11780 9466 8456 gene locus_tag LOCUS_11790 9466 8456 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966904.1 protein_id gnl|my_center|LOCUS_11790 10411 9482 gene locus_tag LOCUS_11800 10411 9482 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966905.1 protein_id gnl|my_center|LOCUS_11800 11341 10424 gene locus_tag LOCUS_11810 11341 10424 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811999.1 protein_id gnl|my_center|LOCUS_11810 12121 11588 gene locus_tag LOCUS_11820 12121 11588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 <12667 12105 gene locus_tag LOCUS_11830 <12667 12105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009889235.1:ribonuclease H family protein >Feature sequence060 1424 342 gene locus_tag LOCUS_11840 gene leuB 1424 342 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_11840 1907 1425 gene locus_tag LOCUS_11850 gene leuD 1907 1425 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_11850 3181 1907 gene locus_tag LOCUS_11860 gene leuC 3181 1907 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_11860 4290 3274 gene locus_tag LOCUS_11870 gene ilvC 4290 3274 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081338.1 protein_id gnl|my_center|LOCUS_11870 4818 4309 gene locus_tag LOCUS_11880 gene ilvN 4818 4309 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_11880 6515 4839 gene locus_tag LOCUS_11890 gene leuA 6515 4839 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963596.1 protein_id gnl|my_center|LOCUS_11890 9684 6982 gene locus_tag LOCUS_11900 9684 6982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 10329 9802 gene locus_tag LOCUS_11910 10329 9802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 >Feature sequence061 70 258 gene locus_tag LOCUS_11920 70 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 359 2365 gene locus_tag LOCUS_11930 359 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 2503 2910 gene locus_tag LOCUS_11940 2503 2910 CDS product PTS mannose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354802.1 protein_id gnl|my_center|LOCUS_11940 2924 3415 gene locus_tag LOCUS_11950 2924 3415 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287026.1 protein_id gnl|my_center|LOCUS_11950 3429 4235 gene locus_tag LOCUS_11960 3429 4235 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888882.1 protein_id gnl|my_center|LOCUS_11960 4232 5059 gene locus_tag LOCUS_11970 4232 5059 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287022.1 protein_id gnl|my_center|LOCUS_11970 5074 6255 gene locus_tag LOCUS_11980 gene nagA 5074 6255 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170470.1 protein_id gnl|my_center|LOCUS_11980 6468 7448 gene locus_tag LOCUS_11990 gene dusB 6468 7448 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912262.1 protein_id gnl|my_center|LOCUS_11990 7473 8333 gene locus_tag LOCUS_12000 gene folD 7473 8333 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226720.1 protein_id gnl|my_center|LOCUS_12000 8323 8505 gene locus_tag LOCUS_12010 8323 8505 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704318.1 protein_id gnl|my_center|LOCUS_12010 8758 10227 gene locus_tag LOCUS_12020 8758 10227 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680980.1 protein_id gnl|my_center|LOCUS_12020 10773 10285 gene locus_tag LOCUS_12030 10773 10285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 11007 11744 gene locus_tag LOCUS_12040 11007 11744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 >Feature sequence062 <1 762 gene locus_tag LOCUS_12050 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009897173.1:ABC transporter ATP-binding protein 759 1433 gene locus_tag LOCUS_12060 759 1433 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459560.1 protein_id gnl|my_center|LOCUS_12060 5821 1586 gene locus_tag LOCUS_12070 5821 1586 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965697.1 protein_id gnl|my_center|LOCUS_12070 6262 5831 gene locus_tag LOCUS_12080 6262 5831 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966683.1 protein_id gnl|my_center|LOCUS_12080 7793 6426 gene locus_tag LOCUS_12090 7793 6426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 8725 7913 gene locus_tag LOCUS_12100 gene srtB 8725 7913 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989918.1 protein_id gnl|my_center|LOCUS_12100 9825 8725 gene locus_tag LOCUS_12110 gene ychF 9825 8725 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293105.1 protein_id gnl|my_center|LOCUS_12110 9932 10156 gene locus_tag LOCUS_12120 9932 10156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 10166 10645 gene locus_tag LOCUS_12130 10166 10645 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286782.1 protein_id gnl|my_center|LOCUS_12130 10662 11657 gene locus_tag LOCUS_12140 10662 11657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 >Feature sequence063 914 2059 gene locus_tag LOCUS_12150 914 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 2062 3189 gene locus_tag LOCUS_12160 2062 3189 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107235.1 protein_id gnl|my_center|LOCUS_12160 3189 4121 gene locus_tag LOCUS_12170 3189 4121 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201897.1 protein_id gnl|my_center|LOCUS_12170 4225 5631 gene locus_tag LOCUS_12180 4225 5631 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091276.1 protein_id gnl|my_center|LOCUS_12180 6718 7257 gene locus_tag LOCUS_12190 gene vpsC 6718 7257 CDS product exopolysaccharide biosynthesis acetyltransferase VpsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098186.1 protein_id gnl|my_center|LOCUS_12190 8849 8544 gene locus_tag LOCUS_12200 8849 8544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 9126 8839 gene locus_tag LOCUS_12210 9126 8839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 9318 9851 gene locus_tag LOCUS_12220 9318 9851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 9902 10078 gene locus_tag LOCUS_12230 9902 10078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 10075 10206 gene locus_tag LOCUS_12240 10075 10206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 11369 10260 gene locus_tag LOCUS_12250 gene ald 11369 10260 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459459.1 protein_id gnl|my_center|LOCUS_12250 >Feature sequence064 2015 1482 gene locus_tag LOCUS_12260 gene atpH 2015 1482 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064683.1 protein_id gnl|my_center|LOCUS_12260 2518 2015 gene locus_tag LOCUS_12270 gene atpF 2518 2015 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244051.1 protein_id gnl|my_center|LOCUS_12270 2767 2540 gene locus_tag LOCUS_12280 2767 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 3471 2806 gene locus_tag LOCUS_12290 gene atpB 3471 2806 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437836.1 protein_id gnl|my_center|LOCUS_12290 3834 3475 gene locus_tag LOCUS_12300 3834 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 4459 3836 gene locus_tag LOCUS_12310 gene upp 4459 3836 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514490.1 protein_id gnl|my_center|LOCUS_12310 5710 4472 gene locus_tag LOCUS_12320 gene glyA 5710 4472 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227669.1 protein_id gnl|my_center|LOCUS_12320 6152 5712 gene locus_tag LOCUS_12330 gene rpiB 6152 5712 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952859.1 protein_id gnl|my_center|LOCUS_12330 6754 6149 gene locus_tag LOCUS_12340 6754 6149 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922372.1 protein_id gnl|my_center|LOCUS_12340 6989 7609 gene locus_tag LOCUS_12350 6989 7609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 7998 8990 gene locus_tag LOCUS_12360 7998 8990 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023905931.1 protein_id gnl|my_center|LOCUS_12360 10052 9357 gene locus_tag LOCUS_12370 10052 9357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 10924 10142 gene locus_tag LOCUS_12380 10924 10142 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917001.1 protein_id gnl|my_center|LOCUS_12380 11410 10934 gene locus_tag LOCUS_12390 gene pssE 11410 10934 CDS product PssE/Cps14G family polysaccharide biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990828.1 protein_id gnl|my_center|LOCUS_12390 >Feature sequence065 195 67 gene locus_tag LOCUS_12400 195 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 615 385 gene locus_tag LOCUS_12410 gene rpsR 615 385 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831354.1 protein_id gnl|my_center|LOCUS_12410 1109 633 gene locus_tag LOCUS_12420 gene ssb 1109 633 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934799.1 protein_id gnl|my_center|LOCUS_12420 1403 1122 gene locus_tag LOCUS_12430 gene rpsF 1403 1122 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233779.1 protein_id gnl|my_center|LOCUS_12430 2872 1538 gene locus_tag LOCUS_12440 2872 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 3506 2847 gene locus_tag LOCUS_12450 gene ispD 3506 2847 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235019.1 protein_id gnl|my_center|LOCUS_12450 3663 4547 gene locus_tag LOCUS_12460 3663 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 4540 5112 gene locus_tag LOCUS_12470 4540 5112 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905527.1 protein_id gnl|my_center|LOCUS_12470 7130 5139 gene locus_tag LOCUS_12480 7130 5139 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852743.1 protein_id gnl|my_center|LOCUS_12480 8212 7217 gene locus_tag LOCUS_12490 8212 7217 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898522.1 protein_id gnl|my_center|LOCUS_12490 8648 8286 gene locus_tag LOCUS_12500 8648 8286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 8724 9425 gene locus_tag LOCUS_12510 8724 9425 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186843528.1 protein_id gnl|my_center|LOCUS_12510 9418 9933 gene locus_tag LOCUS_12520 9418 9933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 10094 10255 gene locus_tag LOCUS_12530 10094 10255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 10281 10616 gene locus_tag LOCUS_12540 10281 10616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 11138 10839 gene locus_tag LOCUS_12550 11138 10839 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837349.1 protein_id gnl|my_center|LOCUS_12550 11471 11196 gene locus_tag LOCUS_12560 11471 11196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 >Feature sequence066 1078 407 gene locus_tag LOCUS_12570 gene natR 1078 407 CDS product two-component system response regulator NatR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234759.1 protein_id gnl|my_center|LOCUS_12570 1767 1081 gene locus_tag LOCUS_12580 1767 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 1909 3768 gene locus_tag LOCUS_12590 1909 3768 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146623251.1 protein_id gnl|my_center|LOCUS_12590 4099 3818 gene locus_tag LOCUS_12600 4099 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 4699 4118 gene locus_tag LOCUS_12610 4699 4118 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402394.1 protein_id gnl|my_center|LOCUS_12610 5524 4841 gene locus_tag LOCUS_12620 5524 4841 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861321.1 protein_id gnl|my_center|LOCUS_12620 5872 7161 gene locus_tag LOCUS_12630 5872 7161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 7187 8623 gene locus_tag LOCUS_12640 7187 8623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 9335 8646 gene locus_tag LOCUS_12650 9335 8646 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948727.1 protein_id gnl|my_center|LOCUS_12650 10148 9339 gene locus_tag LOCUS_12660 10148 9339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 11020 10148 gene locus_tag LOCUS_12670 11020 10148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 >Feature sequence067 <1 5441 gene locus_tag LOCUS_12680 <1 5441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256318.1:SdrD B-like domain-containing protein 5551 7413 gene locus_tag LOCUS_12690 5551 7413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 7560 8738 gene locus_tag LOCUS_12700 7560 8738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 8798 10861 gene locus_tag LOCUS_12710 8798 10861 CDS product peptide cleavage/export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476660.1 protein_id gnl|my_center|LOCUS_12710 10864 11337 gene locus_tag LOCUS_12720 gene ybeY 10864 11337 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054692.1 protein_id gnl|my_center|LOCUS_12720 >Feature sequence068 525 40 gene locus_tag LOCUS_12730 525 40 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461289.1 protein_id gnl|my_center|LOCUS_12730 1519 593 gene locus_tag LOCUS_12740 1519 593 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949052.1 protein_id gnl|my_center|LOCUS_12740 2165 1878 gene locus_tag LOCUS_12750 2165 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 3520 2264 gene locus_tag LOCUS_12760 3520 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 7512 3517 gene locus_tag LOCUS_12770 7512 3517 CDS product TIGR02680 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459216.1 protein_id gnl|my_center|LOCUS_12770 8629 7514 gene locus_tag LOCUS_12780 8629 7514 CDS product TIGR02678 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068556302.1 protein_id gnl|my_center|LOCUS_12780 10109 8601 gene locus_tag LOCUS_12790 10109 8601 CDS product TIGR02677 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459214.1 protein_id gnl|my_center|LOCUS_12790 <10882 10193 gene locus_tag LOCUS_12800 <10882 10193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393897.1:thioredoxin-disulfide reductase >Feature sequence069 2380 1019 gene locus_tag LOCUS_12810 gene trkA 2380 1019 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_12810 3300 2638 gene locus_tag LOCUS_12820 gene ktrA 3300 2638 CDS product potassium uptake transporter gating subunit KtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991064.1 protein_id gnl|my_center|LOCUS_12820 4715 3312 gene locus_tag LOCUS_12830 4715 3312 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897705.1 protein_id gnl|my_center|LOCUS_12830 6298 4712 gene locus_tag LOCUS_12840 6298 4712 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861896.1 protein_id gnl|my_center|LOCUS_12840 7412 6285 gene locus_tag LOCUS_12850 7412 6285 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_12850 7649 8383 gene locus_tag LOCUS_12860 7649 8383 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073261.1 protein_id gnl|my_center|LOCUS_12860 8408 9070 gene locus_tag LOCUS_12870 8408 9070 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815292.1 protein_id gnl|my_center|LOCUS_12870 9067 9483 gene locus_tag LOCUS_12880 9067 9483 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289317.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence070 1850 33 gene locus_tag LOCUS_12890 gene glmS 1850 33 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_12890 2286 2804 gene locus_tag LOCUS_12900 2286 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 4136 2946 gene locus_tag LOCUS_12910 4136 2946 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989750.1 protein_id gnl|my_center|LOCUS_12910 4267 4857 gene locus_tag LOCUS_12920 4267 4857 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_12920 5078 5605 gene locus_tag LOCUS_12930 5078 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 5709 6245 gene locus_tag LOCUS_12940 5709 6245 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223272.1 protein_id gnl|my_center|LOCUS_12940 6255 6704 gene locus_tag LOCUS_12950 gene tsaE 6255 6704 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234079.1 protein_id gnl|my_center|LOCUS_12950 6701 7303 gene locus_tag LOCUS_12960 gene tsaB 6701 7303 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166509.1 protein_id gnl|my_center|LOCUS_12960 7297 7752 gene locus_tag LOCUS_12970 gene rimI 7297 7752 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367197.1 protein_id gnl|my_center|LOCUS_12970 7743 8777 gene locus_tag LOCUS_12980 gene tsaD 7743 8777 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244138.1 protein_id gnl|my_center|LOCUS_12980 8770 9399 gene locus_tag LOCUS_12990 8770 9399 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722329.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence071 2 685 gene locus_tag LOCUS_13000 2 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 2030 699 gene locus_tag LOCUS_13010 2030 699 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_13010 2271 3341 gene locus_tag LOCUS_13020 2271 3341 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109323.1 protein_id gnl|my_center|LOCUS_13020 3495 4493 gene locus_tag LOCUS_13030 3495 4493 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896952.1 protein_id gnl|my_center|LOCUS_13030 4634 6544 gene locus_tag LOCUS_13040 4634 6544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 6554 7954 gene locus_tag LOCUS_13050 gene sacA 6554 7954 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886636.1 protein_id gnl|my_center|LOCUS_13050 8534 9391 gene locus_tag LOCUS_13060 8534 9391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 10309 10512 gene locus_tag LOCUS_13070 10309 10512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 >Feature sequence072 485 1396 gene locus_tag LOCUS_13080 gene nadA 485 1396 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454668.1 protein_id gnl|my_center|LOCUS_13080 1409 2716 gene locus_tag LOCUS_13090 1409 2716 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430790.1 protein_id gnl|my_center|LOCUS_13090 2688 3545 gene locus_tag LOCUS_13100 gene nadC 2688 3545 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360683.1 protein_id gnl|my_center|LOCUS_13100 3976 3572 gene locus_tag LOCUS_13110 3976 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 4098 5456 gene locus_tag LOCUS_13120 4098 5456 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199961.1 protein_id gnl|my_center|LOCUS_13120 6119 5529 gene locus_tag LOCUS_13130 6119 5529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 6753 6106 gene locus_tag LOCUS_13140 6753 6106 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986113.1 protein_id gnl|my_center|LOCUS_13140 7831 6806 gene locus_tag LOCUS_13150 gene queA 7831 6806 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354028.1 protein_id gnl|my_center|LOCUS_13150 8968 7832 gene locus_tag LOCUS_13160 gene tgt 8968 7832 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112045.1 protein_id gnl|my_center|LOCUS_13160 9841 9053 gene locus_tag LOCUS_13170 9841 9053 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965542.1 protein_id gnl|my_center|LOCUS_13170 10547 9891 gene locus_tag LOCUS_13180 10547 9891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 >Feature sequence073 1181 942 gene locus_tag LOCUS_13190 1181 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13190 1356 1144 gene locus_tag LOCUS_13200 1356 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13200 4090 1523 gene locus_tag LOCUS_13210 gene clpB 4090 1523 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_13210 4431 4243 gene locus_tag LOCUS_13220 4431 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 4625 4792 gene locus_tag LOCUS_13230 4625 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 7375 4871 gene locus_tag LOCUS_13240 7375 4871 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814229.1 protein_id gnl|my_center|LOCUS_13240 8052 7378 gene locus_tag LOCUS_13250 8052 7378 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020493338.1 protein_id gnl|my_center|LOCUS_13250 9085 8165 gene locus_tag LOCUS_13260 9085 8165 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943877.1 protein_id gnl|my_center|LOCUS_13260 9778 9086 gene locus_tag LOCUS_13270 9778 9086 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459494.1 protein_id gnl|my_center|LOCUS_13270 10303 10163 gene locus_tag LOCUS_13280 10303 10163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 >Feature sequence074 1735 323 gene locus_tag LOCUS_13290 1735 323 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546946.1 protein_id gnl|my_center|LOCUS_13290 1918 2787 gene locus_tag LOCUS_13300 1918 2787 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354705.1 protein_id gnl|my_center|LOCUS_13300 3629 2979 gene locus_tag LOCUS_13310 3629 2979 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102032.1 protein_id gnl|my_center|LOCUS_13310 3866 5257 gene locus_tag LOCUS_13320 3866 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 6429 5314 gene locus_tag LOCUS_13330 6429 5314 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393239.1 protein_id gnl|my_center|LOCUS_13330 7058 6495 gene locus_tag LOCUS_13340 7058 6495 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398496.1 protein_id gnl|my_center|LOCUS_13340 9199 7058 gene locus_tag LOCUS_13350 gene pnp 9199 7058 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378800.1 protein_id gnl|my_center|LOCUS_13350 >Feature sequence075 1345 29 gene locus_tag LOCUS_13360 gene cssS 1345 29 CDS product secretion stress-responsive two-component system sensor histidine kinase CssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228527.1 protein_id gnl|my_center|LOCUS_13360 1998 1345 gene locus_tag LOCUS_13370 1998 1345 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948085.1 protein_id gnl|my_center|LOCUS_13370 3426 2074 gene locus_tag LOCUS_13380 gene glmM 3426 2074 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902729.1 protein_id gnl|my_center|LOCUS_13380 4864 3440 gene locus_tag LOCUS_13390 4864 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 5675 4866 gene locus_tag LOCUS_13400 gene cdaA 5675 4866 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476186.1 protein_id gnl|my_center|LOCUS_13400 5845 6357 gene locus_tag LOCUS_13410 5845 6357 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459551.1 protein_id gnl|my_center|LOCUS_13410 7043 6384 gene locus_tag LOCUS_13420 7043 6384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 7368 7036 gene locus_tag LOCUS_13430 7368 7036 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459447.1 protein_id gnl|my_center|LOCUS_13430 8896 7466 gene locus_tag LOCUS_13440 gene cps4A 8896 7466 CDS product capsular polysaccharide biosynthesis protein Cps4A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091050.1 protein_id gnl|my_center|LOCUS_13440 9879 8983 gene locus_tag LOCUS_13450 9879 8983 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932020.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence076 1590 646 gene locus_tag LOCUS_13460 1590 646 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547856.1 protein_id gnl|my_center|LOCUS_13460 1984 1577 gene locus_tag LOCUS_13470 1984 1577 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476244.1 protein_id gnl|my_center|LOCUS_13470 4100 1956 gene locus_tag LOCUS_13480 4100 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 4529 5230 gene locus_tag LOCUS_13490 4529 5230 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426384.1 protein_id gnl|my_center|LOCUS_13490 5223 6548 gene locus_tag LOCUS_13500 5223 6548 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458888.1 protein_id gnl|my_center|LOCUS_13500 6593 7105 gene locus_tag LOCUS_13510 6593 7105 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049186.1 protein_id gnl|my_center|LOCUS_13510 7271 8740 gene locus_tag LOCUS_13520 7271 8740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 9621 8767 gene locus_tag LOCUS_13530 9621 8767 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234240.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence077 <1 518 gene locus_tag LOCUS_13540 <1 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966833.1:acetyl-CoA carboxylase biotin carboxylase subunit 522 1394 gene locus_tag LOCUS_13550 gene accD 522 1394 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966832.1 protein_id gnl|my_center|LOCUS_13550 1394 2344 gene locus_tag LOCUS_13560 1394 2344 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889903.1 protein_id gnl|my_center|LOCUS_13560 2337 2798 gene locus_tag LOCUS_13570 2337 2798 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966842.1 protein_id gnl|my_center|LOCUS_13570 2808 3749 gene locus_tag LOCUS_13580 2808 3749 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_13580 3753 4685 gene locus_tag LOCUS_13590 3753 4685 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931899.1 protein_id gnl|my_center|LOCUS_13590 4688 5752 gene locus_tag LOCUS_13600 4688 5752 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966843.1 protein_id gnl|my_center|LOCUS_13600 5752 6684 gene locus_tag LOCUS_13610 gene fabD 5752 6684 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_13610 6686 7438 gene locus_tag LOCUS_13620 gene fabG 6686 7438 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_13620 7451 8689 gene locus_tag LOCUS_13630 gene fabF 7451 8689 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_13630 8694 9119 gene locus_tag LOCUS_13640 gene fabZ 8694 9119 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931959.1 protein_id gnl|my_center|LOCUS_13640 >Feature sequence078 658 20 gene locus_tag LOCUS_13650 658 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 1557 679 gene locus_tag LOCUS_13660 1557 679 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891610.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13660 1784 1554 gene locus_tag LOCUS_13670 1784 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13670 2952 1786 gene locus_tag LOCUS_13680 2952 1786 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179093.1 protein_id gnl|my_center|LOCUS_13680 4273 3098 gene locus_tag LOCUS_13690 4273 3098 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836697.1 protein_id gnl|my_center|LOCUS_13690 6896 5337 gene locus_tag LOCUS_13700 6896 5337 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760930.1 protein_id gnl|my_center|LOCUS_13700 7257 7096 gene locus_tag LOCUS_13710 7257 7096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 8185 7355 gene locus_tag LOCUS_13720 8185 7355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 9452 8214 gene locus_tag LOCUS_13730 9452 8214 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288208.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence079 175 834 gene locus_tag LOCUS_13740 175 834 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263600.1 protein_id gnl|my_center|LOCUS_13740 1360 866 gene locus_tag LOCUS_13750 1360 866 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903104.1 protein_id gnl|my_center|LOCUS_13750 2417 1344 gene locus_tag LOCUS_13760 2417 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 3067 2414 gene locus_tag LOCUS_13770 gene arlR 3067 2414 CDS product response regulator transcription factor ArlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192137.1 protein_id gnl|my_center|LOCUS_13770 3374 3072 gene locus_tag LOCUS_13780 3374 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 3793 3500 gene locus_tag LOCUS_13790 3793 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 5254 3899 gene locus_tag LOCUS_13800 5254 3899 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705185.1 protein_id gnl|my_center|LOCUS_13800 5602 5991 gene locus_tag LOCUS_13810 5602 5991 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986971.1 protein_id gnl|my_center|LOCUS_13810 6283 5978 gene locus_tag LOCUS_13820 6283 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 6382 6810 gene locus_tag LOCUS_13830 6382 6810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943965.1 protein_id gnl|my_center|LOCUS_13830 8930 6849 gene locus_tag LOCUS_13840 8930 6849 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965946.1 protein_id gnl|my_center|LOCUS_13840 9655 9143 gene locus_tag LOCUS_13850 9655 9143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 >Feature sequence080 852 235 gene locus_tag LOCUS_13860 852 235 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871236.1 protein_id gnl|my_center|LOCUS_13860 1037 888 gene locus_tag LOCUS_13870 gene rpmG 1037 888 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831295.1 protein_id gnl|my_center|LOCUS_13870 3218 1110 gene locus_tag LOCUS_13880 3218 1110 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721943.1 protein_id gnl|my_center|LOCUS_13880 5188 3380 gene locus_tag LOCUS_13890 gene lepA 5188 3380 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030952.1 protein_id gnl|my_center|LOCUS_13890 5584 5249 gene locus_tag LOCUS_13900 5584 5249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 6151 5819 gene locus_tag LOCUS_13910 gene acpS 6151 5819 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457108.1 protein_id gnl|my_center|LOCUS_13910 6852 6154 gene locus_tag LOCUS_13920 6852 6154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 7472 6873 gene locus_tag LOCUS_13930 7472 6873 CDS product DUF4479 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006759.1 protein_id gnl|my_center|LOCUS_13930 7804 7484 gene locus_tag LOCUS_13940 7804 7484 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009915789.1 protein_id gnl|my_center|LOCUS_13940 8450 7797 gene locus_tag LOCUS_13950 gene trmB 8450 7797 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239385.1 protein_id gnl|my_center|LOCUS_13950 9202 8483 gene locus_tag LOCUS_13960 9202 8483 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860778.1 protein_id gnl|my_center|LOCUS_13960 9680 9186 gene locus_tag LOCUS_13970 9680 9186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 9916 9767 gene locus_tag LOCUS_13980 9916 9767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 10187 10014 gene locus_tag LOCUS_13990 10187 10014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 >Feature sequence081 1037 63 gene locus_tag LOCUS_14000 1037 63 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582853.1 protein_id gnl|my_center|LOCUS_14000 2997 1165 gene locus_tag LOCUS_14010 2997 1165 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048538587.1 protein_id gnl|my_center|LOCUS_14010 4125 3082 gene locus_tag LOCUS_14020 4125 3082 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287118.1 protein_id gnl|my_center|LOCUS_14020 5392 4115 gene locus_tag LOCUS_14030 5392 4115 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861728.1 protein_id gnl|my_center|LOCUS_14030 6649 5411 gene locus_tag LOCUS_14040 6649 5411 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254437.1 protein_id gnl|my_center|LOCUS_14040 7105 7725 gene locus_tag LOCUS_14050 7105 7725 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902061.1 protein_id gnl|my_center|LOCUS_14050 7722 8600 gene locus_tag LOCUS_14060 7722 8600 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902062.1 protein_id gnl|my_center|LOCUS_14060 8597 9790 gene locus_tag LOCUS_14070 8597 9790 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776619.1 protein_id gnl|my_center|LOCUS_14070 >Feature sequence082 305 481 gene locus_tag LOCUS_14080 305 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 670 972 gene locus_tag LOCUS_14090 670 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14090 1347 2630 gene locus_tag LOCUS_14100 gene serS 1347 2630 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_14100 2647 3471 gene locus_tag LOCUS_14110 2647 3471 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108784.1 protein_id gnl|my_center|LOCUS_14110 4278 3481 gene locus_tag LOCUS_14120 4278 3481 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965978.1 protein_id gnl|my_center|LOCUS_14120 4380 5027 gene locus_tag LOCUS_14130 4380 5027 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963522.1 protein_id gnl|my_center|LOCUS_14130 5837 6745 gene locus_tag LOCUS_14140 5837 6745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 8834 7329 gene locus_tag LOCUS_14150 8834 7329 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002266940.1 protein_id gnl|my_center|LOCUS_14150 9742 8903 gene locus_tag LOCUS_14160 9742 8903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 >Feature sequence083 1415 1254 gene locus_tag LOCUS_14170 1415 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 1640 2416 gene locus_tag LOCUS_14180 gene proC 1640 2416 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898446.1 protein_id gnl|my_center|LOCUS_14180 2507 3244 gene locus_tag LOCUS_14190 2507 3244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 3244 3939 gene locus_tag LOCUS_14200 gene sigE 3244 3939 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_14200 3988 4764 gene locus_tag LOCUS_14210 gene sigG 3988 4764 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965003.1 protein_id gnl|my_center|LOCUS_14210 4789 5028 gene locus_tag LOCUS_14220 4789 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 5128 5559 gene locus_tag LOCUS_14230 gene sepF 5128 5559 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244791.1 protein_id gnl|my_center|LOCUS_14230 5590 6348 gene locus_tag LOCUS_14240 5590 6348 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029719.1 protein_id gnl|my_center|LOCUS_14240 6360 6815 gene locus_tag LOCUS_14250 6360 6815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 7030 9759 gene locus_tag LOCUS_14260 gene ileS2 7030 9759 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455930.1 protein_id gnl|my_center|LOCUS_14260 >Feature sequence084 702 1838 gene locus_tag LOCUS_14270 702 1838 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262240.1 protein_id gnl|my_center|LOCUS_14270 1968 2681 gene locus_tag LOCUS_14280 1968 2681 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889773.1 protein_id gnl|my_center|LOCUS_14280 2674 4284 gene locus_tag LOCUS_14290 2674 4284 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861453.1 protein_id gnl|my_center|LOCUS_14290 4588 5625 gene locus_tag LOCUS_14300 gene argC 4588 5625 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851634.1 protein_id gnl|my_center|LOCUS_14300 5638 6855 gene locus_tag LOCUS_14310 gene argJ 5638 6855 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965687.1 protein_id gnl|my_center|LOCUS_14310 6870 7739 gene locus_tag LOCUS_14320 gene argB 6870 7739 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864194.1 protein_id gnl|my_center|LOCUS_14320 8010 7831 gene locus_tag LOCUS_14330 8010 7831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 8283 8462 gene locus_tag LOCUS_14340 8283 8462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 8443 8655 gene locus_tag LOCUS_14350 8443 8655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 8642 8761 gene locus_tag LOCUS_14360 8642 8761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 8749 8925 gene locus_tag LOCUS_14370 8749 8925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 >Feature sequence085 547 185 gene locus_tag LOCUS_14380 547 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 1001 537 gene locus_tag LOCUS_14390 1001 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 1174 953 gene locus_tag LOCUS_14400 1174 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 1574 1164 gene locus_tag LOCUS_14410 1574 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1875 1564 gene locus_tag LOCUS_14420 gene comGC 1875 1564 CDS product competence type IV pilus major pilin ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178687.1 protein_id gnl|my_center|LOCUS_14420 2893 1892 gene locus_tag LOCUS_14430 2893 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 3872 2886 gene locus_tag LOCUS_14440 gene comGA 3872 2886 CDS product competence protein ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013193.1 protein_id gnl|my_center|LOCUS_14440 4041 4598 gene locus_tag LOCUS_14450 gene efp 4041 4598 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626507.1 protein_id gnl|my_center|LOCUS_14450 4679 5149 gene locus_tag LOCUS_14460 4679 5149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 5201 5539 gene locus_tag LOCUS_14470 5201 5539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 5639 6043 gene locus_tag LOCUS_14480 gene nusB 5639 6043 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831090.1 protein_id gnl|my_center|LOCUS_14480 6043 7359 gene locus_tag LOCUS_14490 gene xseA 6043 7359 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440019.1 protein_id gnl|my_center|LOCUS_14490 7370 7594 gene locus_tag LOCUS_14500 7370 7594 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226409.1 protein_id gnl|my_center|LOCUS_14500 7587 8435 gene locus_tag LOCUS_14510 7587 8435 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965380.1 protein_id gnl|my_center|LOCUS_14510 >Feature sequence086 293 1123 gene locus_tag LOCUS_14520 293 1123 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101946.1 protein_id gnl|my_center|LOCUS_14520 1136 1690 gene locus_tag LOCUS_14530 1136 1690 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020471.1 protein_id gnl|my_center|LOCUS_14530 2321 1746 gene locus_tag LOCUS_14540 2321 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 2471 3331 gene locus_tag LOCUS_14550 2471 3331 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002932053.1 protein_id gnl|my_center|LOCUS_14550 3478 4773 gene locus_tag LOCUS_14560 gene celB 3478 4773 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901597.1 protein_id gnl|my_center|LOCUS_14560 4773 6242 gene locus_tag LOCUS_14570 4773 6242 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964714.1 protein_id gnl|my_center|LOCUS_14570 6356 6817 gene locus_tag LOCUS_14580 6356 6817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 7404 7778 gene locus_tag LOCUS_14590 7404 7778 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_14590 7781 8638 gene locus_tag LOCUS_14600 7781 8638 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897173.1 protein_id gnl|my_center|LOCUS_14600 8640 9290 gene locus_tag LOCUS_14610 8640 9290 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435186.1 protein_id gnl|my_center|LOCUS_14610 >Feature sequence087 225 602 gene locus_tag LOCUS_14620 225 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 599 1072 gene locus_tag LOCUS_14630 599 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 1069 1614 gene locus_tag LOCUS_14640 1069 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 2050 1901 gene locus_tag LOCUS_14650 2050 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 3760 2792 gene locus_tag LOCUS_14660 3760 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_14660 5000 4092 gene locus_tag LOCUS_14670 5000 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_14670 5820 4987 gene locus_tag LOCUS_14680 5820 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_14680 6709 5807 gene locus_tag LOCUS_14690 6709 5807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_14690 6822 7247 gene locus_tag LOCUS_14700 6822 7247 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476083.1 protein_id gnl|my_center|LOCUS_14700 8194 7304 gene locus_tag LOCUS_14710 8194 7304 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721732.1 protein_id gnl|my_center|LOCUS_14710 9569 8253 gene locus_tag LOCUS_14720 9569 8253 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287584.1 protein_id gnl|my_center|LOCUS_14720 >Feature sequence088 1379 2056 gene locus_tag LOCUS_14730 1379 2056 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956859.1 protein_id gnl|my_center|LOCUS_14730 2129 2830 gene locus_tag LOCUS_14740 2129 2830 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861605.1 protein_id gnl|my_center|LOCUS_14740 2839 4902 gene locus_tag LOCUS_14750 2839 4902 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861604.1 protein_id gnl|my_center|LOCUS_14750 5810 4914 gene locus_tag LOCUS_14760 5810 4914 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583216.1 protein_id gnl|my_center|LOCUS_14760 8184 5971 gene locus_tag LOCUS_14770 8184 5971 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391620.1 protein_id gnl|my_center|LOCUS_14770 9468 8197 gene locus_tag LOCUS_14780 gene celB 9468 8197 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901597.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence089 513 166 gene locus_tag LOCUS_14790 513 166 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902357.1 protein_id gnl|my_center|LOCUS_14790 676 1209 gene locus_tag LOCUS_14800 676 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 1318 1914 gene locus_tag LOCUS_14810 1318 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 2027 2800 gene locus_tag LOCUS_14820 2027 2800 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764352.1 protein_id gnl|my_center|LOCUS_14820 2889 4250 gene locus_tag LOCUS_14830 2889 4250 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036271.1 protein_id gnl|my_center|LOCUS_14830 4385 4302 gene locus_tag LOCUS_t00150 4385 4302 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4509 5948 gene locus_tag LOCUS_14840 4509 5948 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033065833.1 protein_id gnl|my_center|LOCUS_14840 6258 7589 gene locus_tag LOCUS_14850 6258 7589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 7561 9027 gene locus_tag LOCUS_14860 7561 9027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 9158 9511 gene locus_tag LOCUS_14870 9158 9511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 >Feature sequence090 484 86 gene locus_tag LOCUS_14880 484 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 608 1432 gene locus_tag LOCUS_14890 608 1432 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963823.1 protein_id gnl|my_center|LOCUS_14890 1677 1492 gene locus_tag LOCUS_14900 1677 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1826 2119 gene locus_tag LOCUS_14910 1826 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 3152 2316 gene locus_tag LOCUS_14920 3152 2316 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395635.1 protein_id gnl|my_center|LOCUS_14920 3438 5087 gene locus_tag LOCUS_14930 3438 5087 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430205.1 protein_id gnl|my_center|LOCUS_14930 5161 6153 gene locus_tag LOCUS_14940 5161 6153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 6233 6703 gene locus_tag LOCUS_14950 6233 6703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 6693 7268 gene locus_tag LOCUS_14960 6693 7268 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922263.1 protein_id gnl|my_center|LOCUS_14960 8441 7284 gene locus_tag LOCUS_14970 8441 7284 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582945.1 protein_id gnl|my_center|LOCUS_14970 8605 9051 gene locus_tag LOCUS_14980 8605 9051 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966683.1 protein_id gnl|my_center|LOCUS_14980 >Feature sequence091 708 196 gene locus_tag LOCUS_14990 708 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 1293 838 gene locus_tag LOCUS_15000 1293 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 2463 1594 gene locus_tag LOCUS_15010 gene hslO 2463 1594 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832190.1 protein_id gnl|my_center|LOCUS_15010 4550 2607 gene locus_tag LOCUS_15020 gene ftsH 4550 2607 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079659.1 protein_id gnl|my_center|LOCUS_15020 5090 4560 gene locus_tag LOCUS_15030 gene hpt 5090 4560 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892177.1 protein_id gnl|my_center|LOCUS_15030 6356 5112 gene locus_tag LOCUS_15040 gene tilS 6356 5112 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166253.1 protein_id gnl|my_center|LOCUS_15040 8666 6468 gene locus_tag LOCUS_15050 gene spoIIE 8666 6468 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243026.1 protein_id gnl|my_center|LOCUS_15050 9375 8881 gene locus_tag LOCUS_15060 9375 8881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 >Feature sequence092 1158 1517 gene locus_tag LOCUS_15070 1158 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 1776 1701 gene locus_tag LOCUS_t00160 1776 1701 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1882 3333 gene locus_tag LOCUS_15080 1882 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 3308 3826 gene locus_tag LOCUS_15090 3308 3826 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_15090 4581 3847 gene locus_tag LOCUS_15100 4581 3847 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775187.1 protein_id gnl|my_center|LOCUS_15100 5445 4594 gene locus_tag LOCUS_15110 5445 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 5831 5496 gene locus_tag LOCUS_15120 5831 5496 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699581.1 protein_id gnl|my_center|LOCUS_15120 5947 6603 gene locus_tag LOCUS_15130 5947 6603 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898027.1 protein_id gnl|my_center|LOCUS_15130 7711 6614 gene locus_tag LOCUS_15140 7711 6614 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905635.1 protein_id gnl|my_center|LOCUS_15140 8898 7711 gene locus_tag LOCUS_15150 8898 7711 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905634.1 protein_id gnl|my_center|LOCUS_15150 9573 8935 gene locus_tag LOCUS_15160 9573 8935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 >Feature sequence093 2410 719 gene locus_tag LOCUS_15170 2410 719 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986853.1 protein_id gnl|my_center|LOCUS_15170 3086 2403 gene locus_tag LOCUS_15180 3086 2403 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986772.1 protein_id gnl|my_center|LOCUS_15180 3756 3097 gene locus_tag LOCUS_15190 gene phoU 3756 3097 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965016.1 protein_id gnl|my_center|LOCUS_15190 4521 3766 gene locus_tag LOCUS_15200 gene pstB 4521 3766 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_15200 5389 4523 gene locus_tag LOCUS_15210 gene pstA 5389 4523 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001912363.1 protein_id gnl|my_center|LOCUS_15210 6314 5382 gene locus_tag LOCUS_15220 gene pstC 6314 5382 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454007.1 protein_id gnl|my_center|LOCUS_15220 7160 6324 gene locus_tag LOCUS_15230 7160 6324 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_15230 8281 7286 gene locus_tag LOCUS_15240 8281 7286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 8911 8291 gene locus_tag LOCUS_15250 8911 8291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence094 1731 448 gene locus_tag LOCUS_15260 1731 448 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359847.1 protein_id gnl|my_center|LOCUS_15260 2357 1746 gene locus_tag LOCUS_15270 2357 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002309706.1 protein_id gnl|my_center|LOCUS_15270 2409 3074 gene locus_tag LOCUS_15280 2409 3074 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948072.1 protein_id gnl|my_center|LOCUS_15280 4336 3170 gene locus_tag LOCUS_15290 4336 3170 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949005.1 protein_id gnl|my_center|LOCUS_15290 5595 4432 gene locus_tag LOCUS_15300 5595 4432 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002411310.1 protein_id gnl|my_center|LOCUS_15300 5700 6602 gene locus_tag LOCUS_15310 5700 6602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 7222 6737 gene locus_tag LOCUS_15320 7222 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 7400 7188 gene locus_tag LOCUS_15330 7400 7188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 <9617 7670 gene locus_tag LOCUS_15340 <9617 7670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010990068.1:glycoside hydrolase family 3 N-terminal domain-containing protein >Feature sequence095 120 45 gene locus_tag LOCUS_t00170 120 45 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 212 137 gene locus_tag LOCUS_t00180 212 137 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 450 2501 gene locus_tag LOCUS_15350 gene fusA 450 2501 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048368.1 protein_id gnl|my_center|LOCUS_15350 2589 3587 gene locus_tag LOCUS_15360 gene galE 2589 3587 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694325.1 protein_id gnl|my_center|LOCUS_15360 3676 4095 gene locus_tag LOCUS_15370 3676 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 5199 4126 gene locus_tag LOCUS_15380 gene alr 5199 4126 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475712.1 protein_id gnl|my_center|LOCUS_15380 6269 5283 gene locus_tag LOCUS_15390 6269 5283 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234282.1 protein_id gnl|my_center|LOCUS_15390 6363 6563 gene locus_tag LOCUS_15400 6363 6563 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220771.1 protein_id gnl|my_center|LOCUS_15400 7201 6578 gene locus_tag LOCUS_15410 7201 6578 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861058.1 protein_id gnl|my_center|LOCUS_15410 7902 7201 gene locus_tag LOCUS_15420 gene deoD 7902 7201 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843292.1 protein_id gnl|my_center|LOCUS_15420 8378 7914 gene locus_tag LOCUS_15430 8378 7914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 <9568 8488 gene locus_tag LOCUS_15440 <9568 8488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002384702.1:PTS cellobiose transporter subunit IIC >Feature sequence096 337 1392 gene locus_tag LOCUS_15450 337 1392 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068670.1 protein_id gnl|my_center|LOCUS_15450 1392 2894 gene locus_tag LOCUS_15460 1392 2894 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 protein_id gnl|my_center|LOCUS_15460 2937 4055 gene locus_tag LOCUS_15470 2937 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 4099 5094 gene locus_tag LOCUS_15480 4099 5094 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122014502.1 protein_id gnl|my_center|LOCUS_15480 5105 5422 gene locus_tag LOCUS_15490 5105 5422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 5456 6481 gene locus_tag LOCUS_15500 5456 6481 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145225398.1 protein_id gnl|my_center|LOCUS_15500 >Feature sequence097 1957 998 gene locus_tag LOCUS_15510 1957 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 2415 1954 gene locus_tag LOCUS_15520 2415 1954 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809864.1 protein_id gnl|my_center|LOCUS_15520 3497 2490 gene locus_tag LOCUS_15530 gene ccpA 3497 2490 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830844.1 protein_id gnl|my_center|LOCUS_15530 3973 3497 gene locus_tag LOCUS_15540 3973 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 4278 3988 gene locus_tag LOCUS_15550 4278 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 5637 4327 gene locus_tag LOCUS_15560 gene murC 5637 4327 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989758.1 protein_id gnl|my_center|LOCUS_15560 6771 5695 gene locus_tag LOCUS_15570 6771 5695 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426912.1 protein_id gnl|my_center|LOCUS_15570 8515 6764 gene locus_tag LOCUS_15580 gene aspS 8515 6764 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840895.1 protein_id gnl|my_center|LOCUS_15580 <9530 8508 gene locus_tag LOCUS_15590 <9530 8508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003229755.1:histidine--tRNA ligase >Feature sequence098 1033 605 gene locus_tag LOCUS_15600 1033 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 2655 1180 gene locus_tag LOCUS_15610 2655 1180 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546652.1 protein_id gnl|my_center|LOCUS_15610 3000 2665 gene locus_tag LOCUS_15620 3000 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 4239 3013 gene locus_tag LOCUS_15630 4239 3013 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861808.1 protein_id gnl|my_center|LOCUS_15630 4560 4246 gene locus_tag LOCUS_15640 4560 4246 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898152.1 protein_id gnl|my_center|LOCUS_15640 4726 6660 gene locus_tag LOCUS_15650 4726 6660 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861809.1 protein_id gnl|my_center|LOCUS_15650 8779 7010 gene locus_tag LOCUS_15660 8779 7010 CDS product KAP family P-loop domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015265747.1 protein_id gnl|my_center|LOCUS_15660 >Feature sequence099 1256 729 gene locus_tag LOCUS_15670 1256 729 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948135.1 protein_id gnl|my_center|LOCUS_15670 1561 1379 gene locus_tag LOCUS_15680 1561 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 1678 1965 gene locus_tag LOCUS_15690 1678 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 2536 2147 gene locus_tag LOCUS_15700 2536 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 2782 3909 gene locus_tag LOCUS_15710 2782 3909 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775654.1 protein_id gnl|my_center|LOCUS_15710 3964 4407 gene locus_tag LOCUS_15720 3964 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 4506 5648 gene locus_tag LOCUS_15730 gene ahbD 4506 5648 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_15730 5645 6529 gene locus_tag LOCUS_15740 5645 6529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 6574 6840 gene locus_tag LOCUS_15750 6574 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 7080 7544 gene locus_tag LOCUS_15760 7080 7544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 8109 7804 gene locus_tag LOCUS_15770 8109 7804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 9013 8423 gene locus_tag LOCUS_15780 9013 8423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 9406 9128 gene locus_tag LOCUS_15790 9406 9128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 >Feature sequence100 2 649 gene locus_tag LOCUS_15800 2 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 651 1277 gene locus_tag LOCUS_15810 651 1277 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435768.1 protein_id gnl|my_center|LOCUS_15810 1720 2094 gene locus_tag LOCUS_15820 1720 2094 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812538.1 protein_id gnl|my_center|LOCUS_15820 2087 3814 gene locus_tag LOCUS_15830 2087 3814 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995243.1 protein_id gnl|my_center|LOCUS_15830 3807 5453 gene locus_tag LOCUS_15840 gene cydC 3807 5453 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667625.1 protein_id gnl|my_center|LOCUS_15840 5455 5754 gene locus_tag LOCUS_15850 5455 5754 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682354.1 protein_id gnl|my_center|LOCUS_15850 7061 5865 gene locus_tag LOCUS_15860 7061 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 7299 7793 gene locus_tag LOCUS_15870 7299 7793 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483964.1 protein_id gnl|my_center|LOCUS_15870 7860 9095 gene locus_tag LOCUS_15880 7860 9095 CDS product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002467821.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence101 1326 976 gene locus_tag LOCUS_15890 gene spoVAE 1326 976 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230467.1 protein_id gnl|my_center|LOCUS_15890 2327 1323 gene locus_tag LOCUS_15900 gene spoVAD 2327 1323 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230465.1 protein_id gnl|my_center|LOCUS_15900 2748 2305 gene locus_tag LOCUS_15910 gene spoVAC 2748 2305 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223947.1 protein_id gnl|my_center|LOCUS_15910 3618 2818 gene locus_tag LOCUS_15920 3618 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 3877 5232 gene locus_tag LOCUS_15930 3877 5232 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052999.1 protein_id gnl|my_center|LOCUS_15930 6892 5258 gene locus_tag LOCUS_15940 6892 5258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 7273 6947 gene locus_tag LOCUS_15950 7273 6947 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722052.1 protein_id gnl|my_center|LOCUS_15950 7876 8034 gene locus_tag LOCUS_15960 7876 8034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 8031 8657 gene locus_tag LOCUS_15970 8031 8657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894741.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence102 658 476 gene locus_tag LOCUS_15980 658 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 1092 709 gene locus_tag LOCUS_15990 1092 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 1654 1070 gene locus_tag LOCUS_16000 gene pgsA 1654 1070 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966859.1 protein_id gnl|my_center|LOCUS_16000 2140 1718 gene locus_tag LOCUS_16010 2140 1718 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022414.1 protein_id gnl|my_center|LOCUS_16010 3047 2145 gene locus_tag LOCUS_16020 3047 2145 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387471.1 protein_id gnl|my_center|LOCUS_16020 4279 3086 gene locus_tag LOCUS_16030 4279 3086 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964048.1 protein_id gnl|my_center|LOCUS_16030 5091 4357 gene locus_tag LOCUS_16040 5091 4357 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674428.1 protein_id gnl|my_center|LOCUS_16040 5221 5295 gene locus_tag LOCUS_t00190 5221 5295 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6683 6366 gene locus_tag LOCUS_16050 6683 6366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 7103 6723 gene locus_tag LOCUS_16060 7103 6723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16060 7790 7200 gene locus_tag LOCUS_16070 7790 7200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 8935 8126 gene locus_tag LOCUS_16080 8935 8126 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812594.1 protein_id gnl|my_center|LOCUS_16080 >Feature sequence103 54 1610 gene locus_tag LOCUS_16090 54 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 3290 1764 gene locus_tag LOCUS_16100 3290 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 4354 3392 gene locus_tag LOCUS_16110 gene eutH 4354 3392 CDS product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243423.1 protein_id gnl|my_center|LOCUS_16110 5567 4488 gene locus_tag LOCUS_16120 gene trpS 5567 4488 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_16120 6615 5863 gene locus_tag LOCUS_16130 6615 5863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 7612 6749 gene locus_tag LOCUS_16140 7612 6749 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990044.1 protein_id gnl|my_center|LOCUS_16140 9112 7703 gene locus_tag LOCUS_16150 9112 7703 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_16150 >Feature sequence104 <1 894 gene locus_tag LOCUS_16160 <1 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948003.1:CoA-disulfide reductase 1035 1868 gene locus_tag LOCUS_16170 1035 1868 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357554.1 protein_id gnl|my_center|LOCUS_16170 1954 4659 gene locus_tag LOCUS_16180 1954 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 4790 5776 gene locus_tag LOCUS_16190 4790 5776 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003019.1 protein_id gnl|my_center|LOCUS_16190 5776 6666 gene locus_tag LOCUS_16200 5776 6666 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435856.1 protein_id gnl|my_center|LOCUS_16200 6773 7627 gene locus_tag LOCUS_16210 6773 7627 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723662.1 protein_id gnl|my_center|LOCUS_16210 7963 7652 gene locus_tag LOCUS_16220 7963 7652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 >Feature sequence105 591 220 gene locus_tag LOCUS_16230 591 220 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047976.1 protein_id gnl|my_center|LOCUS_16230 2674 686 gene locus_tag LOCUS_16240 2674 686 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393552.1 protein_id gnl|my_center|LOCUS_16240 2793 3383 gene locus_tag LOCUS_16250 2793 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 3368 4444 gene locus_tag LOCUS_16260 3368 4444 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793731.1 protein_id gnl|my_center|LOCUS_16260 5152 4457 gene locus_tag LOCUS_16270 gene bioD 5152 4457 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986727.1 protein_id gnl|my_center|LOCUS_16270 6116 5145 gene locus_tag LOCUS_16280 gene bioB 6116 5145 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986728.1 protein_id gnl|my_center|LOCUS_16280 6670 6119 gene locus_tag LOCUS_16290 6670 6119 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986729.1 protein_id gnl|my_center|LOCUS_16290 7641 6679 gene locus_tag LOCUS_16300 7641 6679 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358973.1 protein_id gnl|my_center|LOCUS_16300 7798 8901 gene locus_tag LOCUS_16310 7798 8901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 >Feature sequence106 705 223 gene locus_tag LOCUS_16320 705 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 2219 708 gene locus_tag LOCUS_16330 gene murJ 2219 708 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048104.1 protein_id gnl|my_center|LOCUS_16330 3526 2240 gene locus_tag LOCUS_16340 3526 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 4254 3559 gene locus_tag LOCUS_16350 4254 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 5714 4239 gene locus_tag LOCUS_16360 5714 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 6813 5719 gene locus_tag LOCUS_16370 6813 5719 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824469.1 protein_id gnl|my_center|LOCUS_16370 7952 6816 gene locus_tag LOCUS_16380 7952 6816 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476099.1 protein_id gnl|my_center|LOCUS_16380 8654 7962 gene locus_tag LOCUS_16390 8654 7962 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922186.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence107 768 70 gene locus_tag LOCUS_16400 768 70 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133353.1 protein_id gnl|my_center|LOCUS_16400 1693 836 gene locus_tag LOCUS_16410 1693 836 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948584.1 protein_id gnl|my_center|LOCUS_16410 2974 2147 gene locus_tag LOCUS_16420 2974 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_16420 3599 2964 gene locus_tag LOCUS_16430 3599 2964 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066132.1 protein_id gnl|my_center|LOCUS_16430 4741 3602 gene locus_tag LOCUS_16440 4741 3602 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948943.1 protein_id gnl|my_center|LOCUS_16440 5079 4861 gene locus_tag LOCUS_16450 5079 4861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 5425 5120 gene locus_tag LOCUS_16460 5425 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16460 6452 5481 gene locus_tag LOCUS_16470 6452 5481 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930477.1 protein_id gnl|my_center|LOCUS_16470 7278 6463 gene locus_tag LOCUS_16480 7278 6463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 7950 7381 gene locus_tag LOCUS_16490 7950 7381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 9026 8040 gene locus_tag LOCUS_16500 9026 8040 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705392.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence108 1148 30 gene locus_tag LOCUS_16510 1148 30 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891610.1 protein_id gnl|my_center|LOCUS_16510 1334 3121 gene locus_tag LOCUS_16520 1334 3121 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193735789.1 protein_id gnl|my_center|LOCUS_16520 3528 3139 gene locus_tag LOCUS_16530 3528 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 4445 3534 gene locus_tag LOCUS_16540 4445 3534 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068666.1 protein_id gnl|my_center|LOCUS_16540 5200 4442 gene locus_tag LOCUS_16550 5200 4442 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438534.1 protein_id gnl|my_center|LOCUS_16550 5914 5213 gene locus_tag LOCUS_16560 5914 5213 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217125.1 protein_id gnl|my_center|LOCUS_16560 6072 7037 gene locus_tag LOCUS_16570 6072 7037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 7052 7726 gene locus_tag LOCUS_16580 7052 7726 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243015.1 protein_id gnl|my_center|LOCUS_16580 8378 7746 gene locus_tag LOCUS_16590 8378 7746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 9109 8648 gene locus_tag LOCUS_16600 9109 8648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 >Feature sequence109 1694 210 gene locus_tag LOCUS_16610 1694 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 2628 1861 gene locus_tag LOCUS_16620 2628 1861 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208843.1 protein_id gnl|my_center|LOCUS_16620 4162 2831 gene locus_tag LOCUS_16630 4162 2831 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_16630 4823 4176 gene locus_tag LOCUS_16640 4823 4176 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287951.1 protein_id gnl|my_center|LOCUS_16640 5940 4951 gene locus_tag LOCUS_16650 5940 4951 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457984.1 protein_id gnl|my_center|LOCUS_16650 6691 6047 gene locus_tag LOCUS_16660 6691 6047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 7638 6736 gene locus_tag LOCUS_16670 gene spoIID 7638 6736 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672623.1 protein_id gnl|my_center|LOCUS_16670 7883 7683 gene locus_tag LOCUS_16680 7883 7683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 7954 8490 gene locus_tag LOCUS_16690 7954 8490 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797556.1 protein_id gnl|my_center|LOCUS_16690 8507 8902 gene locus_tag LOCUS_16700 8507 8902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 9026 8951 gene locus_tag LOCUS_t00200 9026 8951 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 9103 9028 gene locus_tag LOCUS_t00210 9103 9028 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence110 <1 1713 gene locus_tag LOCUS_16710 <1 1713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861898.1:NAD-dependent DNA ligase LigA 1760 2857 gene locus_tag LOCUS_16720 1760 2857 CDS product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831700.1 protein_id gnl|my_center|LOCUS_16720 2868 3158 gene locus_tag LOCUS_16730 2868 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 3158 4606 gene locus_tag LOCUS_16740 gene gatA 3158 4606 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288475.1 protein_id gnl|my_center|LOCUS_16740 4614 6047 gene locus_tag LOCUS_16750 gene gatB 4614 6047 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288473.1 protein_id gnl|my_center|LOCUS_16750 6096 6812 gene locus_tag LOCUS_16760 6096 6812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 6851 8206 gene locus_tag LOCUS_16770 gene rlmD 6851 8206 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963844.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence111 327 49 gene locus_tag LOCUS_16780 327 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 326 697 gene locus_tag LOCUS_16790 326 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 1371 985 gene locus_tag LOCUS_16800 1371 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 1522 1995 gene locus_tag LOCUS_16810 1522 1995 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896783.1 protein_id gnl|my_center|LOCUS_16810 3504 2023 gene locus_tag LOCUS_16820 3504 2023 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 protein_id gnl|my_center|LOCUS_16820 8017 3497 gene locus_tag LOCUS_16830 gene gltB 8017 3497 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_16830 8320 8892 gene locus_tag LOCUS_16840 gene eutD 8320 8892 CDS product ethanolamine utilization phosphate acetyltransferase EutD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889877.1 protein_id gnl|my_center|LOCUS_16840 >Feature sequence112 <1 597 gene locus_tag LOCUS_16850 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001157831.1:DNA internalization-related competence protein ComEC/Rec2 696 2411 gene locus_tag LOCUS_16860 696 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 2425 3729 gene locus_tag LOCUS_16870 2425 3729 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891837.1 protein_id gnl|my_center|LOCUS_16870 3833 4780 gene locus_tag LOCUS_16880 gene holA 3833 4780 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279916.1 protein_id gnl|my_center|LOCUS_16880 4789 6003 gene locus_tag LOCUS_16890 4789 6003 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022470187.1 protein_id gnl|my_center|LOCUS_16890 6008 7087 gene locus_tag LOCUS_16900 gene hemW 6008 7087 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002410012.1 protein_id gnl|my_center|LOCUS_16900 7267 8319 gene locus_tag LOCUS_16910 gene hrcA 7267 8319 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726026.1 protein_id gnl|my_center|LOCUS_16910 8331 8882 gene locus_tag LOCUS_16920 gene grpE 8331 8882 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230005.1 protein_id gnl|my_center|LOCUS_16920 >Feature sequence113 2 526 gene locus_tag LOCUS_16930 2 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 538 1971 gene locus_tag LOCUS_16940 538 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 2038 2751 gene locus_tag LOCUS_16950 2038 2751 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227815.1 protein_id gnl|my_center|LOCUS_16950 2933 4306 gene locus_tag LOCUS_16960 2933 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 4319 4996 gene locus_tag LOCUS_16970 4319 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 5001 5621 gene locus_tag LOCUS_16980 5001 5621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 5782 7842 gene locus_tag LOCUS_16990 5782 7842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 7959 8078 gene locus_tag LOCUS_17000 7959 8078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 >Feature sequence114 4252 572 gene locus_tag LOCUS_17010 gene rpoC 4252 572 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567939.1 protein_id gnl|my_center|LOCUS_17010 7947 4264 gene locus_tag LOCUS_17020 gene rpoB 7947 4264 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966326.1 protein_id gnl|my_center|LOCUS_17020 8703 8110 gene locus_tag LOCUS_17030 8703 8110 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930903.1 protein_id gnl|my_center|LOCUS_17030 >Feature sequence115 <1 1427 gene locus_tag LOCUS_17040 <1 1427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001118781.1:DNA translocase FtsK 1511 2773 gene locus_tag LOCUS_17050 1511 2773 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886510.1 protein_id gnl|my_center|LOCUS_17050 2773 4068 gene locus_tag LOCUS_17060 2773 4068 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411976.1 protein_id gnl|my_center|LOCUS_17060 4285 4521 gene locus_tag LOCUS_17070 4285 4521 CDS product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231595.1 protein_id gnl|my_center|LOCUS_17070 4700 6676 gene locus_tag LOCUS_17080 gene tkt 4700 6676 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245397.1 protein_id gnl|my_center|LOCUS_17080 6757 7137 gene locus_tag LOCUS_17090 6757 7137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 7140 7340 gene locus_tag LOCUS_17100 7140 7340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 8009 7401 gene locus_tag LOCUS_17110 gene plsY 8009 7401 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724132.1 protein_id gnl|my_center|LOCUS_17110 >Feature sequence116 423 977 gene locus_tag LOCUS_17120 gene rfbC 423 977 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100803.1 protein_id gnl|my_center|LOCUS_17120 2205 3149 gene locus_tag LOCUS_17130 2205 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 3157 4248 gene locus_tag LOCUS_17140 3157 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 4241 5506 gene locus_tag LOCUS_17150 4241 5506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 5543 6391 gene locus_tag LOCUS_17160 5543 6391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 6402 7313 gene locus_tag LOCUS_17170 6402 7313 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592106.1 protein_id gnl|my_center|LOCUS_17170 7325 8428 gene locus_tag LOCUS_17180 7325 8428 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_17180 >Feature sequence117 157 5352 gene locus_tag LOCUS_17190 157 5352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 5367 5900 gene locus_tag LOCUS_17200 5367 5900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 5900 6688 gene locus_tag LOCUS_17210 5900 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 6688 7464 gene locus_tag LOCUS_17220 6688 7464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 7451 8398 gene locus_tag LOCUS_17230 7451 8398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence118 272 1276 gene locus_tag LOCUS_17240 gene bgsA 272 1276 CDS product cell wall glycolipid biosynthesis glucosyltransferase BgsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359375.1 protein_id gnl|my_center|LOCUS_17240 1291 2319 gene locus_tag LOCUS_17250 1291 2319 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643294.1 protein_id gnl|my_center|LOCUS_17250 2324 4312 gene locus_tag LOCUS_17260 2324 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 4305 5258 gene locus_tag LOCUS_17270 gene yhaM 4305 5258 CDS product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456351.1 protein_id gnl|my_center|LOCUS_17270 5304 6188 gene locus_tag LOCUS_17280 5304 6188 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814117.1 protein_id gnl|my_center|LOCUS_17280 6620 6216 gene locus_tag LOCUS_17290 6620 6216 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368097.1 protein_id gnl|my_center|LOCUS_17290 7533 6676 gene locus_tag LOCUS_17300 7533 6676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 8531 7533 gene locus_tag LOCUS_17310 8531 7533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 >Feature sequence119 819 1 gene locus_tag LOCUS_17320 819 1 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724514.1 protein_id gnl|my_center|LOCUS_17320 2573 816 gene locus_tag LOCUS_17330 gene rnjA 2573 816 CDS product ribonuclease J1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670368.1 protein_id gnl|my_center|LOCUS_17330 3522 2656 gene locus_tag LOCUS_17340 gene fakB2 3522 2656 CDS product fatty acid kinase binding subunit FakB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166063.1 protein_id gnl|my_center|LOCUS_17340 3692 4057 gene locus_tag LOCUS_17350 3692 4057 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641900.1 protein_id gnl|my_center|LOCUS_17350 4057 4959 gene locus_tag LOCUS_17360 4057 4959 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_17360 4934 6808 gene locus_tag LOCUS_17370 4934 6808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 6801 8363 gene locus_tag LOCUS_17380 6801 8363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 8410 8715 gene locus_tag LOCUS_17390 gene trxA 8410 8715 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254147.1 protein_id gnl|my_center|LOCUS_17390 >Feature sequence120 87 791 gene locus_tag LOCUS_17400 gene dapD 87 791 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428057.1 protein_id gnl|my_center|LOCUS_17400 800 1930 gene locus_tag LOCUS_17410 800 1930 CDS product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891676.1 protein_id gnl|my_center|LOCUS_17410 1934 3121 gene locus_tag LOCUS_17420 1934 3121 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965684.1 protein_id gnl|my_center|LOCUS_17420 3393 4574 gene locus_tag LOCUS_17430 3393 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 >Feature sequence121 1494 1057 gene locus_tag LOCUS_17440 1494 1057 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763493.1 protein_id gnl|my_center|LOCUS_17440 1596 2966 gene locus_tag LOCUS_17450 gene pepV 1596 2966 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732537.1 protein_id gnl|my_center|LOCUS_17450 3110 3037 gene locus_tag LOCUS_t00220 3110 3037 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3198 3112 gene locus_tag LOCUS_t00230 3198 3112 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4204 3257 gene locus_tag LOCUS_17460 gene metA 4204 3257 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 protein_id gnl|my_center|LOCUS_17460 5505 4261 gene locus_tag LOCUS_17470 5505 4261 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_17470 7354 5642 gene locus_tag LOCUS_17480 gene ptsP 7354 5642 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040051.1 protein_id gnl|my_center|LOCUS_17480 7769 8500 gene locus_tag LOCUS_17490 gene nagB 7769 8500 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166981.1 protein_id gnl|my_center|LOCUS_17490 >Feature sequence122 <1 1220 gene locus_tag LOCUS_17500 <1 1220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860860.1:sensor histidine kinase 1210 1638 gene locus_tag LOCUS_17510 1210 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 2520 1663 gene locus_tag LOCUS_17520 gene prmC 2520 1663 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267042.1 protein_id gnl|my_center|LOCUS_17520 3596 2520 gene locus_tag LOCUS_17530 gene prfA 3596 2520 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183530.1 protein_id gnl|my_center|LOCUS_17530 4438 3848 gene locus_tag LOCUS_17540 4438 3848 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280862.1 protein_id gnl|my_center|LOCUS_17540 5823 4450 gene locus_tag LOCUS_17550 gene dnaB 5823 4450 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721677.1 protein_id gnl|my_center|LOCUS_17550 6279 5833 gene locus_tag LOCUS_17560 gene rplI 6279 5833 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831811.1 protein_id gnl|my_center|LOCUS_17560 8237 6279 gene locus_tag LOCUS_17570 gene gdpP 8237 6279 CDS product cyclic-di-AMP phosphodiesterase GdpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242517.1 protein_id gnl|my_center|LOCUS_17570 >Feature sequence123 1638 595 gene locus_tag LOCUS_17580 gene serC 1638 595 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_17580 1900 3558 gene locus_tag LOCUS_17590 1900 3558 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896350.1 protein_id gnl|my_center|LOCUS_17590 4375 3587 gene locus_tag LOCUS_17600 4375 3587 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582599.1 protein_id gnl|my_center|LOCUS_17600 5668 4898 gene locus_tag LOCUS_17610 5668 4898 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965719.1 protein_id gnl|my_center|LOCUS_17610 7530 5674 gene locus_tag LOCUS_17620 7530 5674 CDS product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897443.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence124 220 1314 gene locus_tag LOCUS_17630 220 1314 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755866.1 protein_id gnl|my_center|LOCUS_17630 1532 2191 gene locus_tag LOCUS_17640 1532 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 2203 3516 gene locus_tag LOCUS_17650 2203 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 3500 4252 gene locus_tag LOCUS_17660 3500 4252 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986651.1 protein_id gnl|my_center|LOCUS_17660 5299 4442 gene locus_tag LOCUS_17670 5299 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 5413 6366 gene locus_tag LOCUS_17680 5413 6366 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172285.1 protein_id gnl|my_center|LOCUS_17680 6481 7314 gene locus_tag LOCUS_17690 6481 7314 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728098.1 protein_id gnl|my_center|LOCUS_17690 7333 8313 gene locus_tag LOCUS_17700 7333 8313 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182588488.1 protein_id gnl|my_center|LOCUS_17700 >Feature sequence125 592 329 gene locus_tag LOCUS_17710 592 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 1233 790 gene locus_tag LOCUS_17720 1233 790 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166793.1 protein_id gnl|my_center|LOCUS_17720 2273 1317 gene locus_tag LOCUS_17730 2273 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 2974 2333 gene locus_tag LOCUS_17740 2974 2333 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435799.1 protein_id gnl|my_center|LOCUS_17740 4370 3027 gene locus_tag LOCUS_17750 4370 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 5065 4493 gene locus_tag LOCUS_17760 5065 4493 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071130048.1 protein_id gnl|my_center|LOCUS_17760 5822 5058 gene locus_tag LOCUS_17770 5822 5058 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295276.1 protein_id gnl|my_center|LOCUS_17770 6384 5839 gene locus_tag LOCUS_17780 6384 5839 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964443.1 protein_id gnl|my_center|LOCUS_17780 7456 6449 gene locus_tag LOCUS_17790 7456 6449 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412453.1 protein_id gnl|my_center|LOCUS_17790 >Feature sequence126 2020 128 gene locus_tag LOCUS_17800 2020 128 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_17800 3394 2033 gene locus_tag LOCUS_17810 3394 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 4439 3408 gene locus_tag LOCUS_17820 4439 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 4760 4452 gene locus_tag LOCUS_17830 4760 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 5147 6895 gene locus_tag LOCUS_17840 5147 6895 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897431.1 protein_id gnl|my_center|LOCUS_17840 7443 6961 gene locus_tag LOCUS_17850 7443 6961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 7943 7488 gene locus_tag LOCUS_17860 7943 7488 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905253.1 protein_id gnl|my_center|LOCUS_17860 8300 7968 gene locus_tag LOCUS_17870 8300 7968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 >Feature sequence127 781 1365 gene locus_tag LOCUS_17880 781 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 1744 2013 gene locus_tag LOCUS_17890 1744 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 2418 2098 gene locus_tag LOCUS_17900 2418 2098 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986769.1 protein_id gnl|my_center|LOCUS_17900 2757 3041 gene locus_tag LOCUS_17910 2757 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 3087 4115 gene locus_tag LOCUS_17920 3087 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 4117 4965 gene locus_tag LOCUS_17930 4117 4965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 4967 5818 gene locus_tag LOCUS_17940 4967 5818 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948651.1 protein_id gnl|my_center|LOCUS_17940 5811 6920 gene locus_tag LOCUS_17950 5811 6920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 >Feature sequence128 1884 442 gene locus_tag LOCUS_17960 1884 442 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775020.1 protein_id gnl|my_center|LOCUS_17960 3595 2201 gene locus_tag LOCUS_17970 3595 2201 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091276.1 protein_id gnl|my_center|LOCUS_17970 4907 3588 gene locus_tag LOCUS_17980 4907 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 6096 4891 gene locus_tag LOCUS_17990 gene csaB 6096 4891 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181502.1 protein_id gnl|my_center|LOCUS_17990 6964 6086 gene locus_tag LOCUS_18000 6964 6086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 8031 6979 gene locus_tag LOCUS_18010 8031 6979 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926037.1 protein_id gnl|my_center|LOCUS_18010 >Feature sequence129 965 1810 gene locus_tag LOCUS_18020 965 1810 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223846944.1 protein_id gnl|my_center|LOCUS_18020 2445 1834 gene locus_tag LOCUS_18030 2445 1834 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583266.1 protein_id gnl|my_center|LOCUS_18030 4258 2462 gene locus_tag LOCUS_18040 4258 2462 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461397.1 protein_id gnl|my_center|LOCUS_18040 6014 4251 gene locus_tag LOCUS_18050 6014 4251 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461398.1 protein_id gnl|my_center|LOCUS_18050 6651 6097 gene locus_tag LOCUS_18060 6651 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 7004 6723 gene locus_tag LOCUS_18070 7004 6723 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922237.1 protein_id gnl|my_center|LOCUS_18070 7952 7020 gene locus_tag LOCUS_18080 7952 7020 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928176.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence130 3 260 gene locus_tag LOCUS_18090 3 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 398 1246 gene locus_tag LOCUS_18100 398 1246 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942615.1 protein_id gnl|my_center|LOCUS_18100 1239 2579 gene locus_tag LOCUS_18110 1239 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458963.1 protein_id gnl|my_center|LOCUS_18110 4618 2705 gene locus_tag LOCUS_18120 4618 2705 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674124.1 protein_id gnl|my_center|LOCUS_18120 4812 5141 gene locus_tag LOCUS_18130 4812 5141 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429250.1 protein_id gnl|my_center|LOCUS_18130 5147 6418 gene locus_tag LOCUS_18140 5147 6418 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013245438.1 protein_id gnl|my_center|LOCUS_18140 6440 6781 gene locus_tag LOCUS_18150 6440 6781 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573646.1 protein_id gnl|my_center|LOCUS_18150 6784 8250 gene locus_tag LOCUS_18160 6784 8250 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021368039.1 protein_id gnl|my_center|LOCUS_18160 >Feature sequence131 <1 1082 gene locus_tag LOCUS_18170 <1 1082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020587.1:DUF3656 domain-containing protein 1199 1528 gene locus_tag LOCUS_18180 1199 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 2093 1542 gene locus_tag LOCUS_18190 2093 1542 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476166.1 protein_id gnl|my_center|LOCUS_18190 2343 2657 gene locus_tag LOCUS_18200 2343 2657 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990063.1 protein_id gnl|my_center|LOCUS_18200 2724 3041 gene locus_tag LOCUS_18210 2724 3041 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990063.1 protein_id gnl|my_center|LOCUS_18210 3150 3422 gene locus_tag LOCUS_18220 3150 3422 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812009.1 protein_id gnl|my_center|LOCUS_18220 3434 4798 gene locus_tag LOCUS_18230 3434 4798 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_18230 4847 6073 gene locus_tag LOCUS_18240 4847 6073 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966536.1 protein_id gnl|my_center|LOCUS_18240 6087 7814 gene locus_tag LOCUS_18250 6087 7814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 >Feature sequence132 <1 1202 gene locus_tag LOCUS_18260 <1 1202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228075.1:ATP-binding protein 1204 1371 gene locus_tag LOCUS_18270 1204 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 1368 1859 gene locus_tag LOCUS_18280 1368 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 2629 2153 gene locus_tag LOCUS_18290 gene queF 2629 2153 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832596.1 protein_id gnl|my_center|LOCUS_18290 3314 2619 gene locus_tag LOCUS_18300 gene queC 3314 2619 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877949.1 protein_id gnl|my_center|LOCUS_18300 3891 3325 gene locus_tag LOCUS_18310 gene folE 3891 3325 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966889.1 protein_id gnl|my_center|LOCUS_18310 4555 3893 gene locus_tag LOCUS_18320 gene queE 4555 3893 CDS product putative 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966888.1 protein_id gnl|my_center|LOCUS_18320 4973 4548 gene locus_tag LOCUS_18330 gene queD 4973 4548 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949100.1 protein_id gnl|my_center|LOCUS_18330 5246 6904 gene locus_tag LOCUS_18340 5246 6904 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_18340 7244 8095 gene locus_tag LOCUS_18350 7244 8095 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549941.1 protein_id gnl|my_center|LOCUS_18350 >Feature sequence133 588 163 gene locus_tag LOCUS_18360 588 163 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966110.1 protein_id gnl|my_center|LOCUS_18360 1154 588 gene locus_tag LOCUS_18370 1154 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 1955 1155 gene locus_tag LOCUS_18380 1955 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 3620 2193 gene locus_tag LOCUS_18390 gene gltX 3620 2193 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706819.1 protein_id gnl|my_center|LOCUS_18390 4104 3622 gene locus_tag LOCUS_18400 gene ispF 4104 3622 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_18400 4856 4164 gene locus_tag LOCUS_18410 4856 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 5662 4925 gene locus_tag LOCUS_18420 5662 4925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 6438 5665 gene locus_tag LOCUS_18430 6438 5665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 8028 6547 gene locus_tag LOCUS_18440 8028 6547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 >Feature sequence134 3366 2329 gene locus_tag LOCUS_18450 gene pheS 3366 2329 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398818.1 protein_id gnl|my_center|LOCUS_18450 5138 4419 gene locus_tag LOCUS_18460 5138 4419 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003158483.1 protein_id gnl|my_center|LOCUS_18460 5800 5135 gene locus_tag LOCUS_18470 5800 5135 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041356927.1 protein_id gnl|my_center|LOCUS_18470 5860 6060 gene locus_tag LOCUS_18480 5860 6060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 6503 6072 gene locus_tag LOCUS_18490 6503 6072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 7326 6496 gene locus_tag LOCUS_18500 7326 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 <8231 7444 gene locus_tag LOCUS_18510 <8231 7444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001830831.1:pyruvate kinase >Feature sequence135 59 1414 gene locus_tag LOCUS_18520 59 1414 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207256.1 protein_id gnl|my_center|LOCUS_18520 1418 4240 gene locus_tag LOCUS_18530 gene uvrA 1418 4240 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228057.1 protein_id gnl|my_center|LOCUS_18530 4254 5189 gene locus_tag LOCUS_18540 gene hprK 4254 5189 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289568.1 protein_id gnl|my_center|LOCUS_18540 5193 6008 gene locus_tag LOCUS_18550 gene lgt 5193 6008 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513305.1 protein_id gnl|my_center|LOCUS_18550 6193 7599 gene locus_tag LOCUS_18560 6193 7599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence136 503 1168 gene locus_tag LOCUS_18570 503 1168 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964066.1 protein_id gnl|my_center|LOCUS_18570 2029 1889 gene locus_tag LOCUS_18580 2029 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18580 2546 2301 gene locus_tag LOCUS_18590 2546 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18590 3596 3048 gene locus_tag LOCUS_18600 3596 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 4927 3593 gene locus_tag LOCUS_18610 4927 3593 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_18610 5544 4924 gene locus_tag LOCUS_18620 5544 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 7542 5599 gene locus_tag LOCUS_18630 7542 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 >Feature sequence137 243 725 gene locus_tag LOCUS_18640 gene coaD 243 725 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728846.1 protein_id gnl|my_center|LOCUS_18640 1063 1671 gene locus_tag LOCUS_18650 1063 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 1825 2700 gene locus_tag LOCUS_18660 1825 2700 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723082.1 protein_id gnl|my_center|LOCUS_18660 2693 3961 gene locus_tag LOCUS_18670 2693 3961 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767028.1 protein_id gnl|my_center|LOCUS_18670 3971 4726 gene locus_tag LOCUS_18680 3971 4726 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016380.1 protein_id gnl|my_center|LOCUS_18680 4719 5636 gene locus_tag LOCUS_18690 gene pyrD 4719 5636 CDS product dihydroorotate oxidase B catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081057.1 protein_id gnl|my_center|LOCUS_18690 5734 7878 gene locus_tag LOCUS_18700 5734 7878 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948404.1 protein_id gnl|my_center|LOCUS_18700 >Feature sequence138 1933 656 gene locus_tag LOCUS_18710 1933 656 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721679.1 protein_id gnl|my_center|LOCUS_18710 2104 2982 gene locus_tag LOCUS_18720 2104 2982 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435316.1 protein_id gnl|my_center|LOCUS_18720 3074 4867 gene locus_tag LOCUS_18730 3074 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 5962 4892 gene locus_tag LOCUS_18740 5962 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 6897 6058 gene locus_tag LOCUS_18750 6897 6058 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680113.1 protein_id gnl|my_center|LOCUS_18750 <8024 6970 gene locus_tag LOCUS_18760 <8024 6970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963649.1:replication-associated recombination protein A >Feature sequence139 161 1462 gene locus_tag LOCUS_18770 161 1462 CDS product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198991.1 protein_id gnl|my_center|LOCUS_18770 2768 1656 gene locus_tag LOCUS_18780 2768 1656 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948743.1 protein_id gnl|my_center|LOCUS_18780 3493 2768 gene locus_tag LOCUS_18790 3493 2768 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016658.1 protein_id gnl|my_center|LOCUS_18790 4169 3486 gene locus_tag LOCUS_18800 4169 3486 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002938702.1 protein_id gnl|my_center|LOCUS_18800 4954 4187 gene locus_tag LOCUS_18810 4954 4187 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081258.1 protein_id gnl|my_center|LOCUS_18810 5510 5256 gene locus_tag LOCUS_18820 5510 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 6305 5541 gene locus_tag LOCUS_18830 6305 5541 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245153.1 protein_id gnl|my_center|LOCUS_18830 6500 6895 gene locus_tag LOCUS_18840 6500 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 7323 6931 gene locus_tag LOCUS_18850 7323 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 >Feature sequence140 267 73 gene locus_tag LOCUS_18860 gene rpmI 267 73 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222418.1 protein_id gnl|my_center|LOCUS_18860 839 285 gene locus_tag LOCUS_18870 gene infC 839 285 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973214.1 protein_id gnl|my_center|LOCUS_18870 1135 2061 gene locus_tag LOCUS_18880 gene pfkB 1135 2061 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986316.1 protein_id gnl|my_center|LOCUS_18880 3045 2209 gene locus_tag LOCUS_18890 3045 2209 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765521.1 protein_id gnl|my_center|LOCUS_18890 3340 3038 gene locus_tag LOCUS_18900 3340 3038 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582838.1 protein_id gnl|my_center|LOCUS_18900 5311 3362 gene locus_tag LOCUS_18910 5311 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 5890 5369 gene locus_tag LOCUS_18920 5890 5369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 6138 5887 gene locus_tag LOCUS_18930 6138 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 7855 6269 gene locus_tag LOCUS_18940 7855 6269 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048268.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence141 465 139 gene locus_tag LOCUS_18950 465 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 723 571 gene locus_tag LOCUS_18960 723 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 1162 731 gene locus_tag LOCUS_18970 1162 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 1433 1155 gene locus_tag LOCUS_18980 1433 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 1651 1430 gene locus_tag LOCUS_18990 1651 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 1887 1648 gene locus_tag LOCUS_19000 1887 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 2114 1884 gene locus_tag LOCUS_19010 2114 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 2322 2098 gene locus_tag LOCUS_19020 2322 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 2557 2327 gene locus_tag LOCUS_19030 2557 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 2722 2561 gene locus_tag LOCUS_19040 2722 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 3265 2726 gene locus_tag LOCUS_19050 3265 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 3480 3253 gene locus_tag LOCUS_19060 3480 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 3652 3461 gene locus_tag LOCUS_19070 3652 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 4000 3794 gene locus_tag LOCUS_19080 4000 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 4218 4024 gene locus_tag LOCUS_19090 4218 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 4450 4253 gene locus_tag LOCUS_19100 4450 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 4631 4461 gene locus_tag LOCUS_19110 4631 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 4792 4628 gene locus_tag LOCUS_19120 4792 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 5001 4789 gene locus_tag LOCUS_19130 5001 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 5278 5015 gene locus_tag LOCUS_19140 5278 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 5439 5290 gene locus_tag LOCUS_19150 5439 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 5648 5454 gene locus_tag LOCUS_19160 5648 5454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 5835 5641 gene locus_tag LOCUS_19170 5835 5641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 7240 5837 gene locus_tag LOCUS_19180 7240 5837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 7671 7240 gene locus_tag LOCUS_19190 7671 7240 CDS product PcfK-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793657.1 protein_id gnl|my_center|LOCUS_19190 >Feature sequence142 <1 1725 gene locus_tag LOCUS_19200 <1 1725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029414652.1:ABC transporter ATP-binding protein/permease 4969 1784 gene locus_tag LOCUS_19210 4969 1784 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016952.1 protein_id gnl|my_center|LOCUS_19210 5081 5156 gene locus_tag LOCUS_t00240 5081 5156 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5211 5651 gene locus_tag LOCUS_19220 5211 5651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 6140 5742 gene locus_tag LOCUS_19230 6140 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 6724 6164 gene locus_tag LOCUS_19240 6724 6164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002938103.1 protein_id gnl|my_center|LOCUS_19240 7260 6790 gene locus_tag LOCUS_19250 7260 6790 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002869083.1 protein_id gnl|my_center|LOCUS_19250 7431 7356 gene locus_tag LOCUS_t00250 7431 7356 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence143 427 1233 gene locus_tag LOCUS_19260 427 1233 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896027.1 protein_id gnl|my_center|LOCUS_19260 1258 1824 gene locus_tag LOCUS_19270 1258 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 1976 2668 gene locus_tag LOCUS_19280 1976 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 2715 3614 gene locus_tag LOCUS_19290 2715 3614 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101944.1 protein_id gnl|my_center|LOCUS_19290 5049 3637 gene locus_tag LOCUS_19300 5049 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 6034 5150 gene locus_tag LOCUS_19310 6034 5150 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_19310 6537 6082 gene locus_tag LOCUS_19320 6537 6082 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948661.1 protein_id gnl|my_center|LOCUS_19320 >Feature sequence144 275 1543 gene locus_tag LOCUS_19330 275 1543 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227628.1 protein_id gnl|my_center|LOCUS_19330 1650 1853 gene locus_tag LOCUS_19340 gene rpmE 1650 1853 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_19340 2595 2008 gene locus_tag LOCUS_19350 2595 2008 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_19350 2759 3508 gene locus_tag LOCUS_19360 2759 3508 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357943.1 protein_id gnl|my_center|LOCUS_19360 3498 3977 gene locus_tag LOCUS_19370 gene rlmH 3498 3977 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355021.1 protein_id gnl|my_center|LOCUS_19370 4034 4312 gene locus_tag LOCUS_19380 4034 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 4314 4796 gene locus_tag LOCUS_19390 4314 4796 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966054.1 protein_id gnl|my_center|LOCUS_19390 4909 5514 gene locus_tag LOCUS_19400 4909 5514 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227753.1 protein_id gnl|my_center|LOCUS_19400 5520 6068 gene locus_tag LOCUS_19410 gene yfcE 5520 6068 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_19410 6173 6475 gene locus_tag LOCUS_19420 6173 6475 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809626.1 protein_id gnl|my_center|LOCUS_19420 6662 7378 gene locus_tag LOCUS_19430 6662 7378 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723222.1 protein_id gnl|my_center|LOCUS_19430 >Feature sequence145 <1 1355 gene locus_tag LOCUS_19440 <1 1355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003231550.1:DNA topoisomerase IV subunit A 2058 1372 gene locus_tag LOCUS_19450 gene sigK 2058 1372 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051382.1 protein_id gnl|my_center|LOCUS_19450 2200 3294 gene locus_tag LOCUS_19460 gene yqeH 2200 3294 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229966.1 protein_id gnl|my_center|LOCUS_19460 3308 3598 gene locus_tag LOCUS_19470 gene yhbY 3308 3598 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941918.1 protein_id gnl|my_center|LOCUS_19470 3595 4692 gene locus_tag LOCUS_19480 3595 4692 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166626.1 protein_id gnl|my_center|LOCUS_19480 4685 5029 gene locus_tag LOCUS_19490 gene rsfS 4685 5029 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475792.1 protein_id gnl|my_center|LOCUS_19490 5029 5748 gene locus_tag LOCUS_19500 5029 5748 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356302.1 protein_id gnl|my_center|LOCUS_19500 5749 6444 gene locus_tag LOCUS_19510 gene mtnN 5749 6444 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579275.1 protein_id gnl|my_center|LOCUS_19510 >Feature sequence146 569 922 gene locus_tag LOCUS_19520 gene nrdI 569 922 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231758.1 protein_id gnl|my_center|LOCUS_19520 1406 1774 gene locus_tag LOCUS_19530 1406 1774 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964778.1 protein_id gnl|my_center|LOCUS_19530 1933 4542 gene locus_tag LOCUS_19540 1933 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 5043 4597 gene locus_tag LOCUS_19550 5043 4597 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902048.1 protein_id gnl|my_center|LOCUS_19550 5180 6223 gene locus_tag LOCUS_19560 5180 6223 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895264.1 protein_id gnl|my_center|LOCUS_19560 >Feature sequence147 932 513 gene locus_tag LOCUS_19570 932 513 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_19570 1323 3206 gene locus_tag LOCUS_19580 1323 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 3352 3600 gene locus_tag LOCUS_19590 gene cdd1 3352 3600 CDS product protein Cdd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888450.1 protein_id gnl|my_center|LOCUS_19590 3790 4677 gene locus_tag LOCUS_19600 3790 4677 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948435.1 protein_id gnl|my_center|LOCUS_19600 4658 5695 gene locus_tag LOCUS_19610 4658 5695 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986736.1 protein_id gnl|my_center|LOCUS_19610 5822 7138 gene locus_tag LOCUS_19620 5822 7138 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814884.1 protein_id gnl|my_center|LOCUS_19620 >Feature sequence148 2733 337 gene locus_tag LOCUS_19630 gene leuS 2733 337 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285916.1 protein_id gnl|my_center|LOCUS_19630 4887 3022 gene locus_tag LOCUS_19640 4887 3022 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101807.1 protein_id gnl|my_center|LOCUS_19640 6720 4891 gene locus_tag LOCUS_19650 6720 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 >Feature sequence149 1543 941 gene locus_tag LOCUS_19660 1543 941 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062281989.1 protein_id gnl|my_center|LOCUS_19660 1743 2504 gene locus_tag LOCUS_19670 1743 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 3730 2534 gene locus_tag LOCUS_19680 3730 2534 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654702.1 protein_id gnl|my_center|LOCUS_19680 3817 4158 gene locus_tag LOCUS_19690 3817 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 4199 6427 gene locus_tag LOCUS_19700 4199 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 >Feature sequence150 1363 536 gene locus_tag LOCUS_19710 1363 536 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263894.1 protein_id gnl|my_center|LOCUS_19710 2450 1353 gene locus_tag LOCUS_19720 2450 1353 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852095.1 protein_id gnl|my_center|LOCUS_19720 3978 2644 gene locus_tag LOCUS_19730 3978 2644 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809528.1 protein_id gnl|my_center|LOCUS_19730 4399 3971 gene locus_tag LOCUS_19740 4399 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 5927 4491 gene locus_tag LOCUS_19750 gene proS 5927 4491 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040972.1 protein_id gnl|my_center|LOCUS_19750 <7588 5995 gene locus_tag LOCUS_19760 <7588 5995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072762.1:SMC family ATPase >Feature sequence151 982 308 gene locus_tag LOCUS_19770 982 308 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670138.1 protein_id gnl|my_center|LOCUS_19770 2040 1006 gene locus_tag LOCUS_19780 2040 1006 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782642.1 protein_id gnl|my_center|LOCUS_19780 2265 2756 gene locus_tag LOCUS_19790 2265 2756 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_19790 2756 3925 gene locus_tag LOCUS_19800 2756 3925 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808537.1 protein_id gnl|my_center|LOCUS_19800 4256 6574 gene locus_tag LOCUS_19810 4256 6574 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390143.1 protein_id gnl|my_center|LOCUS_19810 7410 6613 gene locus_tag LOCUS_19820 7410 6613 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476336.1 protein_id gnl|my_center|LOCUS_19820 >Feature sequence152 1029 661 gene locus_tag LOCUS_19830 1029 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 1387 1022 gene locus_tag LOCUS_19840 1387 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 1828 1397 gene locus_tag LOCUS_19850 1828 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 2120 1821 gene locus_tag LOCUS_19860 2120 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 3160 2132 gene locus_tag LOCUS_19870 3160 2132 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079343.1 protein_id gnl|my_center|LOCUS_19870 4072 3173 gene locus_tag LOCUS_19880 4072 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 6045 4189 gene locus_tag LOCUS_19890 6045 4189 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_19890 <7527 6047 gene locus_tag LOCUS_19900 <7527 6047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966684.1:ABC transporter ATP-binding protein >Feature sequence153 22 2262 gene locus_tag LOCUS_19910 22 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 2840 2307 gene locus_tag LOCUS_19920 2840 2307 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_19920 3468 2824 gene locus_tag LOCUS_19930 3468 2824 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460050.1 protein_id gnl|my_center|LOCUS_19930 3814 3638 gene locus_tag LOCUS_19940 3814 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 5523 3829 gene locus_tag LOCUS_19950 5523 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 6877 5534 gene locus_tag LOCUS_19960 gene mgtE 6877 5534 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392647.1 protein_id gnl|my_center|LOCUS_19960 7110 7349 gene locus_tag LOCUS_19970 7110 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 >Feature sequence154 1617 481 gene locus_tag LOCUS_19980 1617 481 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765133.1 protein_id gnl|my_center|LOCUS_19980 2036 1614 gene locus_tag LOCUS_19990 2036 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 2592 2095 gene locus_tag LOCUS_20000 2592 2095 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439413.1 protein_id gnl|my_center|LOCUS_20000 3720 2602 gene locus_tag LOCUS_20010 gene pheA 3720 2602 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_20010 4794 3724 gene locus_tag LOCUS_20020 gene aroC 4794 3724 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964214.1 protein_id gnl|my_center|LOCUS_20020 6052 4772 gene locus_tag LOCUS_20030 gene aroA 6052 4772 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861345.1 protein_id gnl|my_center|LOCUS_20030 7112 6054 gene locus_tag LOCUS_20040 gene aroB 7112 6054 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893310.1 protein_id gnl|my_center|LOCUS_20040 >Feature sequence155 <1 923 gene locus_tag LOCUS_20050 <1 923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963590.1:L-lactate dehydrogenase 1036 3015 gene locus_tag LOCUS_20060 1036 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 3941 3048 gene locus_tag LOCUS_20070 3941 3048 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948489.1 protein_id gnl|my_center|LOCUS_20070 4729 3980 gene locus_tag LOCUS_20080 4729 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 5639 4722 gene locus_tag LOCUS_20090 5639 4722 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004846624.1 protein_id gnl|my_center|LOCUS_20090 6382 5714 gene locus_tag LOCUS_20100 6382 5714 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966022.1 protein_id gnl|my_center|LOCUS_20100 6798 6385 gene locus_tag LOCUS_20110 6798 6385 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705736.1 protein_id gnl|my_center|LOCUS_20110 7130 6801 gene locus_tag LOCUS_20120 7130 6801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 >Feature sequence156 1009 299 gene locus_tag LOCUS_20130 1009 299 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861321.1 protein_id gnl|my_center|LOCUS_20130 2361 1108 gene locus_tag LOCUS_20140 2361 1108 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454794.1 protein_id gnl|my_center|LOCUS_20140 3183 2554 gene locus_tag LOCUS_20150 3183 2554 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044665005.1 protein_id gnl|my_center|LOCUS_20150 5155 3188 gene locus_tag LOCUS_20160 5155 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 6420 5266 gene locus_tag LOCUS_20170 6420 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 7093 6413 gene locus_tag LOCUS_20180 7093 6413 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948310.1 protein_id gnl|my_center|LOCUS_20180 >Feature sequence157 511 296 gene locus_tag LOCUS_20190 511 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20190 1772 729 gene locus_tag LOCUS_20200 1772 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 3201 1777 gene locus_tag LOCUS_20210 3201 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 3562 3344 gene locus_tag LOCUS_20220 3562 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 5566 3749 gene locus_tag LOCUS_20230 gene typA 5566 3749 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288735.1 protein_id gnl|my_center|LOCUS_20230 6525 5665 gene locus_tag LOCUS_20240 6525 5665 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262933.1 protein_id gnl|my_center|LOCUS_20240 6632 7195 gene locus_tag LOCUS_20250 6632 7195 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948694.1 protein_id gnl|my_center|LOCUS_20250 >Feature sequence158 1208 393 gene locus_tag LOCUS_20260 1208 393 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287678.1 protein_id gnl|my_center|LOCUS_20260 1883 1218 gene locus_tag LOCUS_20270 1883 1218 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359553.1 protein_id gnl|my_center|LOCUS_20270 2887 1883 gene locus_tag LOCUS_20280 2887 1883 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304234.1 protein_id gnl|my_center|LOCUS_20280 3609 5087 gene locus_tag LOCUS_20290 3609 5087 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387645.1 protein_id gnl|my_center|LOCUS_20290 5530 5111 gene locus_tag LOCUS_20300 5530 5111 CDS product DUF3788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022471380.1 protein_id gnl|my_center|LOCUS_20300 6710 5544 gene locus_tag LOCUS_20310 6710 5544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 >Feature sequence159 804 556 gene locus_tag LOCUS_20320 804 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 1869 928 gene locus_tag LOCUS_20330 1869 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 2951 1869 gene locus_tag LOCUS_20340 2951 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 3091 3819 gene locus_tag LOCUS_20350 3091 3819 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286317.1 protein_id gnl|my_center|LOCUS_20350 3882 4631 gene locus_tag LOCUS_20360 3882 4631 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132534.1 protein_id gnl|my_center|LOCUS_20360 4829 6211 gene locus_tag LOCUS_20370 4829 6211 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068695.1 protein_id gnl|my_center|LOCUS_20370 6204 6962 gene locus_tag LOCUS_20380 6204 6962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 >Feature sequence160 237 461 gene locus_tag LOCUS_20390 237 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 355 1188 gene locus_tag LOCUS_20400 355 1188 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382189.1 protein_id gnl|my_center|LOCUS_20400 1188 1970 gene locus_tag LOCUS_20410 1188 1970 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357916.1 protein_id gnl|my_center|LOCUS_20410 1981 3018 gene locus_tag LOCUS_20420 1981 3018 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002413403.1 protein_id gnl|my_center|LOCUS_20420 3035 4078 gene locus_tag LOCUS_20430 3035 4078 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379352.1 protein_id gnl|my_center|LOCUS_20430 4093 5802 gene locus_tag LOCUS_20440 4093 5802 CDS product adenine deaminase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384673.1 protein_id gnl|my_center|LOCUS_20440 5786 7105 gene locus_tag LOCUS_20450 5786 7105 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386645.1 protein_id gnl|my_center|LOCUS_20450 >Feature sequence161 642 82 gene locus_tag LOCUS_20460 642 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20460 3138 913 gene locus_tag LOCUS_20470 gene relA 3138 913 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229747.1 protein_id gnl|my_center|LOCUS_20470 3700 3182 gene locus_tag LOCUS_20480 3700 3182 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902332.1 protein_id gnl|my_center|LOCUS_20480 5401 3755 gene locus_tag LOCUS_20490 5401 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 5728 5438 gene locus_tag LOCUS_20500 5728 5438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 5798 7096 gene locus_tag LOCUS_20510 5798 7096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 >Feature sequence162 181 1302 gene locus_tag LOCUS_20520 181 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 1956 1420 gene locus_tag LOCUS_20530 1956 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 2041 2907 gene locus_tag LOCUS_20540 2041 2907 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681080.1 protein_id gnl|my_center|LOCUS_20540 2998 3699 gene locus_tag LOCUS_20550 2998 3699 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015921.1 protein_id gnl|my_center|LOCUS_20550 3785 4636 gene locus_tag LOCUS_20560 3785 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 5039 4749 gene locus_tag LOCUS_20570 5039 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 5249 5941 gene locus_tag LOCUS_20580 5249 5941 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861321.1 protein_id gnl|my_center|LOCUS_20580 6208 7119 gene locus_tag LOCUS_20590 6208 7119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 >Feature sequence163 1018 266 gene locus_tag LOCUS_20600 1018 266 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167184.1 protein_id gnl|my_center|LOCUS_20600 2287 1055 gene locus_tag LOCUS_20610 gene purM 2287 1055 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938699.1 protein_id gnl|my_center|LOCUS_20610 2599 2964 gene locus_tag LOCUS_20620 2599 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 2981 3406 gene locus_tag LOCUS_20630 2981 3406 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060880.1 protein_id gnl|my_center|LOCUS_20630 3418 4329 gene locus_tag LOCUS_20640 3418 4329 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_20640 5917 4349 gene locus_tag LOCUS_20650 5917 4349 CDS product DUF1593 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189567636.1 protein_id gnl|my_center|LOCUS_20650 7026 6046 gene locus_tag LOCUS_20660 7026 6046 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548226.1 protein_id gnl|my_center|LOCUS_20660 >Feature sequence164 1821 1027 gene locus_tag LOCUS_20670 1821 1027 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223846944.1 protein_id gnl|my_center|LOCUS_20670 2633 1818 gene locus_tag LOCUS_20680 2633 1818 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861671.1 protein_id gnl|my_center|LOCUS_20680 3063 2788 gene locus_tag LOCUS_20690 gene hupB 3063 2788 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081127.1 protein_id gnl|my_center|LOCUS_20690 4171 3149 gene locus_tag LOCUS_20700 4171 3149 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461701.1 protein_id gnl|my_center|LOCUS_20700 5014 4181 gene locus_tag LOCUS_20710 5014 4181 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464831.1 protein_id gnl|my_center|LOCUS_20710 5392 5087 gene locus_tag LOCUS_20720 5392 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 5809 5465 gene locus_tag LOCUS_20730 5809 5465 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392814.1 protein_id gnl|my_center|LOCUS_20730 7062 5821 gene locus_tag LOCUS_20740 7062 5821 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262686.1 protein_id gnl|my_center|LOCUS_20740 >Feature sequence165 145 849 gene locus_tag LOCUS_20750 gene rgbR 145 849 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_20750 851 2065 gene locus_tag LOCUS_20760 851 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 2159 2314 gene locus_tag LOCUS_20770 2159 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 2311 2877 gene locus_tag LOCUS_20780 2311 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 3257 2910 gene locus_tag LOCUS_20790 3257 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 3444 4325 gene locus_tag LOCUS_20800 3444 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 4901 4404 gene locus_tag LOCUS_20810 4901 4404 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461388.1 protein_id gnl|my_center|LOCUS_20810 5042 5173 gene locus_tag LOCUS_20820 5042 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 5170 6144 gene locus_tag LOCUS_20830 5170 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 <7127 6481 gene locus_tag LOCUS_20840 <7127 6481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966642.1:FAD-dependent oxidoreductase >Feature sequence166 397 164 gene locus_tag LOCUS_20850 397 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 1298 546 gene locus_tag LOCUS_20860 1298 546 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668469.1 protein_id gnl|my_center|LOCUS_20860 2308 1328 gene locus_tag LOCUS_20870 2308 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 2802 2317 gene locus_tag LOCUS_20880 2802 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272655.1 protein_id gnl|my_center|LOCUS_20880 3247 2807 gene locus_tag LOCUS_20890 3247 2807 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673332.1 protein_id gnl|my_center|LOCUS_20890 3573 3370 gene locus_tag LOCUS_20900 3573 3370 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423163.1 protein_id gnl|my_center|LOCUS_20900 4217 3576 gene locus_tag LOCUS_20910 4217 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 4396 4686 gene locus_tag LOCUS_20920 4396 4686 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722275.1 protein_id gnl|my_center|LOCUS_20920 4749 4979 gene locus_tag LOCUS_20930 4749 4979 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966596.1 protein_id gnl|my_center|LOCUS_20930 5085 5816 gene locus_tag LOCUS_20940 5085 5816 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966816.1 protein_id gnl|my_center|LOCUS_20940 5809 6981 gene locus_tag LOCUS_20950 5809 6981 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986712.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence167 2771 90 gene locus_tag LOCUS_20960 2771 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 3653 2865 gene locus_tag LOCUS_20970 3653 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 4815 3664 gene locus_tag LOCUS_20980 4815 3664 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066352518.1 protein_id gnl|my_center|LOCUS_20980 5486 5989 gene locus_tag LOCUS_20990 5486 5989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 6008 6349 gene locus_tag LOCUS_21000 6008 6349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 >Feature sequence168 3 518 gene locus_tag LOCUS_21010 3 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 883 1614 gene locus_tag LOCUS_21020 gene spo0A 883 1614 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965371.1 protein_id gnl|my_center|LOCUS_21020 2487 1672 gene locus_tag LOCUS_21030 gene spo0A 2487 1672 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293867.1 protein_id gnl|my_center|LOCUS_21030 3794 2682 gene locus_tag LOCUS_21040 3794 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 4015 5514 gene locus_tag LOCUS_21050 4015 5514 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064987.1 protein_id gnl|my_center|LOCUS_21050 >Feature sequence169 438 941 gene locus_tag LOCUS_21060 438 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 1112 1687 gene locus_tag LOCUS_21070 1112 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 2623 1718 gene locus_tag LOCUS_21080 2623 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 3467 2856 gene locus_tag LOCUS_21090 3467 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 4776 3457 gene locus_tag LOCUS_21100 4776 3457 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015770.1 protein_id gnl|my_center|LOCUS_21100 5025 6794 gene locus_tag LOCUS_21110 5025 6794 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460031.1 protein_id gnl|my_center|LOCUS_21110 >Feature sequence170 104 1162 gene locus_tag LOCUS_21120 104 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 1298 2320 gene locus_tag LOCUS_21130 1298 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 3910 2468 gene locus_tag LOCUS_21140 3910 2468 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546599.1 protein_id gnl|my_center|LOCUS_21140 4348 5394 gene locus_tag LOCUS_21150 4348 5394 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966740.1 protein_id gnl|my_center|LOCUS_21150 5903 5433 gene locus_tag LOCUS_21160 5903 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 6066 6524 gene locus_tag LOCUS_21170 6066 6524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 6730 6657 gene locus_tag LOCUS_t00260 6730 6657 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6824 6736 gene locus_tag LOCUS_t00270 6824 6736 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6915 6840 gene locus_tag LOCUS_t00280 6915 6840 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence171 1975 1589 gene locus_tag LOCUS_21180 gene tagD 1975 1589 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643222.1 protein_id gnl|my_center|LOCUS_21180 2813 1986 gene locus_tag LOCUS_21190 2813 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 3643 2822 gene locus_tag LOCUS_21200 gene tagG 3643 2822 CDS product teichoic acids export ABC transporter permease subunit TagG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227928.1 protein_id gnl|my_center|LOCUS_21200 3982 4368 gene locus_tag LOCUS_21210 3982 4368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 4496 6844 gene locus_tag LOCUS_21220 gene feoB 4496 6844 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_21220 >Feature sequence172 186 398 gene locus_tag LOCUS_21230 186 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 562 1329 gene locus_tag LOCUS_21240 562 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 1326 2240 gene locus_tag LOCUS_21250 1326 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 2500 3162 gene locus_tag LOCUS_21260 2500 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 3155 5770 gene locus_tag LOCUS_21270 gene valS 3155 5770 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072238.1 protein_id gnl|my_center|LOCUS_21270 5910 6068 gene locus_tag LOCUS_21280 5910 6068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 6265 6651 gene locus_tag LOCUS_21290 6265 6651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 >Feature sequence173 2593 1382 gene locus_tag LOCUS_21300 2593 1382 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836697.1 protein_id gnl|my_center|LOCUS_21300 3727 2729 gene locus_tag LOCUS_21310 3727 2729 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682144.1 protein_id gnl|my_center|LOCUS_21310 4201 3791 gene locus_tag LOCUS_21320 4201 3791 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895547.1 protein_id gnl|my_center|LOCUS_21320 4629 4249 gene locus_tag LOCUS_21330 4629 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 5259 4639 gene locus_tag LOCUS_21340 5259 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 6257 5592 gene locus_tag LOCUS_21350 6257 5592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 <6892 6337 gene locus_tag LOCUS_21360 <6892 6337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861817.1:glycoside hydrolase family 1 protein >Feature sequence174 949 68 gene locus_tag LOCUS_21370 949 68 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289172.1 protein_id gnl|my_center|LOCUS_21370 1749 1000 gene locus_tag LOCUS_21380 1749 1000 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681345.1 protein_id gnl|my_center|LOCUS_21380 2694 1765 gene locus_tag LOCUS_21390 2694 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 3683 2823 gene locus_tag LOCUS_21400 3683 2823 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674118.1 protein_id gnl|my_center|LOCUS_21400 3930 3697 gene locus_tag LOCUS_21410 3930 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 5784 4099 gene locus_tag LOCUS_21420 5784 4099 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775582.1 protein_id gnl|my_center|LOCUS_21420 <6868 5781 gene locus_tag LOCUS_21430 <6868 5781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010890696.1:glycoside hydrolase family 1 protein >Feature sequence175 107 727 gene locus_tag LOCUS_21440 107 727 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282761.1 protein_id gnl|my_center|LOCUS_21440 795 1175 gene locus_tag LOCUS_21450 795 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 1208 2749 gene locus_tag LOCUS_21460 1208 2749 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861147.1 protein_id gnl|my_center|LOCUS_21460 2982 2776 gene locus_tag LOCUS_21470 2982 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 3233 2946 gene locus_tag LOCUS_21480 3233 2946 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392904.1 protein_id gnl|my_center|LOCUS_21480 3358 3227 gene locus_tag LOCUS_21490 3358 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 3518 5110 gene locus_tag LOCUS_21500 3518 5110 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633861.1 protein_id gnl|my_center|LOCUS_21500 5186 5941 gene locus_tag LOCUS_21510 5186 5941 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459709.1 protein_id gnl|my_center|LOCUS_21510 >Feature sequence176 <1 524 gene locus_tag LOCUS_21520 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003386380.1:type IV pilus twitching motility protein PilT 1748 567 gene locus_tag LOCUS_21530 1748 567 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966253.1 protein_id gnl|my_center|LOCUS_21530 1856 2737 gene locus_tag LOCUS_21540 1856 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 2885 4066 gene locus_tag LOCUS_21550 2885 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 4255 4605 gene locus_tag LOCUS_21560 4255 4605 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368681.1 protein_id gnl|my_center|LOCUS_21560 4636 5436 gene locus_tag LOCUS_21570 4636 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 5429 6124 gene locus_tag LOCUS_21580 5429 6124 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006715.1 protein_id gnl|my_center|LOCUS_21580 >Feature sequence177 2361 877 gene locus_tag LOCUS_21590 2361 877 CDS product Lsa family ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987127.1 protein_id gnl|my_center|LOCUS_21590 2930 2580 gene locus_tag LOCUS_21600 2930 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 3995 2997 gene locus_tag LOCUS_21610 3995 2997 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861263.1 protein_id gnl|my_center|LOCUS_21610 4609 3992 gene locus_tag LOCUS_21620 4609 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 5063 4677 gene locus_tag LOCUS_21630 5063 4677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966229.1 protein_id gnl|my_center|LOCUS_21630 5506 5054 gene locus_tag LOCUS_21640 5506 5054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 5820 5698 gene locus_tag LOCUS_21650 5820 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 6019 6639 gene locus_tag LOCUS_21660 6019 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 >Feature sequence178 851 24 gene locus_tag LOCUS_21670 851 24 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964664.1 protein_id gnl|my_center|LOCUS_21670 2959 863 gene locus_tag LOCUS_21680 2959 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 4527 3205 gene locus_tag LOCUS_21690 4527 3205 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986630.1 protein_id gnl|my_center|LOCUS_21690 5564 4692 gene locus_tag LOCUS_21700 5564 4692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 6583 5579 gene locus_tag LOCUS_21710 6583 5579 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence179 622 185 gene locus_tag LOCUS_21720 622 185 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948080.1 protein_id gnl|my_center|LOCUS_21720 2003 675 gene locus_tag LOCUS_21730 2003 675 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963854.1 protein_id gnl|my_center|LOCUS_21730 2526 2032 gene locus_tag LOCUS_21740 2526 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 4113 2551 gene locus_tag LOCUS_21750 gene malP 4113 2551 CDS product PTS maltose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233606.1 protein_id gnl|my_center|LOCUS_21750 4329 6146 gene locus_tag LOCUS_21760 gene asnB 4329 6146 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233080.1 protein_id gnl|my_center|LOCUS_21760 6545 6168 gene locus_tag LOCUS_21770 6545 6168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 >Feature sequence180 1116 127 gene locus_tag LOCUS_21780 1116 127 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398762.1 protein_id gnl|my_center|LOCUS_21780 1274 2155 gene locus_tag LOCUS_21790 1274 2155 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289172.1 protein_id gnl|my_center|LOCUS_21790 2728 2195 gene locus_tag LOCUS_21800 2728 2195 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966606.1 protein_id gnl|my_center|LOCUS_21800 3386 2733 gene locus_tag LOCUS_21810 3386 2733 CDS product DUF4405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211250.1 protein_id gnl|my_center|LOCUS_21810 3994 3389 gene locus_tag LOCUS_21820 3994 3389 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_21820 5505 4105 gene locus_tag LOCUS_21830 5505 4105 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890696.1 protein_id gnl|my_center|LOCUS_21830 <6691 5518 gene locus_tag LOCUS_21840 <6691 5518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_146623251.1:beta-glucoside-specific PTS transporter subunit IIABC >Feature sequence181 1161 598 gene locus_tag LOCUS_21850 1161 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 2423 1215 gene locus_tag LOCUS_21860 2423 1215 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398755.1 protein_id gnl|my_center|LOCUS_21860 3499 2507 gene locus_tag LOCUS_21870 3499 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 5208 3553 gene locus_tag LOCUS_21880 gene recN 5208 3553 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699855.1 protein_id gnl|my_center|LOCUS_21880 6020 5220 gene locus_tag LOCUS_21890 6020 5220 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274739.1 protein_id gnl|my_center|LOCUS_21890 <6652 6001 gene locus_tag LOCUS_21900 <6652 6001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880536.1:1-deoxy-D-xylulose-5-phosphate synthase >Feature sequence182 421 1221 gene locus_tag LOCUS_21910 421 1221 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187402.1 protein_id gnl|my_center|LOCUS_21910 1221 2240 gene locus_tag LOCUS_21920 1221 2240 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263897.1 protein_id gnl|my_center|LOCUS_21920 2319 3146 gene locus_tag LOCUS_21930 gene hisJ 2319 3146 CDS product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227864.1 protein_id gnl|my_center|LOCUS_21930 3146 3928 gene locus_tag LOCUS_21940 3146 3928 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785236.1 protein_id gnl|my_center|LOCUS_21940 4048 4941 gene locus_tag LOCUS_21950 4048 4941 CDS product PEP phosphonomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901609.1 protein_id gnl|my_center|LOCUS_21950 5571 4972 gene locus_tag LOCUS_21960 5571 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 >Feature sequence183 16 1557 gene locus_tag LOCUS_21970 16 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 1548 2483 gene locus_tag LOCUS_21980 1548 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 2461 3351 gene locus_tag LOCUS_21990 gene isdE 2461 3351 CDS product heme ABC transporter substrate-binding protein IsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922615.1 protein_id gnl|my_center|LOCUS_21990 3338 4321 gene locus_tag LOCUS_22000 3338 4321 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036831.1 protein_id gnl|my_center|LOCUS_22000 4311 5072 gene locus_tag LOCUS_22010 4311 5072 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403746.1 protein_id gnl|my_center|LOCUS_22010 >Feature sequence184 922 1695 gene locus_tag LOCUS_22020 922 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 2197 4989 gene locus_tag LOCUS_22030 2197 4989 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262972.1 protein_id gnl|my_center|LOCUS_22030 5001 5648 gene locus_tag LOCUS_22040 5001 5648 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262971.1 protein_id gnl|my_center|LOCUS_22040 5662 6321 gene locus_tag LOCUS_22050 5662 6321 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262970.1 protein_id gnl|my_center|LOCUS_22050 >Feature sequence185 408 1571 gene locus_tag LOCUS_22060 408 1571 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460576.1 protein_id gnl|my_center|LOCUS_22060 1702 3138 gene locus_tag LOCUS_22070 gene bglA 1702 3138 CDS product 6-phospho-beta-glucosidase BglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226994.1 protein_id gnl|my_center|LOCUS_22070 3407 4222 gene locus_tag LOCUS_22080 3407 4222 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924976.1 protein_id gnl|my_center|LOCUS_22080 4319 5731 gene locus_tag LOCUS_22090 gene bglA 4319 5731 CDS product 6-phospho-beta-glucosidase BglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295376.1 protein_id gnl|my_center|LOCUS_22090 <6472 5747 gene locus_tag LOCUS_22100 <6472 5747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002289172.1:MurR/RpiR family transcriptional regulator >Feature sequence186 1471 974 gene locus_tag LOCUS_22110 1471 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 1971 1468 gene locus_tag LOCUS_22120 1971 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 2959 2027 gene locus_tag LOCUS_22130 2959 2027 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109323.1 protein_id gnl|my_center|LOCUS_22130 3398 3222 gene locus_tag LOCUS_22140 3398 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 3809 3480 gene locus_tag LOCUS_22150 3809 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 3983 5245 gene locus_tag LOCUS_22160 3983 5245 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731178.1 protein_id gnl|my_center|LOCUS_22160 6369 5272 gene locus_tag LOCUS_22170 6369 5272 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359094.1 protein_id gnl|my_center|LOCUS_22170 >Feature sequence187 1444 791 gene locus_tag LOCUS_22180 1444 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 2882 1467 gene locus_tag LOCUS_22190 2882 1467 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098239.1 protein_id gnl|my_center|LOCUS_22190 4215 2875 gene locus_tag LOCUS_22200 4215 2875 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725316.1 protein_id gnl|my_center|LOCUS_22200 5128 4391 gene locus_tag LOCUS_22210 5128 4391 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208843.1 protein_id gnl|my_center|LOCUS_22210 6167 5121 gene locus_tag LOCUS_22220 6167 5121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 >Feature sequence188 353 1192 gene locus_tag LOCUS_22230 353 1192 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439998.1 protein_id gnl|my_center|LOCUS_22230 1337 3169 gene locus_tag LOCUS_22240 1337 3169 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861819.1 protein_id gnl|my_center|LOCUS_22240 3187 4572 gene locus_tag LOCUS_22250 3187 4572 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890696.1 protein_id gnl|my_center|LOCUS_22250 4593 4796 gene locus_tag LOCUS_22260 4593 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 5296 5649 gene locus_tag LOCUS_22270 5296 5649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 >Feature sequence189 894 1652 gene locus_tag LOCUS_22280 894 1652 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 protein_id gnl|my_center|LOCUS_22280 1664 2593 gene locus_tag LOCUS_22290 1664 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 2702 4564 gene locus_tag LOCUS_22300 gene mnmG 2702 4564 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000541039.1 protein_id gnl|my_center|LOCUS_22300 4569 5270 gene locus_tag LOCUS_22310 gene rsmG 4569 5270 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019628.1 protein_id gnl|my_center|LOCUS_22310 5279 6046 gene locus_tag LOCUS_22320 gene noc 5279 6046 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799016.1 protein_id gnl|my_center|LOCUS_22320 >Feature sequence190 2688 1321 gene locus_tag LOCUS_22330 2688 1321 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060779496.1 protein_id gnl|my_center|LOCUS_22330 2962 3687 gene locus_tag LOCUS_22340 2962 3687 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355326.1 protein_id gnl|my_center|LOCUS_22340 4106 3945 gene locus_tag LOCUS_22350 4106 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 4335 4096 gene locus_tag LOCUS_22360 4335 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 5310 4339 gene locus_tag LOCUS_22370 5310 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 5628 5329 gene locus_tag LOCUS_22380 5628 5329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 5845 5630 gene locus_tag LOCUS_22390 5845 5630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 6122 5847 gene locus_tag LOCUS_22400 6122 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence191 1814 402 gene locus_tag LOCUS_22410 1814 402 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732174.1 protein_id gnl|my_center|LOCUS_22410 3128 1818 gene locus_tag LOCUS_22420 3128 1818 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098563.1 protein_id gnl|my_center|LOCUS_22420 3344 5215 gene locus_tag LOCUS_22430 gene licR 3344 5215 CDS product transcriptional regulator LicR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243034.1 protein_id gnl|my_center|LOCUS_22430 5572 5297 gene locus_tag LOCUS_22440 5572 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 5966 5691 gene locus_tag LOCUS_22450 5966 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 6278 6129 gene locus_tag LOCUS_22460 6278 6129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 >Feature sequence192 253 5040 gene locus_tag LOCUS_22470 253 5040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 5248 5715 gene locus_tag LOCUS_22480 5248 5715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 >Feature sequence193 692 1075 gene locus_tag LOCUS_22490 692 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 1152 2024 gene locus_tag LOCUS_22500 1152 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 2011 2637 gene locus_tag LOCUS_22510 2011 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 2634 3305 gene locus_tag LOCUS_22520 2634 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 3302 3943 gene locus_tag LOCUS_22530 3302 3943 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803901.1 protein_id gnl|my_center|LOCUS_22530 4311 3985 gene locus_tag LOCUS_22540 4311 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 4535 4873 gene locus_tag LOCUS_22550 4535 4873 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986769.1 protein_id gnl|my_center|LOCUS_22550 4874 5263 gene locus_tag LOCUS_22560 4874 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 5286 5675 gene locus_tag LOCUS_22570 5286 5675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 >Feature sequence194 230 2221 gene locus_tag LOCUS_22580 230 2221 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966944.1 protein_id gnl|my_center|LOCUS_22580 3846 2242 gene locus_tag LOCUS_22590 3846 2242 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015958.1 protein_id gnl|my_center|LOCUS_22590 4409 3846 gene locus_tag LOCUS_22600 gene ahpC 4409 3846 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817384.1 protein_id gnl|my_center|LOCUS_22600 4861 4433 gene locus_tag LOCUS_22610 4861 4433 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041894.1 protein_id gnl|my_center|LOCUS_22610 6017 5016 gene locus_tag LOCUS_22620 6017 5016 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379303.1 protein_id gnl|my_center|LOCUS_22620 >Feature sequence195 829 1218 gene locus_tag LOCUS_22630 829 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 1535 2080 gene locus_tag LOCUS_22640 1535 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 2275 2099 gene locus_tag LOCUS_22650 2275 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 2719 3525 gene locus_tag LOCUS_22660 2719 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 3515 4159 gene locus_tag LOCUS_22670 3515 4159 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243153.1 protein_id gnl|my_center|LOCUS_22670 4152 4847 gene locus_tag LOCUS_22680 4152 4847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 5288 5121 gene locus_tag LOCUS_22690 5288 5121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 5606 5734 gene locus_tag LOCUS_22700 5606 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 >Feature sequence196 1152 307 gene locus_tag LOCUS_22710 1152 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 1796 1170 gene locus_tag LOCUS_22720 1796 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 1944 2165 gene locus_tag LOCUS_22730 1944 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 2423 2542 gene locus_tag LOCUS_22740 2423 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 3006 2662 gene locus_tag LOCUS_22750 3006 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 3236 3454 gene locus_tag LOCUS_22760 3236 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 3729 3520 gene locus_tag LOCUS_22770 3729 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 3874 4053 gene locus_tag LOCUS_22780 3874 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 4054 4764 gene locus_tag LOCUS_22790 4054 4764 CDS product phage antirepressor KilAC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475622.1 protein_id gnl|my_center|LOCUS_22790 4777 5046 gene locus_tag LOCUS_22800 4777 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 5087 5281 gene locus_tag LOCUS_22810 5087 5281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 5383 5778 gene locus_tag LOCUS_22820 5383 5778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 5768 5929 gene locus_tag LOCUS_22830 5768 5929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 >Feature sequence197 390 1607 gene locus_tag LOCUS_22840 390 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22840 1617 2030 gene locus_tag LOCUS_22850 1617 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 2136 2798 gene locus_tag LOCUS_22860 2136 2798 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895132.1 protein_id gnl|my_center|LOCUS_22860 2802 3467 gene locus_tag LOCUS_22870 2802 3467 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986640.1 protein_id gnl|my_center|LOCUS_22870 3464 4471 gene locus_tag LOCUS_22880 3464 4471 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986639.1 protein_id gnl|my_center|LOCUS_22880 4577 5344 gene locus_tag LOCUS_22890 4577 5344 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986651.1 protein_id gnl|my_center|LOCUS_22890 >Feature sequence198 1503 586 gene locus_tag LOCUS_22900 1503 586 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015848914.1 protein_id gnl|my_center|LOCUS_22900 3844 1490 gene locus_tag LOCUS_22910 3844 1490 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184871.1 protein_id gnl|my_center|LOCUS_22910 4718 3957 gene locus_tag LOCUS_22920 4718 3957 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434038.1 protein_id gnl|my_center|LOCUS_22920 5431 4793 gene locus_tag LOCUS_22930 5431 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 5697 5428 gene locus_tag LOCUS_22940 5697 5428 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262697.1 protein_id gnl|my_center|LOCUS_22940 >Feature sequence199 791 2290 gene locus_tag LOCUS_22950 791 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 2335 4245 gene locus_tag LOCUS_22960 2335 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 >Feature sequence200 2902 581 gene locus_tag LOCUS_22970 gene lon 2902 581 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229618.1 protein_id gnl|my_center|LOCUS_22970 4243 2960 gene locus_tag LOCUS_22980 gene tig 4243 2960 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_22980 5259 4336 gene locus_tag LOCUS_22990 5259 4336 CDS product DUF3196 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183422.1 protein_id gnl|my_center|LOCUS_22990 5409 5275 gene locus_tag LOCUS_23000 5409 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 <6092 5447 gene locus_tag LOCUS_23010 <6092 5447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002262369.1:LysR family transcriptional regulator >Feature sequence201 1160 333 gene locus_tag LOCUS_23020 1160 333 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990044.1 protein_id gnl|my_center|LOCUS_23020 1806 1522 gene locus_tag LOCUS_23030 1806 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 2056 1841 gene locus_tag LOCUS_23040 2056 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 3004 2057 gene locus_tag LOCUS_23050 gene whiA 3004 2057 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006561.1 protein_id gnl|my_center|LOCUS_23050 3883 3014 gene locus_tag LOCUS_23060 gene rapZ 3883 3014 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243903.1 protein_id gnl|my_center|LOCUS_23060 4735 4079 gene locus_tag LOCUS_23070 4735 4079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 5607 4822 gene locus_tag LOCUS_23080 5607 4822 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439904.1 protein_id gnl|my_center|LOCUS_23080 >Feature sequence202 15 161 gene locus_tag LOCUS_23090 15 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 616 1956 gene locus_tag LOCUS_23100 gene celB 616 1956 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614053.1 protein_id gnl|my_center|LOCUS_23100 1949 4594 gene locus_tag LOCUS_23110 gene mngB 1949 4594 CDS product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861603.1 protein_id gnl|my_center|LOCUS_23110 4635 5396 gene locus_tag LOCUS_23120 4635 5396 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722092.1 protein_id gnl|my_center|LOCUS_23120 >Feature sequence203 292 828 gene locus_tag LOCUS_23130 292 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 976 1716 gene locus_tag LOCUS_23140 976 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 1884 2096 gene locus_tag LOCUS_23150 1884 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 2142 2312 gene locus_tag LOCUS_23160 2142 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 3755 4390 gene locus_tag LOCUS_23170 3755 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 5877 4996 gene locus_tag LOCUS_23180 5877 4996 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_23180 >Feature sequence204 1454 456 gene locus_tag LOCUS_23190 1454 456 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948083.1 protein_id gnl|my_center|LOCUS_23190 2100 1456 gene locus_tag LOCUS_23200 2100 1456 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167287.1 protein_id gnl|my_center|LOCUS_23200 3845 2127 gene locus_tag LOCUS_23210 3845 2127 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948081.1 protein_id gnl|my_center|LOCUS_23210 4901 3867 gene locus_tag LOCUS_23220 gene uxuA 4901 3867 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964641.1 protein_id gnl|my_center|LOCUS_23220 5671 4892 gene locus_tag LOCUS_23230 5671 4892 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_23230 >Feature sequence205 63 881 gene locus_tag LOCUS_23240 63 881 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108784.1 protein_id gnl|my_center|LOCUS_23240 881 1060 gene locus_tag LOCUS_23250 881 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 1568 2017 gene locus_tag LOCUS_23260 1568 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23260 2014 3087 gene locus_tag LOCUS_23270 2014 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23270 3221 4423 gene locus_tag LOCUS_23280 gene ilvA 3221 4423 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017132.1 protein_id gnl|my_center|LOCUS_23280 4495 5262 gene locus_tag LOCUS_23290 4495 5262 CDS product ChbG/HpnK family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439975.1 protein_id gnl|my_center|LOCUS_23290 >Feature sequence206 526 242 gene locus_tag LOCUS_23300 gene rpmA 526 242 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222623.1 protein_id gnl|my_center|LOCUS_23300 853 530 gene locus_tag LOCUS_23310 853 530 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183339.1 protein_id gnl|my_center|LOCUS_23310 1161 853 gene locus_tag LOCUS_23320 gene rplU 1161 853 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289450.1 protein_id gnl|my_center|LOCUS_23320 1986 1291 gene locus_tag LOCUS_23330 1986 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 2584 2009 gene locus_tag LOCUS_23340 2584 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 3413 2634 gene locus_tag LOCUS_23350 gene minD 3413 2634 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583751.1 protein_id gnl|my_center|LOCUS_23350 3669 3406 gene locus_tag LOCUS_23360 3669 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 3980 3651 gene locus_tag LOCUS_23370 3980 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 4488 3955 gene locus_tag LOCUS_23380 4488 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 5326 4481 gene locus_tag LOCUS_23390 gene mreC 5326 4481 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725674.1 protein_id gnl|my_center|LOCUS_23390 <5888 5384 gene locus_tag LOCUS_23400 <5888 5384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003246034.1:DNA repair protein RadC >Feature sequence207 1551 1228 gene locus_tag LOCUS_23410 1551 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 2283 1747 gene locus_tag LOCUS_23420 2283 1747 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459068.1 protein_id gnl|my_center|LOCUS_23420 4956 2407 gene locus_tag LOCUS_23430 4956 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 5242 4949 gene locus_tag LOCUS_23440 5242 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 >Feature sequence208 296 787 gene locus_tag LOCUS_23450 296 787 CDS product NADAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112815.1 protein_id gnl|my_center|LOCUS_23450 1225 800 gene locus_tag LOCUS_23460 1225 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 1360 1608 gene locus_tag LOCUS_23470 1360 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 1626 2300 gene locus_tag LOCUS_23480 1626 2300 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706813.1 protein_id gnl|my_center|LOCUS_23480 3324 2458 gene locus_tag LOCUS_23490 3324 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 3449 4447 gene locus_tag LOCUS_23500 3449 4447 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202737.1 protein_id gnl|my_center|LOCUS_23500 >Feature sequence209 488 619 gene locus_tag LOCUS_23510 488 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 1888 686 gene locus_tag LOCUS_23520 gene rho 1888 686 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966173.1 protein_id gnl|my_center|LOCUS_23520 4292 2190 gene locus_tag LOCUS_23530 4292 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 5114 4413 gene locus_tag LOCUS_23540 5114 4413 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820352.1 protein_id gnl|my_center|LOCUS_23540 <5808 5239 gene locus_tag LOCUS_23550 <5808 5239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003428619.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence210 3275 1077 gene locus_tag LOCUS_23560 3275 1077 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202292.1 protein_id gnl|my_center|LOCUS_23560 4981 3272 gene locus_tag LOCUS_23570 4981 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 5657 5001 gene locus_tag LOCUS_23580 5657 5001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 >Feature sequence211 813 1559 gene locus_tag LOCUS_23590 813 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 1638 3062 gene locus_tag LOCUS_23600 1638 3062 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861818.1 protein_id gnl|my_center|LOCUS_23600 3304 3077 gene locus_tag LOCUS_23610 3304 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 4229 3306 gene locus_tag LOCUS_23620 4229 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 4848 4270 gene locus_tag LOCUS_23630 4848 4270 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456472.1 protein_id gnl|my_center|LOCUS_23630 <5766 4891 gene locus_tag LOCUS_23640 <5766 4891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002357780.1:thioredoxin-disulfide reductase >Feature sequence212 2279 300 gene locus_tag LOCUS_23650 2279 300 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986650.1 protein_id gnl|my_center|LOCUS_23650 3033 2266 gene locus_tag LOCUS_23660 3033 2266 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986651.1 protein_id gnl|my_center|LOCUS_23660 4113 3100 gene locus_tag LOCUS_23670 4113 3100 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986639.1 protein_id gnl|my_center|LOCUS_23670 4769 4110 gene locus_tag LOCUS_23680 4769 4110 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986640.1 protein_id gnl|my_center|LOCUS_23680 >Feature sequence213 2753 1527 gene locus_tag LOCUS_23690 gene tyrS 2753 1527 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701368.1 protein_id gnl|my_center|LOCUS_23690 <5725 3327 gene locus_tag LOCUS_23700 <5725 3327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582994.1:CRISPR-associated helicase/endonuclease Cas3 >Feature sequence214 1360 440 gene locus_tag LOCUS_23710 1360 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23710 2410 1415 gene locus_tag LOCUS_23720 2410 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23720 3788 2415 gene locus_tag LOCUS_23730 3788 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 4743 3913 gene locus_tag LOCUS_23740 4743 3913 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644019.1 protein_id gnl|my_center|LOCUS_23740 5234 4758 gene locus_tag LOCUS_23750 5234 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 5659 5583 gene locus_tag LOCUS_t00290 5659 5583 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence215 <1 842 gene locus_tag LOCUS_23760 <1 842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679753.1:M3 family oligoendopeptidase 895 1278 gene locus_tag LOCUS_23770 895 1278 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812273.1 protein_id gnl|my_center|LOCUS_23770 1372 2736 gene locus_tag LOCUS_23780 1372 2736 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762587.1 protein_id gnl|my_center|LOCUS_23780 3762 2866 gene locus_tag LOCUS_23790 3762 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 4858 3755 gene locus_tag LOCUS_23800 4858 3755 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_23800 >Feature sequence216 47 562 gene locus_tag LOCUS_23810 47 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 708 2009 gene locus_tag LOCUS_23820 708 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 1999 2616 gene locus_tag LOCUS_23830 1999 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 >Feature sequence217 801 1 gene locus_tag LOCUS_23840 gene ucpA 801 1 CDS product SDR family oxidoreductase UcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517446.1 protein_id gnl|my_center|LOCUS_23840 1470 886 gene locus_tag LOCUS_23850 1470 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 2865 1483 gene locus_tag LOCUS_23860 2865 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 4652 2868 gene locus_tag LOCUS_23870 4652 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 >Feature sequence218 218 504 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttaaatacatctatgttgatattaaac 1934 768 gene locus_tag LOCUS_23880 1934 768 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048277.1 protein_id gnl|my_center|LOCUS_23880 2284 1937 gene locus_tag LOCUS_23890 2284 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 3553 2417 gene locus_tag LOCUS_23900 3553 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 4571 3933 gene locus_tag LOCUS_23910 gene hisIE 4571 3933 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131119.1 protein_id gnl|my_center|LOCUS_23910 5335 4571 gene locus_tag LOCUS_23920 gene hisF 5335 4571 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017864484.1 protein_id gnl|my_center|LOCUS_23920 >Feature sequence219 1576 95 gene locus_tag LOCUS_23930 gene thrC 1576 95 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434031.1 protein_id gnl|my_center|LOCUS_23930 1907 3061 gene locus_tag LOCUS_23940 1907 3061 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_23940 3063 4307 gene locus_tag LOCUS_23950 3063 4307 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975324.1 protein_id gnl|my_center|LOCUS_23950 4311 5345 gene locus_tag LOCUS_23960 4311 5345 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129416.1 protein_id gnl|my_center|LOCUS_23960 >Feature sequence220 1538 279 gene locus_tag LOCUS_23970 1538 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 2228 1575 gene locus_tag LOCUS_23980 2228 1575 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894927.1 protein_id gnl|my_center|LOCUS_23980 2914 2228 gene locus_tag LOCUS_23990 2914 2228 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461724.1 protein_id gnl|my_center|LOCUS_23990 3708 2914 gene locus_tag LOCUS_24000 3708 2914 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360586.1 protein_id gnl|my_center|LOCUS_24000 4443 3721 gene locus_tag LOCUS_24010 4443 3721 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943166.1 protein_id gnl|my_center|LOCUS_24010 5209 4418 gene locus_tag LOCUS_24020 5209 4418 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964806.1 protein_id gnl|my_center|LOCUS_24020 >Feature sequence221 33 722 gene locus_tag LOCUS_24030 33 722 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044887.1 protein_id gnl|my_center|LOCUS_24030 723 2153 gene locus_tag LOCUS_24040 723 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 2334 2603 gene locus_tag LOCUS_24050 2334 2603 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831726.1 protein_id gnl|my_center|LOCUS_24050 2665 3144 gene locus_tag LOCUS_24060 gene ybaK 2665 3144 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288577.1 protein_id gnl|my_center|LOCUS_24060 3146 3643 gene locus_tag LOCUS_24070 gene cobO 3146 3643 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867207.1 protein_id gnl|my_center|LOCUS_24070 >Feature sequence222 358 134 gene locus_tag LOCUS_24080 358 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 1348 614 gene locus_tag LOCUS_24090 1348 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 1686 1363 gene locus_tag LOCUS_24100 1686 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 1841 1704 gene locus_tag LOCUS_24110 1841 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 3796 1838 gene locus_tag LOCUS_24120 3796 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 4346 3798 gene locus_tag LOCUS_24130 4346 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 5143 4469 gene locus_tag LOCUS_24140 5143 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 >Feature sequence223 87 320 gene locus_tag LOCUS_24150 87 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 1412 345 gene locus_tag LOCUS_24160 1412 345 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966309.1 protein_id gnl|my_center|LOCUS_24160 1486 2292 gene locus_tag LOCUS_24170 1486 2292 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207834.1 protein_id gnl|my_center|LOCUS_24170 2565 2248 gene locus_tag LOCUS_24180 2565 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 3143 2574 gene locus_tag LOCUS_24190 3143 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 4315 3158 gene locus_tag LOCUS_24200 4315 3158 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_24200 5360 4455 gene locus_tag LOCUS_24210 5360 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 >Feature sequence224 944 264 gene locus_tag LOCUS_24220 944 264 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966612.1 protein_id gnl|my_center|LOCUS_24220 1380 1048 gene locus_tag LOCUS_24230 1380 1048 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957066.1 protein_id gnl|my_center|LOCUS_24230 2871 1396 gene locus_tag LOCUS_24240 2871 1396 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387645.1 protein_id gnl|my_center|LOCUS_24240 3200 2871 gene locus_tag LOCUS_24250 3200 2871 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429250.1 protein_id gnl|my_center|LOCUS_24250 3646 3350 gene locus_tag LOCUS_24260 3646 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 4209 3700 gene locus_tag LOCUS_24270 4209 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24270 <5314 4197 gene locus_tag LOCUS_24280 <5314 4197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044986.1:HD domain-containing protein >Feature sequence225 <1 543 gene locus_tag LOCUS_24290 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002296776.1:glycoside hydrolase family 1 protein 600 1361 gene locus_tag LOCUS_24300 600 1361 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181832.1 protein_id gnl|my_center|LOCUS_24300 2130 1387 gene locus_tag LOCUS_24310 2130 1387 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_24310 2247 3089 gene locus_tag LOCUS_24320 gene truB 2247 3089 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399352.1 protein_id gnl|my_center|LOCUS_24320 3089 4003 gene locus_tag LOCUS_24330 gene ribF 3089 4003 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245551.1 protein_id gnl|my_center|LOCUS_24330 4081 4938 gene locus_tag LOCUS_24340 4081 4938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 >Feature sequence226 1884 1108 gene locus_tag LOCUS_24350 1884 1108 CDS product Rv0687 family mycofactocin-dependent SDR oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403468.1 protein_id gnl|my_center|LOCUS_24350 2045 2854 gene locus_tag LOCUS_24360 2045 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 4205 2877 gene locus_tag LOCUS_24370 4205 2877 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989199.1 protein_id gnl|my_center|LOCUS_24370 >Feature sequence227 567 1307 gene locus_tag LOCUS_24380 567 1307 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230015.1 protein_id gnl|my_center|LOCUS_24380 1304 2077 gene locus_tag LOCUS_24390 1304 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 2074 3363 gene locus_tag LOCUS_24400 gene mtaB 2074 3363 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831098.1 protein_id gnl|my_center|LOCUS_24400 3360 4823 gene locus_tag LOCUS_24410 3360 4823 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245326.1 protein_id gnl|my_center|LOCUS_24410 >Feature sequence228 1416 559 gene locus_tag LOCUS_24420 1416 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 2084 1407 gene locus_tag LOCUS_24430 2084 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 4278 2395 gene locus_tag LOCUS_24440 4278 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 <5234 4522 gene locus_tag LOCUS_24450 <5234 4522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005898122.1:AAA family ATPase >Feature sequence229 2729 3862 gene locus_tag LOCUS_24460 2729 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 3891 4058 gene locus_tag LOCUS_24470 3891 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 <5233 4185 gene locus_tag LOCUS_24480 <5233 4185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109429.1:C39 family peptidase >Feature sequence230 35 451 gene locus_tag LOCUS_24490 gene cdd 35 451 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016798.1 protein_id gnl|my_center|LOCUS_24490 430 1320 gene locus_tag LOCUS_24500 gene era 430 1320 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080241.1 protein_id gnl|my_center|LOCUS_24500 1310 2062 gene locus_tag LOCUS_24510 gene recO 1310 2062 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730435.1 protein_id gnl|my_center|LOCUS_24510 2164 2757 gene locus_tag LOCUS_24520 2164 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 2754 2909 gene locus_tag LOCUS_24530 2754 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 3029 3409 gene locus_tag LOCUS_24540 3029 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 3755 3456 gene locus_tag LOCUS_24550 3755 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 3910 4338 gene locus_tag LOCUS_24560 3910 4338 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963521.1 protein_id gnl|my_center|LOCUS_24560 >Feature sequence231 286 1878 gene locus_tag LOCUS_24570 286 1878 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475301.1 protein_id gnl|my_center|LOCUS_24570 1941 2882 gene locus_tag LOCUS_24580 gene opp1B 1941 2882 CDS product oligopeptide ABC transporter permease Opp1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381304.1 protein_id gnl|my_center|LOCUS_24580 2889 3818 gene locus_tag LOCUS_24590 2889 3818 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966900.1 protein_id gnl|my_center|LOCUS_24590 3821 4909 gene locus_tag LOCUS_24600 3821 4909 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722316.1 protein_id gnl|my_center|LOCUS_24600 >Feature sequence232 44 175 gene locus_tag LOCUS_24610 44 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 165 1037 gene locus_tag LOCUS_24620 165 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 1127 3079 gene locus_tag LOCUS_24630 1127 3079 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006774564.1 protein_id gnl|my_center|LOCUS_24630 3094 5019 gene locus_tag LOCUS_24640 3094 5019 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877962.1 protein_id gnl|my_center|LOCUS_24640 >Feature sequence233 <1 1479 gene locus_tag LOCUS_24650 <1 1479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002294013.1:ABC transporter ATP-binding protein 1472 3211 gene locus_tag LOCUS_24660 1472 3211 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_24660 3444 5150 gene locus_tag LOCUS_24670 3444 5150 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_24670 >Feature sequence234 479 1705 gene locus_tag LOCUS_24680 479 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 1780 2337 gene locus_tag LOCUS_24690 gene efp 1780 2337 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626507.1 protein_id gnl|my_center|LOCUS_24690 2355 3104 gene locus_tag LOCUS_24700 gene fabG 2355 3104 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_24700 4360 3101 gene locus_tag LOCUS_24710 4360 3101 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000652047.1 protein_id gnl|my_center|LOCUS_24710 >Feature sequence235 277 861 gene locus_tag LOCUS_24720 277 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 1038 1646 gene locus_tag LOCUS_24730 1038 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 2126 1680 gene locus_tag LOCUS_24740 2126 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 2366 3400 gene locus_tag LOCUS_24750 2366 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 3453 5090 gene locus_tag LOCUS_24760 gene bglH 3453 5090 CDS product aryl-phospho-beta-d-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243232.1 protein_id gnl|my_center|LOCUS_24760 >Feature sequence236 1018 317 gene locus_tag LOCUS_24770 gene azlC 1018 317 CDS product azaleucine resistance protein AzlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969035.1 protein_id gnl|my_center|LOCUS_24770 2030 990 gene locus_tag LOCUS_24780 2030 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 2648 2157 gene locus_tag LOCUS_24790 gene paiA 2648 2157 CDS product spermidine/spermine N(1)-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244000.1 protein_id gnl|my_center|LOCUS_24790 4117 2648 gene locus_tag LOCUS_24800 4117 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 4962 4129 gene locus_tag LOCUS_24810 gene mutM 4962 4129 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_24810 >Feature sequence237 1509 91 gene locus_tag LOCUS_24820 1509 91 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461659.1 protein_id gnl|my_center|LOCUS_24820 1679 2503 gene locus_tag LOCUS_24830 gene thiM 1679 2503 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_24830 2490 3128 gene locus_tag LOCUS_24840 gene thiE 2490 3128 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_24840 3121 3765 gene locus_tag LOCUS_24850 3121 3765 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048390.1 protein_id gnl|my_center|LOCUS_24850 3762 4541 gene locus_tag LOCUS_24860 gene thiD 3762 4541 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_24860 >Feature sequence238 1193 285 gene locus_tag LOCUS_24870 gene xerC 1193 285 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101227.1 protein_id gnl|my_center|LOCUS_24870 2478 1174 gene locus_tag LOCUS_24880 gene trmFO 2478 1174 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989721.1 protein_id gnl|my_center|LOCUS_24880 4596 2524 gene locus_tag LOCUS_24890 gene topA 4596 2524 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286968.1 protein_id gnl|my_center|LOCUS_24890 >Feature sequence239 110 36 gene locus_tag LOCUS_t00300 110 36 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 806 1681 gene locus_tag LOCUS_24900 gene yegS 806 1681 CDS product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477542.1 protein_id gnl|my_center|LOCUS_24900 1868 4465 gene locus_tag LOCUS_24910 1868 4465 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949094.1 protein_id gnl|my_center|LOCUS_24910 >Feature sequence240 84 2198 gene locus_tag LOCUS_24920 84 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 2288 2959 gene locus_tag LOCUS_24930 2288 2959 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903427.1 protein_id gnl|my_center|LOCUS_24930 2952 3944 gene locus_tag LOCUS_24940 2952 3944 CDS product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439911.1 protein_id gnl|my_center|LOCUS_24940 >Feature sequence241 1909 1052 gene locus_tag LOCUS_24950 1909 1052 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028344.1 protein_id gnl|my_center|LOCUS_24950 2743 1997 gene locus_tag LOCUS_24960 2743 1997 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649894.1 protein_id gnl|my_center|LOCUS_24960 4409 2724 gene locus_tag LOCUS_24970 4409 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 >Feature sequence242 623 132 gene locus_tag LOCUS_24980 623 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 1150 674 gene locus_tag LOCUS_24990 1150 674 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837194.1 protein_id gnl|my_center|LOCUS_24990 1314 1390 gene locus_tag LOCUS_t00310 1314 1390 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1401 1476 gene locus_tag LOCUS_t00320 1401 1476 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1534 2292 gene locus_tag LOCUS_25000 1534 2292 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861474.1 protein_id gnl|my_center|LOCUS_25000 2295 3290 gene locus_tag LOCUS_25010 2295 3290 CDS product PTS transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903941.1 protein_id gnl|my_center|LOCUS_25010 >Feature sequence243 754 500 gene locus_tag LOCUS_25020 754 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25020 1711 812 gene locus_tag LOCUS_25030 1711 812 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263075.1 protein_id gnl|my_center|LOCUS_25030 2490 1714 gene locus_tag LOCUS_25040 2490 1714 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722653.1 protein_id gnl|my_center|LOCUS_25040 2607 3389 gene locus_tag LOCUS_25050 2607 3389 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021804.1 protein_id gnl|my_center|LOCUS_25050 4008 3406 gene locus_tag LOCUS_25060 4008 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047754.1 protein_id gnl|my_center|LOCUS_25060 4499 4005 gene locus_tag LOCUS_25070 4499 4005 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047753.1 protein_id gnl|my_center|LOCUS_25070 >Feature sequence244 1395 631 gene locus_tag LOCUS_25080 1395 631 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815412.1 protein_id gnl|my_center|LOCUS_25080 2405 1515 gene locus_tag LOCUS_25090 2405 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 2934 2464 gene locus_tag LOCUS_25100 2934 2464 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948074.1 protein_id gnl|my_center|LOCUS_25100 >Feature sequence245 <1 1257 gene locus_tag LOCUS_25110 <1 1257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000145750.1:6-phospho-beta-glucosidase 1993 1286 gene locus_tag LOCUS_25120 1993 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 2805 1990 gene locus_tag LOCUS_25130 2805 1990 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411157.1 protein_id gnl|my_center|LOCUS_25130 3595 2798 gene locus_tag LOCUS_25140 3595 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 4117 3689 gene locus_tag LOCUS_25150 4117 3689 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762812.1 protein_id gnl|my_center|LOCUS_25150 4475 4110 gene locus_tag LOCUS_25160 4475 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 4766 4497 gene locus_tag LOCUS_25170 4766 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 >Feature sequence246 34 441 gene locus_tag LOCUS_25180 34 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 441 1217 gene locus_tag LOCUS_25190 gene rfbF 441 1217 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816687.1 protein_id gnl|my_center|LOCUS_25190 1199 2287 gene locus_tag LOCUS_25200 gene rfbG 1199 2287 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167723.1 protein_id gnl|my_center|LOCUS_25200 2272 3213 gene locus_tag LOCUS_25210 2272 3213 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561952.1 protein_id gnl|my_center|LOCUS_25210 3197 3739 gene locus_tag LOCUS_25220 gene rfbC 3197 3739 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_25220 >Feature sequence247 1021 824 gene locus_tag LOCUS_25230 1021 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 1114 1764 gene locus_tag LOCUS_25240 1114 1764 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785068.1 protein_id gnl|my_center|LOCUS_25240 1751 2194 gene locus_tag LOCUS_25250 1751 2194 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234960.1 protein_id gnl|my_center|LOCUS_25250 2200 3135 gene locus_tag LOCUS_25260 gene manA 2200 3135 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454782.1 protein_id gnl|my_center|LOCUS_25260 3225 3428 gene locus_tag LOCUS_25270 3225 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 3440 3808 gene locus_tag LOCUS_25280 3440 3808 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767940.1 protein_id gnl|my_center|LOCUS_25280 3853 4359 gene locus_tag LOCUS_25290 3853 4359 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775452.1 protein_id gnl|my_center|LOCUS_25290 >Feature sequence248 574 1002 gene locus_tag LOCUS_25300 574 1002 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254323.1 protein_id gnl|my_center|LOCUS_25300 1080 2102 gene locus_tag LOCUS_25310 1080 2102 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964009.1 protein_id gnl|my_center|LOCUS_25310 3066 2125 gene locus_tag LOCUS_25320 3066 2125 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020472.1 protein_id gnl|my_center|LOCUS_25320 3932 3081 gene locus_tag LOCUS_25330 3932 3081 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787284.1 protein_id gnl|my_center|LOCUS_25330 4292 3948 gene locus_tag LOCUS_25340 4292 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 4428 4267 gene locus_tag LOCUS_25350 4428 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 >Feature sequence249 72 1172 gene locus_tag LOCUS_25360 72 1172 CDS product Sapep family Mn(2+)-dependent dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860644.1 protein_id gnl|my_center|LOCUS_25360 1189 1923 gene locus_tag LOCUS_25370 1189 1923 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674428.1 protein_id gnl|my_center|LOCUS_25370 1920 2780 gene locus_tag LOCUS_25380 1920 2780 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723662.1 protein_id gnl|my_center|LOCUS_25380 3635 2919 gene locus_tag LOCUS_25390 3635 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 >Feature sequence250 438 1256 gene locus_tag LOCUS_25400 438 1256 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672882.1 protein_id gnl|my_center|LOCUS_25400 1253 1858 gene locus_tag LOCUS_25410 1253 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 2629 3999 gene locus_tag LOCUS_25420 2629 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 >Feature sequence251 1268 711 gene locus_tag LOCUS_25430 1268 711 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890731.1 protein_id gnl|my_center|LOCUS_25430 1351 1479 gene locus_tag LOCUS_25440 1351 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 1466 1600 gene locus_tag LOCUS_25450 1466 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 1788 1940 gene locus_tag LOCUS_25460 1788 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 2862 2035 gene locus_tag LOCUS_25470 2862 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 3404 2862 gene locus_tag LOCUS_25480 3404 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 3869 3741 gene locus_tag LOCUS_25490 3869 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 >Feature sequence252 1436 780 gene locus_tag LOCUS_25500 1436 780 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861401.1 protein_id gnl|my_center|LOCUS_25500 1912 1442 gene locus_tag LOCUS_25510 1912 1442 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_25510 2769 2008 gene locus_tag LOCUS_25520 2769 2008 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964820.1 protein_id gnl|my_center|LOCUS_25520 3993 3031 gene locus_tag LOCUS_25530 3993 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 >Feature sequence253 1551 151 gene locus_tag LOCUS_25540 1551 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 2189 1569 gene locus_tag LOCUS_25550 2189 1569 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454488.1 protein_id gnl|my_center|LOCUS_25550 2959 2201 gene locus_tag LOCUS_25560 2959 2201 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795042.1 protein_id gnl|my_center|LOCUS_25560 3071 3916 gene locus_tag LOCUS_25570 3071 3916 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254320.1 protein_id gnl|my_center|LOCUS_25570 >Feature sequence254 <1 743 gene locus_tag LOCUS_25580 <1 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459675.1:ABC transporter ATP-binding protein 746 982 gene locus_tag LOCUS_25590 746 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 1106 1585 gene locus_tag LOCUS_25600 1106 1585 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202636.1 protein_id gnl|my_center|LOCUS_25600 1716 2159 gene locus_tag LOCUS_25610 1716 2159 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390305.1 protein_id gnl|my_center|LOCUS_25610 2243 2845 gene locus_tag LOCUS_25620 2243 2845 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101945.1 protein_id gnl|my_center|LOCUS_25620 2859 3404 gene locus_tag LOCUS_25630 2859 3404 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020471.1 protein_id gnl|my_center|LOCUS_25630 3583 3996 gene locus_tag LOCUS_25640 3583 3996 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963521.1 protein_id gnl|my_center|LOCUS_25640 >Feature sequence255 1613 711 gene locus_tag LOCUS_25650 1613 711 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 protein_id gnl|my_center|LOCUS_25650 2308 1685 gene locus_tag LOCUS_25660 2308 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 2887 2348 gene locus_tag LOCUS_25670 2887 2348 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458874.1 protein_id gnl|my_center|LOCUS_25670 3350 2928 gene locus_tag LOCUS_25680 3350 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 3659 3489 gene locus_tag LOCUS_25690 3659 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427864.1 protein_id gnl|my_center|LOCUS_25690 4316 3777 gene locus_tag LOCUS_25700 4316 3777 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861314.1 protein_id gnl|my_center|LOCUS_25700 >Feature sequence256 903 1475 gene locus_tag LOCUS_25710 gene clpP 903 1475 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049162.1 protein_id gnl|my_center|LOCUS_25710 1600 1481 gene locus_tag LOCUS_25720 1600 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 1747 2181 gene locus_tag LOCUS_25730 1747 2181 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966683.1 protein_id gnl|my_center|LOCUS_25730 2250 3590 gene locus_tag LOCUS_25740 2250 3590 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964201.1 protein_id gnl|my_center|LOCUS_25740 3698 4426 gene locus_tag LOCUS_25750 3698 4426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 >Feature sequence257 2288 1953 gene locus_tag LOCUS_25760 2288 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 3024 2872 gene locus_tag LOCUS_25770 3024 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 3256 3561 gene locus_tag LOCUS_25780 3256 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 3561 3854 gene locus_tag LOCUS_25790 3561 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 3851 4402 gene locus_tag LOCUS_25800 3851 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 >Feature sequence258 686 1246 gene locus_tag LOCUS_25810 gene cobB2 686 1246 CDS product NAD-dependent protein deacylase Cob2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877626.1 protein_id gnl|my_center|LOCUS_25810 1246 2493 gene locus_tag LOCUS_25820 1246 2493 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478434.1 protein_id gnl|my_center|LOCUS_25820 2490 3134 gene locus_tag LOCUS_25830 2490 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207502.1 protein_id gnl|my_center|LOCUS_25830 >Feature sequence259 96 614 gene locus_tag LOCUS_25840 96 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 2000 624 gene locus_tag LOCUS_25850 2000 624 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965048.1 protein_id gnl|my_center|LOCUS_25850 2437 2003 gene locus_tag LOCUS_25860 2437 2003 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965564.1 protein_id gnl|my_center|LOCUS_25860 3188 2439 gene locus_tag LOCUS_25870 3188 2439 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965563.1 protein_id gnl|my_center|LOCUS_25870 3276 4199 gene locus_tag LOCUS_25880 3276 4199 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814288.1 protein_id gnl|my_center|LOCUS_25880 >Feature sequence260 <1 771 gene locus_tag LOCUS_25890 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_129881652.1:ATP phosphoribosyltransferase regulatory subunit 764 1393 gene locus_tag LOCUS_25900 gene hisG 764 1393 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131107.1 protein_id gnl|my_center|LOCUS_25900 1393 2703 gene locus_tag LOCUS_25910 gene hisD 1393 2703 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038603405.1 protein_id gnl|my_center|LOCUS_25910 2693 3280 gene locus_tag LOCUS_25920 gene hisB 2693 3280 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131113.1 protein_id gnl|my_center|LOCUS_25920 3283 3891 gene locus_tag LOCUS_25930 gene hisH 3283 3891 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905832.1 protein_id gnl|my_center|LOCUS_25930 >Feature sequence261 634 1974 gene locus_tag LOCUS_25940 634 1974 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567789.1 protein_id gnl|my_center|LOCUS_25940 2361 2044 gene locus_tag LOCUS_25950 2361 2044 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809626.1 protein_id gnl|my_center|LOCUS_25950 3795 2374 gene locus_tag LOCUS_25960 3795 2374 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890696.1 protein_id gnl|my_center|LOCUS_25960 <4587 3971 gene locus_tag LOCUS_25970 <4587 3971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002287584.1:PTS transporter subunit EIIC >Feature sequence262 2749 2000 gene locus_tag LOCUS_25980 2749 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 3471 2749 gene locus_tag LOCUS_25990 3471 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 4560 3604 gene locus_tag LOCUS_26000 4560 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 >Feature sequence263 <1 536 gene locus_tag LOCUS_26010 <1 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964889.1:LytTR family DNA-binding domain-containing protein 871 1668 gene locus_tag LOCUS_26020 871 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 1665 2345 gene locus_tag LOCUS_26030 1665 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 2335 3012 gene locus_tag LOCUS_26040 2335 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 2996 3643 gene locus_tag LOCUS_26050 2996 3643 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460105.1 protein_id gnl|my_center|LOCUS_26050 3640 4296 gene locus_tag LOCUS_26060 3640 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 >Feature sequence264 307 618 gene locus_tag LOCUS_26070 307 618 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003741107.1 protein_id gnl|my_center|LOCUS_26070 711 1568 gene locus_tag LOCUS_26080 711 1568 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990044.1 protein_id gnl|my_center|LOCUS_26080 1682 2278 gene locus_tag LOCUS_26090 1682 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 2694 3479 gene locus_tag LOCUS_26100 gene speD 2694 3479 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965890.1 protein_id gnl|my_center|LOCUS_26100 >Feature sequence265 265 882 gene locus_tag LOCUS_26110 265 882 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964931.1 protein_id gnl|my_center|LOCUS_26110 1260 1733 gene locus_tag LOCUS_26120 1260 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 1745 2638 gene locus_tag LOCUS_26130 gene dapA 1745 2638 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880718.1 protein_id gnl|my_center|LOCUS_26130 2640 3383 gene locus_tag LOCUS_26140 gene dapB 2640 3383 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438808.1 protein_id gnl|my_center|LOCUS_26140 >Feature sequence266 900 199 gene locus_tag LOCUS_26150 900 199 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813919.1 protein_id gnl|my_center|LOCUS_26150 1704 2060 gene locus_tag LOCUS_26160 1704 2060 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399122.1 protein_id gnl|my_center|LOCUS_26160 2014 2418 gene locus_tag LOCUS_26170 2014 2418 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545111.1 protein_id gnl|my_center|LOCUS_26170 3178 2993 gene locus_tag LOCUS_26180 3178 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26180 3407 3222 gene locus_tag LOCUS_26190 3407 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 3863 3420 gene locus_tag LOCUS_26200 3863 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 4392 4318 gene locus_tag LOCUS_t00330 4392 4318 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence267 1068 2366 gene locus_tag LOCUS_26210 1068 2366 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965307.1 protein_id gnl|my_center|LOCUS_26210 2383 3117 gene locus_tag LOCUS_26220 2383 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 3165 3356 gene locus_tag LOCUS_26230 3165 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 3555 4091 gene locus_tag LOCUS_26240 3555 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 >Feature sequence268 1052 897 gene locus_tag LOCUS_26250 1052 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 1161 1033 gene locus_tag LOCUS_26260 1161 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 3928 1313 gene locus_tag LOCUS_26270 3928 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 >Feature sequence269 1287 373 gene locus_tag LOCUS_26280 1287 373 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948486.1 protein_id gnl|my_center|LOCUS_26280 2403 1741 gene locus_tag LOCUS_26290 2403 1741 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966022.1 protein_id gnl|my_center|LOCUS_26290 4037 2484 gene locus_tag LOCUS_26300 4037 2484 CDS product putative ABC exporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048139.1 protein_id gnl|my_center|LOCUS_26300 >Feature sequence270 331 2391 gene locus_tag LOCUS_26310 331 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 2369 3256 gene locus_tag LOCUS_26320 2369 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 3352 4116 gene locus_tag LOCUS_26330 3352 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 >Feature sequence271 260 1141 gene locus_tag LOCUS_26340 gene gmuE 260 1141 CDS product fructokinase GmuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234095.1 protein_id gnl|my_center|LOCUS_26340 1309 1485 gene locus_tag LOCUS_26350 1309 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 2248 1670 gene locus_tag LOCUS_26360 2248 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 2685 3389 gene locus_tag LOCUS_26370 2685 3389 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860653.1 protein_id gnl|my_center|LOCUS_26370 >Feature sequence272 2966 1068 gene locus_tag LOCUS_26380 gene htpG 2966 1068 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243561.1 protein_id gnl|my_center|LOCUS_26380 3900 3073 gene locus_tag LOCUS_26390 3900 3073 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723815.1 protein_id gnl|my_center|LOCUS_26390 >Feature sequence273 320 1657 gene locus_tag LOCUS_26400 320 1657 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986544.1 protein_id gnl|my_center|LOCUS_26400 1890 2531 gene locus_tag LOCUS_26410 1890 2531 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112761.1 protein_id gnl|my_center|LOCUS_26410 2611 3216 gene locus_tag LOCUS_26420 2611 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 3306 3701 gene locus_tag LOCUS_26430 3306 3701 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418377.1 protein_id gnl|my_center|LOCUS_26430 >Feature sequence274 237 1013 gene locus_tag LOCUS_26440 gene murI 237 1013 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966524.1 protein_id gnl|my_center|LOCUS_26440 1102 2661 gene locus_tag LOCUS_26450 1102 2661 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861711.1 protein_id gnl|my_center|LOCUS_26450 2757 3035 gene locus_tag LOCUS_26460 2757 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 4123 3056 gene locus_tag LOCUS_26470 4123 3056 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201892.1 protein_id gnl|my_center|LOCUS_26470 >Feature sequence275 1338 613 gene locus_tag LOCUS_26480 1338 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 1959 1453 gene locus_tag LOCUS_26490 1959 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 3204 2050 gene locus_tag LOCUS_26500 3204 2050 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021367800.1 protein_id gnl|my_center|LOCUS_26500 3832 3140 gene locus_tag LOCUS_26510 gene vanR 3832 3140 CDS product vancomycin resistance response regulator transcriptoin factor VanR-G-Cd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436401.1 protein_id gnl|my_center|LOCUS_26510 4184 3939 gene locus_tag LOCUS_26520 4184 3939 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459149.1 protein_id gnl|my_center|LOCUS_26520 >Feature sequence276 537 971 gene locus_tag LOCUS_26530 537 971 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381519.1 protein_id gnl|my_center|LOCUS_26530 1710 991 gene locus_tag LOCUS_26540 1710 991 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355326.1 protein_id gnl|my_center|LOCUS_26540 2500 2108 gene locus_tag LOCUS_26550 2500 2108 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963919.1 protein_id gnl|my_center|LOCUS_26550 3870 2497 gene locus_tag LOCUS_26560 3870 2497 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387654.1 protein_id gnl|my_center|LOCUS_26560 4122 3946 gene locus_tag LOCUS_26570 4122 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 >Feature sequence277 511 74 gene locus_tag LOCUS_26580 511 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 1285 515 gene locus_tag LOCUS_26590 gene udp 1285 515 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_26590 1949 1452 gene locus_tag LOCUS_26600 1949 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 2674 2177 gene locus_tag LOCUS_26610 2674 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 3836 2658 gene locus_tag LOCUS_26620 3836 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 >Feature sequence278 830 144 gene locus_tag LOCUS_26630 830 144 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895627.1 protein_id gnl|my_center|LOCUS_26630 2740 1061 gene locus_tag LOCUS_26640 gene ilvB 2740 1061 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_26640 <4177 2755 gene locus_tag LOCUS_26650 <4177 2755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393742.1:dihydroxy-acid dehydratase >Feature sequence279 480 680 gene locus_tag LOCUS_26660 480 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 865 2223 gene locus_tag LOCUS_26670 865 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 >Feature sequence280 565 1491 gene locus_tag LOCUS_26680 565 1491 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546354.1 protein_id gnl|my_center|LOCUS_26680 3151 1532 gene locus_tag LOCUS_26690 gene groL 3151 1532 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726503.1 protein_id gnl|my_center|LOCUS_26690 3425 3165 gene locus_tag LOCUS_26700 gene groES 3425 3165 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549156.1 protein_id gnl|my_center|LOCUS_26700 4139 3618 gene locus_tag LOCUS_26710 4139 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 >Feature sequence281 642 190 gene locus_tag LOCUS_26720 642 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 1212 709 gene locus_tag LOCUS_26730 1212 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 2216 1287 gene locus_tag LOCUS_26740 2216 1287 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109323.1 protein_id gnl|my_center|LOCUS_26740 3180 2758 gene locus_tag LOCUS_26750 3180 2758 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691751.1 protein_id gnl|my_center|LOCUS_26750 >Feature sequence282 3 572 gene locus_tag LOCUS_26760 3 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 582 3785 gene locus_tag LOCUS_26770 582 3785 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016952.1 protein_id gnl|my_center|LOCUS_26770 >Feature sequence283 <1 1330 gene locus_tag LOCUS_26780 <1 1330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005898122.1:AAA family ATPase 1476 2231 gene locus_tag LOCUS_26790 1476 2231 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431374.1 protein_id gnl|my_center|LOCUS_26790 >Feature sequence284 567 442 gene locus_tag LOCUS_26800 567 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 1312 557 gene locus_tag LOCUS_26810 1312 557 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462044.1 protein_id gnl|my_center|LOCUS_26810 1633 1484 gene locus_tag LOCUS_26820 1633 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 2443 2036 gene locus_tag LOCUS_26830 2443 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 3230 2496 gene locus_tag LOCUS_26840 3230 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 3931 3287 gene locus_tag LOCUS_26850 3931 3287 CDS product TIGR04100 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860776.1 protein_id gnl|my_center|LOCUS_26850 >Feature sequence285 875 18 gene locus_tag LOCUS_26860 875 18 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890755.1 protein_id gnl|my_center|LOCUS_26860 1901 993 gene locus_tag LOCUS_26870 1901 993 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438084.1 protein_id gnl|my_center|LOCUS_26870 1951 3171 gene locus_tag LOCUS_26880 gene hflX 1951 3171 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393283.1 protein_id gnl|my_center|LOCUS_26880 3185 3373 gene locus_tag LOCUS_26890 3185 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 >Feature sequence286 <1 978 gene locus_tag LOCUS_26900 <1 978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989971.1:YhgE/Pip domain-containing protein 1229 3502 gene locus_tag LOCUS_26910 1229 3502 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898049.1 protein_id gnl|my_center|LOCUS_26910 3897 3730 gene locus_tag LOCUS_26920 3897 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 >Feature sequence287 644 462 gene locus_tag LOCUS_26930 644 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 800 2434 gene locus_tag LOCUS_26940 800 2434 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989585.1 protein_id gnl|my_center|LOCUS_26940 2519 3568 gene locus_tag LOCUS_26950 2519 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 3832 3581 gene locus_tag LOCUS_26960 3832 3581 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358680.1 protein_id gnl|my_center|LOCUS_26960 4031 3825 gene locus_tag LOCUS_26970 4031 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 >Feature sequence288 2153 789 gene locus_tag LOCUS_26980 2153 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 3634 2171 gene locus_tag LOCUS_26990 3634 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 >Feature sequence289 576 1061 gene locus_tag LOCUS_27000 576 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 1559 1798 gene locus_tag LOCUS_27010 1559 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 1938 2393 gene locus_tag LOCUS_27020 1938 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 2368 2751 gene locus_tag LOCUS_27030 2368 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 3396 3211 gene locus_tag LOCUS_27040 3396 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 >Feature sequence290 <1 879 gene locus_tag LOCUS_27050 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107233.1:UDP-N-acetyl glucosamine 2-epimerase 1007 1336 gene locus_tag LOCUS_27060 1007 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 1302 1613 gene locus_tag LOCUS_27070 1302 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 1740 2798 gene locus_tag LOCUS_27080 1740 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 2964 3782 gene locus_tag LOCUS_27090 2964 3782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 >Feature sequence291 806 369 gene locus_tag LOCUS_27100 gene rplM 806 369 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906417.1 protein_id gnl|my_center|LOCUS_27100 1789 1049 gene locus_tag LOCUS_27110 1789 1049 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966927.1 protein_id gnl|my_center|LOCUS_27110 2031 1789 gene locus_tag LOCUS_27120 2031 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 2717 2031 gene locus_tag LOCUS_27130 2717 2031 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_27130 2852 3091 gene locus_tag LOCUS_27140 2852 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 3994 3101 gene locus_tag LOCUS_27150 gene thrB 3994 3101 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986279.1 protein_id gnl|my_center|LOCUS_27150 >Feature sequence292 1001 168 gene locus_tag LOCUS_27160 1001 168 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086430.1 protein_id gnl|my_center|LOCUS_27160 1210 1692 gene locus_tag LOCUS_27170 1210 1692 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965709.1 protein_id gnl|my_center|LOCUS_27170 <4025 1752 gene locus_tag LOCUS_27180 <4025 1752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001126116.1:carbamoyl-phosphate synthase large subunit >Feature sequence293 1807 905 gene locus_tag LOCUS_27190 gene pfkB 1807 905 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861506.1 protein_id gnl|my_center|LOCUS_27190 2785 1937 gene locus_tag LOCUS_27200 2785 1937 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476336.1 protein_id gnl|my_center|LOCUS_27200 3607 2855 gene locus_tag LOCUS_27210 3607 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 >Feature sequence294 <1 1173 gene locus_tag LOCUS_27220 <1 1173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010905307.1:lysine--tRNA ligase 1731 2288 gene locus_tag LOCUS_27230 1731 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 2487 3029 gene locus_tag LOCUS_27240 2487 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 3029 3388 gene locus_tag LOCUS_27250 3029 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 >Feature sequence295 827 441 gene locus_tag LOCUS_27260 827 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 1157 843 gene locus_tag LOCUS_27270 1157 843 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963892.1 protein_id gnl|my_center|LOCUS_27270 1372 2025 gene locus_tag LOCUS_27280 1372 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 3749 2373 gene locus_tag LOCUS_27290 3749 2373 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_27290 >Feature sequence296 688 1572 gene locus_tag LOCUS_27300 688 1572 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006843524.1 protein_id gnl|my_center|LOCUS_27300 1624 1803 gene locus_tag LOCUS_27310 1624 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 1829 2461 gene locus_tag LOCUS_27320 1829 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27320 2458 3732 gene locus_tag LOCUS_27330 2458 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 >Feature sequence297 54 860 gene locus_tag LOCUS_27340 54 860 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895633.1 protein_id gnl|my_center|LOCUS_27340 997 2928 gene locus_tag LOCUS_27350 997 2928 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989931.1 protein_id gnl|my_center|LOCUS_27350 3362 2958 gene locus_tag LOCUS_27360 3362 2958 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722179.1 protein_id gnl|my_center|LOCUS_27360 >Feature sequence298 335 1633 gene locus_tag LOCUS_27370 gene cscA 335 1633 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194514.1 protein_id gnl|my_center|LOCUS_27370 1839 1660 gene locus_tag LOCUS_27380 1839 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 2622 1840 gene locus_tag LOCUS_27390 2622 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 3344 2610 gene locus_tag LOCUS_27400 3344 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 3663 3346 gene locus_tag LOCUS_27410 3663 3346 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669619.1 protein_id gnl|my_center|LOCUS_27410 >Feature sequence299 1949 1593 gene locus_tag LOCUS_27420 1949 1593 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021109.1 protein_id gnl|my_center|LOCUS_27420 2188 2373 gene locus_tag LOCUS_27430 gene rpmB 2188 2373 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221548.1 protein_id gnl|my_center|LOCUS_27430 3600 2473 gene locus_tag LOCUS_27440 gene dnaJ 3600 2473 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990134.1 protein_id gnl|my_center|LOCUS_27440 >Feature sequence300 279 76 gene locus_tag LOCUS_27450 279 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 2476 293 gene locus_tag LOCUS_27460 gene feoB 2476 293 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948706.1 protein_id gnl|my_center|LOCUS_27460 2718 2497 gene locus_tag LOCUS_27470 2718 2497 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_27470 2947 2735 gene locus_tag LOCUS_27480 2947 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 3310 3711 gene locus_tag LOCUS_27490 gene tnpA 3310 3711 CDS product IS200/IS605-like element ISBce3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606463.1 protein_id gnl|my_center|LOCUS_27490 >Feature sequence301 136 1413 gene locus_tag LOCUS_27500 gene galK 136 1413 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_27500 1604 3034 gene locus_tag LOCUS_27510 gene pyk 1604 3034 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_27510 >Feature sequence302 1297 1136 gene locus_tag LOCUS_27520 1297 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 3131 1335 gene locus_tag LOCUS_27530 3131 1335 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721858.1 protein_id gnl|my_center|LOCUS_27530 <3863 3308 gene locus_tag LOCUS_27540 <3863 3308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948570.1:PRD domain-containing protein >Feature sequence303 283 1287 gene locus_tag LOCUS_27550 283 1287 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262368.1 protein_id gnl|my_center|LOCUS_27550 1996 1310 gene locus_tag LOCUS_27560 1996 1310 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399472.1 protein_id gnl|my_center|LOCUS_27560 >Feature sequence304 1993 1121 gene locus_tag LOCUS_27570 1993 1121 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430012.1 protein_id gnl|my_center|LOCUS_27570 2554 2297 gene locus_tag LOCUS_27580 2554 2297 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832208.1 protein_id gnl|my_center|LOCUS_27580 2645 3565 gene locus_tag LOCUS_27590 2645 3565 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966232.1 protein_id gnl|my_center|LOCUS_27590 >Feature sequence305 1417 176 gene locus_tag LOCUS_27600 1417 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 2187 1480 gene locus_tag LOCUS_27610 gene rgbR 2187 1480 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_27610 2379 3209 gene locus_tag LOCUS_27620 2379 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 3404 3228 gene locus_tag LOCUS_27630 3404 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 >Feature sequence306 796 1104 gene locus_tag LOCUS_27640 gene rpsJ 796 1104 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156464.1 protein_id gnl|my_center|LOCUS_27640 1125 1856 gene locus_tag LOCUS_27650 gene rplC 1125 1856 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356199.1 protein_id gnl|my_center|LOCUS_27650 1877 2500 gene locus_tag LOCUS_27660 gene rplD 1877 2500 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399658.1 protein_id gnl|my_center|LOCUS_27660 2500 2790 gene locus_tag LOCUS_27670 gene rplW 2500 2790 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829755.1 protein_id gnl|my_center|LOCUS_27670 2840 3673 gene locus_tag LOCUS_27680 gene rplB 2840 3673 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225795.1 protein_id gnl|my_center|LOCUS_27680 >Feature sequence307 <1 1070 gene locus_tag LOCUS_27690 <1 1070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000497128.1:GTPase ObgE 1184 1747 gene locus_tag LOCUS_27700 gene ruvA 1184 1747 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002309787.1 protein_id gnl|my_center|LOCUS_27700 1760 2749 gene locus_tag LOCUS_27710 gene ruvB 1760 2749 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344450.1 protein_id gnl|my_center|LOCUS_27710 2786 3247 gene locus_tag LOCUS_27720 2786 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 >Feature sequence308 1066 359 gene locus_tag LOCUS_27730 1066 359 CDS product Tim44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964075.1 protein_id gnl|my_center|LOCUS_27730 2554 1226 gene locus_tag LOCUS_27740 2554 1226 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016943.1 protein_id gnl|my_center|LOCUS_27740 2753 3493 gene locus_tag LOCUS_27750 2753 3493 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454798.1 protein_id gnl|my_center|LOCUS_27750 >Feature sequence309 435 2360 gene locus_tag LOCUS_27760 435 2360 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964794.1 protein_id gnl|my_center|LOCUS_27760 2332 3522 gene locus_tag LOCUS_27770 2332 3522 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948851.1 protein_id gnl|my_center|LOCUS_27770 >Feature sequence310 1356 661 gene locus_tag LOCUS_27780 1356 661 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861321.1 protein_id gnl|my_center|LOCUS_27780 1530 1396 gene locus_tag LOCUS_27790 1530 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 1947 2528 gene locus_tag LOCUS_27800 1947 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 3515 2571 gene locus_tag LOCUS_27810 3515 2571 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906355.1 protein_id gnl|my_center|LOCUS_27810 >Feature sequence311 2174 1359 gene locus_tag LOCUS_27820 2174 1359 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986494.1 protein_id gnl|my_center|LOCUS_27820 >Feature sequence312 1756 2652 gene locus_tag LOCUS_27830 1756 2652 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180537.1 protein_id gnl|my_center|LOCUS_27830 <3623 2786 gene locus_tag LOCUS_27840 <3623 2786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_021361811.1:ATP-binding protein >Feature sequence313 1471 65 gene locus_tag LOCUS_27850 1471 65 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964714.1 protein_id gnl|my_center|LOCUS_27850 <3618 1606 gene locus_tag LOCUS_27860 <3618 1606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476111.1:alpha-galactosidase >Feature sequence314 317 1060 gene locus_tag LOCUS_27870 gene tpiA 317 1060 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900651.1 protein_id gnl|my_center|LOCUS_27870 1276 1659 gene locus_tag LOCUS_27880 1276 1659 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_27880 1773 3071 gene locus_tag LOCUS_27890 1773 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 >Feature sequence315 120 45 gene locus_tag LOCUS_t00340 120 45 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 213 138 gene locus_tag LOCUS_t00350 213 138 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1593 313 gene locus_tag LOCUS_27900 1593 313 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435635.1 protein_id gnl|my_center|LOCUS_27900 1972 1595 gene locus_tag LOCUS_27910 1972 1595 CDS product CvfD/Ygs/GSP13 family RNA-binding post-transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287231.1 protein_id gnl|my_center|LOCUS_27910 2119 2256 gene locus_tag LOCUS_27920 2119 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 2243 2482 gene locus_tag LOCUS_27930 2243 2482 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431159.1 protein_id gnl|my_center|LOCUS_27930 2642 2776 gene locus_tag LOCUS_27940 2642 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 >Feature sequence316 939 262 gene locus_tag LOCUS_27950 939 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 >Feature sequence317 <1 1249 gene locus_tag LOCUS_27960 <1 1249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966714.1:MATE family efflux transporter 1846 1268 gene locus_tag LOCUS_27970 1846 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 1989 2639 gene locus_tag LOCUS_27980 1989 2639 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898027.1 protein_id gnl|my_center|LOCUS_27980 2730 3392 gene locus_tag LOCUS_27990 2730 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 >Feature sequence318 <1 982 gene locus_tag LOCUS_28000 <1 982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002357859.1:translation initiation factor IF-2 993 1343 gene locus_tag LOCUS_28010 gene rbfA 993 1343 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967251.1 protein_id gnl|my_center|LOCUS_28010 1441 2580 gene locus_tag LOCUS_28020 gene nagA 1441 2580 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987105.1 protein_id gnl|my_center|LOCUS_28020 2583 3461 gene locus_tag LOCUS_28030 2583 3461 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966313.1 protein_id gnl|my_center|LOCUS_28030 >Feature sequence319 619 101 gene locus_tag LOCUS_28040 619 101 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765867.1 protein_id gnl|my_center|LOCUS_28040 1223 657 gene locus_tag LOCUS_28050 1223 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 1661 1248 gene locus_tag LOCUS_28060 1661 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 >Feature sequence320 <1 761 gene locus_tag LOCUS_28070 <1 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545181.1:type III-A CRISPR-associated protein Cas10/Csm1 775 1194 gene locus_tag LOCUS_28080 775 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 1211 1855 gene locus_tag LOCUS_28090 gene csm3 1211 1855 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082356.1 protein_id gnl|my_center|LOCUS_28090 1857 2795 gene locus_tag LOCUS_28100 1857 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 >Feature sequence321 2 400 gene locus_tag LOCUS_28110 2 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 499 771 gene locus_tag LOCUS_28120 gene rpsP 499 771 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699989.1 protein_id gnl|my_center|LOCUS_28120 774 1022 gene locus_tag LOCUS_28130 774 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 1065 1574 gene locus_tag LOCUS_28140 gene rimM 1065 1574 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832559.1 protein_id gnl|my_center|LOCUS_28140 1564 2283 gene locus_tag LOCUS_28150 gene trmD 1564 2283 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922347.1 protein_id gnl|my_center|LOCUS_28150 2390 2740 gene locus_tag LOCUS_28160 gene rplS 2390 2740 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220825.1 protein_id gnl|my_center|LOCUS_28160 2844 3389 gene locus_tag LOCUS_28170 gene lepB 2844 3389 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711853.1 protein_id gnl|my_center|LOCUS_28170 >Feature sequence322 39 197 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttaaatacatctaatgttgatattaaac <3395 671 gene locus_tag LOCUS_28180 <3395 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808733.1:DEAD/DEAH box helicase family protein >Feature sequence323 847 2448 gene locus_tag LOCUS_28190 847 2448 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723607.1 protein_id gnl|my_center|LOCUS_28190 >Feature sequence324 358 1473 gene locus_tag LOCUS_28200 358 1473 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267353.1 protein_id gnl|my_center|LOCUS_28200 1554 2720 gene locus_tag LOCUS_28210 1554 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 >Feature sequence325 806 1234 gene locus_tag LOCUS_28220 806 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 1860 1252 gene locus_tag LOCUS_28230 1860 1252 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 protein_id gnl|my_center|LOCUS_28230 3305 1863 gene locus_tag LOCUS_28240 3305 1863 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869268.1 protein_id gnl|my_center|LOCUS_28240 >Feature sequence326 460 1260 gene locus_tag LOCUS_28250 460 1260 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107747.1 protein_id gnl|my_center|LOCUS_28250 1261 2259 gene locus_tag LOCUS_28260 1261 2259 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_28260 2264 3163 gene locus_tag LOCUS_28270 2264 3163 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020423.1 protein_id gnl|my_center|LOCUS_28270 >Feature sequence327 >Feature sequence328 1984 1301 gene locus_tag LOCUS_28280 1984 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 2949 2038 gene locus_tag LOCUS_28290 gene ftsX 2949 2038 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732506.1 protein_id gnl|my_center|LOCUS_28290 >Feature sequence329 1833 82 gene locus_tag LOCUS_28300 1833 82 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869269.1 protein_id gnl|my_center|LOCUS_28300 2445 1849 gene locus_tag LOCUS_28310 2445 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 2766 2458 gene locus_tag LOCUS_28320 2766 2458 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925114.1 protein_id gnl|my_center|LOCUS_28320 3217 2786 gene locus_tag LOCUS_28330 3217 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 >Feature sequence330 341 1249 gene locus_tag LOCUS_28340 341 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 1292 1807 gene locus_tag LOCUS_28350 1292 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 2057 2824 gene locus_tag LOCUS_28360 2057 2824 CDS product terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047810.1 protein_id gnl|my_center|LOCUS_28360 >Feature sequence331 2883 2188 gene locus_tag LOCUS_28370 2883 2188 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020493338.1 protein_id gnl|my_center|LOCUS_28370 >Feature sequence332 2006 684 gene locus_tag LOCUS_28380 2006 684 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389943.1 protein_id gnl|my_center|LOCUS_28380 >Feature sequence333 721 164 gene locus_tag LOCUS_28390 721 164 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924169.1 protein_id gnl|my_center|LOCUS_28390 911 1759 gene locus_tag LOCUS_28400 911 1759 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547290.1 protein_id gnl|my_center|LOCUS_28400 1775 2620 gene locus_tag LOCUS_28410 1775 2620 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174466.1 protein_id gnl|my_center|LOCUS_28410 >Feature sequence334 619 44 gene locus_tag LOCUS_28420 619 44 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898317.1 protein_id gnl|my_center|LOCUS_28420 1726 719 gene locus_tag LOCUS_28430 1726 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 1798 2355 gene locus_tag LOCUS_28440 1798 2355 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358306.1 protein_id gnl|my_center|LOCUS_28440 >Feature sequence335 359 1189 gene locus_tag LOCUS_28450 359 1189 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476364.1 protein_id gnl|my_center|LOCUS_28450 1179 1838 gene locus_tag LOCUS_28460 1179 1838 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242965.1 protein_id gnl|my_center|LOCUS_28460 1850 3001 gene locus_tag LOCUS_28470 1850 3001 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774890.1 protein_id gnl|my_center|LOCUS_28470 >Feature sequence336 925 113 gene locus_tag LOCUS_28480 925 113 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294546.1 protein_id gnl|my_center|LOCUS_28480 1940 951 gene locus_tag LOCUS_28490 1940 951 CDS product mannose/fructose/sorbose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289456.1 protein_id gnl|my_center|LOCUS_28490 2627 2175 gene locus_tag LOCUS_28500 2627 2175 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986684.1 protein_id gnl|my_center|LOCUS_28500 >Feature sequence337 495 2273 gene locus_tag LOCUS_28510 495 2273 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962335.1 protein_id gnl|my_center|LOCUS_28510 >Feature sequence338 279 1271 gene locus_tag LOCUS_28520 279 1271 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003019.1 protein_id gnl|my_center|LOCUS_28520 1274 2059 gene locus_tag LOCUS_28530 1274 2059 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965542.1 protein_id gnl|my_center|LOCUS_28530 2075 2932 gene locus_tag LOCUS_28540 2075 2932 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071679.1 protein_id gnl|my_center|LOCUS_28540 >Feature sequence339 44 991 gene locus_tag LOCUS_28550 44 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 984 2843 gene locus_tag LOCUS_28560 984 2843 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_28560 >Feature sequence340 1099 272 gene locus_tag LOCUS_28570 1099 272 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101871.1 protein_id gnl|my_center|LOCUS_28570 2041 1199 gene locus_tag LOCUS_28580 2041 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 <3105 2138 gene locus_tag LOCUS_28590 <3105 2138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176994209.1:glycoside hydrolase family 43 protein >Feature sequence341 714 280 gene locus_tag LOCUS_28600 714 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 2968 1064 gene locus_tag LOCUS_28610 2968 1064 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948279.1 protein_id gnl|my_center|LOCUS_28610 >Feature sequence342 3054 214 gene locus_tag LOCUS_28620 3054 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 >Feature sequence343 1040 408 gene locus_tag LOCUS_28630 1040 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28630 1578 976 gene locus_tag LOCUS_28640 1578 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 1760 1581 gene locus_tag LOCUS_28650 1760 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 >Feature sequence344 <1 686 gene locus_tag LOCUS_28660 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861602.1:BglG family transcription antiterminator 2991 1060 gene locus_tag LOCUS_28670 2991 1060 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986666.1 protein_id gnl|my_center|LOCUS_28670 >Feature sequence345 3 167 gene locus_tag LOCUS_28680 3 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 384 1913 gene locus_tag LOCUS_28690 384 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 2109 2636 gene locus_tag LOCUS_28700 2109 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 2690 2860 gene locus_tag LOCUS_28710 2690 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 >Feature sequence346 <3065 682 gene locus_tag LOCUS_28720 <3065 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948376.1:DEAD/DEAH box helicase >Feature sequence347 489 674 gene locus_tag LOCUS_28730 489 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 2180 816 gene locus_tag LOCUS_28740 gene glmM 2180 816 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521476.1 protein_id gnl|my_center|LOCUS_28740 <3061 2276 gene locus_tag LOCUS_28750 <3061 2276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107233.1:UDP-N-acetyl glucosamine 2-epimerase >Feature sequence348 2431 383 gene locus_tag LOCUS_28760 gene feoB 2431 383 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722364.1 protein_id gnl|my_center|LOCUS_28760 2562 2431 gene locus_tag LOCUS_28770 2562 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 >Feature sequence349 2755 1340 gene locus_tag LOCUS_28780 2755 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 >Feature sequence350 1372 614 gene locus_tag LOCUS_28790 1372 614 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963489.1 protein_id gnl|my_center|LOCUS_28790 2622 1360 gene locus_tag LOCUS_28800 2622 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 >Feature sequence351 1062 1556 gene locus_tag LOCUS_28810 1062 1556 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868903.1 protein_id gnl|my_center|LOCUS_28810 1546 1899 gene locus_tag LOCUS_28820 1546 1899 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583279.1 protein_id gnl|my_center|LOCUS_28820 1896 2303 gene locus_tag LOCUS_28830 1896 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 >Feature sequence352 784 1887 gene locus_tag LOCUS_28840 784 1887 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_28840 >Feature sequence353 1872 1075 gene locus_tag LOCUS_28850 1872 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 2752 1865 gene locus_tag LOCUS_28860 2752 1865 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626612.1 protein_id gnl|my_center|LOCUS_28860 >Feature sequence354 1927 752 gene locus_tag LOCUS_28870 1927 752 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460576.1 protein_id gnl|my_center|LOCUS_28870 2157 1930 gene locus_tag LOCUS_28880 2157 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 >Feature sequence355 507 1304 gene locus_tag LOCUS_28890 507 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 1439 2719 gene locus_tag LOCUS_28900 gene celB 1439 2719 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242539.1 protein_id gnl|my_center|LOCUS_28900 >Feature sequence356 487 137 gene locus_tag LOCUS_28910 487 137 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068054.1 protein_id gnl|my_center|LOCUS_28910 1937 531 gene locus_tag LOCUS_28920 gene atpD 1937 531 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425850.1 protein_id gnl|my_center|LOCUS_28920 2806 1949 gene locus_tag LOCUS_28930 gene atpG 2806 1949 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167039.1 protein_id gnl|my_center|LOCUS_28930 >Feature sequence357 350 964 gene locus_tag LOCUS_28940 350 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 2831 1083 gene locus_tag LOCUS_28950 2831 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 >Feature sequence358 966 415 gene locus_tag LOCUS_28960 966 415 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241398.1 protein_id gnl|my_center|LOCUS_28960 1528 968 gene locus_tag LOCUS_28970 1528 968 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241407.1 protein_id gnl|my_center|LOCUS_28970 1710 2153 gene locus_tag LOCUS_28980 1710 2153 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816014.1 protein_id gnl|my_center|LOCUS_28980 <2845 2222 gene locus_tag LOCUS_28990 <2845 2222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964085.1:aldo/keto reductase >Feature sequence359 1072 593 gene locus_tag LOCUS_29000 1072 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 1262 1125 gene locus_tag LOCUS_29010 1262 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 1563 1393 gene locus_tag LOCUS_29020 1563 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 1750 1589 gene locus_tag LOCUS_29030 1750 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 2010 1834 gene locus_tag LOCUS_29040 2010 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 <2843 2088 gene locus_tag LOCUS_29050 <2843 2088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948822.1:ZIP family metal transporter >Feature sequence360 175 588 gene locus_tag LOCUS_29060 175 588 CDS product holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965147.1 protein_id gnl|my_center|LOCUS_29060 590 1042 gene locus_tag LOCUS_29070 590 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 1045 2019 gene locus_tag LOCUS_29080 1045 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 2024 2263 gene locus_tag LOCUS_29090 2024 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 2253 2414 gene locus_tag LOCUS_29100 2253 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 >Feature sequence361 52 360 gene locus_tag LOCUS_29110 52 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 967 494 gene locus_tag LOCUS_29120 967 494 CDS product LURP-one-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775190.1 protein_id gnl|my_center|LOCUS_29120 1969 1118 gene locus_tag LOCUS_29130 1969 1118 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_29130 >Feature sequence362 728 519 gene locus_tag LOCUS_29140 728 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 970 1056 gene locus_tag LOCUS_t00360 970 1056 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1670 1251 gene locus_tag LOCUS_29150 1670 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 >Feature sequence363 <1 1221 gene locus_tag LOCUS_29160 <1 1221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003904058.1:type III-A CRISPR-associated CARF protein Csm6 >Feature sequence364 691 71 gene locus_tag LOCUS_29170 691 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 1062 2315 gene locus_tag LOCUS_29180 1062 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 2317 2751 gene locus_tag LOCUS_29190 2317 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 >Feature sequence365 419 213 gene locus_tag LOCUS_29200 419 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29200 768 448 gene locus_tag LOCUS_29210 768 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29210 1311 781 gene locus_tag LOCUS_29220 1311 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 1437 2348 gene locus_tag LOCUS_29230 1437 2348 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774964.1 protein_id gnl|my_center|LOCUS_29230 >Feature sequence366 931 176 gene locus_tag LOCUS_29240 931 176 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816623.1 protein_id gnl|my_center|LOCUS_29240 1444 935 gene locus_tag LOCUS_29250 1444 935 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_29250 >Feature sequence367 428 1213 gene locus_tag LOCUS_29260 428 1213 CDS product (S)-acetoin forming diacetyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048144.1 protein_id gnl|my_center|LOCUS_29260 2456 1347 gene locus_tag LOCUS_29270 2456 1347 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_29270 >Feature sequence368 530 12 gene locus_tag LOCUS_29280 530 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 1131 517 gene locus_tag LOCUS_29290 gene scpB 1131 517 CDS product segregation/condensation protein ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375167.1 protein_id gnl|my_center|LOCUS_29290 1859 1131 gene locus_tag LOCUS_29300 1859 1131 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723598.1 protein_id gnl|my_center|LOCUS_29300 <2705 1943 gene locus_tag LOCUS_29310 <2705 1943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003230471.1:spore germination protein SpoVAF >Feature sequence369 <1 901 gene locus_tag LOCUS_29320 <1 901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010882793.1:5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase 2509 923 gene locus_tag LOCUS_29330 2509 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29330 >Feature sequence370 >Feature sequence371 413 1525 gene locus_tag LOCUS_29340 413 1525 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659021.1 protein_id gnl|my_center|LOCUS_29340 1522 1722 gene locus_tag LOCUS_29350 1522 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 1722 2621 gene locus_tag LOCUS_29360 1722 2621 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860718.1 protein_id gnl|my_center|LOCUS_29360 >Feature sequence372 1363 590 gene locus_tag LOCUS_29370 1363 590 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821961.1 protein_id gnl|my_center|LOCUS_29370 1532 2155 gene locus_tag LOCUS_29380 1532 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 2662 2201 gene locus_tag LOCUS_29390 2662 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 >Feature sequence373 428 1654 gene locus_tag LOCUS_29400 428 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 <2667 1745 gene locus_tag LOCUS_29410 <2667 1745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107414.1:helix-turn-helix domain-containing protein >Feature sequence374 1964 204 gene locus_tag LOCUS_29420 gene dnaK 1964 204 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430934.1 protein_id gnl|my_center|LOCUS_29420 2621 1980 gene locus_tag LOCUS_29430 2621 1980 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963967.1 protein_id gnl|my_center|LOCUS_29430 >Feature sequence375 314 970 gene locus_tag LOCUS_29440 314 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 1047 1742 gene locus_tag LOCUS_29450 1047 1742 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038927.1 protein_id gnl|my_center|LOCUS_29450 1817 2071 gene locus_tag LOCUS_29460 1817 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 2481 2350 gene locus_tag LOCUS_29470 2481 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 >Feature sequence376 >Feature sequence377 >Feature sequence378 1873 914 gene locus_tag LOCUS_29480 1873 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 >Feature sequence379 938 1378 gene locus_tag LOCUS_29490 938 1378 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836783.1 protein_id gnl|my_center|LOCUS_29490 <2618 1404 gene locus_tag LOCUS_29500 <2618 1404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860825.1:alpha-glucosidase >Feature sequence380 1172 357 gene locus_tag LOCUS_29510 1172 357 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395635.1 protein_id gnl|my_center|LOCUS_29510 1291 2157 gene locus_tag LOCUS_29520 1291 2157 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399248.1 protein_id gnl|my_center|LOCUS_29520 >Feature sequence381 <2601 2016 gene locus_tag LOCUS_29530 <2601 2016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024089.1:class I SAM-dependent methyltransferase >Feature sequence382 653 1171 gene locus_tag LOCUS_29540 653 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 1260 1652 gene locus_tag LOCUS_29550 1260 1652 CDS product Zn-finger containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964917.1 protein_id gnl|my_center|LOCUS_29550 1653 2486 gene locus_tag LOCUS_29560 1653 2486 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_29560 >Feature sequence383 213 389 gene locus_tag LOCUS_29570 213 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 1395 631 gene locus_tag LOCUS_29580 1395 631 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965719.1 protein_id gnl|my_center|LOCUS_29580 >Feature sequence384 29 1210 gene locus_tag LOCUS_29590 29 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 >Feature sequence385 940 218 gene locus_tag LOCUS_29600 940 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 1217 2518 gene locus_tag LOCUS_29610 1217 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 >Feature sequence386 >Feature sequence387 495 770 gene locus_tag LOCUS_29620 495 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29620 767 2152 gene locus_tag LOCUS_29630 767 2152 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811470.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29630 >Feature sequence388 1866 349 gene locus_tag LOCUS_29640 1866 349 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680024.1 protein_id gnl|my_center|LOCUS_29640 2023 1859 gene locus_tag LOCUS_29650 2023 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 2269 2117 gene locus_tag LOCUS_29660 2269 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 >Feature sequence389 2157 94 gene locus_tag LOCUS_29670 2157 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 >Feature sequence390 811 14 gene locus_tag LOCUS_29680 811 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 1960 1082 gene locus_tag LOCUS_29690 1960 1082 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948489.1 protein_id gnl|my_center|LOCUS_29690 >Feature sequence391 711 400 gene locus_tag LOCUS_29700 711 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 791 1534 gene locus_tag LOCUS_29710 gene pgeF 791 1534 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999341.1 protein_id gnl|my_center|LOCUS_29710 2369 1554 gene locus_tag LOCUS_29720 2369 1554 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131528.1 protein_id gnl|my_center|LOCUS_29720 >Feature sequence392 >Feature sequence393 1205 741 gene locus_tag LOCUS_29730 1205 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 1522 1295 gene locus_tag LOCUS_29740 gene acpP 1522 1295 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057709.1 protein_id gnl|my_center|LOCUS_29740 >Feature sequence394 633 1376 gene locus_tag LOCUS_29750 633 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 <2223 1389 gene locus_tag LOCUS_29760 <2223 1389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003234240.1:AraC family transcriptional regulator >Feature sequence395 <2180 233 gene locus_tag LOCUS_29770 <2180 233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810321.1:carbamoyl-phosphate synthase large subunit >Feature sequence396 501 256 gene locus_tag LOCUS_29780 501 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 883 1500 gene locus_tag LOCUS_29790 883 1500 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_29790 1617 1847 gene locus_tag LOCUS_29800 1617 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 >Feature sequence397 97 1044 gene locus_tag LOCUS_29810 97 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 1358 1227 gene locus_tag LOCUS_29820 1358 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 1721 1374 gene locus_tag LOCUS_29830 1721 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 >Feature sequence398 175 360 gene locus_tag LOCUS_29840 175 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 505 1419 gene locus_tag LOCUS_29850 505 1419 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436568.1 protein_id gnl|my_center|LOCUS_29850 >Feature sequence399 1572 835 gene locus_tag LOCUS_29860 1572 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 >Feature sequence400 1240 548 gene locus_tag LOCUS_29870 1240 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 1951 1460 gene locus_tag LOCUS_29880 1951 1460 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246088.1 protein_id gnl|my_center|LOCUS_29880 >Feature sequence401 1037 249 gene locus_tag LOCUS_29890 1037 249 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965719.1 protein_id gnl|my_center|LOCUS_29890 1760 1278 gene locus_tag LOCUS_29900 1760 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 >Feature sequence402 295 1419 gene locus_tag LOCUS_29910 295 1419 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 protein_id gnl|my_center|LOCUS_29910 >Feature sequence403 1787 1434 gene locus_tag LOCUS_29920 1787 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 >Feature sequence404 277 23 gene locus_tag LOCUS_29930 277 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 >Feature sequence405 1364 180 gene locus_tag LOCUS_29940 1364 180 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549893.1 protein_id gnl|my_center|LOCUS_29940 >Feature sequence406 >Feature sequence407 <1338 728 gene locus_tag LOCUS_29950 <1338 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964889.1:LytTR family DNA-binding domain-containing protein >Feature sequence408 301 173 gene locus_tag LOCUS_29960 301 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 597 397 gene locus_tag LOCUS_29970 597 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 1209 928 gene locus_tag LOCUS_29980 1209 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 >Feature sequence409 >Feature sequence410