>Feature sequence01 368 994 gene locus_tag LOCUS_00010 368 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1007 1744 gene locus_tag LOCUS_00020 1007 1744 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869338.1 protein_id gnl|my_center|LOCUS_00020 1757 2302 gene locus_tag LOCUS_00030 1757 2302 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869337.1 protein_id gnl|my_center|LOCUS_00030 2706 3317 gene locus_tag LOCUS_00040 2706 3317 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381503.1 protein_id gnl|my_center|LOCUS_00040 3388 3903 gene locus_tag LOCUS_00050 3388 3903 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947901.1 protein_id gnl|my_center|LOCUS_00050 4033 4938 gene locus_tag LOCUS_00060 gene nadA 4033 4938 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583121.1 protein_id gnl|my_center|LOCUS_00060 4987 6531 gene locus_tag LOCUS_00070 gene nadB 4987 6531 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545397.1 protein_id gnl|my_center|LOCUS_00070 7058 8284 gene locus_tag LOCUS_00080 7058 8284 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_00080 8295 8891 gene locus_tag LOCUS_00090 gene yfbR 8295 8891 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706162.1 protein_id gnl|my_center|LOCUS_00090 8927 10300 gene locus_tag LOCUS_00100 8927 10300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 10491 12461 gene locus_tag LOCUS_00110 10491 12461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12902 12537 gene locus_tag LOCUS_00120 12902 12537 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878336.1 protein_id gnl|my_center|LOCUS_00120 13120 16068 gene locus_tag LOCUS_00130 13120 16068 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761136.1 protein_id gnl|my_center|LOCUS_00130 16135 17145 gene locus_tag LOCUS_00140 gene yiaK 16135 17145 CDS product 3-dehydro-L-gulonate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869035.1 protein_id gnl|my_center|LOCUS_00140 17170 17592 gene locus_tag LOCUS_00150 17170 17592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 17589 19037 gene locus_tag LOCUS_00160 17589 19037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 19356 20633 gene locus_tag LOCUS_00170 19356 20633 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679977.1 protein_id gnl|my_center|LOCUS_00170 20852 21553 gene locus_tag LOCUS_00180 20852 21553 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020206.1 protein_id gnl|my_center|LOCUS_00180 21578 22027 gene locus_tag LOCUS_00190 21578 22027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 22075 22506 gene locus_tag LOCUS_00200 22075 22506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 22647 24689 gene locus_tag LOCUS_00210 22647 24689 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949159.1 protein_id gnl|my_center|LOCUS_00210 26047 24842 gene locus_tag LOCUS_00220 26047 24842 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087353.1 protein_id gnl|my_center|LOCUS_00220 26197 27537 gene locus_tag LOCUS_00230 26197 27537 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966615.1 protein_id gnl|my_center|LOCUS_00230 27516 28355 gene locus_tag LOCUS_00240 27516 28355 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966616.1 protein_id gnl|my_center|LOCUS_00240 28542 29126 gene locus_tag LOCUS_00250 28542 29126 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172636477.1 protein_id gnl|my_center|LOCUS_00250 29503 30612 gene locus_tag LOCUS_00260 29503 30612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 30623 30982 gene locus_tag LOCUS_00270 30623 30982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 32718 31657 gene locus_tag LOCUS_00280 32718 31657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 33371 33589 gene locus_tag LOCUS_00290 33371 33589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 33492 33758 gene locus_tag LOCUS_00300 33492 33758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 33774 33959 gene locus_tag LOCUS_00310 33774 33959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 34208 34684 gene locus_tag LOCUS_00320 34208 34684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 34698 35651 gene locus_tag LOCUS_00330 34698 35651 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939436.1 protein_id gnl|my_center|LOCUS_00330 35722 36723 gene locus_tag LOCUS_00340 35722 36723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 36736 37371 gene locus_tag LOCUS_00350 36736 37371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 37886 38248 gene locus_tag LOCUS_00360 37886 38248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 38253 38870 gene locus_tag LOCUS_00370 38253 38870 CDS product phage minor tail protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152512.1 protein_id gnl|my_center|LOCUS_00370 38833 39267 gene locus_tag LOCUS_00380 38833 39267 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939431.1 protein_id gnl|my_center|LOCUS_00380 39264 43118 gene locus_tag LOCUS_00390 39264 43118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 43350 44063 gene locus_tag LOCUS_00400 43350 44063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 44299 44613 gene locus_tag LOCUS_00410 44299 44613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 44631 45083 gene locus_tag LOCUS_00420 44631 45083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 45454 45723 gene locus_tag LOCUS_00430 45454 45723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 45725 45973 gene locus_tag LOCUS_00440 45725 45973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 45970 46419 gene locus_tag LOCUS_00450 45970 46419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 46412 47029 gene locus_tag LOCUS_00460 46412 47029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 47092 48282 gene locus_tag LOCUS_00470 47092 48282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 48437 49003 gene locus_tag LOCUS_00480 48437 49003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 49294 50460 gene locus_tag LOCUS_00490 49294 50460 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191212.1 protein_id gnl|my_center|LOCUS_00490 50490 51413 gene locus_tag LOCUS_00500 50490 51413 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064074.1 protein_id gnl|my_center|LOCUS_00500 51426 52580 gene locus_tag LOCUS_00510 51426 52580 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948215.1 protein_id gnl|my_center|LOCUS_00510 52585 53355 gene locus_tag LOCUS_00520 52585 53355 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262678.1 protein_id gnl|my_center|LOCUS_00520 53349 54086 gene locus_tag LOCUS_00530 53349 54086 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_00530 54070 55233 gene locus_tag LOCUS_00540 54070 55233 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266619.1 protein_id gnl|my_center|LOCUS_00540 56366 55323 gene locus_tag LOCUS_00550 56366 55323 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461701.1 protein_id gnl|my_center|LOCUS_00550 56618 57445 gene locus_tag LOCUS_00560 56618 57445 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990820.1 protein_id gnl|my_center|LOCUS_00560 58102 57455 gene locus_tag LOCUS_00570 58102 57455 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896727.1 protein_id gnl|my_center|LOCUS_00570 59105 58326 gene locus_tag LOCUS_00580 59105 58326 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_00580 59301 60527 gene locus_tag LOCUS_00590 59301 60527 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255992.1 protein_id gnl|my_center|LOCUS_00590 60571 61497 gene locus_tag LOCUS_00600 gene ptb 60571 61497 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420701.1 protein_id gnl|my_center|LOCUS_00600 61758 63176 gene locus_tag LOCUS_00610 gene hydG 61758 63176 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_00610 63467 64564 gene locus_tag LOCUS_00620 63467 64564 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949061.1 protein_id gnl|my_center|LOCUS_00620 64632 65015 gene locus_tag LOCUS_00630 64632 65015 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964000.1 protein_id gnl|my_center|LOCUS_00630 65197 66516 gene locus_tag LOCUS_00640 65197 66516 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083240.1 protein_id gnl|my_center|LOCUS_00640 66785 68068 gene locus_tag LOCUS_00650 66785 68068 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545697.1 protein_id gnl|my_center|LOCUS_00650 68095 70023 gene locus_tag LOCUS_00660 68095 70023 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392246.1 protein_id gnl|my_center|LOCUS_00660 70152 71093 gene locus_tag LOCUS_00670 70152 71093 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860958.1 protein_id gnl|my_center|LOCUS_00670 71126 72517 gene locus_tag LOCUS_00680 71126 72517 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392014.1 protein_id gnl|my_center|LOCUS_00680 72670 73878 gene locus_tag LOCUS_00690 72670 73878 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895828.1 protein_id gnl|my_center|LOCUS_00690 74092 76395 gene locus_tag LOCUS_00700 74092 76395 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941205.1 protein_id gnl|my_center|LOCUS_00700 76780 77715 gene locus_tag LOCUS_00710 gene cysK 76780 77715 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461664.1 protein_id gnl|my_center|LOCUS_00710 77762 79051 gene locus_tag LOCUS_00720 77762 79051 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272631.1 protein_id gnl|my_center|LOCUS_00720 79304 80599 gene locus_tag LOCUS_00730 gene thiC 79304 80599 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047970.1 protein_id gnl|my_center|LOCUS_00730 80791 81969 gene locus_tag LOCUS_00740 gene nirJ1 80791 81969 CDS product putative heme d1 biosynthesis radical SAM protein NirJ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460179.1 protein_id gnl|my_center|LOCUS_00740 82064 83059 gene locus_tag LOCUS_00750 gene nirJ2 82064 83059 CDS product putative heme d1 biosynthesis radical SAM protein NirJ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460177.1 protein_id gnl|my_center|LOCUS_00750 83101 84486 gene locus_tag LOCUS_00760 83101 84486 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393585.1 protein_id gnl|my_center|LOCUS_00760 84477 85481 gene locus_tag LOCUS_00770 gene cydB 84477 85481 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393586.1 protein_id gnl|my_center|LOCUS_00770 85627 87354 gene locus_tag LOCUS_00780 gene cydD 85627 87354 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461540.1 protein_id gnl|my_center|LOCUS_00780 87351 89135 gene locus_tag LOCUS_00790 gene cydC 87351 89135 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208974886.1 protein_id gnl|my_center|LOCUS_00790 89278 90453 gene locus_tag LOCUS_00800 89278 90453 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088548.1 protein_id gnl|my_center|LOCUS_00800 90431 92755 gene locus_tag LOCUS_00810 90431 92755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 92802 93686 gene locus_tag LOCUS_00820 92802 93686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 93947 94654 gene locus_tag LOCUS_00830 93947 94654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 95432 94686 gene locus_tag LOCUS_00840 95432 94686 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025704.1 protein_id gnl|my_center|LOCUS_00840 95716 96891 gene locus_tag LOCUS_00850 95716 96891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404253.1 protein_id gnl|my_center|LOCUS_00850 96929 98152 gene locus_tag LOCUS_00860 96929 98152 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927045.1 protein_id gnl|my_center|LOCUS_00860 98149 98601 gene locus_tag LOCUS_00870 98149 98601 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429665.1 protein_id gnl|my_center|LOCUS_00870 98697 99794 gene locus_tag LOCUS_00880 98697 99794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021064.1 protein_id gnl|my_center|LOCUS_00880 100375 99863 gene locus_tag LOCUS_00890 100375 99863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 100741 102882 gene locus_tag LOCUS_00900 100741 102882 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082901051.1 protein_id gnl|my_center|LOCUS_00900 102885 104249 gene locus_tag LOCUS_00910 102885 104249 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268198.1 protein_id gnl|my_center|LOCUS_00910 104253 106364 gene locus_tag LOCUS_00920 104253 106364 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268199.1 protein_id gnl|my_center|LOCUS_00920 107095 107727 gene locus_tag LOCUS_00930 107095 107727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 107727 109157 gene locus_tag LOCUS_00940 107727 109157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00940 109193 109882 gene locus_tag LOCUS_00950 109193 109882 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986981.1 protein_id gnl|my_center|LOCUS_00950 109906 111804 gene locus_tag LOCUS_00960 109906 111804 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272023.1 protein_id gnl|my_center|LOCUS_00960 111823 113142 gene locus_tag LOCUS_00970 111823 113142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 113188 114348 gene locus_tag LOCUS_00980 113188 114348 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808458.1 protein_id gnl|my_center|LOCUS_00980 114396 115679 gene locus_tag LOCUS_00990 114396 115679 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_00990 115618 116694 gene locus_tag LOCUS_01000 gene tviC 115618 116694 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosaminuronic acid C-4 epimerase TviC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127915.1 protein_id gnl|my_center|LOCUS_01000 116717 117832 gene locus_tag LOCUS_01010 116717 117832 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937635.1 protein_id gnl|my_center|LOCUS_01010 117835 118446 gene locus_tag LOCUS_01020 117835 118446 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243002.1 protein_id gnl|my_center|LOCUS_01020 118485 119117 gene locus_tag LOCUS_01030 gene vioB 118485 119117 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose acetyltransferase VioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382700.1 protein_id gnl|my_center|LOCUS_01030 119144 119410 gene locus_tag LOCUS_01040 119144 119410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 119442 120968 gene locus_tag LOCUS_01050 119442 120968 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_01050 121020 121250 gene locus_tag LOCUS_01060 121020 121250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 121247 122311 gene locus_tag LOCUS_01070 121247 122311 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198213.1 protein_id gnl|my_center|LOCUS_01070 122352 123008 gene locus_tag LOCUS_01080 122352 123008 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256835.1 protein_id gnl|my_center|LOCUS_01080 123041 124147 gene locus_tag LOCUS_01090 123041 124147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 124165 125256 gene locus_tag LOCUS_01100 124165 125256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 125296 126258 gene locus_tag LOCUS_01110 125296 126258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 126280 127755 gene locus_tag LOCUS_01120 126280 127755 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767818.1 protein_id gnl|my_center|LOCUS_01120 127748 128734 gene locus_tag LOCUS_01130 127748 128734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 128694 129989 gene locus_tag LOCUS_01140 128694 129989 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202935.1 protein_id gnl|my_center|LOCUS_01140 130022 130585 gene locus_tag LOCUS_01150 130022 130585 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942604.1 protein_id gnl|my_center|LOCUS_01150 130642 131859 gene locus_tag LOCUS_01160 130642 131859 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986574.1 protein_id gnl|my_center|LOCUS_01160 131771 132643 gene locus_tag LOCUS_01170 gene rfbA 131771 132643 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965630.1 protein_id gnl|my_center|LOCUS_01170 132640 133689 gene locus_tag LOCUS_01180 gene rfbB 132640 133689 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_01180 135577 133766 gene locus_tag LOCUS_01190 135577 133766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 136020 136307 gene locus_tag LOCUS_01200 136020 136307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 136353 137123 gene locus_tag LOCUS_01210 136353 137123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 137167 138414 gene locus_tag LOCUS_01220 137167 138414 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968194.1 protein_id gnl|my_center|LOCUS_01220 138489 139640 gene locus_tag LOCUS_01230 138489 139640 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876001.1 protein_id gnl|my_center|LOCUS_01230 139672 140769 gene locus_tag LOCUS_01240 139672 140769 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531351.1 protein_id gnl|my_center|LOCUS_01240 140892 141122 gene locus_tag LOCUS_01250 140892 141122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 141217 141705 gene locus_tag LOCUS_01260 141217 141705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 141838 142176 gene locus_tag LOCUS_01270 141838 142176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 142289 142651 gene locus_tag LOCUS_01280 142289 142651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 143205 144923 gene locus_tag LOCUS_01290 143205 144923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 144926 145168 gene locus_tag LOCUS_01300 144926 145168 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802828.1 protein_id gnl|my_center|LOCUS_01300 145188 146672 gene locus_tag LOCUS_01310 145188 146672 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 protein_id gnl|my_center|LOCUS_01310 146695 147762 gene locus_tag LOCUS_01320 146695 147762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 147791 150070 gene locus_tag LOCUS_01330 147791 150070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 150100 151896 gene locus_tag LOCUS_01340 150100 151896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 151896 153755 gene locus_tag LOCUS_01350 gene pgaB 151896 153755 CDS product poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945561.1 protein_id gnl|my_center|LOCUS_01350 154798 155670 gene locus_tag LOCUS_01360 gene rcpC 154798 155670 CDS product type 4b pilus Flp biogenesis protein RcpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114980.1 protein_id gnl|my_center|LOCUS_01360 155696 156967 gene locus_tag LOCUS_01370 155696 156967 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939396.1 protein_id gnl|my_center|LOCUS_01370 156933 158144 gene locus_tag LOCUS_01380 156933 158144 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259630.1 protein_id gnl|my_center|LOCUS_01380 158226 159368 gene locus_tag LOCUS_01390 158226 159368 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259630.1 protein_id gnl|my_center|LOCUS_01390 159385 160347 gene locus_tag LOCUS_01400 159385 160347 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256415.1 protein_id gnl|my_center|LOCUS_01400 160391 160561 gene locus_tag LOCUS_01410 160391 160561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 160621 160788 gene locus_tag LOCUS_01420 160621 160788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 161000 161410 gene locus_tag LOCUS_01430 161000 161410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 161434 162801 gene locus_tag LOCUS_01440 161434 162801 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_01440 162819 163754 gene locus_tag LOCUS_01450 162819 163754 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256414.1 protein_id gnl|my_center|LOCUS_01450 163821 164504 gene locus_tag LOCUS_01460 163821 164504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 164597 165502 gene locus_tag LOCUS_01470 164597 165502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 167503 165641 gene locus_tag LOCUS_01480 167503 165641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 167701 168306 gene locus_tag LOCUS_01490 167701 168306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 168312 169343 gene locus_tag LOCUS_01500 168312 169343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 170593 169436 gene locus_tag LOCUS_01510 170593 169436 CDS product WG repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358861.1 protein_id gnl|my_center|LOCUS_01510 170837 171454 gene locus_tag LOCUS_01520 170837 171454 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246350.1 protein_id gnl|my_center|LOCUS_01520 171509 172090 gene locus_tag LOCUS_01530 171509 172090 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234723.1 protein_id gnl|my_center|LOCUS_01530 172130 172705 gene locus_tag LOCUS_01540 gene terD 172130 172705 CDS product tellurium resistance membrane protein TerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116677.1 protein_id gnl|my_center|LOCUS_01540 172735 173373 gene locus_tag LOCUS_01550 172735 173373 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454512.1 protein_id gnl|my_center|LOCUS_01550 173451 174188 gene locus_tag LOCUS_01560 173451 174188 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025704.1 protein_id gnl|my_center|LOCUS_01560 174185 175369 gene locus_tag LOCUS_01570 174185 175369 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028308.1 protein_id gnl|my_center|LOCUS_01570 175323 177827 gene locus_tag LOCUS_01580 175323 177827 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028307.1 protein_id gnl|my_center|LOCUS_01580 177829 178641 gene locus_tag LOCUS_01590 177829 178641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028306.1 protein_id gnl|my_center|LOCUS_01590 178646 179326 gene locus_tag LOCUS_01600 178646 179326 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019283.1 protein_id gnl|my_center|LOCUS_01600 179373 180170 gene locus_tag LOCUS_01610 179373 180170 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434058.1 protein_id gnl|my_center|LOCUS_01610 180161 180616 gene locus_tag LOCUS_01620 180161 180616 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434060.1 protein_id gnl|my_center|LOCUS_01620 180613 182907 gene locus_tag LOCUS_01630 180613 182907 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897245.1 protein_id gnl|my_center|LOCUS_01630 182959 184290 gene locus_tag LOCUS_01640 182959 184290 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006718507.1 protein_id gnl|my_center|LOCUS_01640 184327 185088 gene locus_tag LOCUS_01650 184327 185088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 185085 185702 gene locus_tag LOCUS_01660 185085 185702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 185946 186590 gene locus_tag LOCUS_01670 185946 186590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 186902 186696 gene locus_tag LOCUS_01680 186902 186696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 187662 187114 gene locus_tag LOCUS_01690 187662 187114 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483406.1 protein_id gnl|my_center|LOCUS_01690 188675 187758 gene locus_tag LOCUS_01700 188675 187758 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244785.1 protein_id gnl|my_center|LOCUS_01700 188789 189640 gene locus_tag LOCUS_01710 188789 189640 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477972.1 protein_id gnl|my_center|LOCUS_01710 190576 189701 gene locus_tag LOCUS_01720 190576 189701 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814724.1 protein_id gnl|my_center|LOCUS_01720 191169 192197 gene locus_tag LOCUS_01730 191169 192197 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402830.1 protein_id gnl|my_center|LOCUS_01730 192211 193515 gene locus_tag LOCUS_01740 192211 193515 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454645.1 protein_id gnl|my_center|LOCUS_01740 193554 194819 gene locus_tag LOCUS_01750 193554 194819 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087075.1 protein_id gnl|my_center|LOCUS_01750 194962 195603 gene locus_tag LOCUS_01760 194962 195603 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966771.1 protein_id gnl|my_center|LOCUS_01760 195628 197019 gene locus_tag LOCUS_01770 195628 197019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 197351 198133 gene locus_tag LOCUS_01780 197351 198133 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815541.1 protein_id gnl|my_center|LOCUS_01780 198203 199516 gene locus_tag LOCUS_01790 198203 199516 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_01790 199595 200731 gene locus_tag LOCUS_01800 199595 200731 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903799.1 protein_id gnl|my_center|LOCUS_01800 200864 201412 gene locus_tag LOCUS_01810 200864 201412 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869609.1 protein_id gnl|my_center|LOCUS_01810 202818 201418 gene locus_tag LOCUS_01820 202818 201418 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_01820 203066 203836 gene locus_tag LOCUS_01830 203066 203836 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272547.1 protein_id gnl|my_center|LOCUS_01830 203973 204626 gene locus_tag LOCUS_01840 203973 204626 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272546.1 protein_id gnl|my_center|LOCUS_01840 204629 205393 gene locus_tag LOCUS_01850 204629 205393 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815786.1 protein_id gnl|my_center|LOCUS_01850 205767 206807 gene locus_tag LOCUS_01860 205767 206807 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018304949.1 protein_id gnl|my_center|LOCUS_01860 206865 209090 gene locus_tag LOCUS_01870 gene srrA 206865 209090 CDS product respiratory selenite reductase catalytic subunit SrrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214715.1 protein_id gnl|my_center|LOCUS_01870 209092 209637 gene locus_tag LOCUS_01880 209092 209637 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943482.1 protein_id gnl|my_center|LOCUS_01880 209646 210752 gene locus_tag LOCUS_01890 gene nrfD 209646 210752 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817192.1 protein_id gnl|my_center|LOCUS_01890 210829 211761 gene locus_tag LOCUS_01900 210829 211761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 211953 212711 gene locus_tag LOCUS_01910 211953 212711 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256714.1 protein_id gnl|my_center|LOCUS_01910 212708 215140 gene locus_tag LOCUS_01920 212708 215140 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927835.1 protein_id gnl|my_center|LOCUS_01920 215173 216051 gene locus_tag LOCUS_01930 215173 216051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 216159 216926 gene locus_tag LOCUS_01940 216159 216926 CDS product DUF4931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381025.1 protein_id gnl|my_center|LOCUS_01940 217123 217659 gene locus_tag LOCUS_01950 217123 217659 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946639.1 protein_id gnl|my_center|LOCUS_01950 218557 217808 gene locus_tag LOCUS_01960 218557 217808 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392394.1 protein_id gnl|my_center|LOCUS_01960 219483 218557 gene locus_tag LOCUS_01970 219483 218557 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018271.1 protein_id gnl|my_center|LOCUS_01970 219674 220303 gene locus_tag LOCUS_01980 219674 220303 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136889.1 protein_id gnl|my_center|LOCUS_01980 220593 221081 gene locus_tag LOCUS_01990 gene thiW 220593 221081 CDS product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829480.1 protein_id gnl|my_center|LOCUS_01990 221328 222437 gene locus_tag LOCUS_02000 221328 222437 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179295.1 protein_id gnl|my_center|LOCUS_02000 222710 223414 gene locus_tag LOCUS_02010 222710 223414 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947933.1 protein_id gnl|my_center|LOCUS_02010 223472 224428 gene locus_tag LOCUS_02020 223472 224428 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811688.1 protein_id gnl|my_center|LOCUS_02020 224444 225310 gene locus_tag LOCUS_02030 224444 225310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 227755 225575 gene locus_tag LOCUS_02040 227755 225575 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393788.1 protein_id gnl|my_center|LOCUS_02040 228369 227755 gene locus_tag LOCUS_02050 228369 227755 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944374.1 protein_id gnl|my_center|LOCUS_02050 228563 228952 gene locus_tag LOCUS_02060 gene cfbA 228563 228952 CDS product sirohydrochlorin nickelochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061042.1 protein_id gnl|my_center|LOCUS_02060 228976 229545 gene locus_tag LOCUS_02070 gene cobU 228976 229545 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869446.1 protein_id gnl|my_center|LOCUS_02070 229581 230639 gene locus_tag LOCUS_02080 gene cobT 229581 230639 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541537.1 protein_id gnl|my_center|LOCUS_02080 230617 231369 gene locus_tag LOCUS_02090 gene cobS 230617 231369 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392616.1 protein_id gnl|my_center|LOCUS_02090 231388 232239 gene locus_tag LOCUS_02100 gene cobT 231388 232239 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541537.1 protein_id gnl|my_center|LOCUS_02100 232316 232924 gene locus_tag LOCUS_02110 gene cobC 232316 232924 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_02110 232962 233756 gene locus_tag LOCUS_02120 232962 233756 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937402.1 protein_id gnl|my_center|LOCUS_02120 233962 234360 gene locus_tag LOCUS_02130 233962 234360 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812273.1 protein_id gnl|my_center|LOCUS_02130 234361 234690 gene locus_tag LOCUS_02140 gene trxA 234361 234690 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082899.1 protein_id gnl|my_center|LOCUS_02140 234956 234753 gene locus_tag LOCUS_02150 234956 234753 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007190.1 protein_id gnl|my_center|LOCUS_02150 235167 235976 gene locus_tag LOCUS_02160 gene lgt 235167 235976 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289570.1 protein_id gnl|my_center|LOCUS_02160 235973 236437 gene locus_tag LOCUS_02170 235973 236437 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047671.1 protein_id gnl|my_center|LOCUS_02170 236450 237271 gene locus_tag LOCUS_02180 236450 237271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 237355 237813 gene locus_tag LOCUS_02190 gene mraZ 237355 237813 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625480.1 protein_id gnl|my_center|LOCUS_02190 237828 238784 gene locus_tag LOCUS_02200 gene rsmH 237828 238784 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861627.1 protein_id gnl|my_center|LOCUS_02200 238811 239269 gene locus_tag LOCUS_02210 238811 239269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 239522 241012 gene locus_tag LOCUS_02220 gene murE 239522 241012 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766313.1 protein_id gnl|my_center|LOCUS_02220 241012 242403 gene locus_tag LOCUS_02230 241012 242403 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943698.1 protein_id gnl|my_center|LOCUS_02230 242430 243404 gene locus_tag LOCUS_02240 gene mraY 242430 243404 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460699.1 protein_id gnl|my_center|LOCUS_02240 243406 244761 gene locus_tag LOCUS_02250 gene murD 243406 244761 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_02250 244791 245933 gene locus_tag LOCUS_02260 gene murG 244791 245933 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460696.1 protein_id gnl|my_center|LOCUS_02260 245950 247401 gene locus_tag LOCUS_02270 gene murC 245950 247401 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_02270 247456 248394 gene locus_tag LOCUS_02280 247456 248394 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546449.1 protein_id gnl|my_center|LOCUS_02280 248454 249212 gene locus_tag LOCUS_02290 248454 249212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 249243 249935 gene locus_tag LOCUS_02300 249243 249935 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485254.1 protein_id gnl|my_center|LOCUS_02300 249935 250264 gene locus_tag LOCUS_02310 249935 250264 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392367.1 protein_id gnl|my_center|LOCUS_02310 250401 251591 gene locus_tag LOCUS_02320 gene ftsA 250401 251591 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003485272.1 protein_id gnl|my_center|LOCUS_02320 251634 252701 gene locus_tag LOCUS_02330 gene ftsZ 251634 252701 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_02330 252917 254191 gene locus_tag LOCUS_02340 gene larA 252917 254191 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461442.1 protein_id gnl|my_center|LOCUS_02340 254399 255469 gene locus_tag LOCUS_02350 gene ftsZ 254399 255469 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_02350 256036 255521 gene locus_tag LOCUS_02360 256036 255521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 257214 256090 gene locus_tag LOCUS_02370 257214 256090 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393399.1 protein_id gnl|my_center|LOCUS_02370 258121 257219 gene locus_tag LOCUS_02380 258121 257219 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393400.1 protein_id gnl|my_center|LOCUS_02380 259017 258121 gene locus_tag LOCUS_02390 259017 258121 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393401.1 protein_id gnl|my_center|LOCUS_02390 259991 259014 gene locus_tag LOCUS_02400 259991 259014 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943449.1 protein_id gnl|my_center|LOCUS_02400 260575 259988 gene locus_tag LOCUS_02410 260575 259988 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940850.1 protein_id gnl|my_center|LOCUS_02410 261330 260671 gene locus_tag LOCUS_02420 261330 260671 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582682.1 protein_id gnl|my_center|LOCUS_02420 261629 262468 gene locus_tag LOCUS_02430 gene speE 261629 262468 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393316.1 protein_id gnl|my_center|LOCUS_02430 263607 262495 gene locus_tag LOCUS_02440 263607 262495 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 protein_id gnl|my_center|LOCUS_02440 263825 263751 gene locus_tag LOCUS_t00010 263825 263751 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 263905 263830 gene locus_tag LOCUS_t00020 263905 263830 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 264017 265669 gene locus_tag LOCUS_02450 264017 265669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 266307 265666 gene locus_tag LOCUS_02460 266307 265666 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583891.1 protein_id gnl|my_center|LOCUS_02460 266517 267455 gene locus_tag LOCUS_02470 266517 267455 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993980.1 protein_id gnl|my_center|LOCUS_02470 267586 267945 gene locus_tag LOCUS_02480 267586 267945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 268012 268086 gene locus_tag LOCUS_t00030 268012 268086 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 268284 272573 gene locus_tag LOCUS_02490 268284 272573 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081484.1 protein_id gnl|my_center|LOCUS_02490 272726 273634 gene locus_tag LOCUS_02500 272726 273634 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003071365.1 protein_id gnl|my_center|LOCUS_02500 273806 274282 gene locus_tag LOCUS_02510 273806 274282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 274420 276210 gene locus_tag LOCUS_02520 274420 276210 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963614.1 protein_id gnl|my_center|LOCUS_02520 276258 277328 gene locus_tag LOCUS_02530 gene hisC 276258 277328 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949115.1 protein_id gnl|my_center|LOCUS_02530 277408 278079 gene locus_tag LOCUS_02540 277408 278079 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545876.1 protein_id gnl|my_center|LOCUS_02540 278283 279452 gene locus_tag LOCUS_02550 278283 279452 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913616.1 protein_id gnl|my_center|LOCUS_02550 279561 280220 gene locus_tag LOCUS_02560 279561 280220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 280242 281156 gene locus_tag LOCUS_02570 280242 281156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02570 281179 282249 gene locus_tag LOCUS_02580 gene opuCA 281179 282249 CDS product osmoprotectant ABC transporter ATP-binding protein OpuCA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243370.1 protein_id gnl|my_center|LOCUS_02580 282263 282913 gene locus_tag LOCUS_02590 282263 282913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 283735 282968 gene locus_tag LOCUS_02600 283735 282968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 284037 284462 gene locus_tag LOCUS_02610 284037 284462 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418377.1 protein_id gnl|my_center|LOCUS_02610 284464 284877 gene locus_tag LOCUS_02620 284464 284877 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948808.1 protein_id gnl|my_center|LOCUS_02620 284918 285754 gene locus_tag LOCUS_02630 gene murI 284918 285754 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392055.1 protein_id gnl|my_center|LOCUS_02630 285785 286345 gene locus_tag LOCUS_02640 285785 286345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 286347 287015 gene locus_tag LOCUS_02650 286347 287015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392507.1 protein_id gnl|my_center|LOCUS_02650 287096 288073 gene locus_tag LOCUS_02660 287096 288073 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460939.1 protein_id gnl|my_center|LOCUS_02660 288142 288924 gene locus_tag LOCUS_02670 288142 288924 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460938.1 protein_id gnl|my_center|LOCUS_02670 288908 290575 gene locus_tag LOCUS_02680 288908 290575 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022839.1 protein_id gnl|my_center|LOCUS_02680 290572 291894 gene locus_tag LOCUS_02690 290572 291894 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022838.1 protein_id gnl|my_center|LOCUS_02690 291908 292651 gene locus_tag LOCUS_02700 gene rph 291908 292651 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392056.1 protein_id gnl|my_center|LOCUS_02700 292648 293256 gene locus_tag LOCUS_02710 292648 293256 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816920.1 protein_id gnl|my_center|LOCUS_02710 293262 293726 gene locus_tag LOCUS_02720 293262 293726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 293824 293900 gene locus_tag LOCUS_t00040 293824 293900 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 293937 294010 gene locus_tag LOCUS_t00050 293937 294010 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 294314 295609 gene locus_tag LOCUS_02730 gene larA 294314 295609 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461442.1 protein_id gnl|my_center|LOCUS_02730 295730 295805 gene locus_tag LOCUS_t00060 295730 295805 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 296444 296977 gene locus_tag LOCUS_02740 296444 296977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 297675 298082 gene locus_tag LOCUS_02750 297675 298082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 298166 298354 gene locus_tag LOCUS_02760 298166 298354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 >Feature sequence02 605 153 gene locus_tag LOCUS_02770 605 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492212.1 protein_id gnl|my_center|LOCUS_02770 1411 602 gene locus_tag LOCUS_02780 1411 602 CDS product DUF3100 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016874.1 protein_id gnl|my_center|LOCUS_02780 1590 2543 gene locus_tag LOCUS_02790 gene argC 1590 2543 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523123.1 protein_id gnl|my_center|LOCUS_02790 4660 2696 gene locus_tag LOCUS_02800 4660 2696 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256937.1 protein_id gnl|my_center|LOCUS_02800 5911 5072 gene locus_tag LOCUS_02810 5911 5072 CDS product family 1 encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881142.1 protein_id gnl|my_center|LOCUS_02810 6320 5967 gene locus_tag LOCUS_02820 6320 5967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 6534 7115 gene locus_tag LOCUS_02830 6534 7115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 7467 7183 gene locus_tag LOCUS_02840 7467 7183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 7682 7464 gene locus_tag LOCUS_02850 7682 7464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 9087 7744 gene locus_tag LOCUS_02860 9087 7744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 9636 9112 gene locus_tag LOCUS_02870 9636 9112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 11083 9779 gene locus_tag LOCUS_02880 11083 9779 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460406.1 protein_id gnl|my_center|LOCUS_02880 12808 11327 gene locus_tag LOCUS_02890 12808 11327 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_02890 13086 12883 gene locus_tag LOCUS_02900 13086 12883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 13527 13279 gene locus_tag LOCUS_02910 13527 13279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 14575 13607 gene locus_tag LOCUS_02920 gene galE 14575 13607 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929113.1 protein_id gnl|my_center|LOCUS_02920 14886 14602 gene locus_tag LOCUS_02930 14886 14602 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002300557.1 protein_id gnl|my_center|LOCUS_02930 15217 14879 gene locus_tag LOCUS_02940 15217 14879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 16192 15311 gene locus_tag LOCUS_02950 gene galU 16192 15311 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892053.1 protein_id gnl|my_center|LOCUS_02950 17582 16176 gene locus_tag LOCUS_02960 17582 16176 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_02960 18966 17584 gene locus_tag LOCUS_02970 18966 17584 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546227.1 protein_id gnl|my_center|LOCUS_02970 20349 19057 gene locus_tag LOCUS_02980 20349 19057 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814884.1 protein_id gnl|my_center|LOCUS_02980 20680 20384 gene locus_tag LOCUS_02990 20680 20384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 21421 20792 gene locus_tag LOCUS_03000 21421 20792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 21818 21645 gene locus_tag LOCUS_03010 21818 21645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 22237 21857 gene locus_tag LOCUS_03020 22237 21857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 22363 22839 gene locus_tag LOCUS_03030 22363 22839 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811322.1 protein_id gnl|my_center|LOCUS_03030 23547 26402 gene locus_tag LOCUS_03040 23547 26402 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272308.1 protein_id gnl|my_center|LOCUS_03040 28300 26399 gene locus_tag LOCUS_03050 gene asnB 28300 26399 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194643.1 protein_id gnl|my_center|LOCUS_03050 28992 28336 gene locus_tag LOCUS_03060 28992 28336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 32893 28985 gene locus_tag LOCUS_03070 32893 28985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03070 34682 32907 gene locus_tag LOCUS_03080 34682 32907 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528520.1 protein_id gnl|my_center|LOCUS_03080 36015 34699 gene locus_tag LOCUS_03090 36015 34699 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942599.1 protein_id gnl|my_center|LOCUS_03090 36961 36038 gene locus_tag LOCUS_03100 36961 36038 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_03100 38125 37019 gene locus_tag LOCUS_03110 gene gmd 38125 37019 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868774.1 protein_id gnl|my_center|LOCUS_03110 39086 38262 gene locus_tag LOCUS_03120 gene rfbD 39086 38262 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_03120 39660 39091 gene locus_tag LOCUS_03130 gene rfbC 39660 39091 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870350.1 protein_id gnl|my_center|LOCUS_03130 40550 39672 gene locus_tag LOCUS_03140 gene rfbA 40550 39672 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857508.1 protein_id gnl|my_center|LOCUS_03140 41495 40557 gene locus_tag LOCUS_03150 gene rfbB 41495 40557 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522250.1 protein_id gnl|my_center|LOCUS_03150 41433 41591 gene locus_tag LOCUS_03160 41433 41591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 41789 42571 gene locus_tag LOCUS_03170 41789 42571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 45393 43000 gene locus_tag LOCUS_03180 45393 43000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 48853 45494 gene locus_tag LOCUS_03190 48853 45494 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975001.1 protein_id gnl|my_center|LOCUS_03190 51342 49060 gene locus_tag LOCUS_03200 51342 49060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 55191 51499 gene locus_tag LOCUS_03210 55191 51499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 60204 55222 gene locus_tag LOCUS_03220 gene tpsA4 60204 55222 CDS product two-partner secretion system exoprotein TpsA4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115288.1 protein_id gnl|my_center|LOCUS_03220 61699 60485 gene locus_tag LOCUS_03230 61699 60485 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075901854.1 protein_id gnl|my_center|LOCUS_03230 65067 61696 gene locus_tag LOCUS_03240 65067 61696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 66460 65087 gene locus_tag LOCUS_03250 66460 65087 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966765.1 protein_id gnl|my_center|LOCUS_03250 68601 66463 gene locus_tag LOCUS_03260 68601 66463 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082901051.1 protein_id gnl|my_center|LOCUS_03260 70790 68631 gene locus_tag LOCUS_03270 70790 68631 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082901051.1 protein_id gnl|my_center|LOCUS_03270 75695 70914 gene locus_tag LOCUS_03280 75695 70914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 77166 75826 gene locus_tag LOCUS_03290 77166 75826 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107472.1 protein_id gnl|my_center|LOCUS_03290 78307 77180 gene locus_tag LOCUS_03300 78307 77180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 79367 78447 gene locus_tag LOCUS_03310 79367 78447 CDS product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 protein_id gnl|my_center|LOCUS_03310 80365 79397 gene locus_tag LOCUS_03320 80365 79397 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064007.1 protein_id gnl|my_center|LOCUS_03320 81385 80432 gene locus_tag LOCUS_03330 81385 80432 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795870.1 protein_id gnl|my_center|LOCUS_03330 82444 81419 gene locus_tag LOCUS_03340 82444 81419 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074269.1 protein_id gnl|my_center|LOCUS_03340 82931 82455 gene locus_tag LOCUS_03350 gene rfaE2 82931 82455 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896999.1 protein_id gnl|my_center|LOCUS_03350 83922 82912 gene locus_tag LOCUS_03360 gene rfaE1 83922 82912 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057610.1 protein_id gnl|my_center|LOCUS_03360 85328 83946 gene locus_tag LOCUS_03370 85328 83946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 88090 85391 gene locus_tag LOCUS_03380 88090 85391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 88190 89152 gene locus_tag LOCUS_03390 88190 89152 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064007.1 protein_id gnl|my_center|LOCUS_03390 90139 89216 gene locus_tag LOCUS_03400 90139 89216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 90595 90164 gene locus_tag LOCUS_03410 90595 90164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925185.1 protein_id gnl|my_center|LOCUS_03410 92023 90767 gene locus_tag LOCUS_03420 92023 90767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 92845 92429 gene locus_tag LOCUS_03430 gene ruvX 92845 92429 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920731.1 protein_id gnl|my_center|LOCUS_03430 94095 92845 gene locus_tag LOCUS_03440 94095 92845 CDS product DUF3084 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925128.1 protein_id gnl|my_center|LOCUS_03440 95240 94155 gene locus_tag LOCUS_03450 gene lptG 95240 94155 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870030.1 protein_id gnl|my_center|LOCUS_03450 96037 95318 gene locus_tag LOCUS_03460 gene lptB 96037 95318 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647567.1 protein_id gnl|my_center|LOCUS_03460 96849 96118 gene locus_tag LOCUS_03470 96849 96118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 97406 96846 gene locus_tag LOCUS_03480 97406 96846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 98299 97403 gene locus_tag LOCUS_03490 98299 97403 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869059.1 protein_id gnl|my_center|LOCUS_03490 98879 98334 gene locus_tag LOCUS_03500 98879 98334 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211252310.1 protein_id gnl|my_center|LOCUS_03500 99847 98879 gene locus_tag LOCUS_03510 99847 98879 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_03510 100696 99872 gene locus_tag LOCUS_03520 gene kdsA 100696 99872 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_03520 101519 100794 gene locus_tag LOCUS_03530 gene kdsB 101519 100794 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_03530 102694 101537 gene locus_tag LOCUS_03540 gene lpxK 102694 101537 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121336.1 protein_id gnl|my_center|LOCUS_03540 104017 102722 gene locus_tag LOCUS_03550 104017 102722 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_03550 105780 104050 gene locus_tag LOCUS_03560 105780 104050 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_03560 106928 105777 gene locus_tag LOCUS_03570 gene lpxB 106928 105777 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_03570 107762 106956 gene locus_tag LOCUS_03580 gene lpxI 107762 106956 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546653.1 protein_id gnl|my_center|LOCUS_03580 108599 107778 gene locus_tag LOCUS_03590 gene lpxA 108599 107778 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942904.1 protein_id gnl|my_center|LOCUS_03590 109202 108777 gene locus_tag LOCUS_03600 gene fabZ 109202 108777 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221796.1 protein_id gnl|my_center|LOCUS_03600 110048 109218 gene locus_tag LOCUS_03610 gene lpxC 110048 109218 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_03610 110991 110128 gene locus_tag LOCUS_03620 110991 110128 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869059.1 protein_id gnl|my_center|LOCUS_03620 111656 111024 gene locus_tag LOCUS_03630 111656 111024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 112767 111739 gene locus_tag LOCUS_03640 gene lpxD 112767 111739 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_03640 113232 112795 gene locus_tag LOCUS_03650 113232 112795 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869434.1 protein_id gnl|my_center|LOCUS_03650 114188 113256 gene locus_tag LOCUS_03660 114188 113256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 114841 114254 gene locus_tag LOCUS_03670 114841 114254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 116118 114838 gene locus_tag LOCUS_03680 116118 114838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 117953 116187 gene locus_tag LOCUS_03690 117953 116187 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925192.1 protein_id gnl|my_center|LOCUS_03690 118506 117973 gene locus_tag LOCUS_03700 118506 117973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 118651 118439 gene locus_tag LOCUS_03710 118651 118439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 119308 118667 gene locus_tag LOCUS_03720 119308 118667 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925428.1 protein_id gnl|my_center|LOCUS_03720 123706 119372 gene locus_tag LOCUS_03730 123706 119372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 125218 123863 gene locus_tag LOCUS_03740 125218 123863 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870255.1 protein_id gnl|my_center|LOCUS_03740 126588 125320 gene locus_tag LOCUS_03750 126588 125320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 127355 126585 gene locus_tag LOCUS_03760 127355 126585 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433117.1 protein_id gnl|my_center|LOCUS_03760 128163 127393 gene locus_tag LOCUS_03770 128163 127393 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920880.1 protein_id gnl|my_center|LOCUS_03770 130288 128486 gene locus_tag LOCUS_03780 130288 128486 CDS product SpoIVB peptidase S55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869562.1 protein_id gnl|my_center|LOCUS_03780 130614 130303 gene locus_tag LOCUS_03790 130614 130303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 132085 130661 gene locus_tag LOCUS_03800 132085 130661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 132566 132147 gene locus_tag LOCUS_03810 132566 132147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 133724 132606 gene locus_tag LOCUS_03820 133724 132606 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_03820 134471 133866 gene locus_tag LOCUS_03830 134471 133866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 135517 134525 gene locus_tag LOCUS_03840 135517 134525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 136307 135519 gene locus_tag LOCUS_03850 gene flgG 136307 135519 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_03850 137189 136440 gene locus_tag LOCUS_03860 gene flgF 137189 136440 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671871.1 protein_id gnl|my_center|LOCUS_03860 138321 137287 gene locus_tag LOCUS_03870 138321 137287 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393848.1 protein_id gnl|my_center|LOCUS_03870 139865 138603 gene locus_tag LOCUS_03880 gene murA 139865 138603 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393852.1 protein_id gnl|my_center|LOCUS_03880 140443 140030 gene locus_tag LOCUS_03890 140443 140030 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227688.1 protein_id gnl|my_center|LOCUS_03890 141856 140447 gene locus_tag LOCUS_03900 gene atpD 141856 140447 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_03900 142755 141895 gene locus_tag LOCUS_03910 gene atpG 142755 141895 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272788.1 protein_id gnl|my_center|LOCUS_03910 144303 142762 gene locus_tag LOCUS_03920 gene atpA 144303 142762 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_03920 144872 144306 gene locus_tag LOCUS_03930 gene atpH 144872 144306 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016338.1 protein_id gnl|my_center|LOCUS_03930 145369 144866 gene locus_tag LOCUS_03940 145369 144866 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019758.1 protein_id gnl|my_center|LOCUS_03940 145690 145439 gene locus_tag LOCUS_03950 145690 145439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 146446 145763 gene locus_tag LOCUS_03960 gene atpB 146446 145763 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768272.1 protein_id gnl|my_center|LOCUS_03960 146892 146503 gene locus_tag LOCUS_03970 146892 146503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 147175 146963 gene locus_tag LOCUS_03980 147175 146963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 148529 147363 gene locus_tag LOCUS_03990 gene wecB 148529 147363 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187374459.1 protein_id gnl|my_center|LOCUS_03990 149718 148699 gene locus_tag LOCUS_04000 149718 148699 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391762.1 protein_id gnl|my_center|LOCUS_04000 151087 149813 gene locus_tag LOCUS_04010 151087 149813 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_04010 152378 151089 gene locus_tag LOCUS_04020 152378 151089 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355958.1 protein_id gnl|my_center|LOCUS_04020 152740 152501 gene locus_tag LOCUS_04030 152740 152501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 153267 152824 gene locus_tag LOCUS_04040 153267 152824 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_04040 154254 153283 gene locus_tag LOCUS_04050 154254 153283 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459825.1 protein_id gnl|my_center|LOCUS_04050 154947 154318 gene locus_tag LOCUS_04060 154947 154318 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105281.1 protein_id gnl|my_center|LOCUS_04060 155456 155010 gene locus_tag LOCUS_04070 155456 155010 CDS product C-GCAxxG-C-C family (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813157.1 protein_id gnl|my_center|LOCUS_04070 156100 155474 gene locus_tag LOCUS_04080 gene upp 156100 155474 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815407.1 protein_id gnl|my_center|LOCUS_04080 157409 156174 gene locus_tag LOCUS_04090 157409 156174 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_04090 158009 157449 gene locus_tag LOCUS_04100 158009 157449 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678780.1 protein_id gnl|my_center|LOCUS_04100 158459 158016 gene locus_tag LOCUS_04110 gene rpiB 158459 158016 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952859.1 protein_id gnl|my_center|LOCUS_04110 158966 158496 gene locus_tag LOCUS_04120 158966 158496 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437844.1 protein_id gnl|my_center|LOCUS_04120 160063 159014 gene locus_tag LOCUS_04130 160063 159014 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393872.1 protein_id gnl|my_center|LOCUS_04130 160944 160078 gene locus_tag LOCUS_04140 gene prmC 160944 160078 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_04140 162013 160946 gene locus_tag LOCUS_04150 gene prfA 162013 160946 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_04150 162900 162013 gene locus_tag LOCUS_04160 162900 162013 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393875.1 protein_id gnl|my_center|LOCUS_04160 163162 162959 gene locus_tag LOCUS_04170 gene rpmE 163162 162959 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851603.1 protein_id gnl|my_center|LOCUS_04170 164491 163259 gene locus_tag LOCUS_04180 164491 163259 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941550.1 protein_id gnl|my_center|LOCUS_04180 165071 164514 gene locus_tag LOCUS_04190 gene pth 165071 164514 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254063.1 protein_id gnl|my_center|LOCUS_04190 165889 165068 gene locus_tag LOCUS_04200 165889 165068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 166534 165899 gene locus_tag LOCUS_04210 166534 165899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 167001 166633 gene locus_tag LOCUS_04220 gene trxA 167001 166633 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 protein_id gnl|my_center|LOCUS_04220 168251 167028 gene locus_tag LOCUS_04230 168251 167028 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461849.1 protein_id gnl|my_center|LOCUS_04230 170335 168338 gene locus_tag LOCUS_04240 170335 168338 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945510.1 protein_id gnl|my_center|LOCUS_04240 171734 170412 gene locus_tag LOCUS_04250 171734 170412 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044393502.1 protein_id gnl|my_center|LOCUS_04250 172202 172894 gene locus_tag LOCUS_04260 172202 172894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 174072 173002 gene locus_tag LOCUS_04270 174072 173002 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171355.1 protein_id gnl|my_center|LOCUS_04270 175341 174088 gene locus_tag LOCUS_04280 175341 174088 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807816.1 protein_id gnl|my_center|LOCUS_04280 175616 175401 gene locus_tag LOCUS_04290 175616 175401 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940368.1 protein_id gnl|my_center|LOCUS_04290 177268 175616 gene locus_tag LOCUS_04300 177268 175616 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940369.1 protein_id gnl|my_center|LOCUS_04300 179457 177511 gene locus_tag LOCUS_04310 179457 177511 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392246.1 protein_id gnl|my_center|LOCUS_04310 180519 179569 gene locus_tag LOCUS_04320 180519 179569 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814952.1 protein_id gnl|my_center|LOCUS_04320 181904 180537 gene locus_tag LOCUS_04330 gene glmU 181904 180537 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071041.1 protein_id gnl|my_center|LOCUS_04330 182828 182010 gene locus_tag LOCUS_04340 gene purR 182828 182010 CDS product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458918.1 protein_id gnl|my_center|LOCUS_04340 183750 182992 gene locus_tag LOCUS_04350 183750 182992 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391622.1 protein_id gnl|my_center|LOCUS_04350 184455 183772 gene locus_tag LOCUS_04360 184455 183772 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_04360 185335 184430 gene locus_tag LOCUS_04370 gene ispE 185335 184430 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772104.1 protein_id gnl|my_center|LOCUS_04370 185814 185332 gene locus_tag LOCUS_04380 185814 185332 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_04380 186786 185947 gene locus_tag LOCUS_04390 186786 185947 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393282.1 protein_id gnl|my_center|LOCUS_04390 187364 186918 gene locus_tag LOCUS_04400 187364 186918 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816962.1 protein_id gnl|my_center|LOCUS_04400 188877 187357 gene locus_tag LOCUS_04410 188877 187357 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816964.1 protein_id gnl|my_center|LOCUS_04410 189941 188952 gene locus_tag LOCUS_04420 189941 188952 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816965.1 protein_id gnl|my_center|LOCUS_04420 190489 191322 gene locus_tag LOCUS_04430 190489 191322 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356230.1 protein_id gnl|my_center|LOCUS_04430 192209 191355 gene locus_tag LOCUS_04440 gene rsmA 192209 191355 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226751.1 protein_id gnl|my_center|LOCUS_04440 192748 192206 gene locus_tag LOCUS_04450 gene rnmV 192748 192206 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437901.1 protein_id gnl|my_center|LOCUS_04450 193891 192887 gene locus_tag LOCUS_04460 193891 192887 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768275.1 protein_id gnl|my_center|LOCUS_04460 194855 194085 gene locus_tag LOCUS_04470 194855 194085 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 protein_id gnl|my_center|LOCUS_04470 196792 194852 gene locus_tag LOCUS_04480 gene metG 196792 194852 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391596.1 protein_id gnl|my_center|LOCUS_04480 197048 197302 gene locus_tag LOCUS_04490 197048 197302 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391595.1 protein_id gnl|my_center|LOCUS_04490 198219 197365 gene locus_tag LOCUS_04500 gene rsmI 198219 197365 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391594.1 protein_id gnl|my_center|LOCUS_04500 198979 198233 gene locus_tag LOCUS_04510 198979 198233 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087456344.1 protein_id gnl|my_center|LOCUS_04510 199799 198981 gene locus_tag LOCUS_04520 199799 198981 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221433.1 protein_id gnl|my_center|LOCUS_04520 200803 199844 gene locus_tag LOCUS_04530 gene holB 200803 199844 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_04530 201271 200825 gene locus_tag LOCUS_04540 201271 200825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 202067 201381 gene locus_tag LOCUS_04550 202067 201381 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947925.1 protein_id gnl|my_center|LOCUS_04550 203553 202087 gene locus_tag LOCUS_04560 203553 202087 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048125.1 protein_id gnl|my_center|LOCUS_04560 206554 203699 gene locus_tag LOCUS_04570 206554 203699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 207016 206675 gene locus_tag LOCUS_04580 207016 206675 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660457.1 protein_id gnl|my_center|LOCUS_04580 208059 207019 gene locus_tag LOCUS_04590 208059 207019 CDS product DUF4392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_159135634.1 protein_id gnl|my_center|LOCUS_04590 209193 208060 gene locus_tag LOCUS_04600 209193 208060 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392489.1 protein_id gnl|my_center|LOCUS_04600 210423 209212 gene locus_tag LOCUS_04610 210423 209212 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259630.1 protein_id gnl|my_center|LOCUS_04610 211726 210389 gene locus_tag LOCUS_04620 211726 210389 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939396.1 protein_id gnl|my_center|LOCUS_04620 213454 211733 gene locus_tag LOCUS_04630 213454 211733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435136.1 protein_id gnl|my_center|LOCUS_04630 214759 213593 gene locus_tag LOCUS_04640 214759 213593 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329265.1 protein_id gnl|my_center|LOCUS_04640 215394 214963 gene locus_tag LOCUS_04650 215394 214963 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853782.1 protein_id gnl|my_center|LOCUS_04650 216227 215457 gene locus_tag LOCUS_04660 216227 215457 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018701913.1 protein_id gnl|my_center|LOCUS_04660 217706 216411 gene locus_tag LOCUS_04670 gene dctA 217706 216411 CDS product C4-dicarboxylate transporter DctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858214.1 protein_id gnl|my_center|LOCUS_04670 218138 219001 gene locus_tag LOCUS_04680 218138 219001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 219931 219077 gene locus_tag LOCUS_04690 219931 219077 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816050.1 protein_id gnl|my_center|LOCUS_04690 221227 220046 gene locus_tag LOCUS_04700 221227 220046 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666204.1 protein_id gnl|my_center|LOCUS_04700 222904 221351 gene locus_tag LOCUS_04710 222904 221351 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_04710 224289 223336 gene locus_tag LOCUS_04720 224289 223336 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067939.1 protein_id gnl|my_center|LOCUS_04720 225873 224464 gene locus_tag LOCUS_04730 225873 224464 CDS product TIGR00366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246984.1 protein_id gnl|my_center|LOCUS_04730 227639 226260 gene locus_tag LOCUS_04740 gene gltA 227639 226260 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393026.1 protein_id gnl|my_center|LOCUS_04740 228475 227627 gene locus_tag LOCUS_04750 228475 227627 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 protein_id gnl|my_center|LOCUS_04750 229961 228567 gene locus_tag LOCUS_04760 gene atoC 229961 228567 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125281.1 protein_id gnl|my_center|LOCUS_04760 231467 229968 gene locus_tag LOCUS_04770 231467 229968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 232667 231666 gene locus_tag LOCUS_04780 gene aroF 232667 231666 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964210.1 protein_id gnl|my_center|LOCUS_04780 233543 232728 gene locus_tag LOCUS_04790 gene trpA 233543 232728 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392849.1 protein_id gnl|my_center|LOCUS_04790 234729 233545 gene locus_tag LOCUS_04800 gene trpB 234729 233545 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943010.1 protein_id gnl|my_center|LOCUS_04800 235294 234719 gene locus_tag LOCUS_04810 235294 234719 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392851.1 protein_id gnl|my_center|LOCUS_04810 236118 235336 gene locus_tag LOCUS_04820 gene trpC 236118 235336 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392852.1 protein_id gnl|my_center|LOCUS_04820 237136 236120 gene locus_tag LOCUS_04830 gene trpD 237136 236120 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_04830 237708 237136 gene locus_tag LOCUS_04840 237708 237136 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545428.1 protein_id gnl|my_center|LOCUS_04840 239165 237705 gene locus_tag LOCUS_04850 gene trpE 239165 237705 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392855.1 protein_id gnl|my_center|LOCUS_04850 240352 239669 gene locus_tag LOCUS_04860 gene modB 240352 239669 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815806.1 protein_id gnl|my_center|LOCUS_04860 241193 240393 gene locus_tag LOCUS_04870 gene modA 241193 240393 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031846.1 protein_id gnl|my_center|LOCUS_04870 241384 242316 gene locus_tag LOCUS_04880 241384 242316 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461082.1 protein_id gnl|my_center|LOCUS_04880 243187 242666 gene locus_tag LOCUS_04890 243187 242666 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942116.1 protein_id gnl|my_center|LOCUS_04890 244002 243184 gene locus_tag LOCUS_04900 244002 243184 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942115.1 protein_id gnl|my_center|LOCUS_04900 245147 243999 gene locus_tag LOCUS_04910 245147 243999 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869713.1 protein_id gnl|my_center|LOCUS_04910 245344 245144 gene locus_tag LOCUS_04920 245344 245144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 246436 245513 gene locus_tag LOCUS_04930 246436 245513 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878705.1 protein_id gnl|my_center|LOCUS_04930 246693 248249 gene locus_tag LOCUS_04940 246693 248249 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810284.1 protein_id gnl|my_center|LOCUS_04940 248448 249269 gene locus_tag LOCUS_04950 248448 249269 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_04950 249291 250238 gene locus_tag LOCUS_04960 249291 250238 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807688.1 protein_id gnl|my_center|LOCUS_04960 250271 251599 gene locus_tag LOCUS_04970 250271 251599 CDS product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071598.1 protein_id gnl|my_center|LOCUS_04970 252058 251684 gene locus_tag LOCUS_04980 252058 251684 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815873.1 protein_id gnl|my_center|LOCUS_04980 252563 252039 gene locus_tag LOCUS_04990 252563 252039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 253178 252600 gene locus_tag LOCUS_05000 253178 252600 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021975.1 protein_id gnl|my_center|LOCUS_05000 253350 253919 gene locus_tag LOCUS_05010 253350 253919 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_05010 256674 253981 gene locus_tag LOCUS_05020 gene fdhF 256674 253981 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 transl_except (pos:complement(255622..255624),aa:Sec) note codon on position 351 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_05020 257079 256873 gene locus_tag LOCUS_05030 257079 256873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 258152 257082 gene locus_tag LOCUS_05040 gene yedE 258152 257082 CDS product YedE family putative selenium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392953.1 protein_id gnl|my_center|LOCUS_05040 258302 259222 gene locus_tag LOCUS_05050 258302 259222 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943159.1 protein_id gnl|my_center|LOCUS_05050 259818 259363 gene locus_tag LOCUS_05060 259818 259363 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545419.1 protein_id gnl|my_center|LOCUS_05060 260919 259846 gene locus_tag LOCUS_05070 260919 259846 CDS product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963754.1 protein_id gnl|my_center|LOCUS_05070 262358 261369 gene locus_tag LOCUS_05080 262358 261369 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461738.1 protein_id gnl|my_center|LOCUS_05080 263733 262351 gene locus_tag LOCUS_05090 gene rmuC 263733 262351 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460041.1 protein_id gnl|my_center|LOCUS_05090 264779 264042 gene locus_tag LOCUS_05100 264779 264042 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460169.1 protein_id gnl|my_center|LOCUS_05100 265091 264804 gene locus_tag LOCUS_05110 265091 264804 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891186.1 protein_id gnl|my_center|LOCUS_05110 266283 265120 gene locus_tag LOCUS_05120 266283 265120 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460067.1 protein_id gnl|my_center|LOCUS_05120 266579 268504 gene locus_tag LOCUS_05130 266579 268504 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392246.1 protein_id gnl|my_center|LOCUS_05130 268725 270308 gene locus_tag LOCUS_05140 268725 270308 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232344.1 protein_id gnl|my_center|LOCUS_05140 270470 271852 gene locus_tag LOCUS_05150 270470 271852 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048439.1 protein_id gnl|my_center|LOCUS_05150 >Feature sequence03 1769 120 gene locus_tag LOCUS_05160 1769 120 CDS product lactate permease LctP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940541.1 protein_id gnl|my_center|LOCUS_05160 4609 2117 gene locus_tag LOCUS_05170 gene leuS 4609 2117 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_05170 5017 5289 gene locus_tag LOCUS_05180 5017 5289 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422948.1 protein_id gnl|my_center|LOCUS_05180 5988 5281 gene locus_tag LOCUS_05190 5988 5281 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393330.1 protein_id gnl|my_center|LOCUS_05190 6540 5998 gene locus_tag LOCUS_05200 6540 5998 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269072.1 protein_id gnl|my_center|LOCUS_05200 6681 7511 gene locus_tag LOCUS_05210 gene lgt 6681 7511 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461890.1 protein_id gnl|my_center|LOCUS_05210 7619 8974 gene locus_tag LOCUS_05220 7619 8974 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545342.1 protein_id gnl|my_center|LOCUS_05220 8977 10281 gene locus_tag LOCUS_05230 8977 10281 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461049.1 protein_id gnl|my_center|LOCUS_05230 11026 10658 gene locus_tag LOCUS_05240 11026 10658 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462292.1 protein_id gnl|my_center|LOCUS_05240 11439 11062 gene locus_tag LOCUS_05250 gene crcB 11439 11062 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941171.1 protein_id gnl|my_center|LOCUS_05250 11812 11465 gene locus_tag LOCUS_05260 11812 11465 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085423.1 protein_id gnl|my_center|LOCUS_05260 12574 11849 gene locus_tag LOCUS_05270 12574 11849 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941404.1 protein_id gnl|my_center|LOCUS_05270 14094 12589 gene locus_tag LOCUS_05280 14094 12589 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272520.1 protein_id gnl|my_center|LOCUS_05280 15566 14100 gene locus_tag LOCUS_05290 15566 14100 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460862.1 protein_id gnl|my_center|LOCUS_05290 16198 15572 gene locus_tag LOCUS_05300 16198 15572 CDS product hydrogenase-4 component E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027548289.1 protein_id gnl|my_center|LOCUS_05300 17120 16218 gene locus_tag LOCUS_05310 17120 16218 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089080.1 protein_id gnl|my_center|LOCUS_05310 19145 17124 gene locus_tag LOCUS_05320 gene hyfB 19145 17124 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393678.1 protein_id gnl|my_center|LOCUS_05320 20853 19249 gene locus_tag LOCUS_05330 20853 19249 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_05330 21962 20850 gene locus_tag LOCUS_05340 21962 20850 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173644.1 protein_id gnl|my_center|LOCUS_05340 22864 21992 gene locus_tag LOCUS_05350 22864 21992 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878808.1 protein_id gnl|my_center|LOCUS_05350 23020 23925 gene locus_tag LOCUS_05360 23020 23925 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425747.1 protein_id gnl|my_center|LOCUS_05360 24564 23989 gene locus_tag LOCUS_05370 24564 23989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05370 25166 24597 gene locus_tag LOCUS_05380 25166 24597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05380 26910 25792 gene locus_tag LOCUS_05390 26910 25792 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_05390 27421 26912 gene locus_tag LOCUS_05400 27421 26912 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459578.1 protein_id gnl|my_center|LOCUS_05400 27502 31512 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttacattccagtatggtcagattaaaac 31977 31699 gene locus_tag LOCUS_05410 gene cas2 31977 31699 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903132.1 protein_id gnl|my_center|LOCUS_05410 32980 31988 gene locus_tag LOCUS_05420 gene cas1b 32980 31988 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896423.1 protein_id gnl|my_center|LOCUS_05420 33480 32992 gene locus_tag LOCUS_05430 gene cas4 33480 32992 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016964.1 protein_id gnl|my_center|LOCUS_05430 35780 33498 gene locus_tag LOCUS_05440 35780 33498 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861769.1 protein_id gnl|my_center|LOCUS_05440 36564 35833 gene locus_tag LOCUS_05450 gene cas5b 36564 35833 CDS product type I-B CRISPR-associated protein Cas5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439785.1 protein_id gnl|my_center|LOCUS_05450 37415 36561 gene locus_tag LOCUS_05460 gene cas7i 37415 36561 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861770.1 protein_id gnl|my_center|LOCUS_05460 39034 37415 gene locus_tag LOCUS_05470 39034 37415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 39773 39039 gene locus_tag LOCUS_05480 gene cas6 39773 39039 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016969.1 protein_id gnl|my_center|LOCUS_05480 40860 39835 gene locus_tag LOCUS_05490 40860 39835 CDS product WYL domain-containing transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582487.1 protein_id gnl|my_center|LOCUS_05490 43797 41368 gene locus_tag LOCUS_05500 43797 41368 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003185.1 protein_id gnl|my_center|LOCUS_05500 44109 43840 gene locus_tag LOCUS_05510 44109 43840 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460331.1 protein_id gnl|my_center|LOCUS_05510 44508 44233 gene locus_tag LOCUS_05520 44508 44233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 44782 46125 gene locus_tag LOCUS_05530 44782 46125 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393686.1 protein_id gnl|my_center|LOCUS_05530 46112 46933 gene locus_tag LOCUS_05540 gene ccsB 46112 46933 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944563.1 protein_id gnl|my_center|LOCUS_05540 46964 47452 gene locus_tag LOCUS_05550 46964 47452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 47445 48734 gene locus_tag LOCUS_05560 47445 48734 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810724.1 protein_id gnl|my_center|LOCUS_05560 49078 48755 gene locus_tag LOCUS_05570 49078 48755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 49726 49145 gene locus_tag LOCUS_05580 49726 49145 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986737.1 protein_id gnl|my_center|LOCUS_05580 50078 49746 gene locus_tag LOCUS_05590 50078 49746 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245961.1 protein_id gnl|my_center|LOCUS_05590 50540 50130 gene locus_tag LOCUS_05600 50540 50130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 50826 50578 gene locus_tag LOCUS_05610 50826 50578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 51287 50964 gene locus_tag LOCUS_05620 51287 50964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 51984 51277 gene locus_tag LOCUS_05630 51984 51277 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563843.1 protein_id gnl|my_center|LOCUS_05630 52927 52013 gene locus_tag LOCUS_05640 52927 52013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 54398 53034 gene locus_tag LOCUS_05650 54398 53034 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139328014.1 protein_id gnl|my_center|LOCUS_05650 56533 54398 gene locus_tag LOCUS_05660 56533 54398 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045029.1 protein_id gnl|my_center|LOCUS_05660 57084 56734 gene locus_tag LOCUS_05670 57084 56734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 58852 57902 gene locus_tag LOCUS_05680 58852 57902 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107441.1 protein_id gnl|my_center|LOCUS_05680 59536 58904 gene locus_tag LOCUS_05690 59536 58904 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903260.1 protein_id gnl|my_center|LOCUS_05690 60744 59590 gene locus_tag LOCUS_05700 60744 59590 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891610.1 protein_id gnl|my_center|LOCUS_05700 61888 60950 gene locus_tag LOCUS_05710 gene fabK 61888 60950 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419125.1 protein_id gnl|my_center|LOCUS_05710 63143 61935 gene locus_tag LOCUS_05720 gene ilvA 63143 61935 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_05720 63438 63220 gene locus_tag LOCUS_05730 63438 63220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 64635 63610 gene locus_tag LOCUS_05740 64635 63610 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392449.1 protein_id gnl|my_center|LOCUS_05740 65193 64876 gene locus_tag LOCUS_05750 gene trxA 65193 64876 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871903.1 protein_id gnl|my_center|LOCUS_05750 66132 65215 gene locus_tag LOCUS_05760 gene trxB 66132 65215 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357780.1 protein_id gnl|my_center|LOCUS_05760 68121 66256 gene locus_tag LOCUS_05770 68121 66256 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813245.1 protein_id gnl|my_center|LOCUS_05770 69671 68151 gene locus_tag LOCUS_05780 69671 68151 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306203.1 protein_id gnl|my_center|LOCUS_05780 70641 69994 gene locus_tag LOCUS_05790 70641 69994 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461732.1 protein_id gnl|my_center|LOCUS_05790 71289 70729 gene locus_tag LOCUS_05800 71289 70729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 72897 71353 gene locus_tag LOCUS_05810 72897 71353 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393817.1 protein_id gnl|my_center|LOCUS_05810 74049 73195 gene locus_tag LOCUS_05820 74049 73195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 74576 74277 gene locus_tag LOCUS_05830 74576 74277 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018860.1 protein_id gnl|my_center|LOCUS_05830 75254 74604 gene locus_tag LOCUS_05840 75254 74604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 75943 75509 gene locus_tag LOCUS_05850 75943 75509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 76420 76025 gene locus_tag LOCUS_05860 76420 76025 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965859.1 protein_id gnl|my_center|LOCUS_05860 76661 76924 gene locus_tag LOCUS_05870 76661 76924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 77452 78750 gene locus_tag LOCUS_05880 77452 78750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 82263 78856 gene locus_tag LOCUS_05890 82263 78856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 83951 82278 gene locus_tag LOCUS_05900 83951 82278 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816941.1 protein_id gnl|my_center|LOCUS_05900 85772 84303 gene locus_tag LOCUS_05910 85772 84303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 87838 85895 gene locus_tag LOCUS_05920 87838 85895 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964362.1 protein_id gnl|my_center|LOCUS_05920 88472 87879 gene locus_tag LOCUS_05930 88472 87879 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529007.1 protein_id gnl|my_center|LOCUS_05930 89450 88599 gene locus_tag LOCUS_05940 89450 88599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244492.1 protein_id gnl|my_center|LOCUS_05940 90416 89535 gene locus_tag LOCUS_05950 90416 89535 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812339.1 protein_id gnl|my_center|LOCUS_05950 91640 90603 gene locus_tag LOCUS_05960 91640 90603 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048235.1 protein_id gnl|my_center|LOCUS_05960 92479 91637 gene locus_tag LOCUS_05970 92479 91637 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546330.1 protein_id gnl|my_center|LOCUS_05970 93634 92483 gene locus_tag LOCUS_05980 93634 92483 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_05980 94409 94005 gene locus_tag LOCUS_05990 94409 94005 CDS product DUF4332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946351.1 protein_id gnl|my_center|LOCUS_05990 94702 94454 gene locus_tag LOCUS_06000 94702 94454 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386738.1 protein_id gnl|my_center|LOCUS_06000 94902 95759 gene locus_tag LOCUS_06010 94902 95759 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922125.1 protein_id gnl|my_center|LOCUS_06010 96364 95870 gene locus_tag LOCUS_06020 96364 95870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 97381 96419 gene locus_tag LOCUS_06030 97381 96419 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814952.1 protein_id gnl|my_center|LOCUS_06030 99940 97532 gene locus_tag LOCUS_06040 gene ligD 99940 97532 CDS product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113639.1 protein_id gnl|my_center|LOCUS_06040 100860 99952 gene locus_tag LOCUS_06050 100860 99952 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113644.1 protein_id gnl|my_center|LOCUS_06050 102331 100961 gene locus_tag LOCUS_06060 102331 100961 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877907.1 protein_id gnl|my_center|LOCUS_06060 103016 102693 gene locus_tag LOCUS_06070 103016 102693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 103986 103294 gene locus_tag LOCUS_06080 103986 103294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 104377 104304 gene locus_tag LOCUS_t00070 104377 104304 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 105019 104762 gene locus_tag LOCUS_06090 105019 104762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 105475 105293 gene locus_tag LOCUS_06100 105475 105293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 105709 107070 gene locus_tag LOCUS_06110 105709 107070 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227900.1 protein_id gnl|my_center|LOCUS_06110 107857 107381 gene locus_tag LOCUS_06120 107857 107381 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460983.1 protein_id gnl|my_center|LOCUS_06120 108484 107909 gene locus_tag LOCUS_06130 gene cap8M 108484 107909 CDS product type 8 capsular polysaccharide synthesis protein Cap8M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825098.1 protein_id gnl|my_center|LOCUS_06130 109915 108785 gene locus_tag LOCUS_06140 gene wecB 109915 108785 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202262.1 protein_id gnl|my_center|LOCUS_06140 111026 109917 gene locus_tag LOCUS_06150 111026 109917 CDS product capsular polysaccharide biosynthesis protein CapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202261.1 protein_id gnl|my_center|LOCUS_06150 112048 111023 gene locus_tag LOCUS_06160 gene cap8E 112048 111023 CDS product type 8 capsular polysaccharide synthesis protein Cap8E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459062.1 protein_id gnl|my_center|LOCUS_06160 113041 112067 gene locus_tag LOCUS_06170 113041 112067 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003029668.1 protein_id gnl|my_center|LOCUS_06170 114386 113067 gene locus_tag LOCUS_06180 114386 113067 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022298.1 protein_id gnl|my_center|LOCUS_06180 115698 114478 gene locus_tag LOCUS_06190 115698 114478 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107346.1 protein_id gnl|my_center|LOCUS_06190 116616 115774 gene locus_tag LOCUS_06200 116616 115774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 118133 116706 gene locus_tag LOCUS_06210 118133 116706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 118722 118216 gene locus_tag LOCUS_06220 118722 118216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 119776 118724 gene locus_tag LOCUS_06230 119776 118724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 120873 119782 gene locus_tag LOCUS_06240 gene pseC 120873 119782 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_06240 121973 120873 gene locus_tag LOCUS_06250 121973 120873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 123007 121982 gene locus_tag LOCUS_06260 123007 121982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 124239 123094 gene locus_tag LOCUS_06270 124239 123094 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221646.1 protein_id gnl|my_center|LOCUS_06270 125440 124241 gene locus_tag LOCUS_06280 125440 124241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 126689 125421 gene locus_tag LOCUS_06290 126689 125421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 128151 126961 gene locus_tag LOCUS_06300 128151 126961 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107242.1 protein_id gnl|my_center|LOCUS_06300 129305 128247 gene locus_tag LOCUS_06310 129305 128247 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975598.1 protein_id gnl|my_center|LOCUS_06310 130277 129387 gene locus_tag LOCUS_06320 130277 129387 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921254.1 protein_id gnl|my_center|LOCUS_06320 130800 130663 gene locus_tag LOCUS_06330 130800 130663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 132771 130852 gene locus_tag LOCUS_06340 132771 130852 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272023.1 protein_id gnl|my_center|LOCUS_06340 133622 132936 gene locus_tag LOCUS_06350 133622 132936 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467944.1 protein_id gnl|my_center|LOCUS_06350 135111 133642 gene locus_tag LOCUS_06360 135111 133642 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 protein_id gnl|my_center|LOCUS_06360 135847 135167 gene locus_tag LOCUS_06370 135847 135167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 136996 136205 gene locus_tag LOCUS_06380 136996 136205 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099684015.1 protein_id gnl|my_center|LOCUS_06380 137994 137749 gene locus_tag LOCUS_06390 137994 137749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 138507 138214 gene locus_tag LOCUS_06400 138507 138214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 138892 138416 gene locus_tag LOCUS_06410 138892 138416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 142079 139416 gene locus_tag LOCUS_06420 142079 139416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 142324 142076 gene locus_tag LOCUS_06430 142324 142076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 142520 142329 gene locus_tag LOCUS_06440 142520 142329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 142635 143687 gene locus_tag LOCUS_06450 142635 143687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 143879 145123 gene locus_tag LOCUS_06460 143879 145123 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006906966.1 protein_id gnl|my_center|LOCUS_06460 145326 145251 gene locus_tag LOCUS_t00080 145326 145251 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 146343 145420 gene locus_tag LOCUS_06470 146343 145420 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886474.1 protein_id gnl|my_center|LOCUS_06470 146694 146344 gene locus_tag LOCUS_06480 gene rsfS 146694 146344 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_06480 147781 146783 gene locus_tag LOCUS_06490 147781 146783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 148376 147774 gene locus_tag LOCUS_06500 gene yqeK 148376 147774 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392103.1 protein_id gnl|my_center|LOCUS_06500 148511 148383 gene locus_tag LOCUS_06510 148511 148383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 149125 148508 gene locus_tag LOCUS_06520 gene nadD 149125 148508 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392101.1 protein_id gnl|my_center|LOCUS_06520 149493 149326 gene locus_tag LOCUS_06530 149493 149326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 150703 149486 gene locus_tag LOCUS_06540 150703 149486 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_06540 151392 150685 gene locus_tag LOCUS_06550 151392 150685 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404917.1 protein_id gnl|my_center|LOCUS_06550 152503 151409 gene locus_tag LOCUS_06560 152503 151409 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 protein_id gnl|my_center|LOCUS_06560 153914 152658 gene locus_tag LOCUS_06570 153914 152658 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_06570 155070 153943 gene locus_tag LOCUS_06580 gene proB 155070 153943 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392099.1 protein_id gnl|my_center|LOCUS_06580 155377 155090 gene locus_tag LOCUS_06590 gene yhbY 155377 155090 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460893.1 protein_id gnl|my_center|LOCUS_06590 156801 155530 gene locus_tag LOCUS_06600 gene obgE 156801 155530 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_06600 157062 156841 gene locus_tag LOCUS_06610 157062 156841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 157513 157214 gene locus_tag LOCUS_06620 gene rpmA 157513 157214 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053095207.1 protein_id gnl|my_center|LOCUS_06620 157841 157521 gene locus_tag LOCUS_06630 157841 157521 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633692.1 protein_id gnl|my_center|LOCUS_06630 158161 157850 gene locus_tag LOCUS_06640 gene rplU 158161 157850 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419082.1 protein_id gnl|my_center|LOCUS_06640 159739 158300 gene locus_tag LOCUS_06650 159739 158300 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392093.1 protein_id gnl|my_center|LOCUS_06650 160443 159736 gene locus_tag LOCUS_06660 160443 159736 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460898.1 protein_id gnl|my_center|LOCUS_06660 162295 160436 gene locus_tag LOCUS_06670 162295 160436 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460899.1 protein_id gnl|my_center|LOCUS_06670 163474 162368 gene locus_tag LOCUS_06680 gene rodA 163474 162368 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392081.1 protein_id gnl|my_center|LOCUS_06680 163867 163589 gene locus_tag LOCUS_06690 gene minE 163867 163589 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816777.1 protein_id gnl|my_center|LOCUS_06690 164672 163881 gene locus_tag LOCUS_06700 gene minD 164672 163881 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816779.1 protein_id gnl|my_center|LOCUS_06700 165338 164688 gene locus_tag LOCUS_06710 gene minC 165338 164688 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816782.1 protein_id gnl|my_center|LOCUS_06710 167273 165438 gene locus_tag LOCUS_06720 gene mrdA 167273 165438 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_06720 167802 167314 gene locus_tag LOCUS_06730 167802 167314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 168659 167799 gene locus_tag LOCUS_06740 gene mreC 168659 167799 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392075.1 protein_id gnl|my_center|LOCUS_06740 169730 168675 gene locus_tag LOCUS_06750 169730 168675 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392074.1 protein_id gnl|my_center|LOCUS_06750 170481 169780 gene locus_tag LOCUS_06760 gene radC 170481 169780 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392073.1 protein_id gnl|my_center|LOCUS_06760 171047 170478 gene locus_tag LOCUS_06770 171047 170478 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142709.1 protein_id gnl|my_center|LOCUS_06770 171332 171060 gene locus_tag LOCUS_06780 171332 171060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 171913 171407 gene locus_tag LOCUS_06790 171913 171407 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399375.1 protein_id gnl|my_center|LOCUS_06790 172336 171926 gene locus_tag LOCUS_06800 172336 171926 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272275.1 protein_id gnl|my_center|LOCUS_06800 173362 172472 gene locus_tag LOCUS_06810 173362 172472 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355995.1 protein_id gnl|my_center|LOCUS_06810 173968 173387 gene locus_tag LOCUS_06820 gene rsxA 173968 173387 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_06820 174612 173968 gene locus_tag LOCUS_06830 174612 173968 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869098.1 protein_id gnl|my_center|LOCUS_06830 175181 174624 gene locus_tag LOCUS_06840 175181 174624 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_06840 176192 175188 gene locus_tag LOCUS_06850 176192 175188 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015691.1 protein_id gnl|my_center|LOCUS_06850 177523 176204 gene locus_tag LOCUS_06860 gene rsxC 177523 176204 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_06860 178009 177593 gene locus_tag LOCUS_06870 178009 177593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 178451 178185 gene locus_tag LOCUS_06880 178451 178185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 180037 178646 gene locus_tag LOCUS_06890 180037 178646 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022819390.1 protein_id gnl|my_center|LOCUS_06890 180932 180150 gene locus_tag LOCUS_06900 180932 180150 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_06900 181395 180949 gene locus_tag LOCUS_06910 181395 180949 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067916.1 protein_id gnl|my_center|LOCUS_06910 183000 181420 gene locus_tag LOCUS_06920 183000 181420 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_06920 184259 183066 gene locus_tag LOCUS_06930 184259 183066 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048235.1 protein_id gnl|my_center|LOCUS_06930 185063 184278 gene locus_tag LOCUS_06940 185063 184278 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965997.1 protein_id gnl|my_center|LOCUS_06940 186243 185107 gene locus_tag LOCUS_06950 186243 185107 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_06950 186560 186360 gene locus_tag LOCUS_06960 186560 186360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 188386 186605 gene locus_tag LOCUS_06970 188386 186605 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459194.1 protein_id gnl|my_center|LOCUS_06970 189174 188491 gene locus_tag LOCUS_06980 189174 188491 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933918.1 protein_id gnl|my_center|LOCUS_06980 190386 189250 gene locus_tag LOCUS_06990 190386 189250 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_06990 191863 190589 gene locus_tag LOCUS_07000 191863 190589 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986138.1 protein_id gnl|my_center|LOCUS_07000 193077 191971 gene locus_tag LOCUS_07010 193077 191971 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263229.1 protein_id gnl|my_center|LOCUS_07010 193568 193170 gene locus_tag LOCUS_07020 193568 193170 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869046.1 protein_id gnl|my_center|LOCUS_07020 193852 193598 gene locus_tag LOCUS_07030 193852 193598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 195414 193885 gene locus_tag LOCUS_07040 195414 193885 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_07040 196192 195551 gene locus_tag LOCUS_07050 196192 195551 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966000.1 protein_id gnl|my_center|LOCUS_07050 198065 196341 gene locus_tag LOCUS_07060 198065 196341 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_07060 199882 198092 gene locus_tag LOCUS_07070 gene nuoF 199882 198092 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_07070 200275 199910 gene locus_tag LOCUS_07080 200275 199910 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_07080 200825 200262 gene locus_tag LOCUS_07090 200825 200262 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869297.1 protein_id gnl|my_center|LOCUS_07090 201322 200831 gene locus_tag LOCUS_07100 gene nuoE 201322 200831 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_07100 202120 201377 gene locus_tag LOCUS_07110 202120 201377 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869446.1 protein_id gnl|my_center|LOCUS_07110 202458 202117 gene locus_tag LOCUS_07120 202458 202117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 203840 202455 gene locus_tag LOCUS_07130 203840 202455 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_07130 204284 203871 gene locus_tag LOCUS_07140 204284 203871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 204663 204295 gene locus_tag LOCUS_07150 204663 204295 CDS product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583275.1 protein_id gnl|my_center|LOCUS_07150 206071 204923 gene locus_tag LOCUS_07160 206071 204923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 207614 206322 gene locus_tag LOCUS_07170 207614 206322 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_07170 210276 207631 gene locus_tag LOCUS_07180 210276 207631 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460907.1 protein_id gnl|my_center|LOCUS_07180 211578 210820 gene locus_tag LOCUS_07190 gene tatC 211578 210820 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392793.1 protein_id gnl|my_center|LOCUS_07190 211838 211590 gene locus_tag LOCUS_07200 211838 211590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 213315 211930 gene locus_tag LOCUS_07210 213315 211930 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545342.1 protein_id gnl|my_center|LOCUS_07210 214438 213473 gene locus_tag LOCUS_07220 214438 213473 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460185.1 protein_id gnl|my_center|LOCUS_07220 215027 214536 gene locus_tag LOCUS_07230 215027 214536 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966078.1 protein_id gnl|my_center|LOCUS_07230 215494 215045 gene locus_tag LOCUS_07240 215494 215045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 216151 215534 gene locus_tag LOCUS_07250 gene yihA 216151 215534 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943641.1 protein_id gnl|my_center|LOCUS_07250 218466 216148 gene locus_tag LOCUS_07260 gene lon 218466 216148 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_07260 219870 218608 gene locus_tag LOCUS_07270 gene clpX 219870 218608 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_07270 220497 219883 gene locus_tag LOCUS_07280 gene clpP 220497 219883 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081059.1 protein_id gnl|my_center|LOCUS_07280 221866 220520 gene locus_tag LOCUS_07290 gene tig 221866 220520 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392064.1 protein_id gnl|my_center|LOCUS_07290 222128 222054 gene locus_tag LOCUS_t00090 222128 222054 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 222825 222214 gene locus_tag LOCUS_07300 gene wrbA 222825 222214 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941470.1 protein_id gnl|my_center|LOCUS_07300 223203 223119 gene locus_tag LOCUS_t00100 223203 223119 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 223607 223356 gene locus_tag LOCUS_07310 223607 223356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 223930 223661 gene locus_tag LOCUS_07320 223930 223661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 224427 224352 gene locus_tag LOCUS_t00110 224427 224352 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 224507 224432 gene locus_tag LOCUS_t00120 224507 224432 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 224611 224536 gene locus_tag LOCUS_t00130 224611 224536 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 225537 224722 gene locus_tag LOCUS_07330 gene larE 225537 224722 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_07330 226463 225789 gene locus_tag LOCUS_07340 226463 225789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425116.1 protein_id gnl|my_center|LOCUS_07340 227742 226588 gene locus_tag LOCUS_07350 227742 226588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 228855 227944 gene locus_tag LOCUS_07360 228855 227944 CDS product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869129.1 protein_id gnl|my_center|LOCUS_07360 >Feature sequence04 1272 715 gene locus_tag LOCUS_07370 1272 715 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158303423.1 protein_id gnl|my_center|LOCUS_07370 2130 1285 gene locus_tag LOCUS_07380 2130 1285 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671202.1 protein_id gnl|my_center|LOCUS_07380 2286 3191 gene locus_tag LOCUS_07390 2286 3191 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227377.1 protein_id gnl|my_center|LOCUS_07390 4949 3393 gene locus_tag LOCUS_07400 4949 3393 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393817.1 protein_id gnl|my_center|LOCUS_07400 7378 4946 gene locus_tag LOCUS_07410 gene gyrA 7378 4946 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815130.1 protein_id gnl|my_center|LOCUS_07410 7542 8543 gene locus_tag LOCUS_07420 7542 8543 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258942.1 protein_id gnl|my_center|LOCUS_07420 8540 9610 gene locus_tag LOCUS_07430 gene buk 8540 9610 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048334.1 protein_id gnl|my_center|LOCUS_07430 10824 9658 gene locus_tag LOCUS_07440 10824 9658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 11055 12182 gene locus_tag LOCUS_07450 11055 12182 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868783.1 protein_id gnl|my_center|LOCUS_07450 12639 12262 gene locus_tag LOCUS_07460 12639 12262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07460 12992 12636 gene locus_tag LOCUS_07470 12992 12636 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197529991.1 protein_id gnl|my_center|LOCUS_07470 14736 13129 gene locus_tag LOCUS_07480 14736 13129 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761935.1 protein_id gnl|my_center|LOCUS_07480 15665 14733 gene locus_tag LOCUS_07490 15665 14733 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761936.1 protein_id gnl|my_center|LOCUS_07490 16075 15719 gene locus_tag LOCUS_07500 16075 15719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 16577 16260 gene locus_tag LOCUS_07510 16577 16260 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393134.1 protein_id gnl|my_center|LOCUS_07510 17970 16621 gene locus_tag LOCUS_07520 17970 16621 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461881.1 protein_id gnl|my_center|LOCUS_07520 18746 17967 gene locus_tag LOCUS_07530 18746 17967 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461882.1 protein_id gnl|my_center|LOCUS_07530 19977 18916 gene locus_tag LOCUS_07540 gene dsrB 19977 18916 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810503.1 protein_id gnl|my_center|LOCUS_07540 21175 19970 gene locus_tag LOCUS_07550 gene dsrA 21175 19970 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810505.1 protein_id gnl|my_center|LOCUS_07550 21378 21193 gene locus_tag LOCUS_07560 21378 21193 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810507.1 protein_id gnl|my_center|LOCUS_07560 22316 21957 gene locus_tag LOCUS_07570 gene aroH 22316 21957 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460212.1 protein_id gnl|my_center|LOCUS_07570 22836 22378 gene locus_tag LOCUS_07580 22836 22378 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902308.1 protein_id gnl|my_center|LOCUS_07580 25542 22996 gene locus_tag LOCUS_07590 25542 22996 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393352.1 protein_id gnl|my_center|LOCUS_07590 26965 25652 gene locus_tag LOCUS_07600 gene larA 26965 25652 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461442.1 protein_id gnl|my_center|LOCUS_07600 27546 27307 gene locus_tag LOCUS_07610 27546 27307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 27806 27546 gene locus_tag LOCUS_07620 27806 27546 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986396.1 protein_id gnl|my_center|LOCUS_07620 29500 27812 gene locus_tag LOCUS_07630 29500 27812 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_07630 31379 29505 gene locus_tag LOCUS_07640 gene nuoF 31379 29505 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393387.1 protein_id gnl|my_center|LOCUS_07640 31857 31381 gene locus_tag LOCUS_07650 gene nuoE 31857 31381 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582933.1 protein_id gnl|my_center|LOCUS_07650 32467 32168 gene locus_tag LOCUS_07660 32467 32168 CDS product DUF6506 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966779.1 protein_id gnl|my_center|LOCUS_07660 33723 32506 gene locus_tag LOCUS_07670 33723 32506 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257804.1 protein_id gnl|my_center|LOCUS_07670 34756 33752 gene locus_tag LOCUS_07680 34756 33752 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259505.1 protein_id gnl|my_center|LOCUS_07680 35757 34786 gene locus_tag LOCUS_07690 35757 34786 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453964.1 protein_id gnl|my_center|LOCUS_07690 36743 35781 gene locus_tag LOCUS_07700 gene pdhA 36743 35781 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_07700 37156 36791 gene locus_tag LOCUS_07710 37156 36791 CDS product Lin0512 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949160.1 protein_id gnl|my_center|LOCUS_07710 39425 37413 gene locus_tag LOCUS_07720 39425 37413 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986282.1 protein_id gnl|my_center|LOCUS_07720 39673 39990 gene locus_tag LOCUS_07730 39673 39990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 40224 40000 gene locus_tag LOCUS_07740 40224 40000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 41075 41677 gene locus_tag LOCUS_07750 41075 41677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 41989 41768 gene locus_tag LOCUS_07760 41989 41768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 42540 42130 gene locus_tag LOCUS_07770 42540 42130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 42803 43102 gene locus_tag LOCUS_07780 42803 43102 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261655.1 protein_id gnl|my_center|LOCUS_07780 43434 43360 gene locus_tag LOCUS_t00140 43434 43360 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 43615 45366 gene locus_tag LOCUS_07790 43615 45366 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_07790 45378 45893 gene locus_tag LOCUS_07800 gene mug 45378 45893 CDS product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230901.1 protein_id gnl|my_center|LOCUS_07800 46062 47087 gene locus_tag LOCUS_07810 46062 47087 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941934.1 protein_id gnl|my_center|LOCUS_07810 47102 47911 gene locus_tag LOCUS_07820 gene cbiQ 47102 47911 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941935.1 protein_id gnl|my_center|LOCUS_07820 47911 48669 gene locus_tag LOCUS_07830 47911 48669 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941936.1 protein_id gnl|my_center|LOCUS_07830 48725 49816 gene locus_tag LOCUS_07840 48725 49816 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393239.1 protein_id gnl|my_center|LOCUS_07840 50217 49864 gene locus_tag LOCUS_07850 50217 49864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 50748 50302 gene locus_tag LOCUS_07860 50748 50302 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198843.1 protein_id gnl|my_center|LOCUS_07860 51080 50856 gene locus_tag LOCUS_07870 51080 50856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 52892 51084 gene locus_tag LOCUS_07880 52892 51084 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_07880 53321 52893 gene locus_tag LOCUS_07890 53321 52893 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392242.1 protein_id gnl|my_center|LOCUS_07890 54101 53352 gene locus_tag LOCUS_07900 54101 53352 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941182.1 protein_id gnl|my_center|LOCUS_07900 54342 55754 gene locus_tag LOCUS_07910 54342 55754 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943456.1 protein_id gnl|my_center|LOCUS_07910 59308 55856 gene locus_tag LOCUS_07920 gene pyc 59308 55856 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164087.1 protein_id gnl|my_center|LOCUS_07920 59656 60084 gene locus_tag LOCUS_07930 59656 60084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 60258 62072 gene locus_tag LOCUS_07940 60258 62072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 63903 62161 gene locus_tag LOCUS_07950 63903 62161 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938476.1 protein_id gnl|my_center|LOCUS_07950 66330 64414 gene locus_tag LOCUS_07960 gene gyrB 66330 64414 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815132.1 protein_id gnl|my_center|LOCUS_07960 66612 66367 gene locus_tag LOCUS_07970 66612 66367 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024026196.1 protein_id gnl|my_center|LOCUS_07970 67453 66590 gene locus_tag LOCUS_07980 67453 66590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 68513 67458 gene locus_tag LOCUS_07990 gene recF 68513 67458 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356016.1 protein_id gnl|my_center|LOCUS_07990 68806 68585 gene locus_tag LOCUS_08000 68806 68585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 69942 68827 gene locus_tag LOCUS_08010 gene dnaN 69942 68827 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012615304.1 protein_id gnl|my_center|LOCUS_08010 71647 70199 gene locus_tag LOCUS_08020 gene dnaA 71647 70199 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815138.1 protein_id gnl|my_center|LOCUS_08020 71725 71886 gene locus_tag LOCUS_08030 71725 71886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 72660 73022 gene locus_tag LOCUS_08040 gene rnpA 72660 73022 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359393.1 protein_id gnl|my_center|LOCUS_08040 73266 73913 gene locus_tag LOCUS_08050 73266 73913 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393998.1 protein_id gnl|my_center|LOCUS_08050 73933 74565 gene locus_tag LOCUS_08060 73933 74565 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462331.1 protein_id gnl|my_center|LOCUS_08060 74662 76044 gene locus_tag LOCUS_08070 gene mnmE 74662 76044 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295261.1 protein_id gnl|my_center|LOCUS_08070 76087 77958 gene locus_tag LOCUS_08080 gene mnmG 76087 77958 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000541063.1 protein_id gnl|my_center|LOCUS_08080 77962 78678 gene locus_tag LOCUS_08090 gene rsmG 77962 78678 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288804.1 protein_id gnl|my_center|LOCUS_08090 78717 79592 gene locus_tag LOCUS_08100 gene noc 78717 79592 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429292.1 protein_id gnl|my_center|LOCUS_08100 82157 79773 gene locus_tag LOCUS_08110 82157 79773 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943552.1 protein_id gnl|my_center|LOCUS_08110 82842 82141 gene locus_tag LOCUS_08120 82842 82141 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986274.1 protein_id gnl|my_center|LOCUS_08120 82943 83173 gene locus_tag LOCUS_08130 82943 83173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 83184 83945 gene locus_tag LOCUS_08140 gene soj 83184 83945 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_08140 83938 84834 gene locus_tag LOCUS_08150 gene spo0J 83938 84834 CDS product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226832.1 protein_id gnl|my_center|LOCUS_08150 85239 86636 gene locus_tag LOCUS_08160 85239 86636 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392787.1 protein_id gnl|my_center|LOCUS_08160 86705 87931 gene locus_tag LOCUS_08170 gene hydF 86705 87931 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392791.1 protein_id gnl|my_center|LOCUS_08170 88034 88537 gene locus_tag LOCUS_08180 88034 88537 CDS product DUF4446 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398925.1 protein_id gnl|my_center|LOCUS_08180 88631 89551 gene locus_tag LOCUS_08190 88631 89551 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582467.1 protein_id gnl|my_center|LOCUS_08190 89681 90073 gene locus_tag LOCUS_08200 89681 90073 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039429.1 protein_id gnl|my_center|LOCUS_08200 90325 91722 gene locus_tag LOCUS_08210 gene selA 90325 91722 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943980.1 protein_id gnl|my_center|LOCUS_08210 91719 93602 gene locus_tag LOCUS_08220 gene selB 91719 93602 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048014.1 protein_id gnl|my_center|LOCUS_08220 93895 94938 gene locus_tag LOCUS_08230 93895 94938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545929.1 protein_id gnl|my_center|LOCUS_08230 94926 96560 gene locus_tag LOCUS_08240 94926 96560 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545407.1 protein_id gnl|my_center|LOCUS_08240 96573 98888 gene locus_tag LOCUS_08250 96573 98888 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546258.1 protein_id gnl|my_center|LOCUS_08250 99258 100430 gene locus_tag LOCUS_08260 99258 100430 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393979.1 protein_id gnl|my_center|LOCUS_08260 100525 101421 gene locus_tag LOCUS_08270 100525 101421 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_08270 101431 102384 gene locus_tag LOCUS_08280 101431 102384 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018191.1 protein_id gnl|my_center|LOCUS_08280 102371 103138 gene locus_tag LOCUS_08290 102371 103138 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773590.1 protein_id gnl|my_center|LOCUS_08290 103138 103842 gene locus_tag LOCUS_08300 103138 103842 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_08300 103924 104574 gene locus_tag LOCUS_08310 103924 104574 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392650.1 protein_id gnl|my_center|LOCUS_08310 104747 105694 gene locus_tag LOCUS_08320 104747 105694 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393185.1 protein_id gnl|my_center|LOCUS_08320 105941 106897 gene locus_tag LOCUS_08330 gene selD 105941 106897 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_08330 106887 107489 gene locus_tag LOCUS_08340 gene yedF 106887 107489 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391672.1 protein_id gnl|my_center|LOCUS_08340 107538 108392 gene locus_tag LOCUS_08350 gene mscT 107538 108392 CDS product small-conductance mechanosensitive channel protein MscT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244994.1 protein_id gnl|my_center|LOCUS_08350 108428 108628 gene locus_tag LOCUS_08360 108428 108628 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_08360 108866 111094 gene locus_tag LOCUS_08370 gene pflB 108866 111094 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195485.1 protein_id gnl|my_center|LOCUS_08370 111098 111826 gene locus_tag LOCUS_08380 gene pflA 111098 111826 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238477.1 protein_id gnl|my_center|LOCUS_08380 111946 113055 gene locus_tag LOCUS_08390 gene ychF 111946 113055 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815179.1 protein_id gnl|my_center|LOCUS_08390 113511 114512 gene locus_tag LOCUS_08400 gene aroF 113511 114512 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964210.1 protein_id gnl|my_center|LOCUS_08400 114551 115432 gene locus_tag LOCUS_08410 gene pheA 114551 115432 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392847.1 protein_id gnl|my_center|LOCUS_08410 115472 116356 gene locus_tag LOCUS_08420 115472 116356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 117574 116642 gene locus_tag LOCUS_08430 117574 116642 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_08430 118646 117567 gene locus_tag LOCUS_08440 118646 117567 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_08440 120171 118636 gene locus_tag LOCUS_08450 120171 118636 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_08450 121385 120282 gene locus_tag LOCUS_08460 121385 120282 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276126.1 protein_id gnl|my_center|LOCUS_08460 122435 121587 gene locus_tag LOCUS_08470 gene panC 122435 121587 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_08470 123271 122447 gene locus_tag LOCUS_08480 123271 122447 CDS product Rossmann-like and DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391687.1 protein_id gnl|my_center|LOCUS_08480 123726 124010 gene locus_tag LOCUS_08490 gene rpsF 123726 124010 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244064.1 protein_id gnl|my_center|LOCUS_08490 124029 124445 gene locus_tag LOCUS_08500 gene ssb 124029 124445 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815182.1 protein_id gnl|my_center|LOCUS_08500 124459 124692 gene locus_tag LOCUS_08510 gene rpsR 124459 124692 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_08510 124851 126083 gene locus_tag LOCUS_08520 124851 126083 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860963.1 protein_id gnl|my_center|LOCUS_08520 126100 127257 gene locus_tag LOCUS_08530 126100 127257 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071540979.1 protein_id gnl|my_center|LOCUS_08530 127351 127839 gene locus_tag LOCUS_08540 127351 127839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 128037 128813 gene locus_tag LOCUS_08550 128037 128813 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_08550 128807 129718 gene locus_tag LOCUS_08560 128807 129718 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765720.1 protein_id gnl|my_center|LOCUS_08560 129721 131037 gene locus_tag LOCUS_08570 129721 131037 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103412.1 protein_id gnl|my_center|LOCUS_08570 131069 131662 gene locus_tag LOCUS_08580 131069 131662 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183791.1 protein_id gnl|my_center|LOCUS_08580 131976 133613 gene locus_tag LOCUS_08590 131976 133613 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461447.1 protein_id gnl|my_center|LOCUS_08590 133677 134855 gene locus_tag LOCUS_08600 133677 134855 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431263.1 protein_id gnl|my_center|LOCUS_08600 134989 135948 gene locus_tag LOCUS_08610 134989 135948 CDS product YybS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814840.1 protein_id gnl|my_center|LOCUS_08610 135958 137979 gene locus_tag LOCUS_08620 gene gdpP 135958 137979 CDS product cyclic-di-AMP phosphodiesterase GdpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242517.1 protein_id gnl|my_center|LOCUS_08620 137939 138385 gene locus_tag LOCUS_08630 gene rplI 137939 138385 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_08630 138450 140354 gene locus_tag LOCUS_08640 gene lonC 138450 140354 CDS product Lon family ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391681.1 protein_id gnl|my_center|LOCUS_08640 140347 141678 gene locus_tag LOCUS_08650 gene dnaB 140347 141678 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815191.1 protein_id gnl|my_center|LOCUS_08650 142362 143894 gene locus_tag LOCUS_08660 142362 143894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 143894 145861 gene locus_tag LOCUS_08670 143894 145861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 145876 146955 gene locus_tag LOCUS_08680 145876 146955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 146948 150424 gene locus_tag LOCUS_08690 146948 150424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 150437 152326 gene locus_tag LOCUS_08700 150437 152326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 152329 153960 gene locus_tag LOCUS_08710 152329 153960 CDS product ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727568.1 protein_id gnl|my_center|LOCUS_08710 153965 155977 gene locus_tag LOCUS_08720 153965 155977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 155979 157451 gene locus_tag LOCUS_08730 155979 157451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 157478 157642 gene locus_tag LOCUS_08740 157478 157642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 157934 158368 gene locus_tag LOCUS_08750 157934 158368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 158540 159085 gene locus_tag LOCUS_08760 158540 159085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 159622 160275 gene locus_tag LOCUS_08770 159622 160275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 160485 161423 gene locus_tag LOCUS_08780 160485 161423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 161550 162122 gene locus_tag LOCUS_08790 161550 162122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 162124 162744 gene locus_tag LOCUS_08800 162124 162744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 162759 164897 gene locus_tag LOCUS_08810 162759 164897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 165577 165942 gene locus_tag LOCUS_08820 165577 165942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 166469 167899 gene locus_tag LOCUS_08830 166469 167899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 168470 169939 gene locus_tag LOCUS_08840 168470 169939 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722014.1 protein_id gnl|my_center|LOCUS_08840 169954 170661 gene locus_tag LOCUS_08850 169954 170661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 171187 171615 gene locus_tag LOCUS_08860 171187 171615 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890858.1 protein_id gnl|my_center|LOCUS_08860 171664 173007 gene locus_tag LOCUS_08870 gene trkA 171664 173007 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459869.1 protein_id gnl|my_center|LOCUS_08870 173013 174494 gene locus_tag LOCUS_08880 173013 174494 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812211.1 protein_id gnl|my_center|LOCUS_08880 175988 174630 gene locus_tag LOCUS_08890 gene purB 175988 174630 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816141.1 protein_id gnl|my_center|LOCUS_08890 176385 177668 gene locus_tag LOCUS_08900 176385 177668 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462314.1 protein_id gnl|my_center|LOCUS_08900 177825 177900 gene locus_tag LOCUS_t00150 177825 177900 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 178036 178491 gene locus_tag LOCUS_08910 178036 178491 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392448.1 protein_id gnl|my_center|LOCUS_08910 178476 179399 gene locus_tag LOCUS_08920 178476 179399 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728914.1 protein_id gnl|my_center|LOCUS_08920 179396 180166 gene locus_tag LOCUS_08930 gene znuC 179396 180166 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705955.1 protein_id gnl|my_center|LOCUS_08930 180205 181050 gene locus_tag LOCUS_08940 180205 181050 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390141.1 protein_id gnl|my_center|LOCUS_08940 181320 182990 gene locus_tag LOCUS_08950 181320 182990 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_08950 183281 184147 gene locus_tag LOCUS_08960 183281 184147 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391615.1 protein_id gnl|my_center|LOCUS_08960 184168 185040 gene locus_tag LOCUS_08970 184168 185040 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391615.1 protein_id gnl|my_center|LOCUS_08970 185058 185762 gene locus_tag LOCUS_08980 185058 185762 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391616.1 protein_id gnl|my_center|LOCUS_08980 185759 186826 gene locus_tag LOCUS_08990 185759 186826 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391617.1 protein_id gnl|my_center|LOCUS_08990 187084 188892 gene locus_tag LOCUS_09000 187084 188892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 189714 188971 gene locus_tag LOCUS_09010 189714 188971 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358553.1 protein_id gnl|my_center|LOCUS_09010 190168 191832 gene locus_tag LOCUS_09020 gene ilvD 190168 191832 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584102.1 protein_id gnl|my_center|LOCUS_09020 191870 192703 gene locus_tag LOCUS_09030 gene panB 191870 192703 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_09030 193077 193937 gene locus_tag LOCUS_09040 gene folD 193077 193937 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_09040 193953 195308 gene locus_tag LOCUS_09050 193953 195308 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674204.1 protein_id gnl|my_center|LOCUS_09050 196195 197748 gene locus_tag LOCUS_09060 196195 197748 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393738.1 protein_id gnl|my_center|LOCUS_09060 197748 199010 gene locus_tag LOCUS_09070 gene leuC 197748 199010 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393737.1 protein_id gnl|my_center|LOCUS_09070 199007 199498 gene locus_tag LOCUS_09080 gene leuD 199007 199498 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_09080 199495 200559 gene locus_tag LOCUS_09090 gene leuB 199495 200559 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143540.1 protein_id gnl|my_center|LOCUS_09090 200625 200699 gene locus_tag LOCUS_t00160 200625 200699 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 200760 200835 gene locus_tag LOCUS_t00170 200760 200835 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence05 340 110 gene locus_tag LOCUS_09100 340 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 1588 350 gene locus_tag LOCUS_09110 1588 350 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461101.1 protein_id gnl|my_center|LOCUS_09110 1849 1773 gene locus_tag LOCUS_t00180 1849 1773 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2002 2166 gene locus_tag LOCUS_09120 2002 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 2935 2207 gene locus_tag LOCUS_09130 2935 2207 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444927.1 protein_id gnl|my_center|LOCUS_09130 3540 2959 gene locus_tag LOCUS_09140 3540 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 4917 3694 gene locus_tag LOCUS_09150 4917 3694 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732668.1 protein_id gnl|my_center|LOCUS_09150 5666 4992 gene locus_tag LOCUS_09160 5666 4992 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064948.1 protein_id gnl|my_center|LOCUS_09160 5837 5706 gene locus_tag LOCUS_09170 5837 5706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 6382 5888 gene locus_tag LOCUS_09180 6382 5888 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082639.1 protein_id gnl|my_center|LOCUS_09180 8274 6502 gene locus_tag LOCUS_09190 8274 6502 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257959.1 protein_id gnl|my_center|LOCUS_09190 10019 8274 gene locus_tag LOCUS_09200 10019 8274 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989772.1 protein_id gnl|my_center|LOCUS_09200 12077 10176 gene locus_tag LOCUS_09210 12077 10176 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048401.1 protein_id gnl|my_center|LOCUS_09210 12522 12346 gene locus_tag LOCUS_09220 12522 12346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 13270 12557 gene locus_tag LOCUS_09230 13270 12557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 14559 13291 gene locus_tag LOCUS_09240 14559 13291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 15362 14646 gene locus_tag LOCUS_09250 15362 14646 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966508.1 protein_id gnl|my_center|LOCUS_09250 15675 15394 gene locus_tag LOCUS_09260 15675 15394 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722457.1 protein_id gnl|my_center|LOCUS_09260 16067 15672 gene locus_tag LOCUS_09270 16067 15672 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393003.1 protein_id gnl|my_center|LOCUS_09270 17584 16130 gene locus_tag LOCUS_09280 gene panF 17584 16130 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104806.1 protein_id gnl|my_center|LOCUS_09280 17895 17584 gene locus_tag LOCUS_09290 17895 17584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 18313 18225 gene locus_tag LOCUS_t00190 18313 18225 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 18432 18358 gene locus_tag LOCUS_t00200 18432 18358 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 18514 18440 gene locus_tag LOCUS_t00210 18514 18440 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 18600 18525 gene locus_tag LOCUS_t00220 18600 18525 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 18685 18609 gene locus_tag LOCUS_t00230 18685 18609 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 19603 18803 gene locus_tag LOCUS_09300 gene thiD 19603 18803 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256279.1 protein_id gnl|my_center|LOCUS_09300 20298 19618 gene locus_tag LOCUS_09310 20298 19618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 20478 21092 gene locus_tag LOCUS_09320 20478 21092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 21206 21131 gene locus_tag LOCUS_t00240 21206 21131 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 21855 21277 gene locus_tag LOCUS_09330 gene pyrE 21855 21277 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460653.1 protein_id gnl|my_center|LOCUS_09330 22574 21852 gene locus_tag LOCUS_09340 gene pyrF 22574 21852 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_09340 23270 22596 gene locus_tag LOCUS_09350 23270 22596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 25723 23192 gene locus_tag LOCUS_09360 gene carB 25723 23192 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392401.1 protein_id gnl|my_center|LOCUS_09360 26790 25726 gene locus_tag LOCUS_09370 gene carA 26790 25726 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965933.1 protein_id gnl|my_center|LOCUS_09370 28076 26790 gene locus_tag LOCUS_09380 28076 26790 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_09380 29016 28060 gene locus_tag LOCUS_09390 29016 28060 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 protein_id gnl|my_center|LOCUS_09390 29958 29329 gene locus_tag LOCUS_09400 29958 29329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 30796 30110 gene locus_tag LOCUS_09410 30796 30110 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817367.1 protein_id gnl|my_center|LOCUS_09410 30966 30881 gene locus_tag LOCUS_t00250 30966 30881 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 31078 30993 gene locus_tag LOCUS_t00260 31078 30993 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 31378 32952 gene locus_tag LOCUS_09420 31378 32952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 34605 32971 gene locus_tag LOCUS_09430 34605 32971 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_09430 35177 34617 gene locus_tag LOCUS_09440 35177 34617 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816766.1 protein_id gnl|my_center|LOCUS_09440 35786 35184 gene locus_tag LOCUS_09450 gene coaE 35786 35184 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393338.1 protein_id gnl|my_center|LOCUS_09450 36658 35810 gene locus_tag LOCUS_09460 gene mutM 36658 35810 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114480.1 protein_id gnl|my_center|LOCUS_09460 39299 36672 gene locus_tag LOCUS_09470 gene polA 39299 36672 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393341.1 protein_id gnl|my_center|LOCUS_09470 39794 39453 gene locus_tag LOCUS_09480 39794 39453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 40696 39830 gene locus_tag LOCUS_09490 40696 39830 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868898.1 protein_id gnl|my_center|LOCUS_09490 40952 41389 gene locus_tag LOCUS_09500 40952 41389 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189957.1 protein_id gnl|my_center|LOCUS_09500 41502 42269 gene locus_tag LOCUS_09510 41502 42269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 45069 42619 gene locus_tag LOCUS_09520 45069 42619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 47716 46175 gene locus_tag LOCUS_09530 47716 46175 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816130.1 protein_id gnl|my_center|LOCUS_09530 50295 48445 gene locus_tag LOCUS_09540 50295 48445 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064474.1 protein_id gnl|my_center|LOCUS_09540 51455 50292 gene locus_tag LOCUS_09550 51455 50292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 54549 51565 gene locus_tag LOCUS_09560 54549 51565 CDS product type III restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016374.1 protein_id gnl|my_center|LOCUS_09560 55406 54546 gene locus_tag LOCUS_09570 55406 54546 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194812347.1 protein_id gnl|my_center|LOCUS_09570 57452 55419 gene locus_tag LOCUS_09580 57452 55419 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211204934.1 protein_id gnl|my_center|LOCUS_09580 60330 57481 gene locus_tag LOCUS_09590 60330 57481 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286652.1 protein_id gnl|my_center|LOCUS_09590 61248 60574 gene locus_tag LOCUS_09600 61248 60574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 61674 61588 gene locus_tag LOCUS_t00270 61674 61588 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 61880 62608 gene locus_tag LOCUS_09610 61880 62608 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948163.1 protein_id gnl|my_center|LOCUS_09610 62653 63753 gene locus_tag LOCUS_09620 62653 63753 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021442.1 protein_id gnl|my_center|LOCUS_09620 63750 64472 gene locus_tag LOCUS_09630 63750 64472 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927106.1 protein_id gnl|my_center|LOCUS_09630 65050 64535 gene locus_tag LOCUS_09640 65050 64535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 65220 66377 gene locus_tag LOCUS_09650 65220 66377 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378762.1 protein_id gnl|my_center|LOCUS_09650 67284 66427 gene locus_tag LOCUS_09660 gene dat 67284 66427 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484981.1 protein_id gnl|my_center|LOCUS_09660 67464 68417 gene locus_tag LOCUS_09670 67464 68417 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948814.1 protein_id gnl|my_center|LOCUS_09670 68420 69547 gene locus_tag LOCUS_09680 68420 69547 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177656.1 protein_id gnl|my_center|LOCUS_09680 71035 69644 gene locus_tag LOCUS_09690 71035 69644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 72809 71061 gene locus_tag LOCUS_09700 gene pyk 72809 71061 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393367.1 protein_id gnl|my_center|LOCUS_09700 73032 72835 gene locus_tag LOCUS_09710 73032 72835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459626.1 protein_id gnl|my_center|LOCUS_09710 76537 73136 gene locus_tag LOCUS_09720 76537 73136 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_09720 78302 76575 gene locus_tag LOCUS_09730 78302 76575 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140378.1 protein_id gnl|my_center|LOCUS_09730 78949 78527 gene locus_tag LOCUS_09740 78949 78527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 80946 79123 gene locus_tag LOCUS_09750 gene typA 80946 79123 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183842.1 protein_id gnl|my_center|LOCUS_09750 82755 81145 gene locus_tag LOCUS_09760 82755 81145 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392701.1 protein_id gnl|my_center|LOCUS_09760 83640 82771 gene locus_tag LOCUS_09770 gene murB 83640 82771 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048307.1 protein_id gnl|my_center|LOCUS_09770 84043 83693 gene locus_tag LOCUS_09780 84043 83693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 84647 84189 gene locus_tag LOCUS_09790 gene trmL 84647 84189 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_09790 85560 84649 gene locus_tag LOCUS_09800 85560 84649 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023177.1 protein_id gnl|my_center|LOCUS_09800 86849 85680 gene locus_tag LOCUS_09810 86849 85680 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382099.1 protein_id gnl|my_center|LOCUS_09810 88118 86925 gene locus_tag LOCUS_09820 88118 86925 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436121.1 protein_id gnl|my_center|LOCUS_09820 88768 88145 gene locus_tag LOCUS_09830 88768 88145 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258926.1 protein_id gnl|my_center|LOCUS_09830 88994 89266 gene locus_tag LOCUS_09840 88994 89266 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393237.1 protein_id gnl|my_center|LOCUS_09840 90167 89376 gene locus_tag LOCUS_09850 90167 89376 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886407.1 protein_id gnl|my_center|LOCUS_09850 90386 92005 gene locus_tag LOCUS_09860 90386 92005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 92895 92014 gene locus_tag LOCUS_09870 92895 92014 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289140.1 protein_id gnl|my_center|LOCUS_09870 93908 92892 gene locus_tag LOCUS_09880 gene aroF 93908 92892 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460211.1 protein_id gnl|my_center|LOCUS_09880 94837 94322 gene locus_tag LOCUS_09890 94837 94322 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393622.1 protein_id gnl|my_center|LOCUS_09890 95333 94854 gene locus_tag LOCUS_09900 gene moaC 95333 94854 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986478.1 protein_id gnl|my_center|LOCUS_09900 95582 95352 gene locus_tag LOCUS_09910 95582 95352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 97540 95603 gene locus_tag LOCUS_09920 97540 95603 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986480.1 protein_id gnl|my_center|LOCUS_09920 98802 97570 gene locus_tag LOCUS_09930 98802 97570 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545855.1 protein_id gnl|my_center|LOCUS_09930 100021 99041 gene locus_tag LOCUS_09940 gene moaA 100021 99041 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546124.1 protein_id gnl|my_center|LOCUS_09940 100522 100034 gene locus_tag LOCUS_09950 gene mobB 100522 100034 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393319.1 protein_id gnl|my_center|LOCUS_09950 100684 101355 gene locus_tag LOCUS_09960 100684 101355 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272303.1 protein_id gnl|my_center|LOCUS_09960 104847 101347 gene locus_tag LOCUS_09970 gene addA 104847 101347 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288050.1 protein_id gnl|my_center|LOCUS_09970 107953 104840 gene locus_tag LOCUS_09980 gene addB 107953 104840 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948191.1 protein_id gnl|my_center|LOCUS_09980 108540 108079 gene locus_tag LOCUS_09990 108540 108079 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944375.1 protein_id gnl|my_center|LOCUS_09990 109283 108588 gene locus_tag LOCUS_10000 gene nth 109283 108588 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964008.1 protein_id gnl|my_center|LOCUS_10000 110315 109290 gene locus_tag LOCUS_10010 110315 109290 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392449.1 protein_id gnl|my_center|LOCUS_10010 111703 110345 gene locus_tag LOCUS_10020 111703 110345 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 protein_id gnl|my_center|LOCUS_10020 112015 111731 gene locus_tag LOCUS_10030 112015 111731 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112985.1 protein_id gnl|my_center|LOCUS_10030 112219 112440 gene locus_tag LOCUS_10040 112219 112440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 112418 113614 gene locus_tag LOCUS_10050 112418 113614 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227876.1 protein_id gnl|my_center|LOCUS_10050 113784 115538 gene locus_tag LOCUS_10060 113784 115538 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047951.1 protein_id gnl|my_center|LOCUS_10060 115856 117427 gene locus_tag LOCUS_10070 115856 117427 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_10070 117440 118576 gene locus_tag LOCUS_10080 117440 118576 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_10080 118610 120220 gene locus_tag LOCUS_10090 118610 120220 CDS product 4-hydroxyphenylacetate 3-hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064616.1 protein_id gnl|my_center|LOCUS_10090 120351 121673 gene locus_tag LOCUS_10100 120351 121673 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860380.1 protein_id gnl|my_center|LOCUS_10100 122728 121757 gene locus_tag LOCUS_10110 122728 121757 CDS product NrtA/SsuA/CpmA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434121.1 protein_id gnl|my_center|LOCUS_10110 123504 122761 gene locus_tag LOCUS_10120 123504 122761 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869152.1 protein_id gnl|my_center|LOCUS_10120 124255 123491 gene locus_tag LOCUS_10130 124255 123491 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896415.1 protein_id gnl|my_center|LOCUS_10130 124516 126120 gene locus_tag LOCUS_10140 124516 126120 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966897.1 protein_id gnl|my_center|LOCUS_10140 126139 127071 gene locus_tag LOCUS_10150 gene oppB 126139 127071 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245554.1 protein_id gnl|my_center|LOCUS_10150 127073 127987 gene locus_tag LOCUS_10160 127073 127987 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966900.1 protein_id gnl|my_center|LOCUS_10160 128000 129013 gene locus_tag LOCUS_10170 128000 129013 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966904.1 protein_id gnl|my_center|LOCUS_10170 129010 129987 gene locus_tag LOCUS_10180 129010 129987 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519085.1 protein_id gnl|my_center|LOCUS_10180 130084 131472 gene locus_tag LOCUS_10190 130084 131472 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184189.1 protein_id gnl|my_center|LOCUS_10190 131602 132969 gene locus_tag LOCUS_10200 gene oadA 131602 132969 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870743.1 protein_id gnl|my_center|LOCUS_10200 134688 133027 gene locus_tag LOCUS_10210 134688 133027 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948012.1 protein_id gnl|my_center|LOCUS_10210 135958 134711 gene locus_tag LOCUS_10220 135958 134711 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454678.1 protein_id gnl|my_center|LOCUS_10220 136486 136025 gene locus_tag LOCUS_10230 136486 136025 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943628.1 protein_id gnl|my_center|LOCUS_10230 138275 136656 gene locus_tag LOCUS_10240 138275 136656 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963949.1 protein_id gnl|my_center|LOCUS_10240 139658 138435 gene locus_tag LOCUS_10250 139658 138435 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_10250 140187 139792 gene locus_tag LOCUS_10260 140187 139792 CDS product class II SORL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868764.1 protein_id gnl|my_center|LOCUS_10260 140537 141793 gene locus_tag LOCUS_10270 gene uraA 140537 141793 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098238.1 protein_id gnl|my_center|LOCUS_10270 142425 141931 gene locus_tag LOCUS_10280 142425 141931 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943822.1 protein_id gnl|my_center|LOCUS_10280 142685 142428 gene locus_tag LOCUS_10290 142685 142428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 143653 142742 gene locus_tag LOCUS_10300 143653 142742 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390650.1 protein_id gnl|my_center|LOCUS_10300 144256 144032 gene locus_tag LOCUS_10310 144256 144032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 144655 144482 gene locus_tag LOCUS_10320 144655 144482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 144903 145832 gene locus_tag LOCUS_10330 gene fba 144903 145832 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582459.1 protein_id gnl|my_center|LOCUS_10330 146671 145913 gene locus_tag LOCUS_10340 146671 145913 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461834.1 protein_id gnl|my_center|LOCUS_10340 147261 146701 gene locus_tag LOCUS_10350 147261 146701 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080601.1 protein_id gnl|my_center|LOCUS_10350 >Feature sequence06 562 155 gene locus_tag LOCUS_10360 562 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 1125 724 gene locus_tag LOCUS_10370 1125 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 2770 1556 gene locus_tag LOCUS_10380 2770 1556 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870223.1 protein_id gnl|my_center|LOCUS_10380 3265 2888 gene locus_tag LOCUS_10390 3265 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 3554 4492 gene locus_tag LOCUS_10400 3554 4492 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963575.1 protein_id gnl|my_center|LOCUS_10400 5060 4611 gene locus_tag LOCUS_10410 5060 4611 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941183.1 protein_id gnl|my_center|LOCUS_10410 5723 5400 gene locus_tag LOCUS_10420 5723 5400 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020840.1 protein_id gnl|my_center|LOCUS_10420 6071 5742 gene locus_tag LOCUS_10430 6071 5742 CDS product lsr2/espR transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400657.1 protein_id gnl|my_center|LOCUS_10430 6264 6100 gene locus_tag LOCUS_10440 6264 6100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 6670 6446 gene locus_tag LOCUS_10450 6670 6446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 7157 6693 gene locus_tag LOCUS_10460 7157 6693 CDS product putative zinc-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306395.1 protein_id gnl|my_center|LOCUS_10460 7572 7162 gene locus_tag LOCUS_10470 7572 7162 CDS product putative zinc-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306394.1 protein_id gnl|my_center|LOCUS_10470 8425 7550 gene locus_tag LOCUS_10480 8425 7550 CDS product putative zinc-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461612.1 protein_id gnl|my_center|LOCUS_10480 8717 8418 gene locus_tag LOCUS_10490 8717 8418 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393706.1 protein_id gnl|my_center|LOCUS_10490 9100 8717 gene locus_tag LOCUS_10500 9100 8717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461613.1 protein_id gnl|my_center|LOCUS_10500 10542 9145 gene locus_tag LOCUS_10510 gene lpdA 10542 9145 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_227018667.1 protein_id gnl|my_center|LOCUS_10510 11642 10770 gene locus_tag LOCUS_10520 11642 10770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 12534 11911 gene locus_tag LOCUS_10530 12534 11911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 12635 12426 gene locus_tag LOCUS_10540 12635 12426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 13087 13455 gene locus_tag LOCUS_10550 13087 13455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 14607 13657 gene locus_tag LOCUS_10560 gene arsB 14607 13657 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393695.1 protein_id gnl|my_center|LOCUS_10560 15911 14712 gene locus_tag LOCUS_10570 15911 14712 CDS product tungsten cofactor oxidoreductase radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755814.1 protein_id gnl|my_center|LOCUS_10570 16301 15933 gene locus_tag LOCUS_10580 16301 15933 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890787.1 protein_id gnl|my_center|LOCUS_10580 16586 17029 gene locus_tag LOCUS_10590 16586 17029 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869250.1 protein_id gnl|my_center|LOCUS_10590 17056 17871 gene locus_tag LOCUS_10600 17056 17871 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461623.1 protein_id gnl|my_center|LOCUS_10600 17983 18645 gene locus_tag LOCUS_10610 17983 18645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 19537 18797 gene locus_tag LOCUS_10620 19537 18797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 19725 19871 gene locus_tag LOCUS_10630 19725 19871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 20873 19965 gene locus_tag LOCUS_10640 20873 19965 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227377.1 protein_id gnl|my_center|LOCUS_10640 21832 20981 gene locus_tag LOCUS_10650 21832 20981 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967956.1 protein_id gnl|my_center|LOCUS_10650 22225 23289 gene locus_tag LOCUS_10660 gene rsmH 22225 23289 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_10660 24428 23478 gene locus_tag LOCUS_10670 24428 23478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 24549 24394 gene locus_tag LOCUS_10680 24549 24394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 25209 24769 gene locus_tag LOCUS_10690 25209 24769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 26274 25225 gene locus_tag LOCUS_10700 26274 25225 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965886.1 protein_id gnl|my_center|LOCUS_10700 26778 27194 gene locus_tag LOCUS_10710 26778 27194 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809351.1 protein_id gnl|my_center|LOCUS_10710 27264 27851 gene locus_tag LOCUS_10720 27264 27851 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_10720 27940 28317 gene locus_tag LOCUS_10730 27940 28317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 30562 28412 gene locus_tag LOCUS_10740 30562 28412 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860946.1 protein_id gnl|my_center|LOCUS_10740 30817 30951 gene locus_tag LOCUS_10750 30817 30951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 31182 31012 gene locus_tag LOCUS_10760 31182 31012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 31689 31339 gene locus_tag LOCUS_tm00010 31689 31339 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 32625 31834 gene locus_tag LOCUS_10770 32625 31834 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_10770 32873 33757 gene locus_tag LOCUS_10780 32873 33757 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541541.1 protein_id gnl|my_center|LOCUS_10780 34431 33964 gene locus_tag LOCUS_10790 gene smpB 34431 33964 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391819.1 protein_id gnl|my_center|LOCUS_10790 34579 34959 gene locus_tag LOCUS_10800 34579 34959 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816830.1 protein_id gnl|my_center|LOCUS_10800 37352 35013 gene locus_tag LOCUS_10810 gene rnr 37352 35013 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228386.1 protein_id gnl|my_center|LOCUS_10810 37785 37393 gene locus_tag LOCUS_10820 37785 37393 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941659.1 protein_id gnl|my_center|LOCUS_10820 38569 37823 gene locus_tag LOCUS_10830 38569 37823 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242610.1 protein_id gnl|my_center|LOCUS_10830 38823 38647 gene locus_tag LOCUS_10840 38823 38647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 39646 38879 gene locus_tag LOCUS_10850 39646 38879 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393659.1 protein_id gnl|my_center|LOCUS_10850 41376 39643 gene locus_tag LOCUS_10860 41376 39643 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545703.1 protein_id gnl|my_center|LOCUS_10860 43047 41539 gene locus_tag LOCUS_10870 43047 41539 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869054.1 protein_id gnl|my_center|LOCUS_10870 43631 43110 gene locus_tag LOCUS_10880 43631 43110 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942116.1 protein_id gnl|my_center|LOCUS_10880 44446 43628 gene locus_tag LOCUS_10890 44446 43628 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942115.1 protein_id gnl|my_center|LOCUS_10890 45591 44443 gene locus_tag LOCUS_10900 45591 44443 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041082676.1 protein_id gnl|my_center|LOCUS_10900 45782 45588 gene locus_tag LOCUS_10910 45782 45588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 47211 45817 gene locus_tag LOCUS_10920 47211 45817 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393791.1 protein_id gnl|my_center|LOCUS_10920 48496 47213 gene locus_tag LOCUS_10930 48496 47213 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461049.1 protein_id gnl|my_center|LOCUS_10930 49725 48511 gene locus_tag LOCUS_10940 49725 48511 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817128.1 protein_id gnl|my_center|LOCUS_10940 51141 49738 gene locus_tag LOCUS_10950 51141 49738 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040605.1 protein_id gnl|my_center|LOCUS_10950 51599 51423 gene locus_tag LOCUS_10960 51599 51423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 53659 51650 gene locus_tag LOCUS_10970 53659 51650 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945413.1 protein_id gnl|my_center|LOCUS_10970 53968 53738 gene locus_tag LOCUS_10980 gene secG 53968 53738 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936141.1 protein_id gnl|my_center|LOCUS_10980 55178 54144 gene locus_tag LOCUS_10990 gene gap 55178 54144 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_10990 56832 55540 gene locus_tag LOCUS_11000 gene eno 56832 55540 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948030.1 protein_id gnl|my_center|LOCUS_11000 58400 56829 gene locus_tag LOCUS_11010 gene gpmI 58400 56829 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541097.1 protein_id gnl|my_center|LOCUS_11010 59179 58427 gene locus_tag LOCUS_11020 gene tpiA 59179 58427 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391808.1 protein_id gnl|my_center|LOCUS_11020 60740 59556 gene locus_tag LOCUS_11030 60740 59556 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_11030 61782 60775 gene locus_tag LOCUS_11040 gene gap 61782 60775 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_11040 62830 61799 gene locus_tag LOCUS_11050 62830 61799 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964027.1 protein_id gnl|my_center|LOCUS_11050 64117 63158 gene locus_tag LOCUS_11060 gene nrfD 64117 63158 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073772.1 protein_id gnl|my_center|LOCUS_11060 64689 64117 gene locus_tag LOCUS_11070 64689 64117 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073773.1 protein_id gnl|my_center|LOCUS_11070 67006 64706 gene locus_tag LOCUS_11080 gene phsA 67006 64706 CDS product thiosulfate reductase PhsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073774.1 protein_id gnl|my_center|LOCUS_11080 68268 67324 gene locus_tag LOCUS_11090 68268 67324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 68666 68271 gene locus_tag LOCUS_11100 68666 68271 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987070.1 protein_id gnl|my_center|LOCUS_11100 70143 68743 gene locus_tag LOCUS_11110 gene rpoN 70143 68743 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391805.1 protein_id gnl|my_center|LOCUS_11110 71208 70198 gene locus_tag LOCUS_11120 gene hypE 71208 70198 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 protein_id gnl|my_center|LOCUS_11120 72305 71205 gene locus_tag LOCUS_11130 gene hypD 72305 71205 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940977.1 protein_id gnl|my_center|LOCUS_11130 72516 72286 gene locus_tag LOCUS_11140 72516 72286 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545287.1 protein_id gnl|my_center|LOCUS_11140 74801 72519 gene locus_tag LOCUS_11150 gene hypF 74801 72519 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_11150 76235 74856 gene locus_tag LOCUS_11160 gene scfB 76235 74856 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_11160 76668 76504 gene locus_tag LOCUS_11170 76668 76504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 77666 76602 gene locus_tag LOCUS_11180 77666 76602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 78496 77717 gene locus_tag LOCUS_11190 78496 77717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 79436 78480 gene locus_tag LOCUS_11200 gene whiA 79436 78480 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462177.1 protein_id gnl|my_center|LOCUS_11200 80841 79486 gene locus_tag LOCUS_11210 80841 79486 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391803.1 protein_id gnl|my_center|LOCUS_11210 81748 80852 gene locus_tag LOCUS_11220 gene rapZ 81748 80852 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_11220 82592 81861 gene locus_tag LOCUS_11230 82592 81861 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393968.1 protein_id gnl|my_center|LOCUS_11230 83811 82666 gene locus_tag LOCUS_11240 83811 82666 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391945.1 protein_id gnl|my_center|LOCUS_11240 84631 83831 gene locus_tag LOCUS_11250 84631 83831 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462186.1 protein_id gnl|my_center|LOCUS_11250 85110 84766 gene locus_tag LOCUS_11260 85110 84766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 86225 85209 gene locus_tag LOCUS_11270 86225 85209 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546010.1 protein_id gnl|my_center|LOCUS_11270 86498 86340 gene locus_tag LOCUS_11280 86498 86340 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249479.1 protein_id gnl|my_center|LOCUS_11280 87187 86585 gene locus_tag LOCUS_11290 87187 86585 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_11290 88992 87184 gene locus_tag LOCUS_11300 gene uvrC 88992 87184 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_11300 89238 90563 gene locus_tag LOCUS_11310 gene accC 89238 90563 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230253.1 protein_id gnl|my_center|LOCUS_11310 93539 90699 gene locus_tag LOCUS_11320 gene uvrA 93539 90699 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_11320 95695 93605 gene locus_tag LOCUS_11330 gene uvrB 95695 93605 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_11330 96963 95719 gene locus_tag LOCUS_11340 96963 95719 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963822.1 protein_id gnl|my_center|LOCUS_11340 98416 97244 gene locus_tag LOCUS_11350 98416 97244 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_11350 99609 98470 gene locus_tag LOCUS_11360 99609 98470 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_11360 100510 99623 gene locus_tag LOCUS_11370 gene ftsX 100510 99623 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391789.1 protein_id gnl|my_center|LOCUS_11370 101186 100500 gene locus_tag LOCUS_11380 gene ftsE 101186 100500 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361935.1 protein_id gnl|my_center|LOCUS_11380 102295 101360 gene locus_tag LOCUS_11390 102295 101360 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_11390 103159 102323 gene locus_tag LOCUS_11400 103159 102323 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003389978.1 protein_id gnl|my_center|LOCUS_11400 104332 103229 gene locus_tag LOCUS_11410 gene csaB 104332 103229 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391759.1 protein_id gnl|my_center|LOCUS_11410 106380 104329 gene locus_tag LOCUS_11420 106380 104329 CDS product DUF5693 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228037.1 protein_id gnl|my_center|LOCUS_11420 107227 106535 gene locus_tag LOCUS_11430 107227 106535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 108285 107233 gene locus_tag LOCUS_11440 gene prfB 108285 107233 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096001716.1 protein_id gnl|my_center|LOCUS_11440 109645 108671 gene locus_tag LOCUS_11450 109645 108671 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392663.1 protein_id gnl|my_center|LOCUS_11450 110779 109667 gene locus_tag LOCUS_11460 110779 109667 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392664.1 protein_id gnl|my_center|LOCUS_11460 111778 110792 gene locus_tag LOCUS_11470 111778 110792 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392665.1 protein_id gnl|my_center|LOCUS_11470 114452 111942 gene locus_tag LOCUS_11480 gene secA 114452 111942 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945439.1 protein_id gnl|my_center|LOCUS_11480 115245 114706 gene locus_tag LOCUS_11490 gene raiA 115245 114706 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773749.1 protein_id gnl|my_center|LOCUS_11490 115612 115415 gene locus_tag LOCUS_11500 115612 115415 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391770.1 protein_id gnl|my_center|LOCUS_11500 116416 115694 gene locus_tag LOCUS_11510 116416 115694 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815569.1 protein_id gnl|my_center|LOCUS_11510 117068 116403 gene locus_tag LOCUS_11520 117068 116403 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392641.1 protein_id gnl|my_center|LOCUS_11520 118022 117240 gene locus_tag LOCUS_11530 118022 117240 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392640.1 protein_id gnl|my_center|LOCUS_11530 118467 118177 gene locus_tag LOCUS_11540 118467 118177 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815560.1 protein_id gnl|my_center|LOCUS_11540 118830 121817 gene locus_tag LOCUS_11550 118830 121817 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943970.1 protein_id gnl|my_center|LOCUS_11550 122233 121904 gene locus_tag LOCUS_11560 122233 121904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 122627 122235 gene locus_tag LOCUS_11570 gene fliS 122627 122235 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272503.1 protein_id gnl|my_center|LOCUS_11570 124159 122669 gene locus_tag LOCUS_11580 gene fliD 124159 122669 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460770.1 protein_id gnl|my_center|LOCUS_11580 124603 124220 gene locus_tag LOCUS_11590 124603 124220 CDS product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272514.1 protein_id gnl|my_center|LOCUS_11590 124797 127415 gene locus_tag LOCUS_11600 124797 127415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 127439 128503 gene locus_tag LOCUS_11610 gene corA 127439 128503 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942048.1 protein_id gnl|my_center|LOCUS_11610 128850 128593 gene locus_tag LOCUS_11620 128850 128593 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922754.1 protein_id gnl|my_center|LOCUS_11620 129076 128837 gene locus_tag LOCUS_11630 129076 128837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 130097 129273 gene locus_tag LOCUS_11640 130097 129273 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987021.1 protein_id gnl|my_center|LOCUS_11640 130514 130266 gene locus_tag LOCUS_11650 gene csrA 130514 130266 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460793.1 protein_id gnl|my_center|LOCUS_11650 130978 130517 gene locus_tag LOCUS_11660 gene fliW 130978 130517 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460794.1 protein_id gnl|my_center|LOCUS_11660 131691 131131 gene locus_tag LOCUS_11670 131691 131131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 132680 131688 gene locus_tag LOCUS_11680 gene flgL 132680 131688 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 protein_id gnl|my_center|LOCUS_11680 134234 132693 gene locus_tag LOCUS_11690 gene flgK 134234 132693 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392267.1 protein_id gnl|my_center|LOCUS_11690 134775 134278 gene locus_tag LOCUS_11700 134775 134278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 135087 134785 gene locus_tag LOCUS_11710 135087 134785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 135581 135183 gene locus_tag LOCUS_11720 135581 135183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 135960 136562 gene locus_tag LOCUS_11730 135960 136562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 137246 136563 gene locus_tag LOCUS_11740 137246 136563 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257716.1 protein_id gnl|my_center|LOCUS_11740 139402 137240 gene locus_tag LOCUS_11750 139402 137240 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_11750 139760 141067 gene locus_tag LOCUS_11760 139760 141067 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439092.1 protein_id gnl|my_center|LOCUS_11760 >Feature sequence07 893 1630 gene locus_tag LOCUS_11770 893 1630 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963620.1 protein_id gnl|my_center|LOCUS_11770 1953 2133 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tagggaaagttgacaaaaaagg 2504 4891 gene locus_tag LOCUS_11780 2504 4891 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022610.1 protein_id gnl|my_center|LOCUS_11780 5475 5645 gene locus_tag LOCUS_11790 5475 5645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 5671 6747 gene locus_tag LOCUS_11800 5671 6747 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460725.1 protein_id gnl|my_center|LOCUS_11800 6992 7294 gene locus_tag LOCUS_11810 6992 7294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 7935 9968 gene locus_tag LOCUS_11820 7935 9968 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945529.1 protein_id gnl|my_center|LOCUS_11820 10330 10656 gene locus_tag LOCUS_11830 10330 10656 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461845.1 protein_id gnl|my_center|LOCUS_11830 10658 11878 gene locus_tag LOCUS_11840 10658 11878 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943065.1 protein_id gnl|my_center|LOCUS_11840 12174 12917 gene locus_tag LOCUS_11850 12174 12917 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940940.1 protein_id gnl|my_center|LOCUS_11850 13185 14042 gene locus_tag LOCUS_11860 gene garR 13185 14042 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178106.1 protein_id gnl|my_center|LOCUS_11860 14366 15736 gene locus_tag LOCUS_11870 14366 15736 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207163.1 protein_id gnl|my_center|LOCUS_11870 16165 16911 gene locus_tag LOCUS_11880 16165 16911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 17944 19023 gene locus_tag LOCUS_11890 gene rsgA 17944 19023 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861937.1 protein_id gnl|my_center|LOCUS_11890 18983 19168 gene locus_tag LOCUS_11900 18983 19168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 19298 20737 gene locus_tag LOCUS_11910 19298 20737 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015295.1 protein_id gnl|my_center|LOCUS_11910 20901 21464 gene locus_tag LOCUS_11920 20901 21464 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015758443.1 protein_id gnl|my_center|LOCUS_11920 22921 21629 gene locus_tag LOCUS_11930 22921 21629 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015489.1 protein_id gnl|my_center|LOCUS_11930 23793 22957 gene locus_tag LOCUS_11940 gene panB 23793 22957 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869215.1 protein_id gnl|my_center|LOCUS_11940 25087 24296 gene locus_tag LOCUS_11950 25087 24296 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_11950 25480 26175 gene locus_tag LOCUS_11960 25480 26175 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224884.1 protein_id gnl|my_center|LOCUS_11960 26696 27994 gene locus_tag LOCUS_11970 26696 27994 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061243.1 protein_id gnl|my_center|LOCUS_11970 28047 29237 gene locus_tag LOCUS_11980 28047 29237 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975831.1 protein_id gnl|my_center|LOCUS_11980 29623 30183 gene locus_tag LOCUS_11990 29623 30183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 30180 30467 gene locus_tag LOCUS_12000 30180 30467 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398814.1 protein_id gnl|my_center|LOCUS_12000 30486 31481 gene locus_tag LOCUS_12010 30486 31481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 31580 32446 gene locus_tag LOCUS_12020 31580 32446 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932760.1 protein_id gnl|my_center|LOCUS_12020 32803 32570 gene locus_tag LOCUS_12030 32803 32570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 32690 34885 gene locus_tag LOCUS_12040 gene katG 32690 34885 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942744.1 protein_id gnl|my_center|LOCUS_12040 35721 35074 gene locus_tag LOCUS_12050 35721 35074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 36208 36714 gene locus_tag LOCUS_12060 36208 36714 CDS product L-2-amino-thiazoline-4-carboxylic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435938.1 protein_id gnl|my_center|LOCUS_12060 36767 37273 gene locus_tag LOCUS_12070 36767 37273 CDS product L-2-amino-thiazoline-4-carboxylic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435938.1 protein_id gnl|my_center|LOCUS_12070 37301 38566 gene locus_tag LOCUS_12080 37301 38566 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_12080 38690 39943 gene locus_tag LOCUS_12090 38690 39943 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807816.1 protein_id gnl|my_center|LOCUS_12090 40300 41223 gene locus_tag LOCUS_12100 40300 41223 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813240.1 protein_id gnl|my_center|LOCUS_12100 41515 41772 gene locus_tag LOCUS_12110 41515 41772 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085981.1 protein_id gnl|my_center|LOCUS_12110 41763 43439 gene locus_tag LOCUS_12120 41763 43439 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814052.1 protein_id gnl|my_center|LOCUS_12120 43596 45077 gene locus_tag LOCUS_12130 43596 45077 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306203.1 protein_id gnl|my_center|LOCUS_12130 45362 45718 gene locus_tag LOCUS_12140 45362 45718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 45768 46052 gene locus_tag LOCUS_12150 45768 46052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 46387 47403 gene locus_tag LOCUS_12160 46387 47403 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048128.1 protein_id gnl|my_center|LOCUS_12160 47462 48013 gene locus_tag LOCUS_12170 47462 48013 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967173.1 protein_id gnl|my_center|LOCUS_12170 48063 48458 gene locus_tag LOCUS_12180 48063 48458 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807790.1 protein_id gnl|my_center|LOCUS_12180 48811 49689 gene locus_tag LOCUS_12190 gene dapA 48811 49689 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391089.1 protein_id gnl|my_center|LOCUS_12190 50292 49867 gene locus_tag LOCUS_12200 50292 49867 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022482.1 protein_id gnl|my_center|LOCUS_12200 52754 50343 gene locus_tag LOCUS_12210 gene ppsA 52754 50343 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023333.1 protein_id gnl|my_center|LOCUS_12210 53058 53696 gene locus_tag LOCUS_12220 gene udk 53058 53696 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830824.1 protein_id gnl|my_center|LOCUS_12220 54248 53892 gene locus_tag LOCUS_12230 54248 53892 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081748.1 protein_id gnl|my_center|LOCUS_12230 54490 55197 gene locus_tag LOCUS_12240 54490 55197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 55313 55909 gene locus_tag LOCUS_12250 55313 55909 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242591.1 protein_id gnl|my_center|LOCUS_12250 56094 56912 gene locus_tag LOCUS_12260 56094 56912 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966749.1 protein_id gnl|my_center|LOCUS_12260 57168 57530 gene locus_tag LOCUS_12270 57168 57530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 57645 59276 gene locus_tag LOCUS_12280 57645 59276 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392693.1 protein_id gnl|my_center|LOCUS_12280 59390 60658 gene locus_tag LOCUS_12290 59390 60658 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812305.1 protein_id gnl|my_center|LOCUS_12290 60901 61071 gene locus_tag LOCUS_12300 60901 61071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 61068 61544 gene locus_tag LOCUS_12310 gene bcp 61068 61544 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963650.1 protein_id gnl|my_center|LOCUS_12310 61645 62496 gene locus_tag LOCUS_12320 61645 62496 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048320.1 protein_id gnl|my_center|LOCUS_12320 62758 62970 gene locus_tag LOCUS_12330 62758 62970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 63207 64052 gene locus_tag LOCUS_12340 63207 64052 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460667.1 protein_id gnl|my_center|LOCUS_12340 64398 64562 gene locus_tag LOCUS_12350 64398 64562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 66167 64704 gene locus_tag LOCUS_12360 66167 64704 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704217.1 protein_id gnl|my_center|LOCUS_12360 66358 66702 gene locus_tag LOCUS_12370 66358 66702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 66918 68123 gene locus_tag LOCUS_12380 66918 68123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 68149 68325 gene locus_tag LOCUS_12390 68149 68325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 68288 69550 gene locus_tag LOCUS_12400 68288 69550 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083225.1 protein_id gnl|my_center|LOCUS_12400 69547 71712 gene locus_tag LOCUS_12410 69547 71712 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861481.1 protein_id gnl|my_center|LOCUS_12410 71713 72240 gene locus_tag LOCUS_12420 71713 72240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 72412 74523 gene locus_tag LOCUS_12430 72412 74523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 74564 76006 gene locus_tag LOCUS_12440 74564 76006 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_12440 76174 77388 gene locus_tag LOCUS_12450 76174 77388 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640554.1 protein_id gnl|my_center|LOCUS_12450 77468 78772 gene locus_tag LOCUS_12460 77468 78772 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267750.1 protein_id gnl|my_center|LOCUS_12460 78980 79822 gene locus_tag LOCUS_12470 78980 79822 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047741.1 protein_id gnl|my_center|LOCUS_12470 79926 80195 gene locus_tag LOCUS_12480 79926 80195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 80554 81297 gene locus_tag LOCUS_12490 gene cobB 80554 81297 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846381.1 protein_id gnl|my_center|LOCUS_12490 81459 82496 gene locus_tag LOCUS_12500 81459 82496 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966749.1 protein_id gnl|my_center|LOCUS_12500 82835 82653 gene locus_tag LOCUS_12510 82835 82653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 83010 83756 gene locus_tag LOCUS_12520 83010 83756 CDS product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964914.1 protein_id gnl|my_center|LOCUS_12520 83774 84031 gene locus_tag LOCUS_12530 83774 84031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 84168 84638 gene locus_tag LOCUS_12540 gene bfr 84168 84638 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035731.1 protein_id gnl|my_center|LOCUS_12540 85307 84750 gene locus_tag LOCUS_12550 85307 84750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 85848 86030 gene locus_tag LOCUS_12560 85848 86030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 86136 88205 gene locus_tag LOCUS_12570 86136 88205 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462224.1 protein_id gnl|my_center|LOCUS_12570 88226 88582 gene locus_tag LOCUS_12580 88226 88582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 89047 89472 gene locus_tag LOCUS_12590 89047 89472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 90154 89645 gene locus_tag LOCUS_12600 90154 89645 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120910.1 protein_id gnl|my_center|LOCUS_12600 90650 91219 gene locus_tag LOCUS_12610 90650 91219 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023565.1 protein_id gnl|my_center|LOCUS_12610 91593 91306 gene locus_tag LOCUS_12620 91593 91306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 91834 92277 gene locus_tag LOCUS_12630 91834 92277 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940796.1 protein_id gnl|my_center|LOCUS_12630 92320 94500 gene locus_tag LOCUS_12640 gene srrA 92320 94500 CDS product respiratory selenite reductase catalytic subunit SrrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214715.1 protein_id gnl|my_center|LOCUS_12640 94504 95034 gene locus_tag LOCUS_12650 94504 95034 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459138.1 protein_id gnl|my_center|LOCUS_12650 95059 96036 gene locus_tag LOCUS_12660 95059 96036 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939203.1 protein_id gnl|my_center|LOCUS_12660 96036 97436 gene locus_tag LOCUS_12670 96036 97436 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939204.1 protein_id gnl|my_center|LOCUS_12670 97467 98105 gene locus_tag LOCUS_12680 97467 98105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 98215 99579 gene locus_tag LOCUS_12690 98215 99579 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462139.1 protein_id gnl|my_center|LOCUS_12690 99810 101054 gene locus_tag LOCUS_12700 gene lysA 99810 101054 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462285.1 protein_id gnl|my_center|LOCUS_12700 101278 102168 gene locus_tag LOCUS_12710 101278 102168 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898106.1 protein_id gnl|my_center|LOCUS_12710 102165 102857 gene locus_tag LOCUS_12720 102165 102857 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209718.1 protein_id gnl|my_center|LOCUS_12720 103028 104584 gene locus_tag LOCUS_12730 103028 104584 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461217.1 protein_id gnl|my_center|LOCUS_12730 104712 105356 gene locus_tag LOCUS_12740 104712 105356 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249655.1 protein_id gnl|my_center|LOCUS_12740 105394 106350 gene locus_tag LOCUS_12750 105394 106350 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679304.1 protein_id gnl|my_center|LOCUS_12750 106671 108485 gene locus_tag LOCUS_12760 106671 108485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 108463 109776 gene locus_tag LOCUS_12770 108463 109776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 109921 110487 gene locus_tag LOCUS_12780 109921 110487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 110758 111762 gene locus_tag LOCUS_12790 110758 111762 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074055.1 protein_id gnl|my_center|LOCUS_12790 112285 111851 gene locus_tag LOCUS_12800 112285 111851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 113615 112479 gene locus_tag LOCUS_12810 113615 112479 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393847.1 protein_id gnl|my_center|LOCUS_12810 113815 114456 gene locus_tag LOCUS_12820 113815 114456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 114582 115019 gene locus_tag LOCUS_12830 114582 115019 CDS product DUF4342 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964609.1 protein_id gnl|my_center|LOCUS_12830 115300 116481 gene locus_tag LOCUS_12840 gene metK 115300 116481 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432462.1 protein_id gnl|my_center|LOCUS_12840 116548 117420 gene locus_tag LOCUS_12850 gene amrS 116548 117420 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546747.1 protein_id gnl|my_center|LOCUS_12850 117436 118056 gene locus_tag LOCUS_12860 117436 118056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 118108 118509 gene locus_tag LOCUS_12870 118108 118509 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869120.1 protein_id gnl|my_center|LOCUS_12870 118697 119167 gene locus_tag LOCUS_12880 118697 119167 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949083.1 protein_id gnl|my_center|LOCUS_12880 119311 120852 gene locus_tag LOCUS_12890 119311 120852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 120839 121573 gene locus_tag LOCUS_12900 120839 121573 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815859.1 protein_id gnl|my_center|LOCUS_12900 121726 123378 gene locus_tag LOCUS_12910 gene ilvD 121726 123378 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861428.1 protein_id gnl|my_center|LOCUS_12910 123388 124341 gene locus_tag LOCUS_12920 123388 124341 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651842.1 protein_id gnl|my_center|LOCUS_12920 124873 125295 gene locus_tag LOCUS_12930 124873 125295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 125352 125807 gene locus_tag LOCUS_12940 125352 125807 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754241.1 protein_id gnl|my_center|LOCUS_12940 125826 126656 gene locus_tag LOCUS_12950 125826 126656 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_12950 126809 127513 gene locus_tag LOCUS_12960 126809 127513 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814489.1 protein_id gnl|my_center|LOCUS_12960 127592 128221 gene locus_tag LOCUS_12970 127592 128221 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816806.1 protein_id gnl|my_center|LOCUS_12970 128214 129206 gene locus_tag LOCUS_12980 128214 129206 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816804.1 protein_id gnl|my_center|LOCUS_12980 129451 130998 gene locus_tag LOCUS_12990 129451 130998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 132396 131509 gene locus_tag LOCUS_13000 132396 131509 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459741.1 protein_id gnl|my_center|LOCUS_13000 134305 132389 gene locus_tag LOCUS_13010 134305 132389 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403181.1 protein_id gnl|my_center|LOCUS_13010 134458 135414 gene locus_tag LOCUS_13020 134458 135414 CDS product threo-3-hydroxy-L-aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143857.1 protein_id gnl|my_center|LOCUS_13020 135478 136359 gene locus_tag LOCUS_13030 135478 136359 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801609.1 protein_id gnl|my_center|LOCUS_13030 136361 137536 gene locus_tag LOCUS_13040 136361 137536 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897664.1 protein_id gnl|my_center|LOCUS_13040 137636 137908 gene locus_tag LOCUS_13050 137636 137908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082814.1 protein_id gnl|my_center|LOCUS_13050 137973 139043 gene locus_tag LOCUS_13060 137973 139043 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460725.1 protein_id gnl|my_center|LOCUS_13060 139058 139543 gene locus_tag LOCUS_13070 gene ybaK 139058 139543 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868926.1 protein_id gnl|my_center|LOCUS_13070 139567 141063 gene locus_tag LOCUS_13080 gene thrC 139567 141063 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774945.1 protein_id gnl|my_center|LOCUS_13080 >Feature sequence08 189 1055 gene locus_tag LOCUS_13090 gene hpnK 189 1055 CDS product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941812.1 protein_id gnl|my_center|LOCUS_13090 1039 2019 gene locus_tag LOCUS_13100 1039 2019 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869831.1 protein_id gnl|my_center|LOCUS_13100 2036 2956 gene locus_tag LOCUS_13110 2036 2956 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869707.1 protein_id gnl|my_center|LOCUS_13110 2953 4497 gene locus_tag LOCUS_13120 2953 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 4509 6107 gene locus_tag LOCUS_13130 4509 6107 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546376.1 protein_id gnl|my_center|LOCUS_13130 6350 7600 gene locus_tag LOCUS_13140 gene gudB 6350 7600 CDS product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225172.1 protein_id gnl|my_center|LOCUS_13140 7935 8396 gene locus_tag LOCUS_13150 gene nrdR 7935 8396 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_13150 8427 10439 gene locus_tag LOCUS_13160 8427 10439 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963802.1 protein_id gnl|my_center|LOCUS_13160 10465 10953 gene locus_tag LOCUS_13170 gene nrdG 10465 10953 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810328.1 protein_id gnl|my_center|LOCUS_13170 11110 12885 gene locus_tag LOCUS_13180 11110 12885 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_13180 12857 13672 gene locus_tag LOCUS_13190 gene pgeF 12857 13672 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_13190 13762 14457 gene locus_tag LOCUS_13200 13762 14457 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893687.1 protein_id gnl|my_center|LOCUS_13200 14477 14902 gene locus_tag LOCUS_13210 14477 14902 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213920.1 protein_id gnl|my_center|LOCUS_13210 14942 15754 gene locus_tag LOCUS_13220 gene proC 14942 15754 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392379.1 protein_id gnl|my_center|LOCUS_13220 15754 16539 gene locus_tag LOCUS_13230 15754 16539 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355903.1 protein_id gnl|my_center|LOCUS_13230 16599 17051 gene locus_tag LOCUS_13240 gene divIVA 16599 17051 CDS product septum site-determining protein DivIVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131611.1 protein_id gnl|my_center|LOCUS_13240 17048 17371 gene locus_tag LOCUS_13250 17048 17371 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914001.1 protein_id gnl|my_center|LOCUS_13250 17724 20516 gene locus_tag LOCUS_13260 gene ileS 17724 20516 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_13260 20694 20924 gene locus_tag LOCUS_13270 20694 20924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 20944 21645 gene locus_tag LOCUS_13280 20944 21645 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986922.1 protein_id gnl|my_center|LOCUS_13280 21706 21873 gene locus_tag LOCUS_13290 21706 21873 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784522.1 protein_id gnl|my_center|LOCUS_13290 22001 22459 gene locus_tag LOCUS_13300 gene lspA 22001 22459 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392387.1 protein_id gnl|my_center|LOCUS_13300 22450 23379 gene locus_tag LOCUS_13310 22450 23379 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245307.1 protein_id gnl|my_center|LOCUS_13310 23432 23983 gene locus_tag LOCUS_13320 gene pyrR 23432 23983 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768320.1 protein_id gnl|my_center|LOCUS_13320 25794 24037 gene locus_tag LOCUS_13330 25794 24037 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_13330 25995 26834 gene locus_tag LOCUS_13340 gene dapF 25995 26834 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768322.1 protein_id gnl|my_center|LOCUS_13340 27047 27931 gene locus_tag LOCUS_13350 27047 27931 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_13350 27982 28248 gene locus_tag LOCUS_13360 27982 28248 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965024.1 protein_id gnl|my_center|LOCUS_13360 28274 28894 gene locus_tag LOCUS_13370 gene gmk 28274 28894 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460557.1 protein_id gnl|my_center|LOCUS_13370 28924 29130 gene locus_tag LOCUS_13380 gene rpoZ 28924 29130 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392411.1 protein_id gnl|my_center|LOCUS_13380 29143 30342 gene locus_tag LOCUS_13390 gene coaBC 29143 30342 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_13390 30601 31791 gene locus_tag LOCUS_13400 gene metK 30601 31791 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966140.1 protein_id gnl|my_center|LOCUS_13400 31944 34367 gene locus_tag LOCUS_13410 gene priA 31944 34367 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989822.1 protein_id gnl|my_center|LOCUS_13410 34440 34901 gene locus_tag LOCUS_13420 gene def 34440 34901 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392416.1 protein_id gnl|my_center|LOCUS_13420 34901 35842 gene locus_tag LOCUS_13430 gene fmt 34901 35842 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861609.1 protein_id gnl|my_center|LOCUS_13430 35845 36624 gene locus_tag LOCUS_13440 35845 36624 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392418.1 protein_id gnl|my_center|LOCUS_13440 36625 37953 gene locus_tag LOCUS_13450 gene rsmB 36625 37953 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460525.1 protein_id gnl|my_center|LOCUS_13450 37983 39038 gene locus_tag LOCUS_13460 gene rlmN 37983 39038 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626897.1 protein_id gnl|my_center|LOCUS_13460 39095 39862 gene locus_tag LOCUS_13470 39095 39862 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392424.1 protein_id gnl|my_center|LOCUS_13470 39864 40325 gene locus_tag LOCUS_13480 39864 40325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 40332 41054 gene locus_tag LOCUS_13490 gene prpC 40332 41054 CDS product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 protein_id gnl|my_center|LOCUS_13490 41058 42314 gene locus_tag LOCUS_13500 41058 42314 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392427.1 protein_id gnl|my_center|LOCUS_13500 42311 43726 gene locus_tag LOCUS_13510 42311 43726 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392428.1 protein_id gnl|my_center|LOCUS_13510 43739 45619 gene locus_tag LOCUS_13520 gene pknB 43739 45619 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392429.1 protein_id gnl|my_center|LOCUS_13520 45635 46510 gene locus_tag LOCUS_13530 gene rsgA 45635 46510 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392430.1 protein_id gnl|my_center|LOCUS_13530 46513 47160 gene locus_tag LOCUS_13540 gene rpe 46513 47160 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_13540 47460 48578 gene locus_tag LOCUS_13550 gene ribD 47460 48578 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_13550 48559 49209 gene locus_tag LOCUS_13560 48559 49209 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459819.1 protein_id gnl|my_center|LOCUS_13560 49235 50437 gene locus_tag LOCUS_13570 49235 50437 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392434.1 protein_id gnl|my_center|LOCUS_13570 50490 50954 gene locus_tag LOCUS_13580 gene ribE 50490 50954 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811752.1 protein_id gnl|my_center|LOCUS_13580 51296 51105 gene locus_tag LOCUS_13590 gene rpmB 51296 51105 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813371.1 protein_id gnl|my_center|LOCUS_13590 51492 51692 gene locus_tag LOCUS_13600 51492 51692 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392439.1 protein_id gnl|my_center|LOCUS_13600 51814 53856 gene locus_tag LOCUS_13610 gene recG 51814 53856 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_13610 53997 54683 gene locus_tag LOCUS_13620 53997 54683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 54738 54923 gene locus_tag LOCUS_13630 54738 54923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 54992 55483 gene locus_tag LOCUS_13640 54992 55483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 55612 57066 gene locus_tag LOCUS_13650 gene guaB 55612 57066 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226803.1 protein_id gnl|my_center|LOCUS_13650 57265 58005 gene locus_tag LOCUS_13660 57265 58005 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393842.1 protein_id gnl|my_center|LOCUS_13660 58116 58754 gene locus_tag LOCUS_13670 58116 58754 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327813.1 protein_id gnl|my_center|LOCUS_13670 58751 59434 gene locus_tag LOCUS_13680 gene pssA 58751 59434 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853992.1 protein_id gnl|my_center|LOCUS_13680 59574 60857 gene locus_tag LOCUS_13690 59574 60857 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808136.1 protein_id gnl|my_center|LOCUS_13690 61010 61390 gene locus_tag LOCUS_13700 gene queD 61010 61390 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942365.1 protein_id gnl|my_center|LOCUS_13700 61427 62182 gene locus_tag LOCUS_13710 gene surE 61427 62182 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392658.1 protein_id gnl|my_center|LOCUS_13710 62300 62956 gene locus_tag LOCUS_13720 62300 62956 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393503.1 protein_id gnl|my_center|LOCUS_13720 62974 63771 gene locus_tag LOCUS_13730 gene mtnP 62974 63771 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583293.1 protein_id gnl|my_center|LOCUS_13730 63817 64842 gene locus_tag LOCUS_13740 gene mtnA 63817 64842 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080652.1 protein_id gnl|my_center|LOCUS_13740 64845 66086 gene locus_tag LOCUS_13750 64845 66086 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345604.1 protein_id gnl|my_center|LOCUS_13750 66079 66762 gene locus_tag LOCUS_13760 66079 66762 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460450.1 protein_id gnl|my_center|LOCUS_13760 66766 68055 gene locus_tag LOCUS_13770 66766 68055 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583295.1 protein_id gnl|my_center|LOCUS_13770 68185 69354 gene locus_tag LOCUS_13780 68185 69354 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272338.1 protein_id gnl|my_center|LOCUS_13780 69378 69725 gene locus_tag LOCUS_13790 69378 69725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 69773 70351 gene locus_tag LOCUS_13800 69773 70351 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944972.1 protein_id gnl|my_center|LOCUS_13800 70507 71283 gene locus_tag LOCUS_13810 70507 71283 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018701913.1 protein_id gnl|my_center|LOCUS_13810 71352 71555 gene locus_tag LOCUS_13820 71352 71555 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357528.1 protein_id gnl|my_center|LOCUS_13820 71574 72641 gene locus_tag LOCUS_13830 71574 72641 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357407.1 protein_id gnl|my_center|LOCUS_13830 72643 73392 gene locus_tag LOCUS_13840 72643 73392 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420710.1 protein_id gnl|my_center|LOCUS_13840 73389 73934 gene locus_tag LOCUS_13850 73389 73934 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869337.1 protein_id gnl|my_center|LOCUS_13850 74140 75654 gene locus_tag LOCUS_13860 74140 75654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 75680 76366 gene locus_tag LOCUS_13870 75680 76366 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060848.1 protein_id gnl|my_center|LOCUS_13870 76378 77100 gene locus_tag LOCUS_13880 76378 77100 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582685.1 protein_id gnl|my_center|LOCUS_13880 77159 77779 gene locus_tag LOCUS_13890 77159 77779 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812143.1 protein_id gnl|my_center|LOCUS_13890 77928 78263 gene locus_tag LOCUS_13900 77928 78263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 78766 78269 gene locus_tag LOCUS_13910 78766 78269 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903575.1 protein_id gnl|my_center|LOCUS_13910 78891 79481 gene locus_tag LOCUS_13920 78891 79481 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020385.1 protein_id gnl|my_center|LOCUS_13920 80322 79639 gene locus_tag LOCUS_13930 80322 79639 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986926.1 protein_id gnl|my_center|LOCUS_13930 81743 80322 gene locus_tag LOCUS_13940 81743 80322 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839765.1 protein_id gnl|my_center|LOCUS_13940 82450 81800 gene locus_tag LOCUS_13950 82450 81800 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_13950 82936 82487 gene locus_tag LOCUS_13960 82936 82487 CDS product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942956.1 protein_id gnl|my_center|LOCUS_13960 84535 83141 gene locus_tag LOCUS_13970 84535 83141 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460967.1 protein_id gnl|my_center|LOCUS_13970 85354 84593 gene locus_tag LOCUS_13980 85354 84593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 85684 85394 gene locus_tag LOCUS_13990 85684 85394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 87075 85819 gene locus_tag LOCUS_14000 87075 85819 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460286.1 protein_id gnl|my_center|LOCUS_14000 88899 87079 gene locus_tag LOCUS_14010 gene hflX 88899 87079 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965596.1 protein_id gnl|my_center|LOCUS_14010 89837 88956 gene locus_tag LOCUS_14020 gene hslO 89837 88956 CDS product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226695.1 protein_id gnl|my_center|LOCUS_14020 90472 89882 gene locus_tag LOCUS_14030 90472 89882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 91127 90525 gene locus_tag LOCUS_14040 91127 90525 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840540.1 protein_id gnl|my_center|LOCUS_14040 91784 91128 gene locus_tag LOCUS_14050 gene queC 91784 91128 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711595.1 protein_id gnl|my_center|LOCUS_14050 92119 91862 gene locus_tag LOCUS_14060 92119 91862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 93097 92159 gene locus_tag LOCUS_14070 gene miaA 93097 92159 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245569.1 protein_id gnl|my_center|LOCUS_14070 93891 93085 gene locus_tag LOCUS_14080 93891 93085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 95749 93971 gene locus_tag LOCUS_14090 gene mutL 95749 93971 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392628.1 protein_id gnl|my_center|LOCUS_14090 98343 95746 gene locus_tag LOCUS_14100 gene mutS 98343 95746 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047675.1 protein_id gnl|my_center|LOCUS_14100 99690 98347 gene locus_tag LOCUS_14110 gene miaB 99690 98347 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392626.1 protein_id gnl|my_center|LOCUS_14110 100286 99918 gene locus_tag LOCUS_14120 100286 99918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14120 100639 100283 gene locus_tag LOCUS_14130 100639 100283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14130 101546 100722 gene locus_tag LOCUS_14140 101546 100722 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392700.1 protein_id gnl|my_center|LOCUS_14140 102416 101571 gene locus_tag LOCUS_14150 102416 101571 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_14150 103923 102406 gene locus_tag LOCUS_14160 103923 102406 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_14160 104362 104102 gene locus_tag LOCUS_14170 gene spoVS 104362 104102 CDS product stage V sporulation protein SpoVS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459952.1 protein_id gnl|my_center|LOCUS_14170 105265 104483 gene locus_tag LOCUS_14180 105265 104483 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_14180 105821 105303 gene locus_tag LOCUS_14190 105821 105303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392596.1 protein_id gnl|my_center|LOCUS_14190 106743 105907 gene locus_tag LOCUS_14200 gene nadC 106743 105907 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360683.1 protein_id gnl|my_center|LOCUS_14200 108574 107027 gene locus_tag LOCUS_14210 gene rny 108574 107027 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_14210 109237 108755 gene locus_tag LOCUS_14220 109237 108755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 110246 109209 gene locus_tag LOCUS_14230 gene recA 110246 109209 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_14230 111926 110337 gene locus_tag LOCUS_14240 111926 110337 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272339.1 protein_id gnl|my_center|LOCUS_14240 113181 111913 gene locus_tag LOCUS_14250 113181 111913 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_14250 114553 113216 gene locus_tag LOCUS_14260 gene rimO 114553 113216 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_14260 115616 114564 gene locus_tag LOCUS_14270 115616 114564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 115782 116228 gene locus_tag LOCUS_14280 115782 116228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 118130 116244 gene locus_tag LOCUS_14290 118130 116244 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948014.1 protein_id gnl|my_center|LOCUS_14290 118345 118142 gene locus_tag LOCUS_14300 118345 118142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 119091 118369 gene locus_tag LOCUS_14310 119091 118369 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812890.1 protein_id gnl|my_center|LOCUS_14310 120139 119075 gene locus_tag LOCUS_14320 gene mnmH 120139 119075 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812887.1 protein_id gnl|my_center|LOCUS_14320 122458 120299 gene locus_tag LOCUS_14330 122458 120299 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392586.1 protein_id gnl|my_center|LOCUS_14330 123563 122682 gene locus_tag LOCUS_14340 gene dapA 123563 122682 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392582.1 protein_id gnl|my_center|LOCUS_14340 124852 123626 gene locus_tag LOCUS_14350 gene dapG 124852 123626 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808827.1 protein_id gnl|my_center|LOCUS_14350 125897 124866 gene locus_tag LOCUS_14360 125897 124866 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460383.1 protein_id gnl|my_center|LOCUS_14360 126769 125972 gene locus_tag LOCUS_14370 gene dapB 126769 125972 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808837.1 protein_id gnl|my_center|LOCUS_14370 127635 127177 gene locus_tag LOCUS_14380 127635 127177 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905176.1 protein_id gnl|my_center|LOCUS_14380 129950 127878 gene locus_tag LOCUS_14390 129950 127878 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460388.1 protein_id gnl|my_center|LOCUS_14390 >Feature sequence09 367 101 gene locus_tag LOCUS_14400 gene rpsO 367 101 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808855.1 protein_id gnl|my_center|LOCUS_14400 1472 546 gene locus_tag LOCUS_14410 1472 546 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808857.1 protein_id gnl|my_center|LOCUS_14410 2400 1528 gene locus_tag LOCUS_14420 gene truB 2400 1528 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392567.1 protein_id gnl|my_center|LOCUS_14420 3362 2397 gene locus_tag LOCUS_14430 3362 2397 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_14430 3724 3365 gene locus_tag LOCUS_14440 gene rbfA 3724 3365 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776437.1 protein_id gnl|my_center|LOCUS_14440 5505 3745 gene locus_tag LOCUS_14450 5505 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 5568 6110 gene locus_tag LOCUS_14460 5568 6110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 6651 6346 gene locus_tag LOCUS_14470 6651 6346 CDS product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041387.1 protein_id gnl|my_center|LOCUS_14470 6917 6651 gene locus_tag LOCUS_14480 6917 6651 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_14480 7971 6928 gene locus_tag LOCUS_14490 7971 6928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 8468 8010 gene locus_tag LOCUS_14500 gene rimP 8468 8010 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460396.1 protein_id gnl|my_center|LOCUS_14500 12446 8772 gene locus_tag LOCUS_14510 12446 8772 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541505.1 protein_id gnl|my_center|LOCUS_14510 14245 12539 gene locus_tag LOCUS_14520 14245 12539 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460410.1 protein_id gnl|my_center|LOCUS_14520 15314 14247 gene locus_tag LOCUS_14530 gene ispG 15314 14247 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_14530 16365 15334 gene locus_tag LOCUS_14540 gene rseP 16365 15334 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392556.1 protein_id gnl|my_center|LOCUS_14540 17561 16404 gene locus_tag LOCUS_14550 17561 16404 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241803.1 protein_id gnl|my_center|LOCUS_14550 18418 17591 gene locus_tag LOCUS_14560 18418 17591 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392553.1 protein_id gnl|my_center|LOCUS_14560 19211 18426 gene locus_tag LOCUS_14570 19211 18426 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_14570 19571 19371 gene locus_tag LOCUS_14580 19571 19371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 20135 19575 gene locus_tag LOCUS_14590 gene frr 20135 19575 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810666.1 protein_id gnl|my_center|LOCUS_14590 20850 20113 gene locus_tag LOCUS_14600 gene pyrH 20850 20113 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392548.1 protein_id gnl|my_center|LOCUS_14600 21823 21167 gene locus_tag LOCUS_14610 gene tsf 21823 21167 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460416.1 protein_id gnl|my_center|LOCUS_14610 22697 21999 gene locus_tag LOCUS_14620 gene rpsB 22697 21999 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460417.1 protein_id gnl|my_center|LOCUS_14620 23390 22857 gene locus_tag LOCUS_14630 23390 22857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 23744 23400 gene locus_tag LOCUS_14640 23744 23400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 25441 23816 gene locus_tag LOCUS_14650 25441 23816 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535110.1 protein_id gnl|my_center|LOCUS_14650 26217 25459 gene locus_tag LOCUS_14660 gene whiG 26217 25459 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039671.1 protein_id gnl|my_center|LOCUS_14660 26571 26248 gene locus_tag LOCUS_14670 26571 26248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 27072 26587 gene locus_tag LOCUS_14680 27072 26587 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816201.1 protein_id gnl|my_center|LOCUS_14680 27692 27072 gene locus_tag LOCUS_14690 27692 27072 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774235.1 protein_id gnl|my_center|LOCUS_14690 28180 27734 gene locus_tag LOCUS_14700 28180 27734 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_14700 30236 28206 gene locus_tag LOCUS_14710 30236 28206 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965518.1 protein_id gnl|my_center|LOCUS_14710 31297 30251 gene locus_tag LOCUS_14720 31297 30251 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868672.1 protein_id gnl|my_center|LOCUS_14720 31820 31323 gene locus_tag LOCUS_14730 31820 31323 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392314.1 protein_id gnl|my_center|LOCUS_14730 32879 31992 gene locus_tag LOCUS_14740 32879 31992 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460747.1 protein_id gnl|my_center|LOCUS_14740 33940 32879 gene locus_tag LOCUS_14750 gene flhF 33940 32879 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460748.1 protein_id gnl|my_center|LOCUS_14750 36004 33941 gene locus_tag LOCUS_14760 gene flhA 36004 33941 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460749.1 protein_id gnl|my_center|LOCUS_14760 37199 36054 gene locus_tag LOCUS_14770 gene flhB 37199 36054 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_14770 37935 37153 gene locus_tag LOCUS_14780 gene fliR 37935 37153 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245510.1 protein_id gnl|my_center|LOCUS_14780 38224 37955 gene locus_tag LOCUS_14790 gene fliQ 38224 37955 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220888.1 protein_id gnl|my_center|LOCUS_14790 38992 38237 gene locus_tag LOCUS_14800 gene fliP 38992 38237 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_14800 39562 38999 gene locus_tag LOCUS_14810 39562 38999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 39927 39565 gene locus_tag LOCUS_14820 39927 39565 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392324.1 protein_id gnl|my_center|LOCUS_14820 41101 39968 gene locus_tag LOCUS_14830 gene fliY 41101 39968 CDS product flagellar motor switch phosphatase FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460753.1 protein_id gnl|my_center|LOCUS_14830 42092 41094 gene locus_tag LOCUS_14840 gene fliM 42092 41094 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183958.1 protein_id gnl|my_center|LOCUS_14840 42616 42152 gene locus_tag LOCUS_14850 42616 42152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 43443 42661 gene locus_tag LOCUS_14860 43443 42661 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460801.1 protein_id gnl|my_center|LOCUS_14860 43655 43458 gene locus_tag LOCUS_14870 43655 43458 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081092.1 protein_id gnl|my_center|LOCUS_14870 45109 43844 gene locus_tag LOCUS_14880 gene flgE 45109 43844 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680830.1 protein_id gnl|my_center|LOCUS_14880 45691 45290 gene locus_tag LOCUS_14890 45691 45290 CDS product TIGR02530 family flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941086.1 protein_id gnl|my_center|LOCUS_14890 46114 45698 gene locus_tag LOCUS_14900 46114 45698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 47589 46135 gene locus_tag LOCUS_14910 47589 46135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 48262 47672 gene locus_tag LOCUS_14920 48262 47672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 48803 48285 gene locus_tag LOCUS_14930 48803 48285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 49259 48804 gene locus_tag LOCUS_14940 49259 48804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 50599 49271 gene locus_tag LOCUS_14950 gene fliI 50599 49271 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_14950 51321 50596 gene locus_tag LOCUS_14960 51321 50596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 52324 51314 gene locus_tag LOCUS_14970 gene fliG 52324 51314 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932791.1 protein_id gnl|my_center|LOCUS_14970 53888 52347 gene locus_tag LOCUS_14980 gene fliF 53888 52347 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870079.1 protein_id gnl|my_center|LOCUS_14980 54276 53968 gene locus_tag LOCUS_14990 gene fliE 54276 53968 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238544.1 protein_id gnl|my_center|LOCUS_14990 54745 54302 gene locus_tag LOCUS_15000 gene flgC 54745 54302 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941076.1 protein_id gnl|my_center|LOCUS_15000 55155 54742 gene locus_tag LOCUS_15010 gene flgB 55155 54742 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392289.1 protein_id gnl|my_center|LOCUS_15010 56347 55571 gene locus_tag LOCUS_15020 gene codY 56347 55571 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810676.1 protein_id gnl|my_center|LOCUS_15020 57807 56413 gene locus_tag LOCUS_15030 gene hslU 57807 56413 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550088.1 protein_id gnl|my_center|LOCUS_15030 58365 57835 gene locus_tag LOCUS_15040 gene hslV 58365 57835 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392543.1 protein_id gnl|my_center|LOCUS_15040 59281 58376 gene locus_tag LOCUS_15050 gene xerC 59281 58376 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392542.1 protein_id gnl|my_center|LOCUS_15050 60670 59351 gene locus_tag LOCUS_15060 gene trmFO 60670 59351 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989721.1 protein_id gnl|my_center|LOCUS_15060 62807 60663 gene locus_tag LOCUS_15070 gene topA 62807 60663 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541498.1 protein_id gnl|my_center|LOCUS_15070 63886 62804 gene locus_tag LOCUS_15080 gene dprA 63886 62804 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392539.1 protein_id gnl|my_center|LOCUS_15080 65134 63986 gene locus_tag LOCUS_15090 65134 63986 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966180.1 protein_id gnl|my_center|LOCUS_15090 65636 65124 gene locus_tag LOCUS_15100 gene folK 65636 65124 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391686.1 protein_id gnl|my_center|LOCUS_15100 65998 65633 gene locus_tag LOCUS_15110 gene folB 65998 65633 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861219.1 protein_id gnl|my_center|LOCUS_15110 67196 65991 gene locus_tag LOCUS_15120 gene folP 67196 65991 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391658.1 protein_id gnl|my_center|LOCUS_15120 67314 68363 gene locus_tag LOCUS_15130 67314 68363 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658369.1 protein_id gnl|my_center|LOCUS_15130 70075 68564 gene locus_tag LOCUS_15140 70075 68564 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392536.1 protein_id gnl|my_center|LOCUS_15140 70460 70092 gene locus_tag LOCUS_15150 70460 70092 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384683.1 protein_id gnl|my_center|LOCUS_15150 70753 70457 gene locus_tag LOCUS_15160 70753 70457 CDS product FlhB-like flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232001.1 protein_id gnl|my_center|LOCUS_15160 72026 70746 gene locus_tag LOCUS_15170 72026 70746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 72668 72105 gene locus_tag LOCUS_15180 gene rnhB 72668 72105 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534532.1 protein_id gnl|my_center|LOCUS_15180 73545 72691 gene locus_tag LOCUS_15190 gene ylqF 73545 72691 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236704.1 protein_id gnl|my_center|LOCUS_15190 74100 73573 gene locus_tag LOCUS_15200 gene lepB 74100 73573 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_15200 74525 74184 gene locus_tag LOCUS_15210 gene rplS 74525 74184 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813207.1 protein_id gnl|my_center|LOCUS_15210 75222 74638 gene locus_tag LOCUS_15220 75222 74638 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904383.1 protein_id gnl|my_center|LOCUS_15220 75970 75224 gene locus_tag LOCUS_15230 gene trmD 75970 75224 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686903.1 protein_id gnl|my_center|LOCUS_15230 76473 75970 gene locus_tag LOCUS_15240 gene rimM 76473 75970 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232013.1 protein_id gnl|my_center|LOCUS_15240 76886 76479 gene locus_tag LOCUS_15250 76886 76479 CDS product YlqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141484.1 protein_id gnl|my_center|LOCUS_15250 77128 76901 gene locus_tag LOCUS_15260 77128 76901 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362589.1 protein_id gnl|my_center|LOCUS_15260 77415 77134 gene locus_tag LOCUS_15270 gene rpsP 77415 77134 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357434.1 protein_id gnl|my_center|LOCUS_15270 78800 77460 gene locus_tag LOCUS_15280 gene ffh 78800 77460 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392481.1 protein_id gnl|my_center|LOCUS_15280 79162 78818 gene locus_tag LOCUS_15290 79162 78818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 80158 79241 gene locus_tag LOCUS_15300 gene ftsY 80158 79241 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941793.1 protein_id gnl|my_center|LOCUS_15300 83739 80182 gene locus_tag LOCUS_15310 gene smc 83739 80182 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478987.1 protein_id gnl|my_center|LOCUS_15310 84945 83890 gene locus_tag LOCUS_15320 84945 83890 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016184.1 protein_id gnl|my_center|LOCUS_15320 85722 84991 gene locus_tag LOCUS_15330 gene rnc 85722 84991 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460498.1 protein_id gnl|my_center|LOCUS_15330 86966 85725 gene locus_tag LOCUS_15340 gene fabF 86966 85725 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_15340 87927 86980 gene locus_tag LOCUS_15350 87927 86980 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813418.1 protein_id gnl|my_center|LOCUS_15350 88256 88020 gene locus_tag LOCUS_15360 gene acpP 88256 88020 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902726.1 protein_id gnl|my_center|LOCUS_15360 89056 88313 gene locus_tag LOCUS_15370 gene fabG 89056 88313 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_15370 90005 89058 gene locus_tag LOCUS_15380 gene fabD 90005 89058 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_15380 90970 90026 gene locus_tag LOCUS_15390 gene fabK 90970 90026 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460502.1 protein_id gnl|my_center|LOCUS_15390 91979 90963 gene locus_tag LOCUS_15400 91979 90963 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_15400 92988 91966 gene locus_tag LOCUS_15410 gene plsX 92988 91966 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_15410 93559 93005 gene locus_tag LOCUS_15420 gene fapR 93559 93005 CDS product transcription factor FapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869849.1 protein_id gnl|my_center|LOCUS_15420 93873 93697 gene locus_tag LOCUS_15430 gene rpmF 93873 93697 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965052.1 protein_id gnl|my_center|LOCUS_15430 94441 93923 gene locus_tag LOCUS_15440 94441 93923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 95764 94562 gene locus_tag LOCUS_15450 95764 94562 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986808.1 protein_id gnl|my_center|LOCUS_15450 95984 97225 gene locus_tag LOCUS_15460 95984 97225 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965048.1 protein_id gnl|my_center|LOCUS_15460 98058 97288 gene locus_tag LOCUS_15470 98058 97288 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662583.1 protein_id gnl|my_center|LOCUS_15470 98558 98070 gene locus_tag LOCUS_15480 98558 98070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 99091 98594 gene locus_tag LOCUS_15490 gene coaD 99091 98594 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200601.1 protein_id gnl|my_center|LOCUS_15490 99667 99110 gene locus_tag LOCUS_15500 gene rsmD 99667 99110 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266978.1 protein_id gnl|my_center|LOCUS_15500 100079 101785 gene locus_tag LOCUS_15510 100079 101785 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256992.1 protein_id gnl|my_center|LOCUS_15510 102530 101796 gene locus_tag LOCUS_15520 102530 101796 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811530.1 protein_id gnl|my_center|LOCUS_15520 102696 102772 gene locus_tag LOCUS_t00280 102696 102772 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 104920 102836 gene locus_tag LOCUS_15530 gene fusA 104920 102836 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_15530 105661 105155 gene locus_tag LOCUS_15540 105661 105155 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_15540 106095 105661 gene locus_tag LOCUS_15550 106095 105661 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870778.1 protein_id gnl|my_center|LOCUS_15550 107087 106221 gene locus_tag LOCUS_15560 gene htpX 107087 106221 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942212.1 protein_id gnl|my_center|LOCUS_15560 107657 107217 gene locus_tag LOCUS_15570 107657 107217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 108939 107686 gene locus_tag LOCUS_15580 108939 107686 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228287.1 protein_id gnl|my_center|LOCUS_15580 109163 111184 gene locus_tag LOCUS_15590 109163 111184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 111239 112729 gene locus_tag LOCUS_15600 111239 112729 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937982.1 protein_id gnl|my_center|LOCUS_15600 112954 114087 gene locus_tag LOCUS_15610 112954 114087 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816112.1 protein_id gnl|my_center|LOCUS_15610 114154 115470 gene locus_tag LOCUS_15620 114154 115470 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080853745.1 protein_id gnl|my_center|LOCUS_15620 115467 116417 gene locus_tag LOCUS_15630 115467 116417 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565823.1 protein_id gnl|my_center|LOCUS_15630 116417 117238 gene locus_tag LOCUS_15640 116417 117238 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089094.1 protein_id gnl|my_center|LOCUS_15640 117272 118270 gene locus_tag LOCUS_15650 117272 118270 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089093.1 protein_id gnl|my_center|LOCUS_15650 118642 119859 gene locus_tag LOCUS_15660 gene tyrS 118642 119859 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_15660 120345 119914 gene locus_tag LOCUS_15670 120345 119914 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289398.1 protein_id gnl|my_center|LOCUS_15670 120592 122322 gene locus_tag LOCUS_15680 120592 122322 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009922704.1 protein_id gnl|my_center|LOCUS_15680 122974 122390 gene locus_tag LOCUS_15690 122974 122390 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397458.1 protein_id gnl|my_center|LOCUS_15690 123449 123150 gene locus_tag LOCUS_15700 123449 123150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 123830 123630 gene locus_tag LOCUS_15710 123830 123630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 124241 124591 gene locus_tag LOCUS_15720 124241 124591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 124933 124727 gene locus_tag LOCUS_15730 gene rpoZ 124933 124727 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811864.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence10 200 2179 gene locus_tag LOCUS_15740 200 2179 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022610.1 protein_id gnl|my_center|LOCUS_15740 2676 3851 gene locus_tag LOCUS_15750 2676 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 4666 4142 gene locus_tag LOCUS_15760 4666 4142 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810340.1 protein_id gnl|my_center|LOCUS_15760 4784 7336 gene locus_tag LOCUS_15770 4784 7336 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086596.1 protein_id gnl|my_center|LOCUS_15770 9054 7408 gene locus_tag LOCUS_15780 gene hcp 9054 7408 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272545.1 protein_id gnl|my_center|LOCUS_15780 9909 9157 gene locus_tag LOCUS_15790 9909 9157 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462044.1 protein_id gnl|my_center|LOCUS_15790 10469 10050 gene locus_tag LOCUS_15800 10469 10050 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405004.1 protein_id gnl|my_center|LOCUS_15800 10636 11241 gene locus_tag LOCUS_15810 10636 11241 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267941.1 protein_id gnl|my_center|LOCUS_15810 12152 11304 gene locus_tag LOCUS_15820 12152 11304 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707673.1 protein_id gnl|my_center|LOCUS_15820 12367 12663 gene locus_tag LOCUS_15830 12367 12663 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066603.1 protein_id gnl|my_center|LOCUS_15830 13171 14382 gene locus_tag LOCUS_15840 13171 14382 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393979.1 protein_id gnl|my_center|LOCUS_15840 15134 14487 gene locus_tag LOCUS_15850 15134 14487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 17282 15324 gene locus_tag LOCUS_15860 gene htpG 17282 15324 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943026.1 protein_id gnl|my_center|LOCUS_15860 17539 18753 gene locus_tag LOCUS_15870 17539 18753 CDS product DUF401 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812214.1 protein_id gnl|my_center|LOCUS_15870 18785 20014 gene locus_tag LOCUS_15880 18785 20014 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459866.1 protein_id gnl|my_center|LOCUS_15880 20349 21344 gene locus_tag LOCUS_15890 20349 21344 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460503.1 protein_id gnl|my_center|LOCUS_15890 21946 22224 gene locus_tag LOCUS_15900 21946 22224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 22264 23928 gene locus_tag LOCUS_15910 22264 23928 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_15910 24605 24883 gene locus_tag LOCUS_15920 24605 24883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 24909 25904 gene locus_tag LOCUS_15930 gene ilvC 24909 25904 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816729.1 protein_id gnl|my_center|LOCUS_15930 25930 27606 gene locus_tag LOCUS_15940 gene ilvB 25930 27606 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_15940 29737 27611 gene locus_tag LOCUS_15950 29737 27611 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461760.1 protein_id gnl|my_center|LOCUS_15950 31187 29916 gene locus_tag LOCUS_15960 gene larA 31187 29916 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484568.1 protein_id gnl|my_center|LOCUS_15960 31405 32181 gene locus_tag LOCUS_15970 31405 32181 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941438.1 protein_id gnl|my_center|LOCUS_15970 32415 33365 gene locus_tag LOCUS_15980 32415 33365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 33393 34061 gene locus_tag LOCUS_15990 33393 34061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986295.1 protein_id gnl|my_center|LOCUS_15990 34267 34109 gene locus_tag LOCUS_16000 34267 34109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 34247 34690 gene locus_tag LOCUS_16010 34247 34690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 34687 34863 gene locus_tag LOCUS_16020 34687 34863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 34951 37320 gene locus_tag LOCUS_16030 34951 37320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 37401 39053 gene locus_tag LOCUS_16040 gene pgm 37401 39053 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705434.1 protein_id gnl|my_center|LOCUS_16040 39155 39589 gene locus_tag LOCUS_16050 gene mscL 39155 39589 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_16050 41567 39666 gene locus_tag LOCUS_16060 41567 39666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 41762 42802 gene locus_tag LOCUS_16070 41762 42802 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272527.1 protein_id gnl|my_center|LOCUS_16070 42924 43382 gene locus_tag LOCUS_16080 42924 43382 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020665.1 protein_id gnl|my_center|LOCUS_16080 43433 43663 gene locus_tag LOCUS_16090 43433 43663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 43692 44189 gene locus_tag LOCUS_16100 gene msrA 43692 44189 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986464.1 protein_id gnl|my_center|LOCUS_16100 44703 44296 gene locus_tag LOCUS_16110 44703 44296 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_16110 44824 45141 gene locus_tag LOCUS_16120 44824 45141 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077234.1 protein_id gnl|my_center|LOCUS_16120 45805 45485 gene locus_tag LOCUS_16130 45805 45485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 45935 46405 gene locus_tag LOCUS_16140 45935 46405 CDS product DUF188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460027.1 protein_id gnl|my_center|LOCUS_16140 46402 47196 gene locus_tag LOCUS_16150 46402 47196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875784.1 protein_id gnl|my_center|LOCUS_16150 47572 47216 gene locus_tag LOCUS_16160 47572 47216 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459031.1 protein_id gnl|my_center|LOCUS_16160 47706 48872 gene locus_tag LOCUS_16170 47706 48872 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272331.1 protein_id gnl|my_center|LOCUS_16170 48973 50877 gene locus_tag LOCUS_16180 48973 50877 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460031.1 protein_id gnl|my_center|LOCUS_16180 50909 51106 gene locus_tag LOCUS_16190 50909 51106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 51152 51535 gene locus_tag LOCUS_16200 gene panD 51152 51535 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490184.1 protein_id gnl|my_center|LOCUS_16200 51595 51927 gene locus_tag LOCUS_16210 51595 51927 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396628.1 protein_id gnl|my_center|LOCUS_16210 52086 53108 gene locus_tag LOCUS_16220 52086 53108 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942020.1 protein_id gnl|my_center|LOCUS_16220 53204 54583 gene locus_tag LOCUS_16230 53204 54583 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809528.1 protein_id gnl|my_center|LOCUS_16230 54645 55607 gene locus_tag LOCUS_16240 54645 55607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 55620 55814 gene locus_tag LOCUS_16250 55620 55814 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014310.1 protein_id gnl|my_center|LOCUS_16250 56013 57575 gene locus_tag LOCUS_16260 56013 57575 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812879.1 protein_id gnl|my_center|LOCUS_16260 59334 57640 gene locus_tag LOCUS_16270 59334 57640 CDS product fumarate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869524.1 protein_id gnl|my_center|LOCUS_16270 59702 59331 gene locus_tag LOCUS_16280 59702 59331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 59913 61280 gene locus_tag LOCUS_16290 59913 61280 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983287.1 protein_id gnl|my_center|LOCUS_16290 61341 62105 gene locus_tag LOCUS_16300 61341 62105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 62231 62641 gene locus_tag LOCUS_16310 62231 62641 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530166.1 protein_id gnl|my_center|LOCUS_16310 62727 62930 gene locus_tag LOCUS_16320 62727 62930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 64308 63073 gene locus_tag LOCUS_16330 64308 63073 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461084.1 protein_id gnl|my_center|LOCUS_16330 64465 65556 gene locus_tag LOCUS_16340 gene mutY 64465 65556 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171406.1 protein_id gnl|my_center|LOCUS_16340 65632 67125 gene locus_tag LOCUS_16350 65632 67125 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392040.1 protein_id gnl|my_center|LOCUS_16350 67988 67197 gene locus_tag LOCUS_16360 67988 67197 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_16360 68255 69106 gene locus_tag LOCUS_16370 gene panB 68255 69106 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966197.1 protein_id gnl|my_center|LOCUS_16370 69176 70855 gene locus_tag LOCUS_16380 69176 70855 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809880.1 protein_id gnl|my_center|LOCUS_16380 71014 72228 gene locus_tag LOCUS_16390 71014 72228 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582561.1 protein_id gnl|my_center|LOCUS_16390 72273 72836 gene locus_tag LOCUS_16400 72273 72836 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267101.1 protein_id gnl|my_center|LOCUS_16400 73051 73353 gene locus_tag LOCUS_16410 73051 73353 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459031.1 protein_id gnl|my_center|LOCUS_16410 74307 73411 gene locus_tag LOCUS_16420 74307 73411 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435316.1 protein_id gnl|my_center|LOCUS_16420 74482 78258 gene locus_tag LOCUS_16430 74482 78258 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272602.1 protein_id gnl|my_center|LOCUS_16430 78483 78683 gene locus_tag LOCUS_16440 78483 78683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 78574 79737 gene locus_tag LOCUS_16450 78574 79737 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_16450 79904 80710 gene locus_tag LOCUS_16460 gene speD 79904 80710 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461599.1 protein_id gnl|my_center|LOCUS_16460 80884 81324 gene locus_tag LOCUS_16470 80884 81324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 81314 82978 gene locus_tag LOCUS_16480 gene argS 81314 82978 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393887.1 protein_id gnl|my_center|LOCUS_16480 83046 83411 gene locus_tag LOCUS_16490 83046 83411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 83445 85061 gene locus_tag LOCUS_16500 83445 85061 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_16500 85226 86155 gene locus_tag LOCUS_16510 85226 86155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 86158 86739 gene locus_tag LOCUS_16520 86158 86739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 86779 89142 gene locus_tag LOCUS_16530 86779 89142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 89242 89613 gene locus_tag LOCUS_16540 gene spo0F 89242 89613 CDS product sporulation initiation phosphotransferase Spo0F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227621.1 protein_id gnl|my_center|LOCUS_16540 89704 90336 gene locus_tag LOCUS_16550 89704 90336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 90436 93738 gene locus_tag LOCUS_16560 gene mfd 90436 93738 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391629.1 protein_id gnl|my_center|LOCUS_16560 93899 95509 gene locus_tag LOCUS_16570 93899 95509 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_16570 95512 96969 gene locus_tag LOCUS_16580 gene mazG 95512 96969 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014253.1 protein_id gnl|my_center|LOCUS_16580 97075 97350 gene locus_tag LOCUS_16590 97075 97350 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814866.1 protein_id gnl|my_center|LOCUS_16590 97579 98271 gene locus_tag LOCUS_16600 97579 98271 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272485.1 protein_id gnl|my_center|LOCUS_16600 98374 99123 gene locus_tag LOCUS_16610 gene pstB 98374 99123 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391662.1 protein_id gnl|my_center|LOCUS_16610 99141 99797 gene locus_tag LOCUS_16620 gene phoU 99141 99797 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_16620 101629 99830 gene locus_tag LOCUS_16630 101629 99830 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722633.1 protein_id gnl|my_center|LOCUS_16630 101812 102672 gene locus_tag LOCUS_16640 101812 102672 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167205.1 protein_id gnl|my_center|LOCUS_16640 102899 103483 gene locus_tag LOCUS_16650 102899 103483 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986315.1 protein_id gnl|my_center|LOCUS_16650 103487 103657 gene locus_tag LOCUS_16660 103487 103657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 103698 104573 gene locus_tag LOCUS_16670 103698 104573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 104585 106741 gene locus_tag LOCUS_16680 104585 106741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 106674 107597 gene locus_tag LOCUS_16690 106674 107597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 107781 108677 gene locus_tag LOCUS_16700 gene pstC 107781 108677 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391660.1 protein_id gnl|my_center|LOCUS_16700 108677 109537 gene locus_tag LOCUS_16710 gene pstA 108677 109537 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722630.1 protein_id gnl|my_center|LOCUS_16710 109686 109973 gene locus_tag LOCUS_16720 109686 109973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 110057 110476 gene locus_tag LOCUS_16730 110057 110476 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809726.1 protein_id gnl|my_center|LOCUS_16730 110681 112084 gene locus_tag LOCUS_16740 gene tilS 110681 112084 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434952.1 protein_id gnl|my_center|LOCUS_16740 112078 112614 gene locus_tag LOCUS_16750 gene hpt 112078 112614 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_16750 112771 114699 gene locus_tag LOCUS_16760 gene ftsH 112771 114699 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391653.1 protein_id gnl|my_center|LOCUS_16760 114886 115878 gene locus_tag LOCUS_16770 114886 115878 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768282.1 protein_id gnl|my_center|LOCUS_16770 115878 116447 gene locus_tag LOCUS_16780 115878 116447 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391691.1 protein_id gnl|my_center|LOCUS_16780 116467 117231 gene locus_tag LOCUS_16790 116467 117231 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_16790 117283 118293 gene locus_tag LOCUS_16800 gene dusB 117283 118293 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_16800 118265 119227 gene locus_tag LOCUS_16810 118265 119227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 119343 119864 gene locus_tag LOCUS_16820 119343 119864 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391695.1 protein_id gnl|my_center|LOCUS_16820 119877 120782 gene locus_tag LOCUS_16830 119877 120782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391696.1 protein_id gnl|my_center|LOCUS_16830 120799 121893 gene locus_tag LOCUS_16840 120799 121893 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391697.1 protein_id gnl|my_center|LOCUS_16840 122201 122674 gene locus_tag LOCUS_16850 gene greA 122201 122674 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391698.1 protein_id gnl|my_center|LOCUS_16850 122745 124238 gene locus_tag LOCUS_16860 gene lysS 122745 124238 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809769.1 protein_id gnl|my_center|LOCUS_16860 >Feature sequence11 327 230 gene locus_tag LOCUS_t00290 327 230 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 942 481 gene locus_tag LOCUS_16870 942 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 1557 1069 gene locus_tag LOCUS_16880 1557 1069 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119093.1 protein_id gnl|my_center|LOCUS_16880 2057 1611 gene locus_tag LOCUS_16890 2057 1611 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937348.1 protein_id gnl|my_center|LOCUS_16890 3619 2246 gene locus_tag LOCUS_16900 3619 2246 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869134.1 protein_id gnl|my_center|LOCUS_16900 4240 3734 gene locus_tag LOCUS_16910 4240 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 4563 4763 gene locus_tag LOCUS_16920 4563 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 4920 4846 gene locus_tag LOCUS_t00300 4920 4846 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6268 5048 gene locus_tag LOCUS_16930 6268 5048 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461849.1 protein_id gnl|my_center|LOCUS_16930 6640 6314 gene locus_tag LOCUS_16940 6640 6314 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810313.1 protein_id gnl|my_center|LOCUS_16940 8608 6737 gene locus_tag LOCUS_16950 8608 6737 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813245.1 protein_id gnl|my_center|LOCUS_16950 10345 8933 gene locus_tag LOCUS_16960 10345 8933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 11817 10477 gene locus_tag LOCUS_16970 11817 10477 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206913.1 protein_id gnl|my_center|LOCUS_16970 12363 13694 gene locus_tag LOCUS_16980 12363 13694 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391959.1 protein_id gnl|my_center|LOCUS_16980 14560 13877 gene locus_tag LOCUS_16990 14560 13877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 15381 14560 gene locus_tag LOCUS_17000 15381 14560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 16237 15374 gene locus_tag LOCUS_17010 16237 15374 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867495.1 protein_id gnl|my_center|LOCUS_17010 16800 16237 gene locus_tag LOCUS_17020 16800 16237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065113.1 protein_id gnl|my_center|LOCUS_17020 18000 17212 gene locus_tag LOCUS_17030 18000 17212 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359187.1 protein_id gnl|my_center|LOCUS_17030 18798 18031 gene locus_tag LOCUS_17040 18798 18031 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391996.1 protein_id gnl|my_center|LOCUS_17040 20048 18930 gene locus_tag LOCUS_17050 gene ald 20048 18930 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459459.1 protein_id gnl|my_center|LOCUS_17050 21066 20383 gene locus_tag LOCUS_17060 gene hypB 21066 20383 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815169.1 protein_id gnl|my_center|LOCUS_17060 21417 21067 gene locus_tag LOCUS_17070 gene hypA 21417 21067 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388683.1 protein_id gnl|my_center|LOCUS_17070 22286 21441 gene locus_tag LOCUS_17080 22286 21441 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460266.1 protein_id gnl|my_center|LOCUS_17080 23911 22517 gene locus_tag LOCUS_17090 23911 22517 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096992.1 protein_id gnl|my_center|LOCUS_17090 24539 24342 gene locus_tag LOCUS_17100 24539 24342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 24650 25099 gene locus_tag LOCUS_17110 24650 25099 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257678.1 protein_id gnl|my_center|LOCUS_17110 27198 25216 gene locus_tag LOCUS_17120 27198 25216 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_17120 27416 28297 gene locus_tag LOCUS_17130 27416 28297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 28363 29601 gene locus_tag LOCUS_17140 28363 29601 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454678.1 protein_id gnl|my_center|LOCUS_17140 31005 29668 gene locus_tag LOCUS_17150 31005 29668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 31100 33097 gene locus_tag LOCUS_17160 31100 33097 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941543.1 protein_id gnl|my_center|LOCUS_17160 34551 33094 gene locus_tag LOCUS_17170 34551 33094 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986767.1 protein_id gnl|my_center|LOCUS_17170 34785 36065 gene locus_tag LOCUS_17180 34785 36065 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986138.1 protein_id gnl|my_center|LOCUS_17180 36225 36551 gene locus_tag LOCUS_17190 36225 36551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 37921 36713 gene locus_tag LOCUS_17200 gene madB 37921 36713 CDS product Na+-transporting malonate decarboxylase, carboxybiotin decarboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389075.1 protein_id gnl|my_center|LOCUS_17200 38180 37947 gene locus_tag LOCUS_17210 38180 37947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 38532 38119 gene locus_tag LOCUS_17220 38532 38119 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_17220 38816 38565 gene locus_tag LOCUS_17230 38816 38565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 39283 38876 gene locus_tag LOCUS_17240 gene mce 39283 38876 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869043.1 protein_id gnl|my_center|LOCUS_17240 40256 39318 gene locus_tag LOCUS_17250 gene meaB 40256 39318 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_17250 40719 40327 gene locus_tag LOCUS_17260 40719 40327 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_17260 42390 40744 gene locus_tag LOCUS_17270 42390 40744 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869041.1 protein_id gnl|my_center|LOCUS_17270 44021 42510 gene locus_tag LOCUS_17280 44021 42510 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869054.1 protein_id gnl|my_center|LOCUS_17280 44955 44230 gene locus_tag LOCUS_17290 44955 44230 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545169.1 protein_id gnl|my_center|LOCUS_17290 46071 44956 gene locus_tag LOCUS_17300 46071 44956 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156271991.1 protein_id gnl|my_center|LOCUS_17300 47311 46121 gene locus_tag LOCUS_17310 gene ftsW 47311 46121 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_17310 48030 47383 gene locus_tag LOCUS_17320 gene trmB 48030 47383 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398646.1 protein_id gnl|my_center|LOCUS_17320 49941 48043 gene locus_tag LOCUS_17330 49941 48043 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986282.1 protein_id gnl|my_center|LOCUS_17330 50451 50023 gene locus_tag LOCUS_17340 50451 50023 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289398.1 protein_id gnl|my_center|LOCUS_17340 50957 50496 gene locus_tag LOCUS_17350 50957 50496 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576052.1 protein_id gnl|my_center|LOCUS_17350 52000 51143 gene locus_tag LOCUS_17360 52000 51143 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021246.1 protein_id gnl|my_center|LOCUS_17360 53082 52003 gene locus_tag LOCUS_17370 53082 52003 CDS product LeuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021247.1 protein_id gnl|my_center|LOCUS_17370 53749 53108 gene locus_tag LOCUS_17380 53749 53108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 54085 53777 gene locus_tag LOCUS_17390 54085 53777 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933206.1 protein_id gnl|my_center|LOCUS_17390 55359 54085 gene locus_tag LOCUS_17400 55359 54085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17400 56752 55376 gene locus_tag LOCUS_17410 56752 55376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17410 58101 56752 gene locus_tag LOCUS_17420 gene nifE 58101 56752 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943606.1 protein_id gnl|my_center|LOCUS_17420 59533 58145 gene locus_tag LOCUS_17430 gene nifK 59533 58145 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963580.1 protein_id gnl|my_center|LOCUS_17430 61148 59535 gene locus_tag LOCUS_17440 gene nifD 61148 59535 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963579.1 protein_id gnl|my_center|LOCUS_17440 61605 61195 gene locus_tag LOCUS_17450 61605 61195 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176591.1 protein_id gnl|my_center|LOCUS_17450 61944 61618 gene locus_tag LOCUS_17460 61944 61618 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963577.1 protein_id gnl|my_center|LOCUS_17460 62816 61989 gene locus_tag LOCUS_17470 gene nifH 62816 61989 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963576.1 protein_id gnl|my_center|LOCUS_17470 64457 63294 gene locus_tag LOCUS_17480 64457 63294 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393979.1 protein_id gnl|my_center|LOCUS_17480 65273 64602 gene locus_tag LOCUS_17490 65273 64602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 65527 65739 gene locus_tag LOCUS_17500 65527 65739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 66371 65916 gene locus_tag LOCUS_17510 66371 65916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 68245 66398 gene locus_tag LOCUS_17520 68245 66398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 69324 68671 gene locus_tag LOCUS_17530 69324 68671 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064970.1 protein_id gnl|my_center|LOCUS_17530 69737 69378 gene locus_tag LOCUS_17540 69737 69378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 70992 69943 gene locus_tag LOCUS_17550 gene waaC 70992 69943 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_17550 74244 71563 gene locus_tag LOCUS_17560 74244 71563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 75666 74476 gene locus_tag LOCUS_17570 75666 74476 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167773.1 protein_id gnl|my_center|LOCUS_17570 75958 75734 gene locus_tag LOCUS_17580 75958 75734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 76903 76361 gene locus_tag LOCUS_17590 76903 76361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 77315 76863 gene locus_tag LOCUS_17600 77315 76863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 77774 78346 gene locus_tag LOCUS_17610 77774 78346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 78909 79388 gene locus_tag LOCUS_17620 78909 79388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877660.1 protein_id gnl|my_center|LOCUS_17620 82556 79701 gene locus_tag LOCUS_17630 82556 79701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 84673 82562 gene locus_tag LOCUS_17640 84673 82562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 85460 84636 gene locus_tag LOCUS_17650 85460 84636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 86584 85463 gene locus_tag LOCUS_17660 86584 85463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 87393 87851 gene locus_tag LOCUS_17670 gene lrp 87393 87851 CDS product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664572.1 protein_id gnl|my_center|LOCUS_17670 87856 88479 gene locus_tag LOCUS_17680 87856 88479 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258926.1 protein_id gnl|my_center|LOCUS_17680 88558 89796 gene locus_tag LOCUS_17690 88558 89796 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461101.1 protein_id gnl|my_center|LOCUS_17690 89812 90042 gene locus_tag LOCUS_17700 89812 90042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 90315 90124 gene locus_tag LOCUS_17710 90315 90124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 90614 90423 gene locus_tag LOCUS_17720 90614 90423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 90893 92005 gene locus_tag LOCUS_17730 90893 92005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 92026 92373 gene locus_tag LOCUS_17740 92026 92373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 92400 93215 gene locus_tag LOCUS_17750 92400 93215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 93422 94006 gene locus_tag LOCUS_17760 93422 94006 CDS product ERF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091831579.1 protein_id gnl|my_center|LOCUS_17760 >Feature sequence12 333 130 gene locus_tag LOCUS_17770 333 130 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423406.1 protein_id gnl|my_center|LOCUS_17770 1132 440 gene locus_tag LOCUS_17780 1132 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357453.1 protein_id gnl|my_center|LOCUS_17780 2393 1452 gene locus_tag LOCUS_17790 2393 1452 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895564.1 protein_id gnl|my_center|LOCUS_17790 5063 2448 gene locus_tag LOCUS_17800 5063 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17800 7384 5078 gene locus_tag LOCUS_17810 7384 5078 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272211.1 protein_id gnl|my_center|LOCUS_17810 8158 7583 gene locus_tag LOCUS_17820 8158 7583 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941475.1 protein_id gnl|my_center|LOCUS_17820 9654 8272 gene locus_tag LOCUS_17830 9654 8272 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948237.1 protein_id gnl|my_center|LOCUS_17830 10971 9775 gene locus_tag LOCUS_17840 10971 9775 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440662.1 protein_id gnl|my_center|LOCUS_17840 11225 13579 gene locus_tag LOCUS_17850 11225 13579 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462063.1 protein_id gnl|my_center|LOCUS_17850 13566 13919 gene locus_tag LOCUS_17860 13566 13919 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773743.1 protein_id gnl|my_center|LOCUS_17860 14169 15122 gene locus_tag LOCUS_17870 gene rarD 14169 15122 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535539.1 protein_id gnl|my_center|LOCUS_17870 15219 16448 gene locus_tag LOCUS_17880 15219 16448 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989913.1 protein_id gnl|my_center|LOCUS_17880 19204 16820 gene locus_tag LOCUS_17890 19204 16820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 20340 19201 gene locus_tag LOCUS_17900 20340 19201 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943025.1 protein_id gnl|my_center|LOCUS_17900 21203 20862 gene locus_tag LOCUS_17910 gene phnA 21203 20862 CDS product alkylphosphonate utilization operon protein PhnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212737.1 protein_id gnl|my_center|LOCUS_17910 21423 22028 gene locus_tag LOCUS_17920 21423 22028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 22066 22713 gene locus_tag LOCUS_17930 22066 22713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 23655 22795 gene locus_tag LOCUS_17940 23655 22795 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088209.1 protein_id gnl|my_center|LOCUS_17940 24302 23661 gene locus_tag LOCUS_17950 24302 23661 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986573.1 protein_id gnl|my_center|LOCUS_17950 24907 25029 gene locus_tag LOCUS_17960 24907 25029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 25389 25078 gene locus_tag LOCUS_17970 25389 25078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 26854 25460 gene locus_tag LOCUS_17980 gene lpdA 26854 25460 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393264.1 protein_id gnl|my_center|LOCUS_17980 27244 26858 gene locus_tag LOCUS_17990 gene gcvH 27244 26858 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290491.1 protein_id gnl|my_center|LOCUS_17990 27720 27256 gene locus_tag LOCUS_18000 27720 27256 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461731.1 protein_id gnl|my_center|LOCUS_18000 29388 27769 gene locus_tag LOCUS_18010 29388 27769 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100479.1 protein_id gnl|my_center|LOCUS_18010 31677 29596 gene locus_tag LOCUS_18020 31677 29596 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816048.1 protein_id gnl|my_center|LOCUS_18020 32155 32274 gene locus_tag LOCUS_18030 32155 32274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 33619 32342 gene locus_tag LOCUS_18040 33619 32342 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807816.1 protein_id gnl|my_center|LOCUS_18040 34065 33685 gene locus_tag LOCUS_18050 34065 33685 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 protein_id gnl|my_center|LOCUS_18050 35701 34112 gene locus_tag LOCUS_18060 35701 34112 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812114.1 protein_id gnl|my_center|LOCUS_18060 36931 35744 gene locus_tag LOCUS_18070 36931 35744 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421980.1 protein_id gnl|my_center|LOCUS_18070 38168 36948 gene locus_tag LOCUS_18080 gene dpaL 38168 36948 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047950.1 protein_id gnl|my_center|LOCUS_18080 40148 38358 gene locus_tag LOCUS_18090 40148 38358 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047951.1 protein_id gnl|my_center|LOCUS_18090 41020 40250 gene locus_tag LOCUS_18100 41020 40250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 41165 41491 gene locus_tag LOCUS_18110 41165 41491 CDS product DUF1904 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895429.1 protein_id gnl|my_center|LOCUS_18110 41948 41583 gene locus_tag LOCUS_18120 41948 41583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 43636 42185 gene locus_tag LOCUS_18130 43636 42185 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986368.1 protein_id gnl|my_center|LOCUS_18130 44787 43642 gene locus_tag LOCUS_18140 44787 43642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 45673 45005 gene locus_tag LOCUS_18150 45673 45005 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966000.1 protein_id gnl|my_center|LOCUS_18150 46427 45936 gene locus_tag LOCUS_18160 46427 45936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 47194 46499 gene locus_tag LOCUS_18170 47194 46499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 47353 47718 gene locus_tag LOCUS_18180 47353 47718 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072981.1 protein_id gnl|my_center|LOCUS_18180 48539 47928 gene locus_tag LOCUS_18190 48539 47928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 50583 48634 gene locus_tag LOCUS_18200 50583 48634 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966678.1 protein_id gnl|my_center|LOCUS_18200 50816 51391 gene locus_tag LOCUS_18210 50816 51391 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966641.1 protein_id gnl|my_center|LOCUS_18210 52244 51486 gene locus_tag LOCUS_18220 52244 51486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 52503 53174 gene locus_tag LOCUS_18230 52503 53174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 54652 53330 gene locus_tag LOCUS_18240 54652 53330 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087688.1 protein_id gnl|my_center|LOCUS_18240 56042 54849 gene locus_tag LOCUS_18250 56042 54849 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461849.1 protein_id gnl|my_center|LOCUS_18250 56436 56116 gene locus_tag LOCUS_18260 56436 56116 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459212.1 protein_id gnl|my_center|LOCUS_18260 58609 56588 gene locus_tag LOCUS_18270 58609 56588 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945529.1 protein_id gnl|my_center|LOCUS_18270 59826 58930 gene locus_tag LOCUS_18280 59826 58930 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964930.1 protein_id gnl|my_center|LOCUS_18280 61430 59952 gene locus_tag LOCUS_18290 61430 59952 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459057.1 protein_id gnl|my_center|LOCUS_18290 62708 61515 gene locus_tag LOCUS_18300 62708 61515 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461849.1 protein_id gnl|my_center|LOCUS_18300 63104 62784 gene locus_tag LOCUS_18310 63104 62784 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459212.1 protein_id gnl|my_center|LOCUS_18310 65336 63273 gene locus_tag LOCUS_18320 65336 63273 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459446.1 protein_id gnl|my_center|LOCUS_18320 66452 65658 gene locus_tag LOCUS_18330 66452 65658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 67413 66820 gene locus_tag LOCUS_18340 67413 66820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 67863 68783 gene locus_tag LOCUS_18350 67863 68783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 68948 69175 gene locus_tag LOCUS_18360 68948 69175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 70119 69208 gene locus_tag LOCUS_18370 70119 69208 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964712.1 protein_id gnl|my_center|LOCUS_18370 70345 72030 gene locus_tag LOCUS_18380 70345 72030 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986398.1 protein_id gnl|my_center|LOCUS_18380 72035 73204 gene locus_tag LOCUS_18390 72035 73204 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_18390 73663 74685 gene locus_tag LOCUS_18400 73663 74685 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989632.1 protein_id gnl|my_center|LOCUS_18400 74960 76156 gene locus_tag LOCUS_18410 74960 76156 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824230.1 protein_id gnl|my_center|LOCUS_18410 76273 77457 gene locus_tag LOCUS_18420 76273 77457 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436139.1 protein_id gnl|my_center|LOCUS_18420 78948 77578 gene locus_tag LOCUS_18430 gene cpsG 78948 77578 CDS product colanic acid biosynthesis phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097871.1 protein_id gnl|my_center|LOCUS_18430 80348 78966 gene locus_tag LOCUS_18440 80348 78966 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546227.1 protein_id gnl|my_center|LOCUS_18440 81418 80345 gene locus_tag LOCUS_18450 81418 80345 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583801.1 protein_id gnl|my_center|LOCUS_18450 82632 81415 gene locus_tag LOCUS_18460 82632 81415 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583802.1 protein_id gnl|my_center|LOCUS_18460 83748 82741 gene locus_tag LOCUS_18470 83748 82741 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022353.1 protein_id gnl|my_center|LOCUS_18470 84208 84717 gene locus_tag LOCUS_18480 84208 84717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 85140 84760 gene locus_tag LOCUS_18490 85140 84760 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461119.1 protein_id gnl|my_center|LOCUS_18490 85262 85621 gene locus_tag LOCUS_18500 85262 85621 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458981.1 protein_id gnl|my_center|LOCUS_18500 85977 85711 gene locus_tag LOCUS_18510 85977 85711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 >Feature sequence13 845 105 gene locus_tag LOCUS_18520 gene fabG 845 105 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_18520 2042 861 gene locus_tag LOCUS_18530 2042 861 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230291.1 protein_id gnl|my_center|LOCUS_18530 3260 2121 gene locus_tag LOCUS_18540 3260 2121 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_18540 4688 3303 gene locus_tag LOCUS_18550 4688 3303 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022819390.1 protein_id gnl|my_center|LOCUS_18550 5575 4781 gene locus_tag LOCUS_18560 5575 4781 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_18560 7154 5592 gene locus_tag LOCUS_18570 7154 5592 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_18570 8942 7533 gene locus_tag LOCUS_18580 8942 7533 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940093.1 protein_id gnl|my_center|LOCUS_18580 10922 9519 gene locus_tag LOCUS_18590 10922 9519 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705189.1 protein_id gnl|my_center|LOCUS_18590 11783 12721 gene locus_tag LOCUS_18600 11783 12721 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583782.1 protein_id gnl|my_center|LOCUS_18600 12718 13734 gene locus_tag LOCUS_18610 12718 13734 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460055.1 protein_id gnl|my_center|LOCUS_18610 13735 14508 gene locus_tag LOCUS_18620 13735 14508 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680085.1 protein_id gnl|my_center|LOCUS_18620 14529 16367 gene locus_tag LOCUS_18630 gene btuB 14529 16367 CDS product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591414.1 protein_id gnl|my_center|LOCUS_18630 16486 17445 gene locus_tag LOCUS_18640 16486 17445 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932107.1 protein_id gnl|my_center|LOCUS_18640 17471 18109 gene locus_tag LOCUS_18650 17471 18109 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069550.1 protein_id gnl|my_center|LOCUS_18650 18096 18503 gene locus_tag LOCUS_18660 18096 18503 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707897.1 protein_id gnl|my_center|LOCUS_18660 18524 19201 gene locus_tag LOCUS_18670 18524 19201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 22046 19389 gene locus_tag LOCUS_18680 gene ppdK 22046 19389 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460835.1 protein_id gnl|my_center|LOCUS_18680 22902 22048 gene locus_tag LOCUS_18690 22902 22048 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460836.1 protein_id gnl|my_center|LOCUS_18690 23868 23083 gene locus_tag LOCUS_18700 23868 23083 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_18700 24265 23885 gene locus_tag LOCUS_18710 24265 23885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 24481 25116 gene locus_tag LOCUS_18720 24481 25116 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526170.1 protein_id gnl|my_center|LOCUS_18720 25226 25489 gene locus_tag LOCUS_18730 25226 25489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 25530 26636 gene locus_tag LOCUS_18740 gene alr 25530 26636 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_18740 27691 26684 gene locus_tag LOCUS_18750 27691 26684 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048302.1 protein_id gnl|my_center|LOCUS_18750 29187 27811 gene locus_tag LOCUS_18760 29187 27811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 31437 29257 gene locus_tag LOCUS_18770 31437 29257 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461172.1 protein_id gnl|my_center|LOCUS_18770 32759 31458 gene locus_tag LOCUS_18780 32759 31458 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461173.1 protein_id gnl|my_center|LOCUS_18780 33815 32892 gene locus_tag LOCUS_18790 gene nrfD 33815 32892 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809125.1 protein_id gnl|my_center|LOCUS_18790 34375 33815 gene locus_tag LOCUS_18800 34375 33815 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461174.1 protein_id gnl|my_center|LOCUS_18800 36617 34377 gene locus_tag LOCUS_18810 36617 34377 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272564.1 protein_id gnl|my_center|LOCUS_18810 39303 37144 gene locus_tag LOCUS_18820 39303 37144 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943715.1 protein_id gnl|my_center|LOCUS_18820 39702 40988 gene locus_tag LOCUS_18830 39702 40988 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_18830 41898 41068 gene locus_tag LOCUS_18840 41898 41068 CDS product DUF2064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809116.1 protein_id gnl|my_center|LOCUS_18840 42531 41941 gene locus_tag LOCUS_18850 42531 41941 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_18850 42987 42553 gene locus_tag LOCUS_18860 42987 42553 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986477.1 protein_id gnl|my_center|LOCUS_18860 43522 43025 gene locus_tag LOCUS_18870 gene mobB 43522 43025 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460721.1 protein_id gnl|my_center|LOCUS_18870 44032 43553 gene locus_tag LOCUS_18880 gene moaC 44032 43553 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986478.1 protein_id gnl|my_center|LOCUS_18880 45015 44035 gene locus_tag LOCUS_18890 gene moaA 45015 44035 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_18890 46301 45063 gene locus_tag LOCUS_18900 46301 45063 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272494.1 protein_id gnl|my_center|LOCUS_18900 47333 46311 gene locus_tag LOCUS_18910 47333 46311 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948644.1 protein_id gnl|my_center|LOCUS_18910 48353 47559 gene locus_tag LOCUS_18920 48353 47559 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461180.1 protein_id gnl|my_center|LOCUS_18920 48825 48343 gene locus_tag LOCUS_18930 48825 48343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 49806 48844 gene locus_tag LOCUS_18940 49806 48844 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809151.1 protein_id gnl|my_center|LOCUS_18940 50924 49821 gene locus_tag LOCUS_18950 50924 49821 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943711.1 protein_id gnl|my_center|LOCUS_18950 51793 50963 gene locus_tag LOCUS_18960 51793 50963 CDS product DUF2064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809116.1 protein_id gnl|my_center|LOCUS_18960 52811 52065 gene locus_tag LOCUS_18970 52811 52065 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206755.1 protein_id gnl|my_center|LOCUS_18970 53604 52804 gene locus_tag LOCUS_18980 53604 52804 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974810.1 protein_id gnl|my_center|LOCUS_18980 54636 53665 gene locus_tag LOCUS_18990 54636 53665 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808831.1 protein_id gnl|my_center|LOCUS_18990 55625 54675 gene locus_tag LOCUS_19000 gene arsS 55625 54675 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986518.1 protein_id gnl|my_center|LOCUS_19000 56574 55771 gene locus_tag LOCUS_19010 56574 55771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 58112 56748 gene locus_tag LOCUS_19020 58112 56748 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461176.1 protein_id gnl|my_center|LOCUS_19020 58537 58367 gene locus_tag LOCUS_19030 58537 58367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 59151 59474 gene locus_tag LOCUS_19040 59151 59474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 59780 59613 gene locus_tag LOCUS_19050 59780 59613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 60844 60503 gene locus_tag LOCUS_19060 60844 60503 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809140.1 protein_id gnl|my_center|LOCUS_19060 63057 60886 gene locus_tag LOCUS_19070 63057 60886 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461178.1 protein_id gnl|my_center|LOCUS_19070 65459 63780 gene locus_tag LOCUS_19080 gene ilvD 65459 63780 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496775.1 protein_id gnl|my_center|LOCUS_19080 66498 65491 gene locus_tag LOCUS_19090 gene dmpG 66498 65491 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393276.1 protein_id gnl|my_center|LOCUS_19090 67379 66498 gene locus_tag LOCUS_19100 67379 66498 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393277.1 protein_id gnl|my_center|LOCUS_19100 68323 67517 gene locus_tag LOCUS_19110 68323 67517 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_19110 70428 68515 gene locus_tag LOCUS_19120 70428 68515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 71330 70515 gene locus_tag LOCUS_19130 71330 70515 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986985.1 protein_id gnl|my_center|LOCUS_19130 71615 72202 gene locus_tag LOCUS_19140 71615 72202 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981419.1 protein_id gnl|my_center|LOCUS_19140 73119 72325 gene locus_tag LOCUS_19150 73119 72325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 73876 73226 gene locus_tag LOCUS_19160 73876 73226 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880649.1 protein_id gnl|my_center|LOCUS_19160 74705 73881 gene locus_tag LOCUS_19170 74705 73881 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460849.1 protein_id gnl|my_center|LOCUS_19170 77702 74709 gene locus_tag LOCUS_19180 gene fdnG 77702 74709 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941441.1 transl_except (pos:complement(77142..77144),aa:Sec) note codon on position 187 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_19180 79871 78021 gene locus_tag LOCUS_19190 79871 78021 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986475.1 protein_id gnl|my_center|LOCUS_19190 80185 79913 gene locus_tag LOCUS_19200 80185 79913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 80828 80670 gene locus_tag LOCUS_19210 80828 80670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 80940 81524 gene locus_tag LOCUS_19220 80940 81524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 81707 81889 gene locus_tag LOCUS_19230 81707 81889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 82647 82273 gene locus_tag LOCUS_19240 82647 82273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 83079 82894 gene locus_tag LOCUS_19250 83079 82894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 >Feature sequence14 100 175 gene locus_tag LOCUS_t00310 100 175 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 386 637 gene locus_tag LOCUS_19260 386 637 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986396.1 protein_id gnl|my_center|LOCUS_19260 634 2322 gene locus_tag LOCUS_19270 634 2322 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396717.1 protein_id gnl|my_center|LOCUS_19270 2322 3473 gene locus_tag LOCUS_19280 2322 3473 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_19280 3504 3737 gene locus_tag LOCUS_19290 3504 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 3762 5267 gene locus_tag LOCUS_19300 3762 5267 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_19300 5341 6081 gene locus_tag LOCUS_19310 5341 6081 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583963.1 protein_id gnl|my_center|LOCUS_19310 6290 6787 gene locus_tag LOCUS_19320 gene ruvC 6290 6787 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_19320 6784 7383 gene locus_tag LOCUS_19330 gene ruvA 6784 7383 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694351.1 protein_id gnl|my_center|LOCUS_19330 7386 8408 gene locus_tag LOCUS_19340 gene ruvB 7386 8408 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_19340 8419 8964 gene locus_tag LOCUS_19350 8419 8964 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_19350 8965 9186 gene locus_tag LOCUS_19360 8965 9186 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222669.1 protein_id gnl|my_center|LOCUS_19360 9192 10493 gene locus_tag LOCUS_19370 9192 10493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 10510 11529 gene locus_tag LOCUS_19380 gene queA 10510 11529 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 protein_id gnl|my_center|LOCUS_19380 11584 12696 gene locus_tag LOCUS_19390 gene tgt 11584 12696 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_19390 12758 13057 gene locus_tag LOCUS_19400 12758 13057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 13254 14459 gene locus_tag LOCUS_19410 gene secD 13254 14459 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583952.1 protein_id gnl|my_center|LOCUS_19410 14472 15383 gene locus_tag LOCUS_19420 gene secF 14472 15383 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393192.1 protein_id gnl|my_center|LOCUS_19420 15535 17625 gene locus_tag LOCUS_19430 15535 17625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 17680 19893 gene locus_tag LOCUS_19440 17680 19893 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810772.1 protein_id gnl|my_center|LOCUS_19440 19890 20339 gene locus_tag LOCUS_19450 gene dtd 19890 20339 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393181.1 protein_id gnl|my_center|LOCUS_19450 20353 20976 gene locus_tag LOCUS_19460 20353 20976 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_19460 21039 21494 gene locus_tag LOCUS_19470 21039 21494 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392661.1 protein_id gnl|my_center|LOCUS_19470 21680 22945 gene locus_tag LOCUS_19480 gene hisS 21680 22945 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460333.1 protein_id gnl|my_center|LOCUS_19480 22947 24734 gene locus_tag LOCUS_19490 gene aspS 22947 24734 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460332.1 protein_id gnl|my_center|LOCUS_19490 25118 26449 gene locus_tag LOCUS_19500 25118 26449 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393158.1 protein_id gnl|my_center|LOCUS_19500 26547 26969 gene locus_tag LOCUS_19510 26547 26969 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_19510 26983 28191 gene locus_tag LOCUS_19520 gene nifS 26983 28191 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_19520 28234 28605 gene locus_tag LOCUS_19530 gene nifU 28234 28605 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272433.1 protein_id gnl|my_center|LOCUS_19530 28615 29727 gene locus_tag LOCUS_19540 gene mnmA 28615 29727 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948825.1 protein_id gnl|my_center|LOCUS_19540 29858 32470 gene locus_tag LOCUS_19550 gene alaS 29858 32470 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_19550 32622 32879 gene locus_tag LOCUS_19560 32622 32879 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939360.1 protein_id gnl|my_center|LOCUS_19560 32879 33826 gene locus_tag LOCUS_19570 32879 33826 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393143.1 protein_id gnl|my_center|LOCUS_19570 33851 34270 gene locus_tag LOCUS_19580 gene ruvX 33851 34270 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810863.1 protein_id gnl|my_center|LOCUS_19580 34337 34681 gene locus_tag LOCUS_19590 34337 34681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 34802 35824 gene locus_tag LOCUS_19600 gene mltG 34802 35824 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 protein_id gnl|my_center|LOCUS_19600 35826 36455 gene locus_tag LOCUS_19610 35826 36455 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986882.1 protein_id gnl|my_center|LOCUS_19610 36448 37680 gene locus_tag LOCUS_19620 36448 37680 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_19620 37670 37879 gene locus_tag LOCUS_19630 37670 37879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 37941 38408 gene locus_tag LOCUS_19640 gene aroQ 37941 38408 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_19640 38401 39474 gene locus_tag LOCUS_19650 38401 39474 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393048.1 protein_id gnl|my_center|LOCUS_19650 39500 40057 gene locus_tag LOCUS_19660 gene efp 39500 40057 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810907.1 protein_id gnl|my_center|LOCUS_19660 40279 40677 gene locus_tag LOCUS_19670 40279 40677 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_19670 40690 41229 gene locus_tag LOCUS_19680 40690 41229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 41241 41468 gene locus_tag LOCUS_19690 41241 41468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 41486 41896 gene locus_tag LOCUS_19700 gene nusB 41486 41896 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393030.1 protein_id gnl|my_center|LOCUS_19700 42027 43244 gene locus_tag LOCUS_19710 gene xseA 42027 43244 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393024.1 protein_id gnl|my_center|LOCUS_19710 43231 43500 gene locus_tag LOCUS_19720 gene xseB 43231 43500 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428423.1 protein_id gnl|my_center|LOCUS_19720 43493 44371 gene locus_tag LOCUS_19730 43493 44371 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_19730 44472 46361 gene locus_tag LOCUS_19740 gene dxs 44472 46361 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_19740 46362 47168 gene locus_tag LOCUS_19750 46362 47168 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 protein_id gnl|my_center|LOCUS_19750 47183 48052 gene locus_tag LOCUS_19760 47183 48052 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_19760 48039 48638 gene locus_tag LOCUS_19770 48039 48638 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989776.1 protein_id gnl|my_center|LOCUS_19770 48610 49065 gene locus_tag LOCUS_19780 gene argR 48610 49065 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935393.1 protein_id gnl|my_center|LOCUS_19780 49100 50836 gene locus_tag LOCUS_19790 gene recN 49100 50836 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645158.1 protein_id gnl|my_center|LOCUS_19790 50847 51617 gene locus_tag LOCUS_19800 gene spo0A 50847 51617 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393014.1 protein_id gnl|my_center|LOCUS_19800 51651 52337 gene locus_tag LOCUS_19810 51651 52337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357453.1 protein_id gnl|my_center|LOCUS_19810 52379 52909 gene locus_tag LOCUS_19820 52379 52909 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_19820 53331 53089 gene locus_tag LOCUS_19830 53331 53089 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943587.1 protein_id gnl|my_center|LOCUS_19830 54327 53356 gene locus_tag LOCUS_19840 54327 53356 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943586.1 protein_id gnl|my_center|LOCUS_19840 54698 54342 gene locus_tag LOCUS_19850 54698 54342 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890787.1 protein_id gnl|my_center|LOCUS_19850 54925 55815 gene locus_tag LOCUS_19860 gene xerD 54925 55815 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_19860 55845 57176 gene locus_tag LOCUS_19870 55845 57176 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393758.1 protein_id gnl|my_center|LOCUS_19870 57505 58125 gene locus_tag LOCUS_19880 57505 58125 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_19880 58143 59132 gene locus_tag LOCUS_19890 gene trpS 58143 59132 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460225.1 protein_id gnl|my_center|LOCUS_19890 59135 59857 gene locus_tag LOCUS_19900 gene scpA 59135 59857 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246108.1 protein_id gnl|my_center|LOCUS_19900 59847 60404 gene locus_tag LOCUS_19910 gene scpB 59847 60404 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392873.1 protein_id gnl|my_center|LOCUS_19910 60477 61628 gene locus_tag LOCUS_19920 60477 61628 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541694.1 protein_id gnl|my_center|LOCUS_19920 61657 62379 gene locus_tag LOCUS_19930 gene rluB 61657 62379 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398815.1 protein_id gnl|my_center|LOCUS_19930 62422 63669 gene locus_tag LOCUS_19940 62422 63669 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460214.1 protein_id gnl|my_center|LOCUS_19940 63752 64789 gene locus_tag LOCUS_19950 gene aroF 63752 64789 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460211.1 protein_id gnl|my_center|LOCUS_19950 64782 66080 gene locus_tag LOCUS_19960 gene aroA 64782 66080 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056198.1 protein_id gnl|my_center|LOCUS_19960 66118 66786 gene locus_tag LOCUS_19970 gene cmk 66118 66786 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230555.1 protein_id gnl|my_center|LOCUS_19970 66787 67374 gene locus_tag LOCUS_19980 66787 67374 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460203.1 protein_id gnl|my_center|LOCUS_19980 67379 69085 gene locus_tag LOCUS_19990 67379 69085 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393463.1 protein_id gnl|my_center|LOCUS_19990 69082 69858 gene locus_tag LOCUS_20000 69082 69858 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393659.1 protein_id gnl|my_center|LOCUS_20000 70033 71892 gene locus_tag LOCUS_20010 70033 71892 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545972.1 protein_id gnl|my_center|LOCUS_20010 72078 74054 gene locus_tag LOCUS_20020 72078 74054 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811135.1 protein_id gnl|my_center|LOCUS_20020 74064 75131 gene locus_tag LOCUS_20030 74064 75131 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251056.1 protein_id gnl|my_center|LOCUS_20030 75241 76548 gene locus_tag LOCUS_20040 75241 76548 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_20040 76552 77076 gene locus_tag LOCUS_20050 gene cobO 76552 77076 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942222.1 protein_id gnl|my_center|LOCUS_20050 77116 78441 gene locus_tag LOCUS_20060 gene der 77116 78441 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460200.1 protein_id gnl|my_center|LOCUS_20060 78461 79072 gene locus_tag LOCUS_20070 gene plsY 78461 79072 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392834.1 protein_id gnl|my_center|LOCUS_20070 79089 80123 gene locus_tag LOCUS_20080 79089 80123 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460199.1 protein_id gnl|my_center|LOCUS_20080 80329 80778 gene locus_tag LOCUS_20090 80329 80778 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 protein_id gnl|my_center|LOCUS_20090 80796 82091 gene locus_tag LOCUS_20100 80796 82091 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_20100 82106 83014 gene locus_tag LOCUS_20110 gene thrB 82106 83014 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392818.1 protein_id gnl|my_center|LOCUS_20110 >Feature sequence15 246 446 gene locus_tag LOCUS_20120 246 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 460 771 gene locus_tag LOCUS_20130 460 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 2223 3257 gene locus_tag LOCUS_20140 2223 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 3296 4777 gene locus_tag LOCUS_20150 3296 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 5713 5638 gene locus_tag LOCUS_t00320 5713 5638 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7212 5785 gene locus_tag LOCUS_20160 7212 5785 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546144.1 protein_id gnl|my_center|LOCUS_20160 8845 7403 gene locus_tag LOCUS_20170 8845 7403 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810317.1 protein_id gnl|my_center|LOCUS_20170 9758 9063 gene locus_tag LOCUS_20180 9758 9063 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272569.1 protein_id gnl|my_center|LOCUS_20180 10422 9823 gene locus_tag LOCUS_20190 10422 9823 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007140.1 protein_id gnl|my_center|LOCUS_20190 11730 10564 gene locus_tag LOCUS_20200 11730 10564 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393979.1 protein_id gnl|my_center|LOCUS_20200 13435 12002 gene locus_tag LOCUS_20210 13435 12002 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808599.1 protein_id gnl|my_center|LOCUS_20210 14308 13469 gene locus_tag LOCUS_20220 14308 13469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 15724 14342 gene locus_tag LOCUS_20230 gene lpdA 15724 14342 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085912.1 protein_id gnl|my_center|LOCUS_20230 16192 15788 gene locus_tag LOCUS_20240 gene gcvH 16192 15788 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461730.1 protein_id gnl|my_center|LOCUS_20240 16545 17885 gene locus_tag LOCUS_20250 16545 17885 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438813.1 protein_id gnl|my_center|LOCUS_20250 18032 18742 gene locus_tag LOCUS_20260 18032 18742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 21280 18764 gene locus_tag LOCUS_20270 gene mgtA 21280 18764 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932315.1 protein_id gnl|my_center|LOCUS_20270 21965 21363 gene locus_tag LOCUS_20280 21965 21363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 22810 22025 gene locus_tag LOCUS_20290 22810 22025 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513090.1 protein_id gnl|my_center|LOCUS_20290 24042 22864 gene locus_tag LOCUS_20300 24042 22864 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948998.1 protein_id gnl|my_center|LOCUS_20300 25663 24215 gene locus_tag LOCUS_20310 gene abfD 25663 24215 CDS product 4-hydroxybutyryl-CoA dehydratase/vinylacetyl-CoA-Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430738.1 protein_id gnl|my_center|LOCUS_20310 27278 25872 gene locus_tag LOCUS_20320 27278 25872 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225156.1 protein_id gnl|my_center|LOCUS_20320 27508 28902 gene locus_tag LOCUS_20330 27508 28902 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944354.1 protein_id gnl|my_center|LOCUS_20330 29867 28995 gene locus_tag LOCUS_20340 29867 28995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 30424 29897 gene locus_tag LOCUS_20350 30424 29897 CDS product DUF2507 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871166.1 protein_id gnl|my_center|LOCUS_20350 30661 30807 gene locus_tag LOCUS_20360 30661 30807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 31024 31236 gene locus_tag LOCUS_20370 31024 31236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 31423 32613 gene locus_tag LOCUS_20380 31423 32613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 35552 32772 gene locus_tag LOCUS_20390 35552 32772 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262972.1 protein_id gnl|my_center|LOCUS_20390 36583 35621 gene locus_tag LOCUS_20400 36583 35621 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436788.1 protein_id gnl|my_center|LOCUS_20400 37074 36616 gene locus_tag LOCUS_20410 37074 36616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 37435 37106 gene locus_tag LOCUS_20420 37435 37106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 39004 37655 gene locus_tag LOCUS_20430 39004 37655 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392014.1 protein_id gnl|my_center|LOCUS_20430 39733 39080 gene locus_tag LOCUS_20440 39733 39080 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270072.1 protein_id gnl|my_center|LOCUS_20440 40542 40231 gene locus_tag LOCUS_20450 40542 40231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 41272 41075 gene locus_tag LOCUS_20460 41272 41075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 41929 41516 gene locus_tag LOCUS_20470 41929 41516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 43417 42185 gene locus_tag LOCUS_20480 43417 42185 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_20480 43693 43493 gene locus_tag LOCUS_20490 43693 43493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 45539 43806 gene locus_tag LOCUS_20500 45539 43806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 46458 45541 gene locus_tag LOCUS_20510 46458 45541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 46757 47839 gene locus_tag LOCUS_20520 46757 47839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 48066 47866 gene locus_tag LOCUS_20530 48066 47866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 48370 48056 gene locus_tag LOCUS_20540 48370 48056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 48972 48358 gene locus_tag LOCUS_20550 48972 48358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 49604 49017 gene locus_tag LOCUS_20560 49604 49017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 50419 49832 gene locus_tag LOCUS_20570 50419 49832 CDS product ERF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091831579.1 protein_id gnl|my_center|LOCUS_20570 51328 50435 gene locus_tag LOCUS_20580 51328 50435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 51600 51331 gene locus_tag LOCUS_20590 51600 51331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 52674 51613 gene locus_tag LOCUS_20600 52674 51613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 55713 53197 gene locus_tag LOCUS_20610 55713 53197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 56236 55847 gene locus_tag LOCUS_20620 56236 55847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 56744 56268 gene locus_tag LOCUS_20630 56744 56268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487403.1 protein_id gnl|my_center|LOCUS_20630 57498 56989 gene locus_tag LOCUS_20640 57498 56989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 57836 58111 gene locus_tag LOCUS_20650 57836 58111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 58125 60221 gene locus_tag LOCUS_20660 58125 60221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 60224 63028 gene locus_tag LOCUS_20670 60224 63028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 64241 63588 gene locus_tag LOCUS_20680 64241 63588 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_20680 64741 64466 gene locus_tag LOCUS_20690 64741 64466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 65946 65224 gene locus_tag LOCUS_20700 65946 65224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 66107 66430 gene locus_tag LOCUS_20710 66107 66430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 66745 66461 gene locus_tag LOCUS_20720 66745 66461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 67260 67937 gene locus_tag LOCUS_20730 67260 67937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 67952 68548 gene locus_tag LOCUS_20740 67952 68548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 68856 71852 gene locus_tag LOCUS_20750 68856 71852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 71843 72127 gene locus_tag LOCUS_20760 71843 72127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 72159 74324 gene locus_tag LOCUS_20770 72159 74324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 74847 74773 gene locus_tag LOCUS_t00330 74847 74773 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 75641 75922 gene locus_tag LOCUS_20780 75641 75922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 76139 76351 gene locus_tag LOCUS_20790 76139 76351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 76847 76395 gene locus_tag LOCUS_20800 76847 76395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 77370 78509 gene locus_tag LOCUS_20810 77370 78509 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048186.1 protein_id gnl|my_center|LOCUS_20810 >Feature sequence16 302 1474 gene locus_tag LOCUS_20820 302 1474 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941617.1 protein_id gnl|my_center|LOCUS_20820 1471 2664 gene locus_tag LOCUS_20830 1471 2664 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_20830 2673 3419 gene locus_tag LOCUS_20840 2673 3419 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 protein_id gnl|my_center|LOCUS_20840 4035 3469 gene locus_tag LOCUS_20850 4035 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 5341 4151 gene locus_tag LOCUS_20860 gene cdaR 5341 4151 CDS product DNA-binding transcriptional regulator CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929439.1 protein_id gnl|my_center|LOCUS_20860 6744 5584 gene locus_tag LOCUS_20870 6744 5584 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460067.1 protein_id gnl|my_center|LOCUS_20870 7045 6746 gene locus_tag LOCUS_20880 7045 6746 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812779.1 protein_id gnl|my_center|LOCUS_20880 8394 7129 gene locus_tag LOCUS_20890 gene larA 8394 7129 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438088.1 protein_id gnl|my_center|LOCUS_20890 8643 8455 gene locus_tag LOCUS_20900 8643 8455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 8737 8958 gene locus_tag LOCUS_20910 8737 8958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 10077 9166 gene locus_tag LOCUS_20920 gene modA 10077 9166 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932353.1 protein_id gnl|my_center|LOCUS_20920 10502 10356 gene locus_tag LOCUS_20930 10502 10356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 11216 10539 gene locus_tag LOCUS_20940 11216 10539 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_20940 11628 11990 gene locus_tag LOCUS_20950 11628 11990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 13296 12088 gene locus_tag LOCUS_20960 13296 12088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 13703 13335 gene locus_tag LOCUS_20970 13703 13335 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939385.1 protein_id gnl|my_center|LOCUS_20970 14646 13723 gene locus_tag LOCUS_20980 14646 13723 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939380.1 protein_id gnl|my_center|LOCUS_20980 15494 14643 gene locus_tag LOCUS_20990 15494 14643 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_20990 15841 15608 gene locus_tag LOCUS_21000 15841 15608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 16628 16041 gene locus_tag LOCUS_21010 16628 16041 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869954.1 protein_id gnl|my_center|LOCUS_21010 17041 16667 gene locus_tag LOCUS_21020 gene nifU 17041 16667 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877697.1 protein_id gnl|my_center|LOCUS_21020 17820 17182 gene locus_tag LOCUS_21030 17820 17182 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460936.1 protein_id gnl|my_center|LOCUS_21030 18809 17832 gene locus_tag LOCUS_21040 18809 17832 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460935.1 protein_id gnl|my_center|LOCUS_21040 19427 18903 gene locus_tag LOCUS_21050 19427 18903 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938827.1 protein_id gnl|my_center|LOCUS_21050 19942 19427 gene locus_tag LOCUS_21060 19942 19427 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938826.1 protein_id gnl|my_center|LOCUS_21060 20404 20171 gene locus_tag LOCUS_21070 20404 20171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 20921 22495 gene locus_tag LOCUS_21080 20921 22495 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923241.1 protein_id gnl|my_center|LOCUS_21080 23444 22482 gene locus_tag LOCUS_21090 23444 22482 CDS product glutathione synthetase ATP-binding domain-like superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070843.1 protein_id gnl|my_center|LOCUS_21090 23779 23549 gene locus_tag LOCUS_21100 23779 23549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 26078 24042 gene locus_tag LOCUS_21110 26078 24042 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_21110 27837 26221 gene locus_tag LOCUS_21120 27837 26221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 28103 27930 gene locus_tag LOCUS_21130 28103 27930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 29007 28267 gene locus_tag LOCUS_21140 gene fabG 29007 28267 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_21140 30595 29030 gene locus_tag LOCUS_21150 30595 29030 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989914.1 protein_id gnl|my_center|LOCUS_21150 32193 30631 gene locus_tag LOCUS_21160 32193 30631 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989914.1 protein_id gnl|my_center|LOCUS_21160 33525 32314 gene locus_tag LOCUS_21170 33525 32314 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_21170 34401 33547 gene locus_tag LOCUS_21180 34401 33547 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460375.1 protein_id gnl|my_center|LOCUS_21180 35746 34442 gene locus_tag LOCUS_21190 35746 34442 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861638.1 protein_id gnl|my_center|LOCUS_21190 37439 35982 gene locus_tag LOCUS_21200 37439 35982 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459194.1 protein_id gnl|my_center|LOCUS_21200 37860 37711 gene locus_tag LOCUS_21210 37860 37711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 38909 38238 gene locus_tag LOCUS_21220 38909 38238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 39384 39208 gene locus_tag LOCUS_21230 39384 39208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 39966 39586 gene locus_tag LOCUS_21240 39966 39586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 40547 40026 gene locus_tag LOCUS_21250 40547 40026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 40935 41219 gene locus_tag LOCUS_21260 40935 41219 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355819.1 protein_id gnl|my_center|LOCUS_21260 41242 43695 gene locus_tag LOCUS_21270 41242 43695 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948003.1 protein_id gnl|my_center|LOCUS_21270 43718 43954 gene locus_tag LOCUS_21280 43718 43954 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939908.1 protein_id gnl|my_center|LOCUS_21280 45566 44127 gene locus_tag LOCUS_21290 gene glgA 45566 44127 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110443.1 protein_id gnl|my_center|LOCUS_21290 47626 45617 gene locus_tag LOCUS_21300 47626 45617 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861581.1 protein_id gnl|my_center|LOCUS_21300 47897 50404 gene locus_tag LOCUS_21310 gene glgP 47897 50404 CDS product glycogen phosphorylase GlgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399110.1 protein_id gnl|my_center|LOCUS_21310 52097 50853 gene locus_tag LOCUS_21320 gene glgC 52097 50853 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227648.1 protein_id gnl|my_center|LOCUS_21320 52925 52173 gene locus_tag LOCUS_21330 52925 52173 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279153.1 protein_id gnl|my_center|LOCUS_21330 53640 53278 gene locus_tag LOCUS_21340 53640 53278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002025404.1 protein_id gnl|my_center|LOCUS_21340 54247 53948 gene locus_tag LOCUS_21350 54247 53948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 55560 54247 gene locus_tag LOCUS_21360 55560 54247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 56957 55563 gene locus_tag LOCUS_21370 56957 55563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 57939 56980 gene locus_tag LOCUS_21380 57939 56980 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814288.1 protein_id gnl|my_center|LOCUS_21380 59324 58026 gene locus_tag LOCUS_21390 59324 58026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 65194 59321 gene locus_tag LOCUS_21400 65194 59321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 65972 65298 gene locus_tag LOCUS_21410 65972 65298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 68499 65914 gene locus_tag LOCUS_21420 68499 65914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 70027 68531 gene locus_tag LOCUS_21430 70027 68531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21430 70603 70031 gene locus_tag LOCUS_21440 70603 70031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21440 70844 70614 gene locus_tag LOCUS_21450 70844 70614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 71704 71126 gene locus_tag LOCUS_21460 71704 71126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 76568 71769 gene locus_tag LOCUS_21470 76568 71769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 77679 76741 gene locus_tag LOCUS_21480 77679 76741 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038051.1 protein_id gnl|my_center|LOCUS_21480 77896 77663 gene locus_tag LOCUS_21490 77896 77663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 >Feature sequence17 1782 490 gene locus_tag LOCUS_21500 1782 490 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094951.1 protein_id gnl|my_center|LOCUS_21500 3496 2048 gene locus_tag LOCUS_21510 gene abfD 3496 2048 CDS product 4-hydroxybutyryl-CoA dehydratase/vinylacetyl-CoA-Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430738.1 protein_id gnl|my_center|LOCUS_21510 7114 3602 gene locus_tag LOCUS_21520 gene nifJ 7114 3602 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987043.1 protein_id gnl|my_center|LOCUS_21520 8440 7613 gene locus_tag LOCUS_21530 8440 7613 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235891781.1 protein_id gnl|my_center|LOCUS_21530 9080 8754 gene locus_tag LOCUS_21540 9080 8754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 9653 9228 gene locus_tag LOCUS_21550 9653 9228 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272025.1 protein_id gnl|my_center|LOCUS_21550 10483 9668 gene locus_tag LOCUS_21560 10483 9668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 10807 10625 gene locus_tag LOCUS_21570 10807 10625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 12215 10773 gene locus_tag LOCUS_21580 gene nhaC 12215 10773 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461270.1 protein_id gnl|my_center|LOCUS_21580 13663 12212 gene locus_tag LOCUS_21590 13663 12212 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808599.1 protein_id gnl|my_center|LOCUS_21590 14870 13689 gene locus_tag LOCUS_21600 14870 13689 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171355.1 protein_id gnl|my_center|LOCUS_21600 15068 15766 gene locus_tag LOCUS_21610 15068 15766 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272569.1 protein_id gnl|my_center|LOCUS_21610 16701 16012 gene locus_tag LOCUS_21620 16701 16012 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356424.1 protein_id gnl|my_center|LOCUS_21620 18253 16976 gene locus_tag LOCUS_21630 gene larA 18253 16976 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438088.1 protein_id gnl|my_center|LOCUS_21630 19667 18354 gene locus_tag LOCUS_21640 19667 18354 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461049.1 protein_id gnl|my_center|LOCUS_21640 21028 19670 gene locus_tag LOCUS_21650 gene glcD 21028 19670 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890729.1 protein_id gnl|my_center|LOCUS_21650 22458 21073 gene locus_tag LOCUS_21660 22458 21073 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545342.1 protein_id gnl|my_center|LOCUS_21660 24352 22703 gene locus_tag LOCUS_21670 24352 22703 CDS product lactate permease LctP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940541.1 protein_id gnl|my_center|LOCUS_21670 25248 25949 gene locus_tag LOCUS_21680 25248 25949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 26888 26073 gene locus_tag LOCUS_21690 26888 26073 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966216.1 protein_id gnl|my_center|LOCUS_21690 27057 26869 gene locus_tag LOCUS_21700 27057 26869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 28267 27191 gene locus_tag LOCUS_21710 28267 27191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 29201 28515 gene locus_tag LOCUS_21720 29201 28515 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238630.1 protein_id gnl|my_center|LOCUS_21720 30739 30473 gene locus_tag LOCUS_21730 30739 30473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 30939 33509 gene locus_tag LOCUS_21740 30939 33509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 33512 34078 gene locus_tag LOCUS_21750 33512 34078 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461975.1 protein_id gnl|my_center|LOCUS_21750 34080 34997 gene locus_tag LOCUS_21760 34080 34997 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460250.1 protein_id gnl|my_center|LOCUS_21760 35084 35758 gene locus_tag LOCUS_21770 35084 35758 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461328.1 protein_id gnl|my_center|LOCUS_21770 37283 36159 gene locus_tag LOCUS_21780 37283 36159 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986590.1 protein_id gnl|my_center|LOCUS_21780 38694 37477 gene locus_tag LOCUS_21790 38694 37477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 39428 38949 gene locus_tag LOCUS_21800 gene rlmH 39428 38949 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435703.1 protein_id gnl|my_center|LOCUS_21800 40542 39430 gene locus_tag LOCUS_21810 40542 39430 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815222.1 protein_id gnl|my_center|LOCUS_21810 41377 40601 gene locus_tag LOCUS_21820 41377 40601 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989402.1 protein_id gnl|my_center|LOCUS_21820 42826 41483 gene locus_tag LOCUS_21830 42826 41483 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869220.1 protein_id gnl|my_center|LOCUS_21830 43499 42858 gene locus_tag LOCUS_21840 gene deoC 43499 42858 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933101.1 protein_id gnl|my_center|LOCUS_21840 44393 43533 gene locus_tag LOCUS_21850 44393 43533 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742057.1 protein_id gnl|my_center|LOCUS_21850 46288 44561 gene locus_tag LOCUS_21860 46288 44561 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948081.1 protein_id gnl|my_center|LOCUS_21860 47582 46311 gene locus_tag LOCUS_21870 gene larA 47582 46311 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062283069.1 protein_id gnl|my_center|LOCUS_21870 48666 47662 gene locus_tag LOCUS_21880 gene pdxA 48666 47662 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392248.1 protein_id gnl|my_center|LOCUS_21880 49951 48668 gene locus_tag LOCUS_21890 49951 48668 CDS product D-threonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783298.1 protein_id gnl|my_center|LOCUS_21890 50652 50170 gene locus_tag LOCUS_21900 50652 50170 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048199.1 protein_id gnl|my_center|LOCUS_21900 50839 51678 gene locus_tag LOCUS_21910 50839 51678 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250743.1 protein_id gnl|my_center|LOCUS_21910 51744 53921 gene locus_tag LOCUS_21920 51744 53921 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461496.1 protein_id gnl|my_center|LOCUS_21920 54615 53971 gene locus_tag LOCUS_21930 54615 53971 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203598.1 protein_id gnl|my_center|LOCUS_21930 56265 54643 gene locus_tag LOCUS_21940 56265 54643 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028485.1 protein_id gnl|my_center|LOCUS_21940 57127 56279 gene locus_tag LOCUS_21950 57127 56279 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459812.1 protein_id gnl|my_center|LOCUS_21950 57313 59466 gene locus_tag LOCUS_21960 57313 59466 CDS product cell division FtsA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214035.1 protein_id gnl|my_center|LOCUS_21960 60264 59566 gene locus_tag LOCUS_21970 60264 59566 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392343.1 protein_id gnl|my_center|LOCUS_21970 61631 60327 gene locus_tag LOCUS_21980 gene hemL 61631 60327 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_21980 62633 61656 gene locus_tag LOCUS_21990 gene hemB 62633 61656 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963427.1 protein_id gnl|my_center|LOCUS_21990 64159 62630 gene locus_tag LOCUS_22000 gene cobA 64159 62630 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460180.1 protein_id gnl|my_center|LOCUS_22000 65105 64146 gene locus_tag LOCUS_22010 gene hemC 65105 64146 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943896.1 protein_id gnl|my_center|LOCUS_22010 66384 65068 gene locus_tag LOCUS_22020 gene hemA 66384 65068 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460182.1 protein_id gnl|my_center|LOCUS_22020 67000 66353 gene locus_tag LOCUS_22030 67000 66353 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_22030 68598 67219 gene locus_tag LOCUS_22040 68598 67219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 68948 68709 gene locus_tag LOCUS_22050 gene copZ 68948 68709 CDS product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076661.1 protein_id gnl|my_center|LOCUS_22050 69249 68917 gene locus_tag LOCUS_22060 69249 68917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 69587 69862 gene locus_tag LOCUS_22070 69587 69862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 70621 69986 gene locus_tag LOCUS_22080 70621 69986 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949003.1 protein_id gnl|my_center|LOCUS_22080 71679 70654 gene locus_tag LOCUS_22090 71679 70654 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_22090 72263 72187 gene locus_tag LOCUS_t00340 72263 72187 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 73286 72336 gene locus_tag LOCUS_22100 73286 72336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 74476 73286 gene locus_tag LOCUS_22110 74476 73286 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358751.1 protein_id gnl|my_center|LOCUS_22110 76092 74536 gene locus_tag LOCUS_22120 76092 74536 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891132.1 protein_id gnl|my_center|LOCUS_22120 76338 76262 gene locus_tag LOCUS_t00350 76338 76262 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence18 86 307 gene locus_tag LOCUS_22130 86 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 366 590 gene locus_tag LOCUS_22140 366 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 996 1235 gene locus_tag LOCUS_22150 996 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 1461 3134 gene locus_tag LOCUS_22160 1461 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 3435 6191 gene locus_tag LOCUS_22170 3435 6191 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022108.1 protein_id gnl|my_center|LOCUS_22170 6195 7544 gene locus_tag LOCUS_22180 6195 7544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 7541 9025 gene locus_tag LOCUS_22190 7541 9025 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022102.1 protein_id gnl|my_center|LOCUS_22190 9355 10128 gene locus_tag LOCUS_22200 9355 10128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 10244 10900 gene locus_tag LOCUS_22210 10244 10900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 11371 11793 gene locus_tag LOCUS_22220 11371 11793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 11909 12550 gene locus_tag LOCUS_22230 11909 12550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 12754 14292 gene locus_tag LOCUS_22240 gene guaA 12754 14292 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817253.1 protein_id gnl|my_center|LOCUS_22240 14683 15165 gene locus_tag LOCUS_22250 gene purE 14683 15165 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249787.1 protein_id gnl|my_center|LOCUS_22250 15192 15905 gene locus_tag LOCUS_22260 15192 15905 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393547.1 protein_id gnl|my_center|LOCUS_22260 15921 17372 gene locus_tag LOCUS_22270 gene purF 15921 17372 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785566.1 protein_id gnl|my_center|LOCUS_22270 17384 18439 gene locus_tag LOCUS_22280 gene purM 17384 18439 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_22280 18432 19073 gene locus_tag LOCUS_22290 gene purN 18432 19073 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_22290 19070 20602 gene locus_tag LOCUS_22300 gene purH 19070 20602 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745439.1 protein_id gnl|my_center|LOCUS_22300 20636 21907 gene locus_tag LOCUS_22310 gene purD 20636 21907 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_22310 23465 22014 gene locus_tag LOCUS_22320 23465 22014 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125918.1 protein_id gnl|my_center|LOCUS_22320 23698 23501 gene locus_tag LOCUS_22330 23698 23501 CDS product DUF3311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231189.1 protein_id gnl|my_center|LOCUS_22330 23922 24572 gene locus_tag LOCUS_22340 23922 24572 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963381.1 protein_id gnl|my_center|LOCUS_22340 25493 24780 gene locus_tag LOCUS_22350 25493 24780 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205180.1 protein_id gnl|my_center|LOCUS_22350 26776 25604 gene locus_tag LOCUS_22360 26776 25604 CDS product methionine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257764.1 protein_id gnl|my_center|LOCUS_22360 27162 27473 gene locus_tag LOCUS_22370 27162 27473 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817220.1 protein_id gnl|my_center|LOCUS_22370 27506 28699 gene locus_tag LOCUS_22380 gene hisZ 27506 28699 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393533.1 protein_id gnl|my_center|LOCUS_22380 28701 29228 gene locus_tag LOCUS_22390 28701 29228 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963337.1 protein_id gnl|my_center|LOCUS_22390 30345 29389 gene locus_tag LOCUS_22400 30345 29389 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 protein_id gnl|my_center|LOCUS_22400 30502 31167 gene locus_tag LOCUS_22410 gene hisG 30502 31167 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817216.1 protein_id gnl|my_center|LOCUS_22410 31164 32522 gene locus_tag LOCUS_22420 gene hisD 31164 32522 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461463.1 protein_id gnl|my_center|LOCUS_22420 32509 33576 gene locus_tag LOCUS_22430 gene hisC 32509 33576 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927011.1 protein_id gnl|my_center|LOCUS_22430 33576 34160 gene locus_tag LOCUS_22440 gene hisB 33576 34160 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949112.1 protein_id gnl|my_center|LOCUS_22440 34199 34807 gene locus_tag LOCUS_22450 gene hisH 34199 34807 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_22450 34804 35538 gene locus_tag LOCUS_22460 gene hisA 34804 35538 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943717.1 protein_id gnl|my_center|LOCUS_22460 35538 36296 gene locus_tag LOCUS_22470 gene hisF 35538 36296 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393527.1 protein_id gnl|my_center|LOCUS_22470 36293 36949 gene locus_tag LOCUS_22480 gene hisIE 36293 36949 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817209.1 protein_id gnl|my_center|LOCUS_22480 37154 37828 gene locus_tag LOCUS_22490 37154 37828 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811530.1 protein_id gnl|my_center|LOCUS_22490 37850 38074 gene locus_tag LOCUS_22500 37850 38074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 39526 38342 gene locus_tag LOCUS_22510 39526 38342 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_22510 40002 39523 gene locus_tag LOCUS_22520 40002 39523 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_22520 41222 40434 gene locus_tag LOCUS_22530 41222 40434 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_22530 41612 42712 gene locus_tag LOCUS_22540 gene gcvT 41612 42712 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_22540 42714 43100 gene locus_tag LOCUS_22550 gene gcvH 42714 43100 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393442.1 protein_id gnl|my_center|LOCUS_22550 43100 44461 gene locus_tag LOCUS_22560 gene gcvPA 43100 44461 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460675.1 protein_id gnl|my_center|LOCUS_22560 44458 45924 gene locus_tag LOCUS_22570 gene gcvPB 44458 45924 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722477.1 protein_id gnl|my_center|LOCUS_22570 46203 45973 gene locus_tag LOCUS_22580 46203 45973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 46375 47013 gene locus_tag LOCUS_22590 46375 47013 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002054718.1 protein_id gnl|my_center|LOCUS_22590 47007 48032 gene locus_tag LOCUS_22600 47007 48032 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393810.1 protein_id gnl|my_center|LOCUS_22600 48034 49206 gene locus_tag LOCUS_22610 48034 49206 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966542.1 protein_id gnl|my_center|LOCUS_22610 49206 50372 gene locus_tag LOCUS_22620 49206 50372 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393813.1 protein_id gnl|my_center|LOCUS_22620 50392 52419 gene locus_tag LOCUS_22630 50392 52419 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942638.1 protein_id gnl|my_center|LOCUS_22630 52737 54599 gene locus_tag LOCUS_22640 52737 54599 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986475.1 protein_id gnl|my_center|LOCUS_22640 54647 55813 gene locus_tag LOCUS_22650 54647 55813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 55815 56054 gene locus_tag LOCUS_22660 55815 56054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 56275 58503 gene locus_tag LOCUS_22670 gene pcrA 56275 58503 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817187.1 protein_id gnl|my_center|LOCUS_22670 58532 60544 gene locus_tag LOCUS_22680 gene ligA 58532 60544 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393509.1 protein_id gnl|my_center|LOCUS_22680 60666 60956 gene locus_tag LOCUS_22690 gene gatC 60666 60956 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_22690 60968 62431 gene locus_tag LOCUS_22700 gene gatA 60968 62431 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_22700 62435 63877 gene locus_tag LOCUS_22710 gene gatB 62435 63877 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393504.1 protein_id gnl|my_center|LOCUS_22710 64061 66499 gene locus_tag LOCUS_22720 64061 66499 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_22720 66527 67909 gene locus_tag LOCUS_22730 gene rlmD 66527 67909 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105059.1 protein_id gnl|my_center|LOCUS_22730 >Feature sequence19 987 103 gene locus_tag LOCUS_22740 gene sdaAA 987 103 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671221.1 protein_id gnl|my_center|LOCUS_22740 1698 1033 gene locus_tag LOCUS_22750 gene sdaAB 1698 1033 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460514.1 protein_id gnl|my_center|LOCUS_22750 2000 1725 gene locus_tag LOCUS_22760 2000 1725 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357396.1 protein_id gnl|my_center|LOCUS_22760 3358 2138 gene locus_tag LOCUS_22770 3358 2138 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391154.1 protein_id gnl|my_center|LOCUS_22770 5099 3510 gene locus_tag LOCUS_22780 5099 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 5259 5834 gene locus_tag LOCUS_22790 5259 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 6715 6047 gene locus_tag LOCUS_22800 6715 6047 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814961.1 protein_id gnl|my_center|LOCUS_22800 6958 7098 gene locus_tag LOCUS_22810 6958 7098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 7172 7315 gene locus_tag LOCUS_22820 7172 7315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 7400 8587 gene locus_tag LOCUS_22830 gene nifV 7400 8587 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583977.1 protein_id gnl|my_center|LOCUS_22830 8644 9639 gene locus_tag LOCUS_22840 8644 9639 CDS product isocitrate dehydrogenase (NAD(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964290.1 protein_id gnl|my_center|LOCUS_22840 9667 12009 gene locus_tag LOCUS_22850 9667 12009 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461677.1 protein_id gnl|my_center|LOCUS_22850 13019 12084 gene locus_tag LOCUS_22860 gene metA 13019 12084 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462040.1 protein_id gnl|my_center|LOCUS_22860 13791 13306 gene locus_tag LOCUS_22870 13791 13306 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815410.1 protein_id gnl|my_center|LOCUS_22870 15429 14032 gene locus_tag LOCUS_22880 gene lpdA 15429 14032 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949165.1 protein_id gnl|my_center|LOCUS_22880 17463 15898 gene locus_tag LOCUS_22890 gene pckA 17463 15898 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_22890 18491 17742 gene locus_tag LOCUS_22900 18491 17742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 20905 18545 gene locus_tag LOCUS_22910 20905 18545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 21571 20936 gene locus_tag LOCUS_22920 21571 20936 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970538.1 protein_id gnl|my_center|LOCUS_22920 21915 22067 gene locus_tag LOCUS_22930 21915 22067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 23077 22403 gene locus_tag LOCUS_22940 23077 22403 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024089.1 protein_id gnl|my_center|LOCUS_22940 23421 23107 gene locus_tag LOCUS_22950 23421 23107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 24219 23434 gene locus_tag LOCUS_22960 24219 23434 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542174.1 protein_id gnl|my_center|LOCUS_22960 24989 24198 gene locus_tag LOCUS_22970 gene yqeB 24989 24198 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393498.1 protein_id gnl|my_center|LOCUS_22970 25912 25025 gene locus_tag LOCUS_22980 gene xdhB 25912 25025 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393457.1 protein_id gnl|my_center|LOCUS_22980 26816 25983 gene locus_tag LOCUS_22990 26816 25983 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027363870.1 protein_id gnl|my_center|LOCUS_22990 27737 26859 gene locus_tag LOCUS_23000 27737 26859 CDS product thiamine biosynthesis protein ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528452.1 protein_id gnl|my_center|LOCUS_23000 29245 27734 gene locus_tag LOCUS_23010 29245 27734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966263.1 protein_id gnl|my_center|LOCUS_23010 30876 29527 gene locus_tag LOCUS_23020 30876 29527 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272601.1 protein_id gnl|my_center|LOCUS_23020 32000 31014 gene locus_tag LOCUS_23030 32000 31014 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392739.1 protein_id gnl|my_center|LOCUS_23030 33346 32000 gene locus_tag LOCUS_23040 33346 32000 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392740.1 protein_id gnl|my_center|LOCUS_23040 33827 33339 gene locus_tag LOCUS_23050 33827 33339 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_23050 35149 34280 gene locus_tag LOCUS_23060 35149 34280 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665727.1 protein_id gnl|my_center|LOCUS_23060 36628 35183 gene locus_tag LOCUS_23070 gene glmL 36628 35183 CDS product methylaspartate mutase accessory protein GlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945203.1 protein_id gnl|my_center|LOCUS_23070 37828 36683 gene locus_tag LOCUS_23080 37828 36683 CDS product PrpF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040164.1 protein_id gnl|my_center|LOCUS_23080 39675 37825 gene locus_tag LOCUS_23090 39675 37825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 40196 39675 gene locus_tag LOCUS_23100 40196 39675 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256237.1 protein_id gnl|my_center|LOCUS_23100 41406 40201 gene locus_tag LOCUS_23110 gene hacA 41406 40201 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876998.1 protein_id gnl|my_center|LOCUS_23110 42833 41418 gene locus_tag LOCUS_23120 42833 41418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 43887 42997 gene locus_tag LOCUS_23130 gene garR 43887 42997 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566608.1 protein_id gnl|my_center|LOCUS_23130 44478 43897 gene locus_tag LOCUS_23140 44478 43897 CDS product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086605.1 protein_id gnl|my_center|LOCUS_23140 45712 44540 gene locus_tag LOCUS_23150 45712 44540 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530301.1 protein_id gnl|my_center|LOCUS_23150 47196 45850 gene locus_tag LOCUS_23160 47196 45850 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006789594.1 protein_id gnl|my_center|LOCUS_23160 49163 47553 gene locus_tag LOCUS_23170 49163 47553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 51367 49511 gene locus_tag LOCUS_23180 gene feoB 51367 49511 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541602.1 protein_id gnl|my_center|LOCUS_23180 51610 51392 gene locus_tag LOCUS_23190 51610 51392 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392697.1 protein_id gnl|my_center|LOCUS_23190 53152 51878 gene locus_tag LOCUS_23200 gene serS 53152 51878 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391570.1 protein_id gnl|my_center|LOCUS_23200 54242 53370 gene locus_tag LOCUS_23210 54242 53370 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816742.1 protein_id gnl|my_center|LOCUS_23210 54499 54723 gene locus_tag LOCUS_23220 54499 54723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 56330 54744 gene locus_tag LOCUS_23230 gene serA 56330 54744 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391569.1 protein_id gnl|my_center|LOCUS_23230 57474 56374 gene locus_tag LOCUS_23240 gene serC 57474 56374 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233234.1 protein_id gnl|my_center|LOCUS_23240 58635 57919 gene locus_tag LOCUS_23250 gene ubiE 58635 57919 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392794.1 protein_id gnl|my_center|LOCUS_23250 58735 59238 gene locus_tag LOCUS_23260 58735 59238 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397668.1 protein_id gnl|my_center|LOCUS_23260 60375 59329 gene locus_tag LOCUS_23270 60375 59329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 61989 60424 gene locus_tag LOCUS_23280 61989 60424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 62498 62013 gene locus_tag LOCUS_23290 gene sixA 62498 62013 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814151.1 protein_id gnl|my_center|LOCUS_23290 63127 62489 gene locus_tag LOCUS_23300 gene thiE 63127 62489 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256280.1 protein_id gnl|my_center|LOCUS_23300 63527 63288 gene locus_tag LOCUS_23310 63527 63288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 64420 63563 gene locus_tag LOCUS_23320 64420 63563 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233767.1 protein_id gnl|my_center|LOCUS_23320 >Feature sequence20 565 230 gene locus_tag LOCUS_23330 565 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 1085 597 gene locus_tag LOCUS_23340 1085 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 1326 1553 gene locus_tag LOCUS_23350 1326 1553 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021345.1 protein_id gnl|my_center|LOCUS_23350 1564 3840 gene locus_tag LOCUS_23360 1564 3840 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162006391.1 protein_id gnl|my_center|LOCUS_23360 4848 3895 gene locus_tag LOCUS_23370 4848 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 4848 6005 gene locus_tag LOCUS_23380 4848 6005 CDS product 3-hydroxy-3-methylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814048.1 protein_id gnl|my_center|LOCUS_23380 6280 7185 gene locus_tag LOCUS_23390 6280 7185 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714563.1 protein_id gnl|my_center|LOCUS_23390 7412 8038 gene locus_tag LOCUS_23400 7412 8038 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940854.1 protein_id gnl|my_center|LOCUS_23400 8274 8846 gene locus_tag LOCUS_23410 8274 8846 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266129.1 protein_id gnl|my_center|LOCUS_23410 8908 9642 gene locus_tag LOCUS_23420 gene nfsA 8908 9642 CDS product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244098.1 protein_id gnl|my_center|LOCUS_23420 9886 10101 gene locus_tag LOCUS_23430 9886 10101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 10231 11595 gene locus_tag LOCUS_23440 10231 11595 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201919.1 protein_id gnl|my_center|LOCUS_23440 11981 13237 gene locus_tag LOCUS_23450 11981 13237 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963073.1 protein_id gnl|my_center|LOCUS_23450 13241 14470 gene locus_tag LOCUS_23460 13241 14470 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975247.1 protein_id gnl|my_center|LOCUS_23460 14463 15188 gene locus_tag LOCUS_23470 14463 15188 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065420.1 protein_id gnl|my_center|LOCUS_23470 15185 16216 gene locus_tag LOCUS_23480 15185 16216 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974032.1 protein_id gnl|my_center|LOCUS_23480 16402 17859 gene locus_tag LOCUS_23490 16402 17859 CDS product 4-hydroxyphenylacetate 3-hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064616.1 protein_id gnl|my_center|LOCUS_23490 19281 17992 gene locus_tag LOCUS_23500 19281 17992 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_23500 19656 21332 gene locus_tag LOCUS_23510 19656 21332 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965754.1 protein_id gnl|my_center|LOCUS_23510 21335 22186 gene locus_tag LOCUS_23520 21335 22186 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965753.1 protein_id gnl|my_center|LOCUS_23520 22248 23414 gene locus_tag LOCUS_23530 22248 23414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 23653 26037 gene locus_tag LOCUS_23540 23653 26037 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392112.1 protein_id gnl|my_center|LOCUS_23540 26034 27134 gene locus_tag LOCUS_23550 gene holA 26034 27134 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279916.1 protein_id gnl|my_center|LOCUS_23550 27573 29369 gene locus_tag LOCUS_23560 gene lepA 27573 29369 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816487.1 protein_id gnl|my_center|LOCUS_23560 29362 30513 gene locus_tag LOCUS_23570 gene hemW 29362 30513 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_23570 30611 31639 gene locus_tag LOCUS_23580 gene hrcA 30611 31639 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392120.1 protein_id gnl|my_center|LOCUS_23580 31665 33251 gene locus_tag LOCUS_23590 31665 33251 CDS product TCP-1/cpn60 chaperonin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143737.1 protein_id gnl|my_center|LOCUS_23590 33264 33845 gene locus_tag LOCUS_23600 gene grpE 33264 33845 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_23600 33906 35747 gene locus_tag LOCUS_23610 gene dnaK 33906 35747 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_23610 35894 37015 gene locus_tag LOCUS_23620 gene dnaJ 35894 37015 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_23620 37201 38142 gene locus_tag LOCUS_23630 gene prmA 37201 38142 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872105.1 protein_id gnl|my_center|LOCUS_23630 38144 38881 gene locus_tag LOCUS_23640 38144 38881 CDS product RsmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460869.1 protein_id gnl|my_center|LOCUS_23640 38881 40179 gene locus_tag LOCUS_23650 gene mtaB 38881 40179 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816469.1 protein_id gnl|my_center|LOCUS_23650 40350 40697 gene locus_tag LOCUS_23660 40350 40697 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546430.1 protein_id gnl|my_center|LOCUS_23660 40794 40967 gene locus_tag LOCUS_23670 40794 40967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 40989 41441 gene locus_tag LOCUS_23680 40989 41441 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460866.1 protein_id gnl|my_center|LOCUS_23680 42044 43348 gene locus_tag LOCUS_23690 42044 43348 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583133.1 protein_id gnl|my_center|LOCUS_23690 43390 44406 gene locus_tag LOCUS_23700 gene floA 43390 44406 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812222.1 protein_id gnl|my_center|LOCUS_23700 44411 44767 gene locus_tag LOCUS_23710 44411 44767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 44816 45781 gene locus_tag LOCUS_23720 44816 45781 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816443.1 protein_id gnl|my_center|LOCUS_23720 45815 47998 gene locus_tag LOCUS_23730 45815 47998 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392131.1 protein_id gnl|my_center|LOCUS_23730 47916 48383 gene locus_tag LOCUS_23740 gene ybeY 47916 48383 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392132.1 protein_id gnl|my_center|LOCUS_23740 48471 48755 gene locus_tag LOCUS_23750 48471 48755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 48766 49179 gene locus_tag LOCUS_23760 gene cdd 48766 49179 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080780.1 protein_id gnl|my_center|LOCUS_23760 49163 50059 gene locus_tag LOCUS_23770 gene era 49163 50059 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460854.1 protein_id gnl|my_center|LOCUS_23770 50103 50690 gene locus_tag LOCUS_23780 50103 50690 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546603.1 protein_id gnl|my_center|LOCUS_23780 50749 52041 gene locus_tag LOCUS_23790 50749 52041 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460069.1 protein_id gnl|my_center|LOCUS_23790 52070 52804 gene locus_tag LOCUS_23800 52070 52804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 53157 54035 gene locus_tag LOCUS_23810 gene glyQ 53157 54035 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392140.1 protein_id gnl|my_center|LOCUS_23810 54035 56098 gene locus_tag LOCUS_23820 gene glyS 54035 56098 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392141.1 protein_id gnl|my_center|LOCUS_23820 56187 56837 gene locus_tag LOCUS_23830 56187 56837 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392142.1 protein_id gnl|my_center|LOCUS_23830 56843 57655 gene locus_tag LOCUS_23840 56843 57655 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230064.1 protein_id gnl|my_center|LOCUS_23840 >Feature sequence21 39 677 gene locus_tag LOCUS_23850 39 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23850 682 1359 gene locus_tag LOCUS_23860 682 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23860 1707 1982 gene locus_tag LOCUS_23870 1707 1982 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_23870 1988 3682 gene locus_tag LOCUS_23880 gene ptsP 1988 3682 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218638.1 protein_id gnl|my_center|LOCUS_23880 4648 3629 gene locus_tag LOCUS_23890 4648 3629 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861264.1 protein_id gnl|my_center|LOCUS_23890 4774 6138 gene locus_tag LOCUS_23900 4774 6138 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711305.1 protein_id gnl|my_center|LOCUS_23900 6141 7232 gene locus_tag LOCUS_23910 6141 7232 CDS product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948951.1 protein_id gnl|my_center|LOCUS_23910 7222 8133 gene locus_tag LOCUS_23920 gene murQ 7222 8133 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477459.1 protein_id gnl|my_center|LOCUS_23920 8171 8698 gene locus_tag LOCUS_23930 8171 8698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 8747 9931 gene locus_tag LOCUS_23940 gene nagA 8747 9931 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582637.1 protein_id gnl|my_center|LOCUS_23940 10158 10610 gene locus_tag LOCUS_23950 10158 10610 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262312.1 protein_id gnl|my_center|LOCUS_23950 10643 11266 gene locus_tag LOCUS_23960 10643 11266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 11467 12732 gene locus_tag LOCUS_23970 11467 12732 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943128.1 protein_id gnl|my_center|LOCUS_23970 12738 13241 gene locus_tag LOCUS_23980 12738 13241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 14281 13283 gene locus_tag LOCUS_23990 14281 13283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 14733 14410 gene locus_tag LOCUS_24000 14733 14410 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459212.1 protein_id gnl|my_center|LOCUS_24000 16892 14844 gene locus_tag LOCUS_24010 16892 14844 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945529.1 protein_id gnl|my_center|LOCUS_24010 18505 17129 gene locus_tag LOCUS_24020 18505 17129 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243011.1 protein_id gnl|my_center|LOCUS_24020 18941 20185 gene locus_tag LOCUS_24030 18941 20185 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461849.1 protein_id gnl|my_center|LOCUS_24030 20379 21302 gene locus_tag LOCUS_24040 20379 21302 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815230.1 protein_id gnl|my_center|LOCUS_24040 21488 22483 gene locus_tag LOCUS_24050 21488 22483 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017005.1 protein_id gnl|my_center|LOCUS_24050 22495 22758 gene locus_tag LOCUS_24060 22495 22758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 22775 23395 gene locus_tag LOCUS_24070 22775 23395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 23443 24951 gene locus_tag LOCUS_24080 23443 24951 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462303.1 protein_id gnl|my_center|LOCUS_24080 25036 27579 gene locus_tag LOCUS_24090 gene cutC 25036 27579 CDS product choline trimethylamine-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272795.1 protein_id gnl|my_center|LOCUS_24090 27579 28562 gene locus_tag LOCUS_24100 gene cutD 27579 28562 CDS product choline TMA-lyase-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462301.1 protein_id gnl|my_center|LOCUS_24100 28603 28956 gene locus_tag LOCUS_24110 28603 28956 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815259.1 protein_id gnl|my_center|LOCUS_24110 28953 29387 gene locus_tag LOCUS_24120 28953 29387 CDS product EutP/PduV family microcompartment system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815261.1 protein_id gnl|my_center|LOCUS_24120 29438 30280 gene locus_tag LOCUS_24130 gene eutJ 29438 30280 CDS product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815263.1 protein_id gnl|my_center|LOCUS_24130 30300 30611 gene locus_tag LOCUS_24140 30300 30611 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815265.1 protein_id gnl|my_center|LOCUS_24140 30608 30868 gene locus_tag LOCUS_24150 30608 30868 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815267.1 protein_id gnl|my_center|LOCUS_24150 30890 32227 gene locus_tag LOCUS_24160 30890 32227 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462297.1 protein_id gnl|my_center|LOCUS_24160 32220 32768 gene locus_tag LOCUS_24170 32220 32768 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815271.1 protein_id gnl|my_center|LOCUS_24170 32820 33491 gene locus_tag LOCUS_24180 32820 33491 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815273.1 protein_id gnl|my_center|LOCUS_24180 33503 34060 gene locus_tag LOCUS_24190 33503 34060 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815275.1 protein_id gnl|my_center|LOCUS_24190 34146 35630 gene locus_tag LOCUS_24200 34146 35630 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462296.1 protein_id gnl|my_center|LOCUS_24200 35632 36276 gene locus_tag LOCUS_24210 35632 36276 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018212010.1 protein_id gnl|my_center|LOCUS_24210 36297 36587 gene locus_tag LOCUS_24220 gene eutM 36297 36587 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815281.1 protein_id gnl|my_center|LOCUS_24220 36847 39354 gene locus_tag LOCUS_24230 gene hrpB 36847 39354 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405451.1 protein_id gnl|my_center|LOCUS_24230 39354 40208 gene locus_tag LOCUS_24240 39354 40208 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267511.1 protein_id gnl|my_center|LOCUS_24240 40329 42956 gene locus_tag LOCUS_24250 40329 42956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 43289 45322 gene locus_tag LOCUS_24260 43289 45322 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459970.1 protein_id gnl|my_center|LOCUS_24260 45552 46709 gene locus_tag LOCUS_24270 45552 46709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 46763 47194 gene locus_tag LOCUS_24280 46763 47194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 47191 48015 gene locus_tag LOCUS_24290 47191 48015 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_24290 48855 48037 gene locus_tag LOCUS_24300 48855 48037 CDS product RMD1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943194.1 protein_id gnl|my_center|LOCUS_24300 49289 48888 gene locus_tag LOCUS_24310 49289 48888 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256140.1 protein_id gnl|my_center|LOCUS_24310 49553 50671 gene locus_tag LOCUS_24320 49553 50671 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941162.1 protein_id gnl|my_center|LOCUS_24320 50771 54289 gene locus_tag LOCUS_24330 gene nifJ 50771 54289 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987043.1 protein_id gnl|my_center|LOCUS_24330 54476 54700 gene locus_tag LOCUS_24340 54476 54700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 54847 56250 gene locus_tag LOCUS_24350 54847 56250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 >Feature sequence22 953 192 gene locus_tag LOCUS_24360 953 192 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896287.1 protein_id gnl|my_center|LOCUS_24360 1991 960 gene locus_tag LOCUS_24370 1991 960 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896290.1 protein_id gnl|my_center|LOCUS_24370 2737 1988 gene locus_tag LOCUS_24380 gene pxpB 2737 1988 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868109.1 protein_id gnl|my_center|LOCUS_24380 4140 2917 gene locus_tag LOCUS_24390 4140 2917 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419704.1 protein_id gnl|my_center|LOCUS_24390 4994 4197 gene locus_tag LOCUS_24400 4994 4197 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002204714.1 protein_id gnl|my_center|LOCUS_24400 5695 4994 gene locus_tag LOCUS_24410 5695 4994 CDS product DUF2848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811063.1 protein_id gnl|my_center|LOCUS_24410 5902 5723 gene locus_tag LOCUS_24420 5902 5723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 5914 8016 gene locus_tag LOCUS_24430 5914 8016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 10441 8078 gene locus_tag LOCUS_24440 10441 8078 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229541.1 protein_id gnl|my_center|LOCUS_24440 12979 10451 gene locus_tag LOCUS_24450 12979 10451 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393214.1 protein_id gnl|my_center|LOCUS_24450 13298 13038 gene locus_tag LOCUS_24460 gene zapA 13298 13038 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808223.1 protein_id gnl|my_center|LOCUS_24460 15876 13447 gene locus_tag LOCUS_24470 gene pheT 15876 13447 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_24470 16979 15957 gene locus_tag LOCUS_24480 gene pheS 16979 15957 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_24480 18230 17421 gene locus_tag LOCUS_24490 18230 17421 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965655.1 protein_id gnl|my_center|LOCUS_24490 18892 18230 gene locus_tag LOCUS_24500 18892 18230 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357824.1 protein_id gnl|my_center|LOCUS_24500 20271 18904 gene locus_tag LOCUS_24510 20271 18904 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062283476.1 protein_id gnl|my_center|LOCUS_24510 21268 20420 gene locus_tag LOCUS_24520 21268 20420 CDS product ketose 1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418474.1 protein_id gnl|my_center|LOCUS_24520 21972 21586 gene locus_tag LOCUS_24530 gene rplT 21972 21586 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393257.1 protein_id gnl|my_center|LOCUS_24530 22202 22005 gene locus_tag LOCUS_24540 gene rpmI 22202 22005 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_24540 22766 22218 gene locus_tag LOCUS_24550 gene infC 22766 22218 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808206.1 protein_id gnl|my_center|LOCUS_24550 24856 22934 gene locus_tag LOCUS_24560 gene thrS 24856 22934 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 protein_id gnl|my_center|LOCUS_24560 25534 25199 gene locus_tag LOCUS_24570 25534 25199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 26600 25539 gene locus_tag LOCUS_24580 gene hydE 26600 25539 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964939.1 protein_id gnl|my_center|LOCUS_24580 28758 26827 gene locus_tag LOCUS_24590 28758 26827 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_24590 29351 28791 gene locus_tag LOCUS_24600 29351 28791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 30335 29370 gene locus_tag LOCUS_24610 30335 29370 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_24610 32005 30755 gene locus_tag LOCUS_24620 32005 30755 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732668.1 protein_id gnl|my_center|LOCUS_24620 33301 32069 gene locus_tag LOCUS_24630 33301 32069 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024286.1 protein_id gnl|my_center|LOCUS_24630 34062 33298 gene locus_tag LOCUS_24640 34062 33298 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938321.1 protein_id gnl|my_center|LOCUS_24640 34826 34206 gene locus_tag LOCUS_24650 34826 34206 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391567.1 protein_id gnl|my_center|LOCUS_24650 35626 34874 gene locus_tag LOCUS_24660 35626 34874 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544947.1 protein_id gnl|my_center|LOCUS_24660 36249 35695 gene locus_tag LOCUS_24670 gene thpR 36249 35695 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943961.1 protein_id gnl|my_center|LOCUS_24670 37092 36334 gene locus_tag LOCUS_24680 37092 36334 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 protein_id gnl|my_center|LOCUS_24680 38220 37114 gene locus_tag LOCUS_24690 gene menC 38220 37114 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403270.1 protein_id gnl|my_center|LOCUS_24690 39726 38245 gene locus_tag LOCUS_24700 39726 38245 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449576.1 protein_id gnl|my_center|LOCUS_24700 40619 39804 gene locus_tag LOCUS_24710 gene menB 40619 39804 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229054.1 protein_id gnl|my_center|LOCUS_24710 41462 40650 gene locus_tag LOCUS_24720 gene menH 41462 40650 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255997.1 protein_id gnl|my_center|LOCUS_24720 43243 41474 gene locus_tag LOCUS_24730 gene menD 43243 41474 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059249.1 protein_id gnl|my_center|LOCUS_24730 44674 43244 gene locus_tag LOCUS_24740 44674 43244 CDS product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398674.1 protein_id gnl|my_center|LOCUS_24740 44924 45655 gene locus_tag LOCUS_24750 44924 45655 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392949.1 protein_id gnl|my_center|LOCUS_24750 46454 45540 gene locus_tag LOCUS_24760 gene modA 46454 45540 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461081.1 protein_id gnl|my_center|LOCUS_24760 47542 46712 gene locus_tag LOCUS_24770 47542 46712 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545002.1 protein_id gnl|my_center|LOCUS_24770 48229 47645 gene locus_tag LOCUS_24780 48229 47645 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869954.1 protein_id gnl|my_center|LOCUS_24780 48754 48305 gene locus_tag LOCUS_24790 48754 48305 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393157.1 protein_id gnl|my_center|LOCUS_24790 48924 48754 gene locus_tag LOCUS_24800 48924 48754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 49563 49003 gene locus_tag LOCUS_24810 49563 49003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 49786 49553 gene locus_tag LOCUS_24820 49786 49553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 50034 50726 gene locus_tag LOCUS_24830 50034 50726 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459569.1 protein_id gnl|my_center|LOCUS_24830 50723 52231 gene locus_tag LOCUS_24840 50723 52231 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172635924.1 protein_id gnl|my_center|LOCUS_24840 52381 52779 gene locus_tag LOCUS_24850 52381 52779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 >Feature sequence23 885 67 gene locus_tag LOCUS_24860 gene folE2 885 67 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_24860 2010 910 gene locus_tag LOCUS_24870 2010 910 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966912.1 protein_id gnl|my_center|LOCUS_24870 3432 2227 gene locus_tag LOCUS_24880 gene larC 3432 2227 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460167.1 protein_id gnl|my_center|LOCUS_24880 4188 3436 gene locus_tag LOCUS_24890 gene larB 4188 3436 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812203.1 protein_id gnl|my_center|LOCUS_24890 4074 4352 gene locus_tag LOCUS_24900 4074 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 5390 4347 gene locus_tag LOCUS_24910 5390 4347 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963600.1 protein_id gnl|my_center|LOCUS_24910 8724 5602 gene locus_tag LOCUS_24920 8724 5602 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_24920 9854 8721 gene locus_tag LOCUS_24930 gene vmeC 9854 8721 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VmeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455175.1 protein_id gnl|my_center|LOCUS_24930 11170 10073 gene locus_tag LOCUS_24940 gene aroB 11170 10073 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545319.1 protein_id gnl|my_center|LOCUS_24940 11684 11157 gene locus_tag LOCUS_24950 11684 11157 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_24950 12784 11681 gene locus_tag LOCUS_24960 gene aroC 12784 11681 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879991.1 protein_id gnl|my_center|LOCUS_24960 13351 12806 gene locus_tag LOCUS_24970 13351 12806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 13885 13355 gene locus_tag LOCUS_24980 13885 13355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 14916 13882 gene locus_tag LOCUS_24990 gene pilM 14916 13882 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181416674.1 protein_id gnl|my_center|LOCUS_24990 15197 14925 gene locus_tag LOCUS_25000 15197 14925 CDS product late competence development ComFB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391619.1 protein_id gnl|my_center|LOCUS_25000 15638 15210 gene locus_tag LOCUS_25010 15638 15210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 16187 15675 gene locus_tag LOCUS_25020 16187 15675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 16576 16199 gene locus_tag LOCUS_25030 16576 16199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 17081 16638 gene locus_tag LOCUS_25040 17081 16638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 17513 17109 gene locus_tag LOCUS_25050 17513 17109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 17512 17661 gene locus_tag LOCUS_25060 17512 17661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 18476 18087 gene locus_tag LOCUS_25070 18476 18087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 19972 18746 gene locus_tag LOCUS_25080 19972 18746 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393061.1 protein_id gnl|my_center|LOCUS_25080 21052 19973 gene locus_tag LOCUS_25090 21052 19973 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583239.1 protein_id gnl|my_center|LOCUS_25090 22739 21066 gene locus_tag LOCUS_25100 22739 21066 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_25100 23638 22784 gene locus_tag LOCUS_25110 gene aroE 23638 22784 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289627.1 protein_id gnl|my_center|LOCUS_25110 24172 23666 gene locus_tag LOCUS_25120 24172 23666 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393068.1 protein_id gnl|my_center|LOCUS_25120 25162 24593 gene locus_tag LOCUS_25130 25162 24593 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_25130 26905 25190 gene locus_tag LOCUS_25140 26905 25190 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583190.1 protein_id gnl|my_center|LOCUS_25140 27697 27032 gene locus_tag LOCUS_25150 27697 27032 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811530.1 protein_id gnl|my_center|LOCUS_25150 28851 27886 gene locus_tag LOCUS_25160 28851 27886 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393837.1 protein_id gnl|my_center|LOCUS_25160 29703 29323 gene locus_tag LOCUS_25170 29703 29323 CDS product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880398.1 protein_id gnl|my_center|LOCUS_25170 30181 29696 gene locus_tag LOCUS_25180 30181 29696 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880396.1 protein_id gnl|my_center|LOCUS_25180 30876 30178 gene locus_tag LOCUS_25190 gene cybH 30876 30178 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880394.1 protein_id gnl|my_center|LOCUS_25190 32798 30900 gene locus_tag LOCUS_25200 32798 30900 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880393.1 protein_id gnl|my_center|LOCUS_25200 33905 32826 gene locus_tag LOCUS_25210 33905 32826 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880392.1 protein_id gnl|my_center|LOCUS_25210 35051 34143 gene locus_tag LOCUS_25220 35051 34143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 35377 35174 gene locus_tag LOCUS_25230 35377 35174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 36941 35430 gene locus_tag LOCUS_25240 36941 35430 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015261871.1 protein_id gnl|my_center|LOCUS_25240 37630 36938 gene locus_tag LOCUS_25250 37630 36938 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459569.1 protein_id gnl|my_center|LOCUS_25250 38062 37739 gene locus_tag LOCUS_25260 gene trxA 38062 37739 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392444.1 protein_id gnl|my_center|LOCUS_25260 39614 38664 gene locus_tag LOCUS_25270 39614 38664 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_25270 40368 39661 gene locus_tag LOCUS_25280 40368 39661 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938748.1 protein_id gnl|my_center|LOCUS_25280 41667 40549 gene locus_tag LOCUS_25290 41667 40549 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392163.1 protein_id gnl|my_center|LOCUS_25290 42347 41658 gene locus_tag LOCUS_25300 42347 41658 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889262.1 protein_id gnl|my_center|LOCUS_25300 42496 42421 gene locus_tag LOCUS_t00360 42496 42421 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 42598 42524 gene locus_tag LOCUS_t00370 42598 42524 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 42682 42608 gene locus_tag LOCUS_t00380 42682 42608 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 42798 42723 gene locus_tag LOCUS_t00390 42798 42723 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 43984 42875 gene locus_tag LOCUS_25310 gene rpoD 43984 42875 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_25310 45834 44032 gene locus_tag LOCUS_25320 gene dnaG 45834 44032 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816339.1 protein_id gnl|my_center|LOCUS_25320 47149 46121 gene locus_tag LOCUS_25330 47149 46121 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816343.1 protein_id gnl|my_center|LOCUS_25330 47350 47859 gene locus_tag LOCUS_25340 47350 47859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 >Feature sequence24 20 95 gene locus_tag LOCUS_t00400 20 95 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 312 1295 gene locus_tag LOCUS_25350 312 1295 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943043.1 protein_id gnl|my_center|LOCUS_25350 1361 3958 gene locus_tag LOCUS_25360 gene clpB 1361 3958 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869824.1 protein_id gnl|my_center|LOCUS_25360 4191 4937 gene locus_tag LOCUS_25370 4191 4937 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221295.1 protein_id gnl|my_center|LOCUS_25370 5137 5427 gene locus_tag LOCUS_25380 5137 5427 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816969.1 protein_id gnl|my_center|LOCUS_25380 5465 6628 gene locus_tag LOCUS_25390 5465 6628 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460953.1 protein_id gnl|my_center|LOCUS_25390 7006 8406 gene locus_tag LOCUS_25400 7006 8406 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810284.1 protein_id gnl|my_center|LOCUS_25400 8946 9803 gene locus_tag LOCUS_25410 gene garR 8946 9803 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566608.1 protein_id gnl|my_center|LOCUS_25410 10064 11503 gene locus_tag LOCUS_25420 10064 11503 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816116.1 protein_id gnl|my_center|LOCUS_25420 11933 12988 gene locus_tag LOCUS_25430 11933 12988 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565859.1 protein_id gnl|my_center|LOCUS_25430 13079 13588 gene locus_tag LOCUS_25440 13079 13588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25440 13578 14867 gene locus_tag LOCUS_25450 13578 14867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 14943 15800 gene locus_tag LOCUS_25460 gene garR 14943 15800 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566608.1 protein_id gnl|my_center|LOCUS_25460 16079 17500 gene locus_tag LOCUS_25470 16079 17500 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941769.1 protein_id gnl|my_center|LOCUS_25470 17644 18636 gene locus_tag LOCUS_25480 17644 18636 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393378.1 protein_id gnl|my_center|LOCUS_25480 19543 18644 gene locus_tag LOCUS_25490 19543 18644 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_25490 21035 19695 gene locus_tag LOCUS_25500 21035 19695 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459729.1 protein_id gnl|my_center|LOCUS_25500 22276 21071 gene locus_tag LOCUS_25510 22276 21071 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_25510 23172 22327 gene locus_tag LOCUS_25520 23172 22327 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393881.1 protein_id gnl|my_center|LOCUS_25520 24391 23285 gene locus_tag LOCUS_25530 24391 23285 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816110.1 protein_id gnl|my_center|LOCUS_25530 25132 24482 gene locus_tag LOCUS_25540 gene fsa 25132 24482 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667670.1 protein_id gnl|my_center|LOCUS_25540 25314 26108 gene locus_tag LOCUS_25550 25314 26108 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816105.1 protein_id gnl|my_center|LOCUS_25550 26150 27241 gene locus_tag LOCUS_25560 26150 27241 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816112.1 protein_id gnl|my_center|LOCUS_25560 27328 28629 gene locus_tag LOCUS_25570 27328 28629 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816106.1 protein_id gnl|my_center|LOCUS_25570 28726 29640 gene locus_tag LOCUS_25580 28726 29640 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816113.1 protein_id gnl|my_center|LOCUS_25580 29661 30506 gene locus_tag LOCUS_25590 29661 30506 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459730.1 protein_id gnl|my_center|LOCUS_25590 30664 31500 gene locus_tag LOCUS_25600 30664 31500 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392942.1 protein_id gnl|my_center|LOCUS_25600 31554 34268 gene locus_tag LOCUS_25610 31554 34268 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073717.1 protein_id gnl|my_center|LOCUS_25610 34971 34273 gene locus_tag LOCUS_25620 34971 34273 CDS product DUF3944 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323695.1 protein_id gnl|my_center|LOCUS_25620 35115 35786 gene locus_tag LOCUS_25630 35115 35786 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986922.1 protein_id gnl|my_center|LOCUS_25630 35941 36375 gene locus_tag LOCUS_25640 35941 36375 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966974.1 protein_id gnl|my_center|LOCUS_25640 37743 36487 gene locus_tag LOCUS_25650 37743 36487 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438175.1 protein_id gnl|my_center|LOCUS_25650 38741 38001 gene locus_tag LOCUS_25660 38741 38001 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393787.1 protein_id gnl|my_center|LOCUS_25660 40267 39041 gene locus_tag LOCUS_25670 40267 39041 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391587.1 protein_id gnl|my_center|LOCUS_25670 41679 40291 gene locus_tag LOCUS_25680 41679 40291 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_25680 42083 44230 gene locus_tag LOCUS_25690 42083 44230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 >Feature sequence25 692 294 gene locus_tag LOCUS_25700 692 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 1708 785 gene locus_tag LOCUS_25710 1708 785 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976038.1 protein_id gnl|my_center|LOCUS_25710 3076 1856 gene locus_tag LOCUS_25720 3076 1856 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_25720 3920 3192 gene locus_tag LOCUS_25730 3920 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 4347 3937 gene locus_tag LOCUS_25740 4347 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 5230 4409 gene locus_tag LOCUS_25750 5230 4409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969426.1 protein_id gnl|my_center|LOCUS_25750 5563 5267 gene locus_tag LOCUS_25760 5563 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 6458 6111 gene locus_tag LOCUS_25770 6458 6111 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440244.1 protein_id gnl|my_center|LOCUS_25770 7134 6538 gene locus_tag LOCUS_25780 7134 6538 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_25780 7331 8365 gene locus_tag LOCUS_25790 7331 8365 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393149.1 protein_id gnl|my_center|LOCUS_25790 9581 8382 gene locus_tag LOCUS_25800 9581 8382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 11041 9782 gene locus_tag LOCUS_25810 11041 9782 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969784.1 protein_id gnl|my_center|LOCUS_25810 12173 11070 gene locus_tag LOCUS_25820 12173 11070 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008194.1 protein_id gnl|my_center|LOCUS_25820 13910 12342 gene locus_tag LOCUS_25830 13910 12342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 14793 14302 gene locus_tag LOCUS_25840 14793 14302 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003091.1 protein_id gnl|my_center|LOCUS_25840 15233 14811 gene locus_tag LOCUS_25850 15233 14811 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902189.1 protein_id gnl|my_center|LOCUS_25850 16400 15312 gene locus_tag LOCUS_25860 gene rlmN 16400 15312 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989487.1 protein_id gnl|my_center|LOCUS_25860 18203 16554 gene locus_tag LOCUS_25870 gene ilvD 18203 16554 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_25870 19546 18254 gene locus_tag LOCUS_25880 19546 18254 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_25880 20763 19597 gene locus_tag LOCUS_25890 20763 19597 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439842.1 protein_id gnl|my_center|LOCUS_25890 21066 20785 gene locus_tag LOCUS_25900 21066 20785 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582865.1 protein_id gnl|my_center|LOCUS_25900 21460 22086 gene locus_tag LOCUS_25910 21460 22086 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090461.1 protein_id gnl|my_center|LOCUS_25910 22833 22120 gene locus_tag LOCUS_25920 22833 22120 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870318.1 protein_id gnl|my_center|LOCUS_25920 23095 22859 gene locus_tag LOCUS_25930 23095 22859 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938477.1 protein_id gnl|my_center|LOCUS_25930 23470 23129 gene locus_tag LOCUS_25940 23470 23129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 25339 23597 gene locus_tag LOCUS_25950 25339 23597 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938476.1 protein_id gnl|my_center|LOCUS_25950 25909 25706 gene locus_tag LOCUS_25960 25909 25706 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704042.1 protein_id gnl|my_center|LOCUS_25960 26792 26058 gene locus_tag LOCUS_25970 26792 26058 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815292.1 protein_id gnl|my_center|LOCUS_25970 28434 26824 gene locus_tag LOCUS_25980 28434 26824 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272455.1 protein_id gnl|my_center|LOCUS_25980 28928 28458 gene locus_tag LOCUS_25990 28928 28458 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024098.1 protein_id gnl|my_center|LOCUS_25990 29434 29012 gene locus_tag LOCUS_26000 29434 29012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 30218 29448 gene locus_tag LOCUS_26010 30218 29448 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776489.1 protein_id gnl|my_center|LOCUS_26010 30697 30281 gene locus_tag LOCUS_26020 30697 30281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 31930 30857 gene locus_tag LOCUS_26030 31930 30857 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816060.1 protein_id gnl|my_center|LOCUS_26030 32925 32086 gene locus_tag LOCUS_26040 32925 32086 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460375.1 protein_id gnl|my_center|LOCUS_26040 33752 32973 gene locus_tag LOCUS_26050 33752 32973 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889459.1 protein_id gnl|my_center|LOCUS_26050 35490 34183 gene locus_tag LOCUS_26060 35490 34183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 35937 36101 gene locus_tag LOCUS_26070 35937 36101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 37032 36043 gene locus_tag LOCUS_26080 37032 36043 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878701.1 protein_id gnl|my_center|LOCUS_26080 38080 37157 gene locus_tag LOCUS_26090 38080 37157 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331309.1 protein_id gnl|my_center|LOCUS_26090 40191 38158 gene locus_tag LOCUS_26100 40191 38158 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773682.1 protein_id gnl|my_center|LOCUS_26100 41179 40319 gene locus_tag LOCUS_26110 41179 40319 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460375.1 protein_id gnl|my_center|LOCUS_26110 42835 41255 gene locus_tag LOCUS_26120 42835 41255 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989914.1 protein_id gnl|my_center|LOCUS_26120 43819 43037 gene locus_tag LOCUS_26130 43819 43037 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048188.1 protein_id gnl|my_center|LOCUS_26130 >Feature sequence26 694 125 gene locus_tag LOCUS_26140 694 125 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943299.1 protein_id gnl|my_center|LOCUS_26140 1921 731 gene locus_tag LOCUS_26150 1921 731 CDS product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948785.1 protein_id gnl|my_center|LOCUS_26150 2241 1951 gene locus_tag LOCUS_26160 2241 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 3505 2555 gene locus_tag LOCUS_26170 3505 2555 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387246.1 protein_id gnl|my_center|LOCUS_26170 4442 3627 gene locus_tag LOCUS_26180 gene thiM 4442 3627 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393513.1 protein_id gnl|my_center|LOCUS_26180 6013 4574 gene locus_tag LOCUS_26190 6013 4574 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206587.1 protein_id gnl|my_center|LOCUS_26190 6873 6184 gene locus_tag LOCUS_26200 6873 6184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 7981 6992 gene locus_tag LOCUS_26210 7981 6992 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226442.1 protein_id gnl|my_center|LOCUS_26210 8152 8487 gene locus_tag LOCUS_26220 8152 8487 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047981.1 protein_id gnl|my_center|LOCUS_26220 9175 8612 gene locus_tag LOCUS_26230 9175 8612 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436558.1 protein_id gnl|my_center|LOCUS_26230 11090 9261 gene locus_tag LOCUS_26240 gene glmS 11090 9261 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808420.1 protein_id gnl|my_center|LOCUS_26240 12734 11394 gene locus_tag LOCUS_26250 gene glmM 12734 11394 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461863.1 protein_id gnl|my_center|LOCUS_26250 14377 12779 gene locus_tag LOCUS_26260 14377 12779 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048336.1 protein_id gnl|my_center|LOCUS_26260 15335 14394 gene locus_tag LOCUS_26270 15335 14394 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393730.1 protein_id gnl|my_center|LOCUS_26270 16153 15332 gene locus_tag LOCUS_26280 gene cdaA 16153 15332 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_26280 17365 16292 gene locus_tag LOCUS_26290 17365 16292 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_26290 18899 17484 gene locus_tag LOCUS_26300 gene argH 18899 17484 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_26300 20110 18896 gene locus_tag LOCUS_26310 20110 18896 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393768.1 protein_id gnl|my_center|LOCUS_26310 21081 20149 gene locus_tag LOCUS_26320 gene argF 21081 20149 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_26320 22334 21141 gene locus_tag LOCUS_26330 22334 21141 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870226.1 protein_id gnl|my_center|LOCUS_26330 23271 22387 gene locus_tag LOCUS_26340 gene argB 23271 22387 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_26340 24498 23290 gene locus_tag LOCUS_26350 gene argJ 24498 23290 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259189.1 protein_id gnl|my_center|LOCUS_26350 25199 24684 gene locus_tag LOCUS_26360 25199 24684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26360 26064 25237 gene locus_tag LOCUS_26370 26064 25237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26370 26299 27066 gene locus_tag LOCUS_26380 26299 27066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 27816 27163 gene locus_tag LOCUS_26390 27816 27163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 28453 28061 gene locus_tag LOCUS_26400 gene rpsI 28453 28061 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393901.1 protein_id gnl|my_center|LOCUS_26400 28914 28477 gene locus_tag LOCUS_26410 gene rplM 28914 28477 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393902.1 protein_id gnl|my_center|LOCUS_26410 29830 29081 gene locus_tag LOCUS_26420 gene truA 29830 29081 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966380.1 protein_id gnl|my_center|LOCUS_26420 30632 29832 gene locus_tag LOCUS_26430 30632 29832 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_26430 31491 30622 gene locus_tag LOCUS_26440 31491 30622 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966382.1 protein_id gnl|my_center|LOCUS_26440 32315 31482 gene locus_tag LOCUS_26450 32315 31482 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226187.1 protein_id gnl|my_center|LOCUS_26450 32800 32462 gene locus_tag LOCUS_26460 gene rplQ 32800 32462 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357477.1 protein_id gnl|my_center|LOCUS_26460 33773 32814 gene locus_tag LOCUS_26470 33773 32814 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810110.1 protein_id gnl|my_center|LOCUS_26470 34466 33834 gene locus_tag LOCUS_26480 gene rpsD 34466 33834 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_26480 34885 34493 gene locus_tag LOCUS_26490 gene rpsK 34885 34493 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_26490 35276 34902 gene locus_tag LOCUS_26500 gene rpsM 35276 34902 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_26500 35572 35354 gene locus_tag LOCUS_26510 gene infA 35572 35354 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029884.1 protein_id gnl|my_center|LOCUS_26510 36441 35695 gene locus_tag LOCUS_26520 gene map 36441 35695 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_26520 37090 36443 gene locus_tag LOCUS_26530 37090 36443 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810125.1 protein_id gnl|my_center|LOCUS_26530 38367 37111 gene locus_tag LOCUS_26540 gene secY 38367 37111 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_26540 38808 38368 gene locus_tag LOCUS_26550 gene rplO 38808 38368 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357513.1 protein_id gnl|my_center|LOCUS_26550 39012 38827 gene locus_tag LOCUS_26560 gene rpmD 39012 38827 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936638.1 protein_id gnl|my_center|LOCUS_26560 39525 39025 gene locus_tag LOCUS_26570 gene rpsE 39525 39025 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_26570 39861 39544 gene locus_tag LOCUS_26580 gene rplR 39861 39544 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459106.1 protein_id gnl|my_center|LOCUS_26580 >Feature sequence27 282 410 gene locus_tag LOCUS_26590 282 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 422 1450 gene locus_tag LOCUS_26600 422 1450 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879345.1 protein_id gnl|my_center|LOCUS_26600 2457 1552 gene locus_tag LOCUS_26610 2457 1552 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245441.1 protein_id gnl|my_center|LOCUS_26610 2696 3004 gene locus_tag LOCUS_26620 2696 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 3119 3544 gene locus_tag LOCUS_26630 gene ssb 3119 3544 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815182.1 protein_id gnl|my_center|LOCUS_26630 3711 6635 gene locus_tag LOCUS_26640 3711 6635 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048254.1 protein_id gnl|my_center|LOCUS_26640 6714 6789 gene locus_tag LOCUS_t00410 6714 6789 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 6870 7454 gene locus_tag LOCUS_26650 6870 7454 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161533195.1 protein_id gnl|my_center|LOCUS_26650 7518 8891 gene locus_tag LOCUS_26660 7518 8891 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810284.1 protein_id gnl|my_center|LOCUS_26660 9619 9014 gene locus_tag LOCUS_26670 9619 9014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26670 10225 9905 gene locus_tag LOCUS_26680 10225 9905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 10804 10463 gene locus_tag LOCUS_26690 10804 10463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 11333 11524 gene locus_tag LOCUS_26700 11333 11524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 12441 11539 gene locus_tag LOCUS_26710 12441 11539 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965690.1 protein_id gnl|my_center|LOCUS_26710 12776 13744 gene locus_tag LOCUS_26720 gene pdhA 12776 13744 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_26720 13774 14766 gene locus_tag LOCUS_26730 13774 14766 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257218.1 protein_id gnl|my_center|LOCUS_26730 14766 15971 gene locus_tag LOCUS_26740 14766 15971 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257804.1 protein_id gnl|my_center|LOCUS_26740 15995 17386 gene locus_tag LOCUS_26750 gene lpdA 15995 17386 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949165.1 protein_id gnl|my_center|LOCUS_26750 17507 18394 gene locus_tag LOCUS_26760 17507 18394 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873993.1 protein_id gnl|my_center|LOCUS_26760 18473 19225 gene locus_tag LOCUS_26770 18473 19225 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065170.1 protein_id gnl|my_center|LOCUS_26770 19284 20543 gene locus_tag LOCUS_26780 19284 20543 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674843.1 protein_id gnl|my_center|LOCUS_26780 20843 22018 gene locus_tag LOCUS_26790 20843 22018 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158673.1 protein_id gnl|my_center|LOCUS_26790 22226 23392 gene locus_tag LOCUS_26800 gene sucC 22226 23392 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881049.1 protein_id gnl|my_center|LOCUS_26800 23407 24285 gene locus_tag LOCUS_26810 gene sucD 23407 24285 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881050.1 protein_id gnl|my_center|LOCUS_26810 24345 25145 gene locus_tag LOCUS_26820 24345 25145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_26820 25156 27069 gene locus_tag LOCUS_26830 25156 27069 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941837.1 protein_id gnl|my_center|LOCUS_26830 27069 27815 gene locus_tag LOCUS_26840 27069 27815 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941838.1 protein_id gnl|my_center|LOCUS_26840 28119 29345 gene locus_tag LOCUS_26850 28119 29345 CDS product NAD-dependent malic enzyme 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199012.1 protein_id gnl|my_center|LOCUS_26850 30143 30319 gene locus_tag LOCUS_26860 30143 30319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 30371 31099 gene locus_tag LOCUS_26870 30371 31099 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462089.1 protein_id gnl|my_center|LOCUS_26870 31290 32678 gene locus_tag LOCUS_26880 31290 32678 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015921358.1 protein_id gnl|my_center|LOCUS_26880 32763 33935 gene locus_tag LOCUS_26890 32763 33935 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258523.1 protein_id gnl|my_center|LOCUS_26890 33978 35123 gene locus_tag LOCUS_26900 gene ald 33978 35123 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219405.1 protein_id gnl|my_center|LOCUS_26900 35335 36774 gene locus_tag LOCUS_26910 35335 36774 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731109.1 protein_id gnl|my_center|LOCUS_26910 >Feature sequence28 1064 864 gene locus_tag LOCUS_26920 1064 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 1382 2191 gene locus_tag LOCUS_26930 1382 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 2404 2282 gene locus_tag LOCUS_26940 2404 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 3549 2743 gene locus_tag LOCUS_26950 3549 2743 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_26950 4385 3618 gene locus_tag LOCUS_26960 4385 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 4537 4941 gene locus_tag LOCUS_26970 4537 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 5398 4892 gene locus_tag LOCUS_26980 5398 4892 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810020.1 protein_id gnl|my_center|LOCUS_26980 6481 5477 gene locus_tag LOCUS_26990 6481 5477 CDS product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930605.1 protein_id gnl|my_center|LOCUS_26990 7605 6823 gene locus_tag LOCUS_27000 7605 6823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 7914 8210 gene locus_tag LOCUS_27010 7914 8210 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459031.1 protein_id gnl|my_center|LOCUS_27010 8362 9240 gene locus_tag LOCUS_27020 8362 9240 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437125.1 protein_id gnl|my_center|LOCUS_27020 9373 10626 gene locus_tag LOCUS_27030 9373 10626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 10646 11353 gene locus_tag LOCUS_27040 10646 11353 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985169.1 protein_id gnl|my_center|LOCUS_27040 11451 11738 gene locus_tag LOCUS_27050 11451 11738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 11738 12088 gene locus_tag LOCUS_27060 11738 12088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 12096 13139 gene locus_tag LOCUS_27070 12096 13139 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787328.1 protein_id gnl|my_center|LOCUS_27070 13164 13829 gene locus_tag LOCUS_27080 13164 13829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 13822 14694 gene locus_tag LOCUS_27090 13822 14694 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942624.1 protein_id gnl|my_center|LOCUS_27090 14755 15447 gene locus_tag LOCUS_27100 14755 15447 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066872391.1 protein_id gnl|my_center|LOCUS_27100 15691 16473 gene locus_tag LOCUS_27110 15691 16473 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966927.1 protein_id gnl|my_center|LOCUS_27110 17510 16554 gene locus_tag LOCUS_27120 gene bsdA 17510 16554 CDS product transcriptional regulator BsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246552.1 protein_id gnl|my_center|LOCUS_27120 17812 19107 gene locus_tag LOCUS_27130 17812 19107 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061243.1 protein_id gnl|my_center|LOCUS_27130 19173 20240 gene locus_tag LOCUS_27140 gene buk 19173 20240 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420702.1 protein_id gnl|my_center|LOCUS_27140 20272 22047 gene locus_tag LOCUS_27150 gene iorA 20272 22047 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430808.1 protein_id gnl|my_center|LOCUS_27150 22049 22630 gene locus_tag LOCUS_27160 22049 22630 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430806.1 protein_id gnl|my_center|LOCUS_27160 22783 23058 gene locus_tag LOCUS_27170 22783 23058 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_27170 23319 26867 gene locus_tag LOCUS_27180 gene nifJ 23319 26867 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987043.1 protein_id gnl|my_center|LOCUS_27180 27072 26875 gene locus_tag LOCUS_27190 27072 26875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 27643 27017 gene locus_tag LOCUS_27200 gene lexA 27643 27017 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238209.1 protein_id gnl|my_center|LOCUS_27200 27779 28039 gene locus_tag LOCUS_27210 27779 28039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 28208 29365 gene locus_tag LOCUS_27220 28208 29365 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765153.1 protein_id gnl|my_center|LOCUS_27220 29362 32427 gene locus_tag LOCUS_27230 29362 32427 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247622.1 protein_id gnl|my_center|LOCUS_27230 32476 33150 gene locus_tag LOCUS_27240 32476 33150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 >Feature sequence29 618 334 gene locus_tag LOCUS_27250 618 334 CDS product pro-sigmaK processing inhibitor BofA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391580.1 protein_id gnl|my_center|LOCUS_27250 1331 732 gene locus_tag LOCUS_27260 gene recR 1331 732 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_27260 1663 1337 gene locus_tag LOCUS_27270 1663 1337 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815036.1 protein_id gnl|my_center|LOCUS_27270 3426 1687 gene locus_tag LOCUS_27280 gene dnaX 3426 1687 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458896.1 protein_id gnl|my_center|LOCUS_27280 3831 3742 gene locus_tag LOCUS_t00420 3831 3742 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4464 3997 gene locus_tag LOCUS_27290 4464 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 5160 4750 gene locus_tag LOCUS_27300 5160 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 5368 5213 gene locus_tag LOCUS_27310 5368 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 5727 5425 gene locus_tag LOCUS_27320 5727 5425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 8392 5804 gene locus_tag LOCUS_27330 8392 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876271.1 protein_id gnl|my_center|LOCUS_27330 9535 8498 gene locus_tag LOCUS_27340 9535 8498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 10466 9714 gene locus_tag LOCUS_27350 10466 9714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 11035 10526 gene locus_tag LOCUS_27360 11035 10526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 11417 11184 gene locus_tag LOCUS_27370 11417 11184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 12069 11497 gene locus_tag LOCUS_27380 12069 11497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 13082 12156 gene locus_tag LOCUS_27390 13082 12156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 13453 13307 gene locus_tag LOCUS_27400 13453 13307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 14131 13655 gene locus_tag LOCUS_27410 14131 13655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 14571 14365 gene locus_tag LOCUS_27420 14571 14365 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095174.1 protein_id gnl|my_center|LOCUS_27420 15349 14687 gene locus_tag LOCUS_27430 15349 14687 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256835.1 protein_id gnl|my_center|LOCUS_27430 18323 16272 gene locus_tag LOCUS_27440 18323 16272 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949077.1 protein_id gnl|my_center|LOCUS_27440 21364 18353 gene locus_tag LOCUS_27450 21364 18353 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021984.1 protein_id gnl|my_center|LOCUS_27450 23918 21549 gene locus_tag LOCUS_27460 23918 21549 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120163.1 protein_id gnl|my_center|LOCUS_27460 24576 23974 gene locus_tag LOCUS_27470 24576 23974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 25012 24641 gene locus_tag LOCUS_27480 25012 24641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 26898 25066 gene locus_tag LOCUS_27490 26898 25066 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921313.1 protein_id gnl|my_center|LOCUS_27490 28074 26938 gene locus_tag LOCUS_27500 28074 26938 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965535.1 protein_id gnl|my_center|LOCUS_27500 >Feature sequence30 <1 520 gene locus_tag LOCUS_27510 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880434.1:1,4-alpha-glucan branching protein GlgB 910 500 gene locus_tag LOCUS_27520 910 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 2927 1077 gene locus_tag LOCUS_27530 2927 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 4724 3261 gene locus_tag LOCUS_27540 4724 3261 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403783.1 protein_id gnl|my_center|LOCUS_27540 6202 4916 gene locus_tag LOCUS_27550 6202 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 6878 6195 gene locus_tag LOCUS_27560 6878 6195 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259363.1 protein_id gnl|my_center|LOCUS_27560 8524 6893 gene locus_tag LOCUS_27570 8524 6893 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546376.1 protein_id gnl|my_center|LOCUS_27570 8830 8742 gene locus_tag LOCUS_t00430 8830 8742 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9330 8869 gene locus_tag LOCUS_27580 gene tadA 9330 8869 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391574.1 protein_id gnl|my_center|LOCUS_27580 10716 9466 gene locus_tag LOCUS_27590 10716 9466 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048415.1 protein_id gnl|my_center|LOCUS_27590 11553 10987 gene locus_tag LOCUS_27600 11553 10987 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948697.1 protein_id gnl|my_center|LOCUS_27600 12440 11817 gene locus_tag LOCUS_27610 12440 11817 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966965.1 protein_id gnl|my_center|LOCUS_27610 13978 12467 gene locus_tag LOCUS_27620 13978 12467 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867316.1 protein_id gnl|my_center|LOCUS_27620 14127 14816 gene locus_tag LOCUS_27630 14127 14816 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392755.1 protein_id gnl|my_center|LOCUS_27630 14806 15129 gene locus_tag LOCUS_27640 14806 15129 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605630.1 protein_id gnl|my_center|LOCUS_27640 17600 15258 gene locus_tag LOCUS_27650 17600 15258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 18927 18040 gene locus_tag LOCUS_27660 18927 18040 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932020.1 protein_id gnl|my_center|LOCUS_27660 19147 19071 gene locus_tag LOCUS_t00440 19147 19071 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 19820 19221 gene locus_tag LOCUS_27670 19820 19221 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896408.1 protein_id gnl|my_center|LOCUS_27670 20311 20009 gene locus_tag LOCUS_27680 20311 20009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 20545 22077 gene locus_tag LOCUS_27690 gene ppx 20545 22077 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963940.1 protein_id gnl|my_center|LOCUS_27690 23288 22113 gene locus_tag LOCUS_27700 gene dinB 23288 22113 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937382.1 protein_id gnl|my_center|LOCUS_27700 23458 23883 gene locus_tag LOCUS_27710 23458 23883 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023986.1 protein_id gnl|my_center|LOCUS_27710 26074 23966 gene locus_tag LOCUS_27720 26074 23966 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_27720 27632 26079 gene locus_tag LOCUS_27730 27632 26079 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814148.1 protein_id gnl|my_center|LOCUS_27730 28256 27825 gene locus_tag LOCUS_27740 28256 27825 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_27740 29029 28460 gene locus_tag LOCUS_27750 29029 28460 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393334.1 protein_id gnl|my_center|LOCUS_27750 >Feature sequence31 229 813 gene locus_tag LOCUS_27760 gene pdxT 229 813 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391559.1 protein_id gnl|my_center|LOCUS_27760 939 2447 gene locus_tag LOCUS_27770 939 2447 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056367.1 protein_id gnl|my_center|LOCUS_27770 2473 3768 gene locus_tag LOCUS_27780 2473 3768 CDS product hexokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108294.1 protein_id gnl|my_center|LOCUS_27780 4019 6187 gene locus_tag LOCUS_27790 4019 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 6707 6330 gene locus_tag LOCUS_27800 6707 6330 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964000.1 protein_id gnl|my_center|LOCUS_27800 8153 6741 gene locus_tag LOCUS_27810 8153 6741 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_27810 9326 8382 gene locus_tag LOCUS_27820 9326 8382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 9577 9843 gene locus_tag LOCUS_27830 9577 9843 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903691.1 protein_id gnl|my_center|LOCUS_27830 9949 10806 gene locus_tag LOCUS_27840 9949 10806 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964635.1 protein_id gnl|my_center|LOCUS_27840 10843 11388 gene locus_tag LOCUS_27850 10843 11388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 11544 13379 gene locus_tag LOCUS_27860 11544 13379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 13400 14392 gene locus_tag LOCUS_27870 13400 14392 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986275.1 protein_id gnl|my_center|LOCUS_27870 14412 14603 gene locus_tag LOCUS_27880 14412 14603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 14554 15645 gene locus_tag LOCUS_27890 gene buk 14554 15645 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115781.1 protein_id gnl|my_center|LOCUS_27890 15664 16572 gene locus_tag LOCUS_27900 15664 16572 CDS product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869129.1 protein_id gnl|my_center|LOCUS_27900 16586 16789 gene locus_tag LOCUS_27910 16586 16789 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869340.1 protein_id gnl|my_center|LOCUS_27910 16811 17881 gene locus_tag LOCUS_27920 16811 17881 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082297.1 protein_id gnl|my_center|LOCUS_27920 17884 18636 gene locus_tag LOCUS_27930 17884 18636 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_27930 18633 19178 gene locus_tag LOCUS_27940 18633 19178 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420711.1 protein_id gnl|my_center|LOCUS_27940 19322 19561 gene locus_tag LOCUS_27950 19322 19561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 19754 20530 gene locus_tag LOCUS_27960 19754 20530 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921905.1 protein_id gnl|my_center|LOCUS_27960 20915 22993 gene locus_tag LOCUS_27970 20915 22993 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816048.1 protein_id gnl|my_center|LOCUS_27970 23208 23627 gene locus_tag LOCUS_27980 23208 23627 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390712.1 protein_id gnl|my_center|LOCUS_27980 23739 24878 gene locus_tag LOCUS_27990 23739 24878 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_27990 24983 26386 gene locus_tag LOCUS_28000 24983 26386 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705189.1 protein_id gnl|my_center|LOCUS_28000 26547 28103 gene locus_tag LOCUS_28010 26547 28103 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_28010 28118 28915 gene locus_tag LOCUS_28020 28118 28915 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_28020 >Feature sequence32 2078 939 gene locus_tag LOCUS_28030 2078 939 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_28030 3255 2113 gene locus_tag LOCUS_28040 gene acdA 3255 2113 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242719.1 protein_id gnl|my_center|LOCUS_28040 4736 3330 gene locus_tag LOCUS_28050 4736 3330 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_28050 5685 4750 gene locus_tag LOCUS_28060 5685 4750 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461383.1 protein_id gnl|my_center|LOCUS_28060 6495 5716 gene locus_tag LOCUS_28070 6495 5716 CDS product electron transfer flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461748.1 protein_id gnl|my_center|LOCUS_28070 6623 7540 gene locus_tag LOCUS_28080 6623 7540 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354840.1 protein_id gnl|my_center|LOCUS_28080 8813 7680 gene locus_tag LOCUS_28090 gene hadC 8813 7680 CDS product (R)-2-hydroxyisocaproyl-CoA dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_28090 10039 8813 gene locus_tag LOCUS_28100 gene fldB 10039 8813 CDS product phenyllactyl-CoA dehydratase subunit FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048237.1 protein_id gnl|my_center|LOCUS_28100 10836 10036 gene locus_tag LOCUS_28110 gene hadI 10836 10036 CDS product 2-hydroxyisocaproyl-CoA dehydratase activator HadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986690.1 protein_id gnl|my_center|LOCUS_28110 12084 10876 gene locus_tag LOCUS_28120 gene fldA 12084 10876 CDS product 3-(aryl)acryloyl-CoA:(R)-3-(aryl)lactate CoA-transferase FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048238.1 protein_id gnl|my_center|LOCUS_28120 14279 12339 gene locus_tag LOCUS_28130 14279 12339 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393382.1 protein_id gnl|my_center|LOCUS_28130 15394 14321 gene locus_tag LOCUS_28140 gene leuB 15394 14321 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_28140 15977 15462 gene locus_tag LOCUS_28150 gene leuD 15977 15462 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_28150 17247 15982 gene locus_tag LOCUS_28160 gene hacA 17247 15982 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876998.1 protein_id gnl|my_center|LOCUS_28160 17451 19319 gene locus_tag LOCUS_28170 17451 19319 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392246.1 protein_id gnl|my_center|LOCUS_28170 20716 19376 gene locus_tag LOCUS_28180 20716 19376 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392014.1 protein_id gnl|my_center|LOCUS_28180 21722 20820 gene locus_tag LOCUS_28190 21722 20820 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860958.1 protein_id gnl|my_center|LOCUS_28190 22944 21742 gene locus_tag LOCUS_28200 22944 21742 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895828.1 protein_id gnl|my_center|LOCUS_28200 25111 23207 gene locus_tag LOCUS_28210 25111 23207 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392246.1 protein_id gnl|my_center|LOCUS_28210 26396 25347 gene locus_tag LOCUS_28220 26396 25347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 26645 27523 gene locus_tag LOCUS_28230 26645 27523 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583336.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28230 27517 27828 gene locus_tag LOCUS_28240 27517 27828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 >Feature sequence33 1662 400 gene locus_tag LOCUS_28250 1662 400 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086793.1 protein_id gnl|my_center|LOCUS_28250 2250 3242 gene locus_tag LOCUS_28260 2250 3242 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939915.1 protein_id gnl|my_center|LOCUS_28260 4345 3422 gene locus_tag LOCUS_28270 4345 3422 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_28270 5865 4615 gene locus_tag LOCUS_28280 5865 4615 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461052.1 protein_id gnl|my_center|LOCUS_28280 7178 5916 gene locus_tag LOCUS_28290 7178 5916 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080518297.1 protein_id gnl|my_center|LOCUS_28290 7717 8946 gene locus_tag LOCUS_28300 7717 8946 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086793.1 protein_id gnl|my_center|LOCUS_28300 12518 9039 gene locus_tag LOCUS_28310 12518 9039 CDS product bifunctional glycogen debranching protein GlgX/4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460009.1 protein_id gnl|my_center|LOCUS_28310 14964 12493 gene locus_tag LOCUS_28320 14964 12493 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964971.1 protein_id gnl|my_center|LOCUS_28320 16396 14957 gene locus_tag LOCUS_28330 gene glgA 16396 14957 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110443.1 protein_id gnl|my_center|LOCUS_28330 17561 16446 gene locus_tag LOCUS_28340 gene glgD 17561 16446 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082940.1 protein_id gnl|my_center|LOCUS_28340 18810 17620 gene locus_tag LOCUS_28350 gene glgC 18810 17620 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057611.1 protein_id gnl|my_center|LOCUS_28350 19132 18980 gene locus_tag LOCUS_28360 19132 18980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 20029 19355 gene locus_tag LOCUS_28370 20029 19355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425116.1 protein_id gnl|my_center|LOCUS_28370 21413 20259 gene locus_tag LOCUS_28380 21413 20259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 22795 21731 gene locus_tag LOCUS_28390 gene buk 22795 21731 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966356.1 protein_id gnl|my_center|LOCUS_28390 23841 23068 gene locus_tag LOCUS_28400 23841 23068 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018701913.1 protein_id gnl|my_center|LOCUS_28400 25392 24091 gene locus_tag LOCUS_28410 25392 24091 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_28410 >Feature sequence34 1808 114 gene locus_tag LOCUS_28420 1808 114 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877907.1 protein_id gnl|my_center|LOCUS_28420 2493 2068 gene locus_tag LOCUS_28430 2493 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 2677 3057 gene locus_tag LOCUS_28440 2677 3057 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393656.1 protein_id gnl|my_center|LOCUS_28440 3054 4604 gene locus_tag LOCUS_28450 3054 4604 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_28450 4644 5558 gene locus_tag LOCUS_28460 4644 5558 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948181.1 protein_id gnl|my_center|LOCUS_28460 5555 5788 gene locus_tag LOCUS_28470 5555 5788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 5902 6987 gene locus_tag LOCUS_28480 5902 6987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 6987 7574 gene locus_tag LOCUS_28490 6987 7574 CDS product GerMN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392053.1 protein_id gnl|my_center|LOCUS_28490 9213 7642 gene locus_tag LOCUS_28500 9213 7642 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812353.1 protein_id gnl|my_center|LOCUS_28500 9435 10439 gene locus_tag LOCUS_28510 gene thiL 9435 10439 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392671.1 protein_id gnl|my_center|LOCUS_28510 10442 10939 gene locus_tag LOCUS_28520 gene tsaE 10442 10939 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_28520 10899 11606 gene locus_tag LOCUS_28530 gene tsaB 10899 11606 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048262.1 protein_id gnl|my_center|LOCUS_28530 11576 12055 gene locus_tag LOCUS_28540 gene rimI 11576 12055 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966125.1 protein_id gnl|my_center|LOCUS_28540 12104 13123 gene locus_tag LOCUS_28550 gene tsaD 12104 13123 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_28550 13417 14847 gene locus_tag LOCUS_28560 13417 14847 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966007.1 protein_id gnl|my_center|LOCUS_28560 14848 15429 gene locus_tag LOCUS_28570 14848 15429 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583472.1 protein_id gnl|my_center|LOCUS_28570 15436 15939 gene locus_tag LOCUS_28580 15436 15939 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256008.1 protein_id gnl|my_center|LOCUS_28580 15944 16537 gene locus_tag LOCUS_28590 15944 16537 CDS product DUF1405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831230.1 protein_id gnl|my_center|LOCUS_28590 16691 16975 gene locus_tag LOCUS_28600 gene groES 16691 16975 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583322.1 protein_id gnl|my_center|LOCUS_28600 17008 18660 gene locus_tag LOCUS_28610 gene groL 17008 18660 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817317.1 protein_id gnl|my_center|LOCUS_28610 19928 18765 gene locus_tag LOCUS_28620 19928 18765 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179343.1 protein_id gnl|my_center|LOCUS_28620 21016 19931 gene locus_tag LOCUS_28630 21016 19931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 21335 21526 gene locus_tag LOCUS_28640 21335 21526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 21519 21722 gene locus_tag LOCUS_28650 21519 21722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 21800 21949 gene locus_tag LOCUS_28660 21800 21949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 21939 24122 gene locus_tag LOCUS_28670 21939 24122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 24270 24809 gene locus_tag LOCUS_28680 24270 24809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 25008 25391 gene locus_tag LOCUS_28690 25008 25391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 >Feature sequence35 314 238 gene locus_tag LOCUS_t00450 314 238 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 397 322 gene locus_tag LOCUS_t00460 397 322 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 482 407 gene locus_tag LOCUS_t00470 482 407 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 589 514 gene locus_tag LOCUS_t00480 589 514 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 697 613 gene locus_tag LOCUS_t00490 697 613 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1581 781 gene locus_tag LOCUS_28700 gene uppP 1581 781 CDS product bacitracin resistance undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796238.1 protein_id gnl|my_center|LOCUS_28700 2249 1785 gene locus_tag LOCUS_28710 2249 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 3106 2366 gene locus_tag LOCUS_28720 gene sigH 3106 2366 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393956.1 protein_id gnl|my_center|LOCUS_28720 3843 3325 gene locus_tag LOCUS_28730 3843 3325 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421194.1 protein_id gnl|my_center|LOCUS_28730 4617 3856 gene locus_tag LOCUS_28740 gene rlmB 4617 3856 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459087.1 protein_id gnl|my_center|LOCUS_28740 5318 4614 gene locus_tag LOCUS_28750 gene thyX 5318 4614 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459086.1 protein_id gnl|my_center|LOCUS_28750 5800 5318 gene locus_tag LOCUS_28760 5800 5318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 7242 5797 gene locus_tag LOCUS_28770 gene cysS 7242 5797 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393961.1 protein_id gnl|my_center|LOCUS_28770 7906 7223 gene locus_tag LOCUS_28780 gene cysE 7906 7223 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069591551.1 protein_id gnl|my_center|LOCUS_28780 9678 8215 gene locus_tag LOCUS_28790 gene gltX 9678 8215 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810213.1 protein_id gnl|my_center|LOCUS_28790 10924 9719 gene locus_tag LOCUS_28800 gene ispD 10924 9719 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546162.1 protein_id gnl|my_center|LOCUS_28800 12040 10934 gene locus_tag LOCUS_28810 12040 10934 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942743.1 protein_id gnl|my_center|LOCUS_28810 12645 12151 gene locus_tag LOCUS_28820 12645 12151 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_28820 12915 13310 gene locus_tag LOCUS_28830 12915 13310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810220.1 protein_id gnl|my_center|LOCUS_28830 14529 13447 gene locus_tag LOCUS_28840 gene disA 14529 13447 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393302.1 protein_id gnl|my_center|LOCUS_28840 15884 14526 gene locus_tag LOCUS_28850 gene radA 15884 14526 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_28850 18436 15980 gene locus_tag LOCUS_28860 gene clpC 18436 15980 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235011.1 protein_id gnl|my_center|LOCUS_28860 19506 18439 gene locus_tag LOCUS_28870 19506 18439 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235007.1 protein_id gnl|my_center|LOCUS_28870 20033 19515 gene locus_tag LOCUS_28880 gene mcsA 20033 19515 CDS product protein-arginine kinase activator protein McsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966297.1 protein_id gnl|my_center|LOCUS_28880 20491 20048 gene locus_tag LOCUS_28890 gene ctsR 20491 20048 CDS product transcriptional regulator CtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244563.1 protein_id gnl|my_center|LOCUS_28890 21859 20678 gene locus_tag LOCUS_28900 21859 20678 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_28900 23054 21870 gene locus_tag LOCUS_28910 23054 21870 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392801.1 protein_id gnl|my_center|LOCUS_28910 23391 23843 gene locus_tag LOCUS_28920 gene speD 23391 23843 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496461.1 protein_id gnl|my_center|LOCUS_28920 >Feature sequence36 774 319 gene locus_tag LOCUS_28930 774 319 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067916.1 protein_id gnl|my_center|LOCUS_28930 2085 949 gene locus_tag LOCUS_28940 2085 949 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048186.1 protein_id gnl|my_center|LOCUS_28940 3436 2297 gene locus_tag LOCUS_28950 gene acdA 3436 2297 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545532.1 protein_id gnl|my_center|LOCUS_28950 3962 3546 gene locus_tag LOCUS_28960 3962 3546 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163926.1 protein_id gnl|my_center|LOCUS_28960 4444 4028 gene locus_tag LOCUS_28970 4444 4028 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163926.1 protein_id gnl|my_center|LOCUS_28970 5972 4572 gene locus_tag LOCUS_28980 5972 4572 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424336.1 protein_id gnl|my_center|LOCUS_28980 7664 6117 gene locus_tag LOCUS_28990 7664 6117 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989914.1 protein_id gnl|my_center|LOCUS_28990 8597 7797 gene locus_tag LOCUS_29000 8597 7797 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048188.1 protein_id gnl|my_center|LOCUS_29000 10777 9059 gene locus_tag LOCUS_29010 10777 9059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 11192 11028 gene locus_tag LOCUS_29020 11192 11028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 12579 11485 gene locus_tag LOCUS_29030 12579 11485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 13231 12749 gene locus_tag LOCUS_29040 13231 12749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 13580 13873 gene locus_tag LOCUS_29050 13580 13873 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355819.1 protein_id gnl|my_center|LOCUS_29050 13887 16340 gene locus_tag LOCUS_29060 13887 16340 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948003.1 protein_id gnl|my_center|LOCUS_29060 16364 16606 gene locus_tag LOCUS_29070 16364 16606 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939908.1 protein_id gnl|my_center|LOCUS_29070 17211 16894 gene locus_tag LOCUS_29080 17211 16894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 17482 17195 gene locus_tag LOCUS_29090 17482 17195 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814556.1 protein_id gnl|my_center|LOCUS_29090 >Feature sequence37 191 553 gene locus_tag LOCUS_29100 191 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 1093 1284 gene locus_tag LOCUS_29110 1093 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 1322 1768 gene locus_tag LOCUS_29120 1322 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 2310 3065 gene locus_tag LOCUS_29130 2310 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 3065 3262 gene locus_tag LOCUS_29140 3065 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 3361 4422 gene locus_tag LOCUS_29150 3361 4422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 4419 5072 gene locus_tag LOCUS_29160 4419 5072 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_29160 5074 5856 gene locus_tag LOCUS_29170 5074 5856 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900005.1 protein_id gnl|my_center|LOCUS_29170 5896 6489 gene locus_tag LOCUS_29180 5896 6489 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036287.1 protein_id gnl|my_center|LOCUS_29180 6633 6788 gene locus_tag LOCUS_29190 6633 6788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 6880 7299 gene locus_tag LOCUS_29200 6880 7299 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_29200 8076 9194 gene locus_tag LOCUS_29210 8076 9194 CDS product HNH endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986608.1 protein_id gnl|my_center|LOCUS_29210 9274 12429 gene locus_tag LOCUS_29220 9274 12429 CDS product DUF3427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070731.1 protein_id gnl|my_center|LOCUS_29220 12432 12818 gene locus_tag LOCUS_29230 gene mutT 12432 12818 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459573.1 protein_id gnl|my_center|LOCUS_29230 13391 13564 gene locus_tag LOCUS_29240 13391 13564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 14562 13645 gene locus_tag LOCUS_29250 14562 13645 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814967.1 protein_id gnl|my_center|LOCUS_29250 15468 16988 gene locus_tag LOCUS_29260 15468 16988 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080443.1 protein_id gnl|my_center|LOCUS_29260 >Feature sequence38 213 362 gene locus_tag LOCUS_29270 gene rpmG 213 362 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_29270 382 457 gene locus_tag LOCUS_t00500 382 457 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 508 723 gene locus_tag LOCUS_29280 gene secE 508 723 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081514.1 protein_id gnl|my_center|LOCUS_29280 832 1365 gene locus_tag LOCUS_29290 gene nusG 832 1365 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810198.1 protein_id gnl|my_center|LOCUS_29290 1415 1840 gene locus_tag LOCUS_29300 gene rplK 1415 1840 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393949.1 protein_id gnl|my_center|LOCUS_29300 1935 2639 gene locus_tag LOCUS_29310 gene rplA 1935 2639 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_29310 2824 3348 gene locus_tag LOCUS_29320 gene rplJ 2824 3348 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810195.1 protein_id gnl|my_center|LOCUS_29320 3425 3796 gene locus_tag LOCUS_29330 gene rplL 3425 3796 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459089.1 protein_id gnl|my_center|LOCUS_29330 4277 8074 gene locus_tag LOCUS_29340 gene rpoB 4277 8074 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723045.1 protein_id gnl|my_center|LOCUS_29340 8097 12062 gene locus_tag LOCUS_29350 8097 12062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 12313 12558 gene locus_tag LOCUS_29360 12313 12558 CDS product ribosomal L7Ae/L30e/S12e/Gadd45 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459096.1 protein_id gnl|my_center|LOCUS_29360 12643 13017 gene locus_tag LOCUS_29370 gene rpsL 12643 13017 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393942.1 protein_id gnl|my_center|LOCUS_29370 13082 13552 gene locus_tag LOCUS_29380 gene rpsG 13082 13552 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137491.1 protein_id gnl|my_center|LOCUS_29380 13696 15618 gene locus_tag LOCUS_29390 gene fusA 13696 15618 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459098.1 protein_id gnl|my_center|LOCUS_29390 >Feature sequence39 866 147 gene locus_tag LOCUS_29400 866 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 1762 1124 gene locus_tag LOCUS_29410 1762 1124 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810308.1 protein_id gnl|my_center|LOCUS_29410 3269 1812 gene locus_tag LOCUS_29420 3269 1812 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810305.1 protein_id gnl|my_center|LOCUS_29420 3595 3314 gene locus_tag LOCUS_29430 3595 3314 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810301.1 protein_id gnl|my_center|LOCUS_29430 4036 3758 gene locus_tag LOCUS_29440 4036 3758 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810303.1 protein_id gnl|my_center|LOCUS_29440 4707 4099 gene locus_tag LOCUS_29450 4707 4099 CDS product ethanolamine utilization protein EutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810297.1 protein_id gnl|my_center|LOCUS_29450 5296 4748 gene locus_tag LOCUS_29460 5296 4748 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810294.1 protein_id gnl|my_center|LOCUS_29460 6630 5293 gene locus_tag LOCUS_29470 6630 5293 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810293.1 protein_id gnl|my_center|LOCUS_29470 6913 6623 gene locus_tag LOCUS_29480 6913 6623 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810291.1 protein_id gnl|my_center|LOCUS_29480 7896 6967 gene locus_tag LOCUS_29490 7896 6967 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810287.1 protein_id gnl|my_center|LOCUS_29490 8840 7911 gene locus_tag LOCUS_29500 8840 7911 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459063.1 protein_id gnl|my_center|LOCUS_29500 11396 8913 gene locus_tag LOCUS_29510 11396 8913 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459062.1 protein_id gnl|my_center|LOCUS_29510 13030 11717 gene locus_tag LOCUS_29520 13030 11717 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061782.1 protein_id gnl|my_center|LOCUS_29520 13848 13501 gene locus_tag LOCUS_29530 13848 13501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 >Feature sequence40 711 1976 gene locus_tag LOCUS_29540 711 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 2017 2610 gene locus_tag LOCUS_29550 2017 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 2603 5497 gene locus_tag LOCUS_29560 2603 5497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 5509 6795 gene locus_tag LOCUS_29570 5509 6795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 7390 8154 gene locus_tag LOCUS_29580 7390 8154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29580 8708 8142 gene locus_tag LOCUS_29590 8708 8142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29590 9000 8683 gene locus_tag LOCUS_29600 9000 8683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29600 9495 9304 gene locus_tag LOCUS_29610 9495 9304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 10329 9835 gene locus_tag LOCUS_29620 10329 9835 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986565.1 protein_id gnl|my_center|LOCUS_29620 10737 10432 gene locus_tag LOCUS_29630 10737 10432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 11069 11323 gene locus_tag LOCUS_29640 11069 11323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29640 11666 11454 gene locus_tag LOCUS_29650 11666 11454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 12090 11800 gene locus_tag LOCUS_29660 12090 11800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29660 >Feature sequence41 970 824 gene locus_tag LOCUS_29670 970 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 2609 1041 gene locus_tag LOCUS_29680 2609 1041 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626662.1 protein_id gnl|my_center|LOCUS_29680 3414 2674 gene locus_tag LOCUS_29690 3414 2674 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259103.1 protein_id gnl|my_center|LOCUS_29690 3671 3450 gene locus_tag LOCUS_29700 3671 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 4841 3678 gene locus_tag LOCUS_29710 4841 3678 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 protein_id gnl|my_center|LOCUS_29710 5421 6593 gene locus_tag LOCUS_29720 5421 6593 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989913.1 protein_id gnl|my_center|LOCUS_29720 8131 6695 gene locus_tag LOCUS_29730 8131 6695 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437559.1 protein_id gnl|my_center|LOCUS_29730 9453 8689 gene locus_tag LOCUS_29740 9453 8689 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878463.1 protein_id gnl|my_center|LOCUS_29740 9923 9672 gene locus_tag LOCUS_29750 9923 9672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 >Feature sequence42 311 991 gene locus_tag LOCUS_29760 311 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048344.1 protein_id gnl|my_center|LOCUS_29760 1122 1832 gene locus_tag LOCUS_29770 gene tsaA 1122 1832 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_29770 2047 2376 gene locus_tag LOCUS_29780 2047 2376 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813638.1 protein_id gnl|my_center|LOCUS_29780 2678 4774 gene locus_tag LOCUS_29790 2678 4774 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968448.1 protein_id gnl|my_center|LOCUS_29790 4864 5355 gene locus_tag LOCUS_29800 4864 5355 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870310.1 protein_id gnl|my_center|LOCUS_29800 5494 6711 gene locus_tag LOCUS_29810 5494 6711 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272494.1 protein_id gnl|my_center|LOCUS_29810 6911 8188 gene locus_tag LOCUS_29820 6911 8188 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986138.1 protein_id gnl|my_center|LOCUS_29820 >Feature sequence43 1116 658 gene locus_tag LOCUS_29830 1116 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 1202 1495 gene locus_tag LOCUS_29840 1202 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 2133 1885 gene locus_tag LOCUS_29850 2133 1885 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393126.1 protein_id gnl|my_center|LOCUS_29850 3288 2188 gene locus_tag LOCUS_29860 3288 2188 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660365.1 protein_id gnl|my_center|LOCUS_29860 3716 3369 gene locus_tag LOCUS_29870 3716 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 4246 3986 gene locus_tag LOCUS_29880 4246 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 4949 4338 gene locus_tag LOCUS_29890 gene sigW 4949 4338 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_29890 5660 4998 gene locus_tag LOCUS_29900 5660 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460670.1 protein_id gnl|my_center|LOCUS_29900 6164 5730 gene locus_tag LOCUS_29910 6164 5730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 6890 6261 gene locus_tag LOCUS_29920 6890 6261 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583465.1 protein_id gnl|my_center|LOCUS_29920 >Feature sequence44 424 257 gene locus_tag LOCUS_29930 424 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 914 531 gene locus_tag LOCUS_29940 914 531 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257109.1 protein_id gnl|my_center|LOCUS_29940 1156 914 gene locus_tag LOCUS_29950 1156 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 2158 1211 gene locus_tag LOCUS_29960 2158 1211 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081416.1 protein_id gnl|my_center|LOCUS_29960 3932 2163 gene locus_tag LOCUS_29970 3932 2163 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860933.1 protein_id gnl|my_center|LOCUS_29970 4203 6092 gene locus_tag LOCUS_29980 gene pepF 4203 6092 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944353.1 protein_id gnl|my_center|LOCUS_29980 >Feature sequence45 656 1543 gene locus_tag LOCUS_29990 656 1543 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962520.1 protein_id gnl|my_center|LOCUS_29990 1768 1517 gene locus_tag LOCUS_30000 1768 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 2722 1841 gene locus_tag LOCUS_30010 2722 1841 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814288.1 protein_id gnl|my_center|LOCUS_30010 3842 2898 gene locus_tag LOCUS_30020 3842 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 4465 4136 gene locus_tag LOCUS_30030 4465 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 4918 4598 gene locus_tag LOCUS_30040 4918 4598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 5026 5373 gene locus_tag LOCUS_30050 5026 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 >Feature sequence46 1022 1768 gene locus_tag LOCUS_30060 1022 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 2650 1790 gene locus_tag LOCUS_30070 2650 1790 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965690.1 protein_id gnl|my_center|LOCUS_30070 3212 4135 gene locus_tag LOCUS_30080 3212 4135 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160961434.1 protein_id gnl|my_center|LOCUS_30080 4132 4386 gene locus_tag LOCUS_30090 4132 4386 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948437.1 protein_id gnl|my_center|LOCUS_30090 >Feature sequence47 814 542 gene locus_tag LOCUS_30100 814 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 2806 1508 gene locus_tag LOCUS_30110 gene larA 2806 1508 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461442.1 protein_id gnl|my_center|LOCUS_30110 3335 3162 gene locus_tag LOCUS_30120 3335 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 3966 3301 gene locus_tag LOCUS_30130 3966 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 >Feature sequence48 216 485 gene locus_tag LOCUS_30140 216 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 497 2377 gene locus_tag LOCUS_30150 497 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 2450 2710 gene locus_tag LOCUS_30160 2450 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 2861 2945 gene locus_tag LOCUS_t00510 2861 2945 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3069 3680 gene locus_tag LOCUS_30170 gene wrbA 3069 3680 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941470.1 protein_id gnl|my_center|LOCUS_30170 3789 3863 gene locus_tag LOCUS_t00520 3789 3863 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence49 412 80 gene locus_tag LOCUS_30180 gene rplV 412 80 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966407.1 protein_id gnl|my_center|LOCUS_30180 718 434 gene locus_tag LOCUS_30190 gene rpsS 718 434 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393933.1 protein_id gnl|my_center|LOCUS_30190 1589 762 gene locus_tag LOCUS_30200 gene rplB 1589 762 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459099.1 protein_id gnl|my_center|LOCUS_30200 1905 1618 gene locus_tag LOCUS_30210 gene rplW 1905 1618 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_30210 2531 1905 gene locus_tag LOCUS_30220 gene rplD 2531 1905 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393936.1 protein_id gnl|my_center|LOCUS_30220 3213 2572 gene locus_tag LOCUS_30230 gene rplC 3213 2572 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184218.1 protein_id gnl|my_center|LOCUS_30230 3540 3229 gene locus_tag LOCUS_30240 gene rpsJ 3540 3229 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393938.1 protein_id gnl|my_center|LOCUS_30240 >Feature sequence50 <1 922 gene locus_tag LOCUS_30250 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939709.1:ABC transporter permease 922 1584 gene locus_tag LOCUS_30260 922 1584 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809060.1 protein_id gnl|my_center|LOCUS_30260 1602 2600 gene locus_tag LOCUS_30270 1602 2600 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461160.1 protein_id gnl|my_center|LOCUS_30270