>Feature sequence01 221 484 gene locus_tag LOCUS_00010 221 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1316 516 gene locus_tag LOCUS_00020 1316 516 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257270.1 protein_id gnl|my_center|LOCUS_00020 1605 2864 gene locus_tag LOCUS_00030 1605 2864 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667047.1 protein_id gnl|my_center|LOCUS_00030 2861 4093 gene locus_tag LOCUS_00040 2861 4093 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680777.1 protein_id gnl|my_center|LOCUS_00040 4090 4734 gene locus_tag LOCUS_00050 4090 4734 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941145.1 protein_id gnl|my_center|LOCUS_00050 4769 5638 gene locus_tag LOCUS_00060 4769 5638 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957681.1 protein_id gnl|my_center|LOCUS_00060 5670 5743 gene locus_tag LOCUS_t00010 5670 5743 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7460 5763 gene locus_tag LOCUS_00070 7460 5763 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_00070 8353 7568 gene locus_tag LOCUS_00080 8353 7568 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048228.1 protein_id gnl|my_center|LOCUS_00080 9717 8350 gene locus_tag LOCUS_00090 9717 8350 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_00090 10383 9985 gene locus_tag LOCUS_00100 10383 9985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 12581 10380 gene locus_tag LOCUS_00110 12581 10380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12692 13576 gene locus_tag LOCUS_00120 gene ispH 12692 13576 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682405.1 protein_id gnl|my_center|LOCUS_00120 13569 14648 gene locus_tag LOCUS_00130 13569 14648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14729 16843 gene locus_tag LOCUS_00140 14729 16843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957276.1 protein_id gnl|my_center|LOCUS_00140 16916 17320 gene locus_tag LOCUS_00150 16916 17320 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680077.1 protein_id gnl|my_center|LOCUS_00150 17359 18393 gene locus_tag LOCUS_00160 17359 18393 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016565.1 protein_id gnl|my_center|LOCUS_00160 18399 19061 gene locus_tag LOCUS_00170 18399 19061 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528883.1 protein_id gnl|my_center|LOCUS_00170 20605 19064 gene locus_tag LOCUS_00180 20605 19064 CDS product DUF5312 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680918.1 protein_id gnl|my_center|LOCUS_00180 21429 20623 gene locus_tag LOCUS_00190 21429 20623 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669703.1 protein_id gnl|my_center|LOCUS_00190 22063 21485 gene locus_tag LOCUS_00200 22063 21485 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670118.1 protein_id gnl|my_center|LOCUS_00200 22689 22060 gene locus_tag LOCUS_00210 22689 22060 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670120.1 protein_id gnl|my_center|LOCUS_00210 23838 22699 gene locus_tag LOCUS_00220 23838 22699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 24788 23835 gene locus_tag LOCUS_00230 24788 23835 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002685644.1 protein_id gnl|my_center|LOCUS_00230 26134 24788 gene locus_tag LOCUS_00240 gene rsxC 26134 24788 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682097.1 protein_id gnl|my_center|LOCUS_00240 26274 27338 gene locus_tag LOCUS_00250 26274 27338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 27335 30517 gene locus_tag LOCUS_00260 27335 30517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 30703 30777 gene locus_tag LOCUS_t00020 30703 30777 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 32601 30901 gene locus_tag LOCUS_00270 32601 30901 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957136.1 protein_id gnl|my_center|LOCUS_00270 34006 32588 gene locus_tag LOCUS_00280 34006 32588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679821.1 protein_id gnl|my_center|LOCUS_00280 34092 35183 gene locus_tag LOCUS_00290 34092 35183 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920597.1 protein_id gnl|my_center|LOCUS_00290 35176 35712 gene locus_tag LOCUS_00300 35176 35712 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671188.1 protein_id gnl|my_center|LOCUS_00300 35709 36122 gene locus_tag LOCUS_00310 35709 36122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 37306 36119 gene locus_tag LOCUS_00320 37306 36119 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677016.1 protein_id gnl|my_center|LOCUS_00320 38151 37333 gene locus_tag LOCUS_00330 38151 37333 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669892.1 protein_id gnl|my_center|LOCUS_00330 38463 40424 gene locus_tag LOCUS_00340 38463 40424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 40879 40571 gene locus_tag LOCUS_00350 gene yhbY 40879 40571 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210185.1 protein_id gnl|my_center|LOCUS_00350 43324 41054 gene locus_tag LOCUS_00360 43324 41054 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201964.1 protein_id gnl|my_center|LOCUS_00360 43730 43347 gene locus_tag LOCUS_00370 43730 43347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 45377 43896 gene locus_tag LOCUS_00380 45377 43896 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416108.1 protein_id gnl|my_center|LOCUS_00380 47146 45422 gene locus_tag LOCUS_00390 47146 45422 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775582.1 protein_id gnl|my_center|LOCUS_00390 48007 47147 gene locus_tag LOCUS_00400 48007 47147 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027122.1 protein_id gnl|my_center|LOCUS_00400 48160 49371 gene locus_tag LOCUS_00410 48160 49371 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097906.1 protein_id gnl|my_center|LOCUS_00410 49466 50542 gene locus_tag LOCUS_00420 gene uxuA 49466 50542 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391968.1 protein_id gnl|my_center|LOCUS_00420 50539 52167 gene locus_tag LOCUS_00430 50539 52167 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937112.1 protein_id gnl|my_center|LOCUS_00430 52183 53601 gene locus_tag LOCUS_00440 gene uxaC 52183 53601 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964011.1 protein_id gnl|my_center|LOCUS_00440 53732 55027 gene locus_tag LOCUS_00450 53732 55027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 55120 56028 gene locus_tag LOCUS_00460 55120 56028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 56044 59457 gene locus_tag LOCUS_00470 56044 59457 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_00470 60626 59556 gene locus_tag LOCUS_00480 60626 59556 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680111.1 protein_id gnl|my_center|LOCUS_00480 61160 62002 gene locus_tag LOCUS_00490 61160 62002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 62039 63178 gene locus_tag LOCUS_00500 gene ychF 62039 63178 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666350.1 protein_id gnl|my_center|LOCUS_00500 63205 63585 gene locus_tag LOCUS_00510 63205 63585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 63620 65350 gene locus_tag LOCUS_00520 63620 65350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 65577 66146 gene locus_tag LOCUS_00530 gene efp 65577 66146 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813823.1 protein_id gnl|my_center|LOCUS_00530 68254 66374 gene locus_tag LOCUS_00540 68254 66374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 69480 68260 gene locus_tag LOCUS_00550 69480 68260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 70730 69633 gene locus_tag LOCUS_00560 70730 69633 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_00560 71012 70803 gene locus_tag LOCUS_00570 71012 70803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 71277 71837 gene locus_tag LOCUS_00580 71277 71837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 72071 73408 gene locus_tag LOCUS_00590 72071 73408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 73430 75175 gene locus_tag LOCUS_00600 73430 75175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 77748 76042 gene locus_tag LOCUS_00610 77748 76042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 78866 77817 gene locus_tag LOCUS_00620 78866 77817 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694419.1 protein_id gnl|my_center|LOCUS_00620 79821 79045 gene locus_tag LOCUS_00630 79821 79045 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002455962.1 protein_id gnl|my_center|LOCUS_00630 81506 79818 gene locus_tag LOCUS_00640 81506 79818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 82452 81499 gene locus_tag LOCUS_00650 82452 81499 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660662.1 protein_id gnl|my_center|LOCUS_00650 83273 82578 gene locus_tag LOCUS_00660 83273 82578 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127552.1 protein_id gnl|my_center|LOCUS_00660 84206 83298 gene locus_tag LOCUS_00670 gene metA 84206 83298 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462040.1 protein_id gnl|my_center|LOCUS_00670 84256 85260 gene locus_tag LOCUS_00680 84256 85260 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680147.1 protein_id gnl|my_center|LOCUS_00680 85267 86712 gene locus_tag LOCUS_00690 85267 86712 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680143.1 protein_id gnl|my_center|LOCUS_00690 86739 87467 gene locus_tag LOCUS_00700 86739 87467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 87464 88288 gene locus_tag LOCUS_00710 87464 88288 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669381.1 protein_id gnl|my_center|LOCUS_00710 89044 88328 gene locus_tag LOCUS_00720 89044 88328 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129982.1 protein_id gnl|my_center|LOCUS_00720 89215 89997 gene locus_tag LOCUS_00730 89215 89997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 91017 90190 gene locus_tag LOCUS_00740 91017 90190 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406424.1 protein_id gnl|my_center|LOCUS_00740 92408 91212 gene locus_tag LOCUS_00750 92408 91212 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680885.1 protein_id gnl|my_center|LOCUS_00750 93931 92405 gene locus_tag LOCUS_00760 93931 92405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 94106 95953 gene locus_tag LOCUS_00770 94106 95953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682311.1 protein_id gnl|my_center|LOCUS_00770 96884 95961 gene locus_tag LOCUS_00780 gene ricT 96884 95961 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680971.1 protein_id gnl|my_center|LOCUS_00780 97433 96906 gene locus_tag LOCUS_00790 97433 96906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 97843 97430 gene locus_tag LOCUS_00800 97843 97430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 98869 97847 gene locus_tag LOCUS_00810 98869 97847 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666722.1 protein_id gnl|my_center|LOCUS_00810 99070 99852 gene locus_tag LOCUS_00820 99070 99852 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680785.1 protein_id gnl|my_center|LOCUS_00820 99852 100844 gene locus_tag LOCUS_00830 gene dusB 99852 100844 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680788.1 protein_id gnl|my_center|LOCUS_00830 101002 102639 gene locus_tag LOCUS_00840 101002 102639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680987.1 protein_id gnl|my_center|LOCUS_00840 102824 103429 gene locus_tag LOCUS_00850 102824 103429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666686.1 protein_id gnl|my_center|LOCUS_00850 103499 103906 gene locus_tag LOCUS_00860 103499 103906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 103921 105477 gene locus_tag LOCUS_00870 103921 105477 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680967.1 protein_id gnl|my_center|LOCUS_00870 106124 105498 gene locus_tag LOCUS_00880 106124 105498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669375.1 protein_id gnl|my_center|LOCUS_00880 108906 106141 gene locus_tag LOCUS_00890 108906 106141 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678931.1 protein_id gnl|my_center|LOCUS_00890 109607 109086 gene locus_tag LOCUS_00900 109607 109086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 110329 109772 gene locus_tag LOCUS_00910 110329 109772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 112656 110326 gene locus_tag LOCUS_00920 112656 110326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 112916 113392 gene locus_tag LOCUS_00930 112916 113392 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966687.1 protein_id gnl|my_center|LOCUS_00930 114272 113502 gene locus_tag LOCUS_00940 gene amrS 114272 113502 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393777.1 protein_id gnl|my_center|LOCUS_00940 114849 114448 gene locus_tag LOCUS_00950 114849 114448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 115055 114846 gene locus_tag LOCUS_00960 115055 114846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 116132 115173 gene locus_tag LOCUS_00970 gene yhdJ 116132 115173 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258927.1 protein_id gnl|my_center|LOCUS_00970 117646 116222 gene locus_tag LOCUS_00980 gene amrA 117646 116222 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964729.1 protein_id gnl|my_center|LOCUS_00980 118605 117727 gene locus_tag LOCUS_00990 118605 117727 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454079.1 protein_id gnl|my_center|LOCUS_00990 120770 118602 gene locus_tag LOCUS_01000 120770 118602 CDS product DUF4954 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682106.1 protein_id gnl|my_center|LOCUS_01000 120940 121242 gene locus_tag LOCUS_01010 120940 121242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 121595 121239 gene locus_tag LOCUS_01020 gene rsfS 121595 121239 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679464.1 protein_id gnl|my_center|LOCUS_01020 122811 121624 gene locus_tag LOCUS_01030 122811 121624 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669467.1 protein_id gnl|my_center|LOCUS_01030 123456 122812 gene locus_tag LOCUS_01040 123456 122812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01040 124093 123443 gene locus_tag LOCUS_01050 124093 123443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01050 125247 124090 gene locus_tag LOCUS_01060 gene obgE 125247 124090 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679468.1 protein_id gnl|my_center|LOCUS_01060 125588 125331 gene locus_tag LOCUS_01070 gene rpmA 125588 125331 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669471.1 protein_id gnl|my_center|LOCUS_01070 125961 125623 gene locus_tag LOCUS_01080 125961 125623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 126272 125958 gene locus_tag LOCUS_01090 gene rplU 126272 125958 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669481.1 protein_id gnl|my_center|LOCUS_01090 127539 126826 gene locus_tag LOCUS_01100 127539 126826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 128626 127886 gene locus_tag LOCUS_01110 128626 127886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 129235 128876 gene locus_tag LOCUS_01120 129235 128876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 129452 129222 gene locus_tag LOCUS_01130 129452 129222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 129880 129518 gene locus_tag LOCUS_01140 129880 129518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 130466 130008 gene locus_tag LOCUS_01150 130466 130008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 131784 130450 gene locus_tag LOCUS_01160 131784 130450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 132086 132856 gene locus_tag LOCUS_01170 132086 132856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 135111 133213 gene locus_tag LOCUS_01180 135111 133213 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_01180 136869 135127 gene locus_tag LOCUS_01190 136869 135127 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_01190 137789 136980 gene locus_tag LOCUS_01200 137789 136980 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679604.1 protein_id gnl|my_center|LOCUS_01200 137923 138336 gene locus_tag LOCUS_01210 gene arfB 137923 138336 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125377.1 protein_id gnl|my_center|LOCUS_01210 138348 138701 gene locus_tag LOCUS_01220 138348 138701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 140284 138806 gene locus_tag LOCUS_01230 140284 138806 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674333.1 protein_id gnl|my_center|LOCUS_01230 141247 140486 gene locus_tag LOCUS_01240 gene map 141247 140486 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670900.1 protein_id gnl|my_center|LOCUS_01240 142154 141315 gene locus_tag LOCUS_01250 142154 141315 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679454.1 protein_id gnl|my_center|LOCUS_01250 142605 142231 gene locus_tag LOCUS_01260 142605 142231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 143639 142890 gene locus_tag LOCUS_01270 gene tpiA 143639 142890 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678731.1 protein_id gnl|my_center|LOCUS_01270 145874 143709 gene locus_tag LOCUS_01280 145874 143709 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680924.1 protein_id gnl|my_center|LOCUS_01280 147364 146093 gene locus_tag LOCUS_01290 147364 146093 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679428.1 protein_id gnl|my_center|LOCUS_01290 148677 147586 gene locus_tag LOCUS_01300 148677 147586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 151364 148674 gene locus_tag LOCUS_01310 151364 148674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679659.1 protein_id gnl|my_center|LOCUS_01310 151419 151952 gene locus_tag LOCUS_01320 151419 151952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 153195 152143 gene locus_tag LOCUS_01330 gene gap 153195 152143 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785248.1 protein_id gnl|my_center|LOCUS_01330 153875 153339 gene locus_tag LOCUS_01340 153875 153339 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_01340 154650 153958 gene locus_tag LOCUS_01350 154650 153958 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_01350 154798 155559 gene locus_tag LOCUS_01360 154798 155559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 155684 157045 gene locus_tag LOCUS_01370 155684 157045 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861617.1 protein_id gnl|my_center|LOCUS_01370 157272 157093 gene locus_tag LOCUS_01380 157272 157093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 157246 158208 gene locus_tag LOCUS_01390 157246 158208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 159960 158461 gene locus_tag LOCUS_01400 gene gatA 159960 158461 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956776.1 protein_id gnl|my_center|LOCUS_01400 160265 159957 gene locus_tag LOCUS_01410 gene gatC 160265 159957 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665812.1 protein_id gnl|my_center|LOCUS_01410 162126 160819 gene locus_tag LOCUS_01420 162126 160819 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739314.1 protein_id gnl|my_center|LOCUS_01420 163090 162458 gene locus_tag LOCUS_01430 gene gmhA 163090 162458 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390355.1 protein_id gnl|my_center|LOCUS_01430 164101 163106 gene locus_tag LOCUS_01440 164101 163106 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_01440 164901 164098 gene locus_tag LOCUS_01450 164901 164098 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422862.1 protein_id gnl|my_center|LOCUS_01450 165789 164920 gene locus_tag LOCUS_01460 165789 164920 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971772.1 protein_id gnl|my_center|LOCUS_01460 167071 165926 gene locus_tag LOCUS_01470 gene glf 167071 165926 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922747.1 protein_id gnl|my_center|LOCUS_01470 168207 167080 gene locus_tag LOCUS_01480 168207 167080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 169277 168207 gene locus_tag LOCUS_01490 169277 168207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 169779 169279 gene locus_tag LOCUS_01500 169779 169279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 171267 170386 gene locus_tag LOCUS_01510 171267 170386 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_01510 172397 171264 gene locus_tag LOCUS_01520 172397 171264 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533192.1 protein_id gnl|my_center|LOCUS_01520 173110 172394 gene locus_tag LOCUS_01530 173110 172394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 173742 173107 gene locus_tag LOCUS_01540 173742 173107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 174044 173862 gene locus_tag LOCUS_01550 174044 173862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01550 174949 174344 gene locus_tag LOCUS_01560 174949 174344 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261028.1 protein_id gnl|my_center|LOCUS_01560 176111 175077 gene locus_tag LOCUS_01570 176111 175077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 176452 176111 gene locus_tag LOCUS_01580 176452 176111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01580 176732 176469 gene locus_tag LOCUS_01590 176732 176469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 177620 176745 gene locus_tag LOCUS_01600 177620 176745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 178186 177647 gene locus_tag LOCUS_01610 178186 177647 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167727.1 protein_id gnl|my_center|LOCUS_01610 179518 178190 gene locus_tag LOCUS_01620 gene rfbH 179518 178190 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208596.1 protein_id gnl|my_center|LOCUS_01620 180186 179518 gene locus_tag LOCUS_01630 gene rfbC 180186 179518 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_01630 181098 180187 gene locus_tag LOCUS_01640 181098 180187 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987005.1 protein_id gnl|my_center|LOCUS_01640 181361 181119 gene locus_tag LOCUS_01650 181361 181119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 182541 181489 gene locus_tag LOCUS_01660 gene rfbG 182541 181489 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 protein_id gnl|my_center|LOCUS_01660 183335 182541 gene locus_tag LOCUS_01670 gene rfbF 183335 182541 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107730.1 protein_id gnl|my_center|LOCUS_01670 184743 183355 gene locus_tag LOCUS_01680 184743 183355 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292875.1 protein_id gnl|my_center|LOCUS_01680 185327 184743 gene locus_tag LOCUS_01690 185327 184743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 186229 185333 gene locus_tag LOCUS_01700 186229 185333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 187205 186204 gene locus_tag LOCUS_01710 187205 186204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 188152 187253 gene locus_tag LOCUS_01720 gene pseI 188152 187253 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987011.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01720 189050 188295 gene locus_tag LOCUS_01730 189050 188295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 190558 189059 gene locus_tag LOCUS_01740 190558 189059 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722014.1 protein_id gnl|my_center|LOCUS_01740 191142 190762 gene locus_tag LOCUS_01750 191142 190762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 191797 191165 gene locus_tag LOCUS_01760 191797 191165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 192408 191803 gene locus_tag LOCUS_01770 192408 191803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 192867 192442 gene locus_tag LOCUS_01780 192867 192442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 193730 193143 gene locus_tag LOCUS_01790 193730 193143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 194791 193727 gene locus_tag LOCUS_01800 194791 193727 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015754.1 protein_id gnl|my_center|LOCUS_01800 195997 194810 gene locus_tag LOCUS_01810 195997 194810 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392273.1 protein_id gnl|my_center|LOCUS_01810 196652 195987 gene locus_tag LOCUS_01820 196652 195987 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_01820 197718 196720 gene locus_tag LOCUS_01830 gene pseB 197718 196720 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867763.1 protein_id gnl|my_center|LOCUS_01830 198750 198235 gene locus_tag LOCUS_01840 gene nusG 198750 198235 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806885.1 protein_id gnl|my_center|LOCUS_01840 200497 199304 gene locus_tag LOCUS_01850 200497 199304 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928539.1 protein_id gnl|my_center|LOCUS_01850 200748 202280 gene locus_tag LOCUS_01860 gene gatB 200748 202280 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681743.1 protein_id gnl|my_center|LOCUS_01860 202320 203111 gene locus_tag LOCUS_01870 202320 203111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 203114 203404 gene locus_tag LOCUS_01880 203114 203404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 203506 203901 gene locus_tag LOCUS_01890 203506 203901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670484.1 protein_id gnl|my_center|LOCUS_01890 205546 204014 gene locus_tag LOCUS_01900 gene rny 205546 204014 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681149.1 protein_id gnl|my_center|LOCUS_01900 206340 205669 gene locus_tag LOCUS_01910 gene lptB 206340 205669 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681841.1 protein_id gnl|my_center|LOCUS_01910 207197 206397 gene locus_tag LOCUS_01920 207197 206397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 207855 207262 gene locus_tag LOCUS_01930 207855 207262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 209465 207852 gene locus_tag LOCUS_01940 209465 207852 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091728.1 protein_id gnl|my_center|LOCUS_01940 209612 211444 gene locus_tag LOCUS_01950 209612 211444 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_01950 211903 213399 gene locus_tag LOCUS_01960 gene putP 211903 213399 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_01960 213696 215297 gene locus_tag LOCUS_01970 213696 215297 CDS product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143598.1 protein_id gnl|my_center|LOCUS_01970 215375 215962 gene locus_tag LOCUS_01980 215375 215962 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_01980 216605 216108 gene locus_tag LOCUS_01990 216605 216108 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966038.1 protein_id gnl|my_center|LOCUS_01990 217006 216602 gene locus_tag LOCUS_02000 217006 216602 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902189.1 protein_id gnl|my_center|LOCUS_02000 220098 217159 gene locus_tag LOCUS_02010 220098 217159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 221095 220118 gene locus_tag LOCUS_02020 gene argB 221095 220118 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459300.1 protein_id gnl|my_center|LOCUS_02020 222555 221185 gene locus_tag LOCUS_02030 gene argJ 222555 221185 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_02030 223508 222825 gene locus_tag LOCUS_02040 223508 222825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 224860 223583 gene locus_tag LOCUS_02050 224860 223583 CDS product YhjD/YihY/BrkB family envelope integrity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681017.1 protein_id gnl|my_center|LOCUS_02050 225767 224871 gene locus_tag LOCUS_02060 225767 224871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 227175 225724 gene locus_tag LOCUS_02070 gene asnS 227175 225724 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682293.1 protein_id gnl|my_center|LOCUS_02070 228851 227607 gene locus_tag LOCUS_02080 gene secF 228851 227607 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681892.1 protein_id gnl|my_center|LOCUS_02080 230593 228851 gene locus_tag LOCUS_02090 gene secD 230593 228851 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681894.1 protein_id gnl|my_center|LOCUS_02090 231022 230612 gene locus_tag LOCUS_02100 231022 230612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 231826 231167 gene locus_tag LOCUS_02110 231826 231167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02110 232803 231811 gene locus_tag LOCUS_02120 232803 231811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 234563 232803 gene locus_tag LOCUS_02130 234563 232803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 235163 234570 gene locus_tag LOCUS_02140 235163 234570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 235299 236276 gene locus_tag LOCUS_02150 235299 236276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668143.1 protein_id gnl|my_center|LOCUS_02150 236294 237490 gene locus_tag LOCUS_02160 236294 237490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 237623 238957 gene locus_tag LOCUS_02170 237623 238957 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674553.1 protein_id gnl|my_center|LOCUS_02170 239037 239669 gene locus_tag LOCUS_02180 239037 239669 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861240.1 protein_id gnl|my_center|LOCUS_02180 241027 239780 gene locus_tag LOCUS_02190 241027 239780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 242004 241024 gene locus_tag LOCUS_02200 242004 241024 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799698.1 protein_id gnl|my_center|LOCUS_02200 242124 243521 gene locus_tag LOCUS_02210 242124 243521 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 protein_id gnl|my_center|LOCUS_02210 243571 243644 gene locus_tag LOCUS_t00030 243571 243644 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 244528 243698 gene locus_tag LOCUS_02220 244528 243698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 245287 244607 gene locus_tag LOCUS_02230 245287 244607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 246912 245377 gene locus_tag LOCUS_02240 246912 245377 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675527.1 protein_id gnl|my_center|LOCUS_02240 249288 246931 gene locus_tag LOCUS_02250 gene rpsA 249288 246931 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679883.1 protein_id gnl|my_center|LOCUS_02250 250050 249304 gene locus_tag LOCUS_02260 250050 249304 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682155.1 protein_id gnl|my_center|LOCUS_02260 250579 250040 gene locus_tag LOCUS_02270 gene scpB 250579 250040 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672067.1 protein_id gnl|my_center|LOCUS_02270 251537 250701 gene locus_tag LOCUS_02280 251537 250701 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670199.1 protein_id gnl|my_center|LOCUS_02280 252102 251527 gene locus_tag LOCUS_02290 252102 251527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 253331 252105 gene locus_tag LOCUS_02300 gene recA 253331 252105 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682153.1 protein_id gnl|my_center|LOCUS_02300 254519 253410 gene locus_tag LOCUS_02310 254519 253410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667248.1 protein_id gnl|my_center|LOCUS_02310 255631 254522 gene locus_tag LOCUS_02320 255631 254522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 256518 255628 gene locus_tag LOCUS_02330 256518 255628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 257141 256515 gene locus_tag LOCUS_02340 gene rpe 257141 256515 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957271.1 protein_id gnl|my_center|LOCUS_02340 257226 258173 gene locus_tag LOCUS_02350 257226 258173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667094.1 protein_id gnl|my_center|LOCUS_02350 258292 261006 gene locus_tag LOCUS_02360 gene greA 258292 261006 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673498.1 protein_id gnl|my_center|LOCUS_02360 261871 261137 gene locus_tag LOCUS_02370 gene deoC 261871 261137 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256596.1 protein_id gnl|my_center|LOCUS_02370 262025 262198 gene locus_tag LOCUS_02380 262025 262198 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670897.1 protein_id gnl|my_center|LOCUS_02380 262198 262626 gene locus_tag LOCUS_02390 262198 262626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 262619 263560 gene locus_tag LOCUS_02400 262619 263560 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679456.1 protein_id gnl|my_center|LOCUS_02400 263580 264563 gene locus_tag LOCUS_02410 263580 264563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 264786 267338 gene locus_tag LOCUS_02420 264786 267338 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679459.1 protein_id gnl|my_center|LOCUS_02420 267495 268448 gene locus_tag LOCUS_02430 267495 268448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 268468 269982 gene locus_tag LOCUS_02440 268468 269982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 269975 271564 gene locus_tag LOCUS_02450 269975 271564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 271539 272594 gene locus_tag LOCUS_02460 gene xylF 271539 272594 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094963.1 protein_id gnl|my_center|LOCUS_02460 272754 273869 gene locus_tag LOCUS_02470 gene chvE 272754 273869 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257793.1 protein_id gnl|my_center|LOCUS_02470 273937 275460 gene locus_tag LOCUS_02480 gene gguA 273937 275460 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257794.1 protein_id gnl|my_center|LOCUS_02480 275486 276649 gene locus_tag LOCUS_02490 gene gguB 275486 276649 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257795.1 protein_id gnl|my_center|LOCUS_02490 277935 276967 gene locus_tag LOCUS_02500 277935 276967 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966228.1 protein_id gnl|my_center|LOCUS_02500 278230 278158 gene locus_tag LOCUS_t00040 278230 278158 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 278358 278284 gene locus_tag LOCUS_t00050 278358 278284 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 278525 280006 gene locus_tag LOCUS_02510 278525 280006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680488.1 protein_id gnl|my_center|LOCUS_02510 280047 282020 gene locus_tag LOCUS_02520 280047 282020 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680487.1 protein_id gnl|my_center|LOCUS_02520 282749 282141 gene locus_tag LOCUS_02530 gene eamB 282749 282141 CDS product cysteine/O-acetylserine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368123.1 protein_id gnl|my_center|LOCUS_02530 284158 282869 gene locus_tag LOCUS_02540 284158 282869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 284978 284226 gene locus_tag LOCUS_02550 gene rpiA 284978 284226 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679325.1 protein_id gnl|my_center|LOCUS_02550 286467 284965 gene locus_tag LOCUS_02560 286467 284965 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679324.1 protein_id gnl|my_center|LOCUS_02560 287565 286498 gene locus_tag LOCUS_02570 287565 286498 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678383.1 protein_id gnl|my_center|LOCUS_02570 288303 287608 gene locus_tag LOCUS_02580 288303 287608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 288411 289313 gene locus_tag LOCUS_02590 gene hflK 288411 289313 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_02590 289310 290284 gene locus_tag LOCUS_02600 gene hflC 289310 290284 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 protein_id gnl|my_center|LOCUS_02600 290402 292453 gene locus_tag LOCUS_02610 290402 292453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 293354 292839 gene locus_tag LOCUS_02620 293354 292839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 >Feature sequence02 714 235 gene locus_tag LOCUS_02630 714 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 1608 775 gene locus_tag LOCUS_02640 1608 775 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459342.1 protein_id gnl|my_center|LOCUS_02640 1943 1668 gene locus_tag LOCUS_02650 1943 1668 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206812040.1 protein_id gnl|my_center|LOCUS_02650 2806 2603 gene locus_tag LOCUS_02660 2806 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 3072 3803 gene locus_tag LOCUS_02670 3072 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957243.1 protein_id gnl|my_center|LOCUS_02670 3867 3939 gene locus_tag LOCUS_t00060 3867 3939 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3942 4025 gene locus_tag LOCUS_t00070 3942 4025 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 4150 4530 gene locus_tag LOCUS_02680 4150 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 4521 5459 gene locus_tag LOCUS_02690 4521 5459 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669065.1 protein_id gnl|my_center|LOCUS_02690 5456 5644 gene locus_tag LOCUS_02700 5456 5644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 5641 6714 gene locus_tag LOCUS_02710 gene mltG 5641 6714 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671179.1 protein_id gnl|my_center|LOCUS_02710 6714 8489 gene locus_tag LOCUS_02720 gene dnaG 6714 8489 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678905.1 protein_id gnl|my_center|LOCUS_02720 8506 10359 gene locus_tag LOCUS_02730 gene rpoD 8506 10359 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678907.1 protein_id gnl|my_center|LOCUS_02730 10428 11315 gene locus_tag LOCUS_02740 10428 11315 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671470.1 protein_id gnl|my_center|LOCUS_02740 11741 12688 gene locus_tag LOCUS_02750 11741 12688 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678909.1 protein_id gnl|my_center|LOCUS_02750 12712 13749 gene locus_tag LOCUS_02760 12712 13749 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668696.1 protein_id gnl|my_center|LOCUS_02760 13755 14627 gene locus_tag LOCUS_02770 gene mreC 13755 14627 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668697.1 protein_id gnl|my_center|LOCUS_02770 14624 15127 gene locus_tag LOCUS_02780 gene mreD 14624 15127 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099493.1 protein_id gnl|my_center|LOCUS_02780 15131 17017 gene locus_tag LOCUS_02790 gene mrdA 15131 17017 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671463.1 protein_id gnl|my_center|LOCUS_02790 17025 18344 gene locus_tag LOCUS_02800 gene rodA 17025 18344 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677908.1 protein_id gnl|my_center|LOCUS_02800 18884 18681 gene locus_tag LOCUS_02810 18884 18681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02810 19154 18951 gene locus_tag LOCUS_02820 19154 18951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 19436 19173 gene locus_tag LOCUS_02830 19436 19173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 23198 19572 gene locus_tag LOCUS_02840 gene mfd 23198 19572 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678792.1 protein_id gnl|my_center|LOCUS_02840 23322 24239 gene locus_tag LOCUS_02850 23322 24239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670623.1 protein_id gnl|my_center|LOCUS_02850 24236 25165 gene locus_tag LOCUS_02860 24236 25165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 25162 25563 gene locus_tag LOCUS_02870 25162 25563 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667147.1 protein_id gnl|my_center|LOCUS_02870 25784 25870 gene locus_tag LOCUS_t00080 25784 25870 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 28051 25952 gene locus_tag LOCUS_02880 28051 25952 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680511.1 protein_id gnl|my_center|LOCUS_02880 29129 28299 gene locus_tag LOCUS_02890 29129 28299 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682394.1 protein_id gnl|my_center|LOCUS_02890 30177 29131 gene locus_tag LOCUS_02900 30177 29131 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682393.1 protein_id gnl|my_center|LOCUS_02900 30787 30131 gene locus_tag LOCUS_02910 30787 30131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 31485 30784 gene locus_tag LOCUS_02920 31485 30784 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_02920 32357 31482 gene locus_tag LOCUS_02930 gene rsmA 32357 31482 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682389.1 protein_id gnl|my_center|LOCUS_02930 33626 32370 gene locus_tag LOCUS_02940 33626 32370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 34795 33620 gene locus_tag LOCUS_02950 34795 33620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 35999 34827 gene locus_tag LOCUS_02960 35999 34827 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678853.1 protein_id gnl|my_center|LOCUS_02960 36087 36752 gene locus_tag LOCUS_02970 36087 36752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 38112 37186 gene locus_tag LOCUS_02980 38112 37186 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679668.1 protein_id gnl|my_center|LOCUS_02980 39725 38109 gene locus_tag LOCUS_02990 39725 38109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 42087 39778 gene locus_tag LOCUS_03000 gene metG 42087 39778 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682373.1 protein_id gnl|my_center|LOCUS_03000 42356 42132 gene locus_tag LOCUS_03010 42356 42132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 42823 42347 gene locus_tag LOCUS_03020 42823 42347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 43031 42798 gene locus_tag LOCUS_03030 43031 42798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 45220 43199 gene locus_tag LOCUS_03040 45220 43199 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956965.1 protein_id gnl|my_center|LOCUS_03040 45832 45230 gene locus_tag LOCUS_03050 45832 45230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 46389 45832 gene locus_tag LOCUS_03060 46389 45832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 46999 46382 gene locus_tag LOCUS_03070 46999 46382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 47472 46996 gene locus_tag LOCUS_03080 47472 46996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 48533 47469 gene locus_tag LOCUS_03090 48533 47469 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678975.1 protein_id gnl|my_center|LOCUS_03090 49833 48526 gene locus_tag LOCUS_03100 49833 48526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 51218 49830 gene locus_tag LOCUS_03110 51218 49830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 51706 51224 gene locus_tag LOCUS_03120 51706 51224 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678972.1 protein_id gnl|my_center|LOCUS_03120 51778 52731 gene locus_tag LOCUS_03130 51778 52731 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295861.1 protein_id gnl|my_center|LOCUS_03130 52737 53636 gene locus_tag LOCUS_03140 52737 53636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679695.1 protein_id gnl|my_center|LOCUS_03140 54724 53633 gene locus_tag LOCUS_03150 gene pcnB 54724 53633 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669419.1 protein_id gnl|my_center|LOCUS_03150 55680 54766 gene locus_tag LOCUS_03160 55680 54766 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679981.1 protein_id gnl|my_center|LOCUS_03160 55801 57141 gene locus_tag LOCUS_03170 gene rlmD 55801 57141 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722228.1 protein_id gnl|my_center|LOCUS_03170 57193 59004 gene locus_tag LOCUS_03180 57193 59004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 59159 60655 gene locus_tag LOCUS_03190 59159 60655 CDS product P83/100 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680732.1 protein_id gnl|my_center|LOCUS_03190 62026 60710 gene locus_tag LOCUS_03200 gene dnaB 62026 60710 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669313.1 protein_id gnl|my_center|LOCUS_03200 62402 62328 gene locus_tag LOCUS_t00090 62402 62328 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 62512 63486 gene locus_tag LOCUS_03210 62512 63486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 65037 63646 gene locus_tag LOCUS_03220 gene flgE 65037 63646 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680830.1 protein_id gnl|my_center|LOCUS_03220 65493 65050 gene locus_tag LOCUS_03230 gene flgD 65493 65050 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666981.1 protein_id gnl|my_center|LOCUS_03230 66810 65536 gene locus_tag LOCUS_03240 66810 65536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 67486 66854 gene locus_tag LOCUS_03250 67486 66854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678886.1 protein_id gnl|my_center|LOCUS_03250 68860 67547 gene locus_tag LOCUS_03260 68860 67547 CDS product hexokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680422.1 protein_id gnl|my_center|LOCUS_03260 69067 71079 gene locus_tag LOCUS_03270 69067 71079 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682194.1 protein_id gnl|my_center|LOCUS_03270 71174 71620 gene locus_tag LOCUS_03280 71174 71620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 72635 71727 gene locus_tag LOCUS_03290 72635 71727 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682397.1 protein_id gnl|my_center|LOCUS_03290 74131 72647 gene locus_tag LOCUS_03300 gene murC 74131 72647 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956876.1 protein_id gnl|my_center|LOCUS_03300 74591 74196 gene locus_tag LOCUS_03310 74591 74196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 74836 74588 gene locus_tag LOCUS_03320 74836 74588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 74938 76599 gene locus_tag LOCUS_03330 74938 76599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 76785 77324 gene locus_tag LOCUS_03340 76785 77324 CDS product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902203.1 protein_id gnl|my_center|LOCUS_03340 79231 78059 gene locus_tag LOCUS_03350 gene alr 79231 78059 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682404.1 protein_id gnl|my_center|LOCUS_03350 79427 80338 gene locus_tag LOCUS_03360 79427 80338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 80405 81820 gene locus_tag LOCUS_03370 gene thrC 80405 81820 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680037.1 protein_id gnl|my_center|LOCUS_03370 82139 82067 gene locus_tag LOCUS_t00100 82139 82067 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 82329 82769 gene locus_tag LOCUS_03380 82329 82769 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112957.1 protein_id gnl|my_center|LOCUS_03380 82851 84143 gene locus_tag LOCUS_03390 82851 84143 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671452.1 protein_id gnl|my_center|LOCUS_03390 84160 84651 gene locus_tag LOCUS_03400 84160 84651 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674498.1 protein_id gnl|my_center|LOCUS_03400 86032 84743 gene locus_tag LOCUS_03410 86032 84743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 89248 86201 gene locus_tag LOCUS_03420 89248 86201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 89608 90993 gene locus_tag LOCUS_03430 gene fumC 89608 90993 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456604.1 protein_id gnl|my_center|LOCUS_03430 93993 91153 gene locus_tag LOCUS_03440 93993 91153 CDS product CHASE2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682238.1 protein_id gnl|my_center|LOCUS_03440 94737 94018 gene locus_tag LOCUS_03450 gene rnc 94737 94018 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670498.1 protein_id gnl|my_center|LOCUS_03450 95062 94820 gene locus_tag LOCUS_03460 gene acpP 95062 94820 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670497.1 protein_id gnl|my_center|LOCUS_03460 95871 95386 gene locus_tag LOCUS_03470 gene coaD 95871 95386 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678956.1 protein_id gnl|my_center|LOCUS_03470 96027 96491 gene locus_tag LOCUS_03480 96027 96491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 96690 97442 gene locus_tag LOCUS_03490 96690 97442 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674261.1 protein_id gnl|my_center|LOCUS_03490 97503 97576 gene locus_tag LOCUS_t00110 97503 97576 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 97608 98198 gene locus_tag LOCUS_03500 97608 98198 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680263.1 protein_id gnl|my_center|LOCUS_03500 98334 99209 gene locus_tag LOCUS_03510 gene rpsB 98334 99209 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680262.1 protein_id gnl|my_center|LOCUS_03510 99231 100064 gene locus_tag LOCUS_03520 gene tsf 99231 100064 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674264.1 protein_id gnl|my_center|LOCUS_03520 100135 100677 gene locus_tag LOCUS_03530 gene frr 100135 100677 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675802.1 protein_id gnl|my_center|LOCUS_03530 100677 101393 gene locus_tag LOCUS_03540 gene uppS 100677 101393 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675801.1 protein_id gnl|my_center|LOCUS_03540 101386 102255 gene locus_tag LOCUS_03550 101386 102255 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667742.1 protein_id gnl|my_center|LOCUS_03550 102258 103340 gene locus_tag LOCUS_03560 gene dxr 102258 103340 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680260.1 protein_id gnl|my_center|LOCUS_03560 103337 104461 gene locus_tag LOCUS_03570 gene rseP 103337 104461 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002934663.1 protein_id gnl|my_center|LOCUS_03570 104462 106366 gene locus_tag LOCUS_03580 104462 106366 CDS product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680031.1 protein_id gnl|my_center|LOCUS_03580 108113 106626 gene locus_tag LOCUS_03590 gene glgA 108113 106626 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679256.1 protein_id gnl|my_center|LOCUS_03590 109548 108376 gene locus_tag LOCUS_03600 109548 108376 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938142.1 protein_id gnl|my_center|LOCUS_03600 109668 110396 gene locus_tag LOCUS_03610 109668 110396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 110422 111375 gene locus_tag LOCUS_03620 gene rfbD 110422 111375 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_03620 112834 111413 gene locus_tag LOCUS_03630 112834 111413 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680980.1 protein_id gnl|my_center|LOCUS_03630 113073 114791 gene locus_tag LOCUS_03640 113073 114791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 115016 116260 gene locus_tag LOCUS_03650 115016 116260 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128519551.1 protein_id gnl|my_center|LOCUS_03650 116289 117293 gene locus_tag LOCUS_03660 116289 117293 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201896.1 protein_id gnl|my_center|LOCUS_03660 118431 117247 gene locus_tag LOCUS_03670 118431 117247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 118598 119494 gene locus_tag LOCUS_03680 118598 119494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203008.1 protein_id gnl|my_center|LOCUS_03680 119509 120426 gene locus_tag LOCUS_03690 119509 120426 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202149.1 protein_id gnl|my_center|LOCUS_03690 120482 123163 gene locus_tag LOCUS_03700 120482 123163 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679058.1 protein_id gnl|my_center|LOCUS_03700 123160 124434 gene locus_tag LOCUS_03710 123160 124434 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679056.1 protein_id gnl|my_center|LOCUS_03710 124486 126315 gene locus_tag LOCUS_03720 124486 126315 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203684.1 protein_id gnl|my_center|LOCUS_03720 126362 126805 gene locus_tag LOCUS_03730 126362 126805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03730 126838 128631 gene locus_tag LOCUS_03740 126838 128631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03740 128628 129056 gene locus_tag LOCUS_03750 128628 129056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 130935 129172 gene locus_tag LOCUS_03760 130935 129172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 131262 130978 gene locus_tag LOCUS_03770 131262 130978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 132730 131276 gene locus_tag LOCUS_03780 132730 131276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 132994 134064 gene locus_tag LOCUS_03790 132994 134064 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582745.1 protein_id gnl|my_center|LOCUS_03790 134390 134998 gene locus_tag LOCUS_03800 134390 134998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 135023 136189 gene locus_tag LOCUS_03810 135023 136189 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583291.1 protein_id gnl|my_center|LOCUS_03810 136329 137678 gene locus_tag LOCUS_03820 136329 137678 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294624.1 protein_id gnl|my_center|LOCUS_03820 137678 139213 gene locus_tag LOCUS_03830 137678 139213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681908.1 protein_id gnl|my_center|LOCUS_03830 140397 139279 gene locus_tag LOCUS_03840 140397 139279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 141491 140406 gene locus_tag LOCUS_03850 gene ispG 141491 140406 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678768.1 protein_id gnl|my_center|LOCUS_03850 141941 141513 gene locus_tag LOCUS_03860 141941 141513 CDS product ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669353.1 protein_id gnl|my_center|LOCUS_03860 143856 141955 gene locus_tag LOCUS_03870 143856 141955 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003276.1 protein_id gnl|my_center|LOCUS_03870 144455 143853 gene locus_tag LOCUS_03880 144455 143853 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679385.1 protein_id gnl|my_center|LOCUS_03880 145763 144468 gene locus_tag LOCUS_03890 145763 144468 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669361.1 protein_id gnl|my_center|LOCUS_03890 147535 145766 gene locus_tag LOCUS_03900 147535 145766 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669362.1 protein_id gnl|my_center|LOCUS_03900 148073 147528 gene locus_tag LOCUS_03910 148073 147528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 148693 148079 gene locus_tag LOCUS_03920 148693 148079 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678965.1 protein_id gnl|my_center|LOCUS_03920 149492 148842 gene locus_tag LOCUS_03930 149492 148842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 149830 149495 gene locus_tag LOCUS_03940 149830 149495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 151775 149811 gene locus_tag LOCUS_03950 151775 149811 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667114.1 protein_id gnl|my_center|LOCUS_03950 152563 151775 gene locus_tag LOCUS_03960 gene whiG 152563 151775 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667112.1 protein_id gnl|my_center|LOCUS_03960 153283 152573 gene locus_tag LOCUS_03970 153283 152573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 154249 153350 gene locus_tag LOCUS_03980 154249 153350 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680723.1 protein_id gnl|my_center|LOCUS_03980 155486 154269 gene locus_tag LOCUS_03990 gene flhF 155486 154269 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957291.1 protein_id gnl|my_center|LOCUS_03990 157665 155479 gene locus_tag LOCUS_04000 gene flhA 157665 155479 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889723.1 protein_id gnl|my_center|LOCUS_04000 158862 157687 gene locus_tag LOCUS_04010 gene flhB 158862 157687 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680909.1 protein_id gnl|my_center|LOCUS_04010 159656 158859 gene locus_tag LOCUS_04020 gene fliR 159656 158859 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673318.1 protein_id gnl|my_center|LOCUS_04020 159938 159669 gene locus_tag LOCUS_04030 gene fliQ 159938 159669 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666830.1 protein_id gnl|my_center|LOCUS_04030 160986 160279 gene locus_tag LOCUS_04040 gene fliP 160986 160279 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680826.1 protein_id gnl|my_center|LOCUS_04040 161785 161129 gene locus_tag LOCUS_04050 gene fliO 161785 161129 CDS product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680827.1 protein_id gnl|my_center|LOCUS_04050 162911 161799 gene locus_tag LOCUS_04060 gene fliN 162911 161799 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680828.1 protein_id gnl|my_center|LOCUS_04060 163941 162904 gene locus_tag LOCUS_04070 gene fliM 163941 162904 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666990.1 protein_id gnl|my_center|LOCUS_04070 164496 163951 gene locus_tag LOCUS_04080 164496 163951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 165254 164526 gene locus_tag LOCUS_04090 gene motB 165254 164526 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666988.1 protein_id gnl|my_center|LOCUS_04090 166039 165257 gene locus_tag LOCUS_04100 166039 165257 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666986.1 protein_id gnl|my_center|LOCUS_04100 166241 166044 gene locus_tag LOCUS_04110 166241 166044 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680829.1 protein_id gnl|my_center|LOCUS_04110 166386 167093 gene locus_tag LOCUS_04120 166386 167093 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485328.1 protein_id gnl|my_center|LOCUS_04120 167107 168498 gene locus_tag LOCUS_04130 167107 168498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 169627 168446 gene locus_tag LOCUS_04140 gene hemW 169627 168446 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964591.1 protein_id gnl|my_center|LOCUS_04140 170445 169747 gene locus_tag LOCUS_04150 gene lepB 170445 169747 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668934.1 protein_id gnl|my_center|LOCUS_04150 170708 171172 gene locus_tag LOCUS_04160 gene smpB 170708 171172 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668932.1 protein_id gnl|my_center|LOCUS_04160 171169 172017 gene locus_tag LOCUS_04170 171169 172017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 172183 172515 gene locus_tag LOCUS_04180 172183 172515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099360.1 protein_id gnl|my_center|LOCUS_04180 172496 172672 gene locus_tag LOCUS_04190 172496 172672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 173597 173037 gene locus_tag LOCUS_04200 173597 173037 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679118.1 protein_id gnl|my_center|LOCUS_04200 174091 173594 gene locus_tag LOCUS_04210 174091 173594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 174262 176067 gene locus_tag LOCUS_04220 174262 176067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679117.1 protein_id gnl|my_center|LOCUS_04220 176069 176929 gene locus_tag LOCUS_04230 176069 176929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 176933 178402 gene locus_tag LOCUS_04240 176933 178402 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679115.1 protein_id gnl|my_center|LOCUS_04240 178399 179895 gene locus_tag LOCUS_04250 178399 179895 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679114.1 protein_id gnl|my_center|LOCUS_04250 179921 181111 gene locus_tag LOCUS_04260 179921 181111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 181787 181128 gene locus_tag LOCUS_04270 181787 181128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 182824 181784 gene locus_tag LOCUS_04280 182824 181784 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671073.1 protein_id gnl|my_center|LOCUS_04280 183806 182967 gene locus_tag LOCUS_04290 183806 182967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 187020 183829 gene locus_tag LOCUS_04300 gene ileS 187020 183829 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680710.1 protein_id gnl|my_center|LOCUS_04300 187184 190186 gene locus_tag LOCUS_04310 187184 190186 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679154.1 protein_id gnl|my_center|LOCUS_04310 190173 190553 gene locus_tag LOCUS_04320 190173 190553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 190550 192130 gene locus_tag LOCUS_04330 190550 192130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 192191 192895 gene locus_tag LOCUS_04340 192191 192895 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404569.1 protein_id gnl|my_center|LOCUS_04340 192922 194220 gene locus_tag LOCUS_04350 gene serS 192922 194220 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680220.1 protein_id gnl|my_center|LOCUS_04350 194223 195365 gene locus_tag LOCUS_04360 194223 195365 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_04360 195683 196006 gene locus_tag LOCUS_04370 195683 196006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04370 195984 196460 gene locus_tag LOCUS_04380 195984 196460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04380 197103 196666 gene locus_tag LOCUS_04390 197103 196666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 197808 197383 gene locus_tag LOCUS_04400 197808 197383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 198754 197927 gene locus_tag LOCUS_04410 198754 197927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 210316 198824 gene locus_tag LOCUS_04420 210316 198824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 210605 211915 gene locus_tag LOCUS_04430 210605 211915 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867389.1 protein_id gnl|my_center|LOCUS_04430 211920 212735 gene locus_tag LOCUS_04440 211920 212735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 212847 212775 gene locus_tag LOCUS_t00120 212847 212775 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 214439 213000 gene locus_tag LOCUS_04450 gene mtaB 214439 213000 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679581.1 protein_id gnl|my_center|LOCUS_04450 215289 214444 gene locus_tag LOCUS_04460 215289 214444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 215650 215291 gene locus_tag LOCUS_04470 215650 215291 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669698.1 protein_id gnl|my_center|LOCUS_04470 215779 217098 gene locus_tag LOCUS_04480 gene pta 215779 217098 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666863.1 protein_id gnl|my_center|LOCUS_04480 217102 218283 gene locus_tag LOCUS_04490 217102 218283 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679158.1 protein_id gnl|my_center|LOCUS_04490 218485 218315 gene locus_tag LOCUS_04500 218485 218315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 219444 218485 gene locus_tag LOCUS_04510 219444 218485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 219664 222318 gene locus_tag LOCUS_04520 219664 222318 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044971578.1 protein_id gnl|my_center|LOCUS_04520 223800 222331 gene locus_tag LOCUS_04530 223800 222331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 225042 223909 gene locus_tag LOCUS_04540 gene tgt 225042 223909 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681512.1 protein_id gnl|my_center|LOCUS_04540 226254 225178 gene locus_tag LOCUS_04550 226254 225178 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682352.1 protein_id gnl|my_center|LOCUS_04550 227456 226251 gene locus_tag LOCUS_04560 227456 226251 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670521.1 protein_id gnl|my_center|LOCUS_04560 227937 227491 gene locus_tag LOCUS_04570 gene dut 227937 227491 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682351.1 protein_id gnl|my_center|LOCUS_04570 230075 227976 gene locus_tag LOCUS_04580 gene pnp 230075 227976 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682350.1 protein_id gnl|my_center|LOCUS_04580 230528 230259 gene locus_tag LOCUS_04590 gene rpsO 230528 230259 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671840.1 protein_id gnl|my_center|LOCUS_04590 231369 230551 gene locus_tag LOCUS_04600 231369 230551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 231646 232734 gene locus_tag LOCUS_04610 231646 232734 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_04610 233475 232738 gene locus_tag LOCUS_04620 233475 232738 CDS product CPBP family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028427.1 protein_id gnl|my_center|LOCUS_04620 234838 233600 gene locus_tag LOCUS_04630 234838 233600 CDS product RelA/SpoT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679418.1 protein_id gnl|my_center|LOCUS_04630 236007 234907 gene locus_tag LOCUS_04640 236007 234907 CDS product flagellar filament outer layer protein FlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670927.1 protein_id gnl|my_center|LOCUS_04640 236547 236086 gene locus_tag LOCUS_04650 236547 236086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 237617 236565 gene locus_tag LOCUS_04660 237617 236565 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679426.1 protein_id gnl|my_center|LOCUS_04660 239244 237610 gene locus_tag LOCUS_04670 239244 237610 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680053.1 protein_id gnl|my_center|LOCUS_04670 241723 239249 gene locus_tag LOCUS_04680 241723 239249 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679616.1 protein_id gnl|my_center|LOCUS_04680 242682 241720 gene locus_tag LOCUS_04690 242682 241720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679623.1 protein_id gnl|my_center|LOCUS_04690 244297 242657 gene locus_tag LOCUS_04700 244297 242657 CDS product spiro-SPASM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679625.1 protein_id gnl|my_center|LOCUS_04700 244432 245664 gene locus_tag LOCUS_04710 gene xseA 244432 245664 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682333.1 protein_id gnl|my_center|LOCUS_04710 245695 245973 gene locus_tag LOCUS_04720 gene xseB 245695 245973 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674672.1 protein_id gnl|my_center|LOCUS_04720 245970 247982 gene locus_tag LOCUS_04730 gene mutL 245970 247982 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516269.1 protein_id gnl|my_center|LOCUS_04730 250837 248123 gene locus_tag LOCUS_04740 250837 248123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 251038 251255 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttttctgcagcaatgcgctcctgctctgcacg 251888 253255 gene locus_tag LOCUS_04750 251888 253255 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670692.1 protein_id gnl|my_center|LOCUS_04750 253256 253957 gene locus_tag LOCUS_04760 253256 253957 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670690.1 protein_id gnl|my_center|LOCUS_04760 253954 254877 gene locus_tag LOCUS_04770 253954 254877 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259715.1 protein_id gnl|my_center|LOCUS_04770 254901 256592 gene locus_tag LOCUS_04780 254901 256592 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682419.1 protein_id gnl|my_center|LOCUS_04780 256604 256942 gene locus_tag LOCUS_04790 256604 256942 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670686.1 protein_id gnl|my_center|LOCUS_04790 257115 257660 gene locus_tag LOCUS_04800 257115 257660 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670683.1 protein_id gnl|my_center|LOCUS_04800 257721 258101 gene locus_tag LOCUS_tm00010 257721 258101 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 259806 258301 gene locus_tag LOCUS_04810 gene hslU 259806 258301 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677705.1 protein_id gnl|my_center|LOCUS_04810 260447 259911 gene locus_tag LOCUS_04820 gene hslV 260447 259911 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668456.1 protein_id gnl|my_center|LOCUS_04820 261366 260440 gene locus_tag LOCUS_04830 261366 260440 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678705.1 protein_id gnl|my_center|LOCUS_04830 262452 261499 gene locus_tag LOCUS_04840 262452 261499 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963590.1 protein_id gnl|my_center|LOCUS_04840 265035 262891 gene locus_tag LOCUS_04850 gene topA 265035 262891 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678704.1 protein_id gnl|my_center|LOCUS_04850 266143 265109 gene locus_tag LOCUS_04860 266143 265109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 266861 266133 gene locus_tag LOCUS_04870 266861 266133 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678696.1 protein_id gnl|my_center|LOCUS_04870 267824 266904 gene locus_tag LOCUS_04880 267824 266904 CDS product site-specific tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044909847.1 protein_id gnl|my_center|LOCUS_04880 269250 267835 gene locus_tag LOCUS_04890 gene ftsZ 269250 267835 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656388.1 protein_id gnl|my_center|LOCUS_04890 270521 269280 gene locus_tag LOCUS_04900 gene ftsA 270521 269280 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678694.1 protein_id gnl|my_center|LOCUS_04900 271342 270539 gene locus_tag LOCUS_04910 271342 270539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 272528 271335 gene locus_tag LOCUS_04920 gene ftsW 272528 271335 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677685.1 protein_id gnl|my_center|LOCUS_04920 274002 272521 gene locus_tag LOCUS_04930 gene murF 274002 272521 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678687.1 protein_id gnl|my_center|LOCUS_04930 274297 273992 gene locus_tag LOCUS_04940 274297 273992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 275277 274294 gene locus_tag LOCUS_04950 gene rsmH 275277 274294 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678681.1 protein_id gnl|my_center|LOCUS_04950 275740 275297 gene locus_tag LOCUS_04960 gene mraZ 275740 275297 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678680.1 protein_id gnl|my_center|LOCUS_04960 275894 276610 gene locus_tag LOCUS_04970 275894 276610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679004.1 protein_id gnl|my_center|LOCUS_04970 277730 276771 gene locus_tag LOCUS_04980 277730 276771 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943599.1 protein_id gnl|my_center|LOCUS_04980 278593 277871 gene locus_tag LOCUS_04990 278593 277871 CDS product flagellar filament outer layer protein FlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668795.1 protein_id gnl|my_center|LOCUS_04990 279343 278594 gene locus_tag LOCUS_05000 279343 278594 CDS product flagellar filament outer layer protein FlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668794.1 protein_id gnl|my_center|LOCUS_05000 >Feature sequence03 80 1027 gene locus_tag LOCUS_05010 80 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 1672 1094 gene locus_tag LOCUS_05020 1672 1094 CDS product master DNA invertase Mpi family serine-type recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680425.1 protein_id gnl|my_center|LOCUS_05020 4215 1813 gene locus_tag LOCUS_05030 gene pbpC 4215 1813 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957163.1 protein_id gnl|my_center|LOCUS_05030 4402 5682 gene locus_tag LOCUS_05040 4402 5682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 5757 6800 gene locus_tag LOCUS_05050 5757 6800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 6870 6944 gene locus_tag LOCUS_t00130 6870 6944 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7224 7054 gene locus_tag LOCUS_05060 7224 7054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 7187 8419 gene locus_tag LOCUS_05070 7187 8419 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682387.1 protein_id gnl|my_center|LOCUS_05070 8561 9820 gene locus_tag LOCUS_05080 gene fabF 8561 9820 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673329.1 protein_id gnl|my_center|LOCUS_05080 9923 9993 gene locus_tag LOCUS_t00140 9923 9993 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 10195 10596 gene locus_tag LOCUS_05090 10195 10596 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814175.1 protein_id gnl|my_center|LOCUS_05090 10612 12159 gene locus_tag LOCUS_05100 10612 12159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 12251 13060 gene locus_tag LOCUS_05110 12251 13060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 13047 14033 gene locus_tag LOCUS_05120 13047 14033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 14038 14940 gene locus_tag LOCUS_05130 gene rsmG 14038 14940 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957250.1 protein_id gnl|my_center|LOCUS_05130 15922 15086 gene locus_tag LOCUS_05140 gene thyX 15922 15086 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681263.1 protein_id gnl|my_center|LOCUS_05140 16550 15948 gene locus_tag LOCUS_05150 16550 15948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 17760 16918 gene locus_tag LOCUS_05160 17760 16918 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680159.1 protein_id gnl|my_center|LOCUS_05160 18249 18335 gene locus_tag LOCUS_t00150 18249 18335 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 18467 18553 gene locus_tag LOCUS_t00160 18467 18553 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 18560 18637 gene locus_tag LOCUS_t00170 18560 18637 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 18666 18754 gene locus_tag LOCUS_t00180 18666 18754 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 19445 18774 gene locus_tag LOCUS_05170 19445 18774 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678714.1 protein_id gnl|my_center|LOCUS_05170 20364 19486 gene locus_tag LOCUS_05180 20364 19486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 21269 20361 gene locus_tag LOCUS_05190 gene troC 21269 20361 CDS product transition metal ABC transporter permease subunit TroC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677722.1 protein_id gnl|my_center|LOCUS_05190 22018 21278 gene locus_tag LOCUS_05200 22018 21278 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678718.1 protein_id gnl|my_center|LOCUS_05200 22962 22027 gene locus_tag LOCUS_05210 22962 22027 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671643.1 protein_id gnl|my_center|LOCUS_05210 25417 23066 gene locus_tag LOCUS_05220 25417 23066 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074031.1 protein_id gnl|my_center|LOCUS_05220 25609 25869 gene locus_tag LOCUS_05230 25609 25869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 26000 27097 gene locus_tag LOCUS_05240 26000 27097 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681927.1 protein_id gnl|my_center|LOCUS_05240 27449 28339 gene locus_tag LOCUS_05250 27449 28339 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870102.1 protein_id gnl|my_center|LOCUS_05250 29002 28370 gene locus_tag LOCUS_05260 29002 28370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 29216 29004 gene locus_tag LOCUS_05270 29216 29004 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016020.1 protein_id gnl|my_center|LOCUS_05270 29299 30042 gene locus_tag LOCUS_05280 29299 30042 CDS product MT-A70 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103677717.1 protein_id gnl|my_center|LOCUS_05280 30147 30602 gene locus_tag LOCUS_05290 30147 30602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 31248 30622 gene locus_tag LOCUS_05300 31248 30622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 31855 31373 gene locus_tag LOCUS_05310 31855 31373 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316680.1 protein_id gnl|my_center|LOCUS_05310 32844 31858 gene locus_tag LOCUS_05320 32844 31858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05320 33589 32837 gene locus_tag LOCUS_05330 33589 32837 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208350.1 protein_id gnl|my_center|LOCUS_05330 33967 33605 gene locus_tag LOCUS_05340 33967 33605 CDS product thioester dehydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074026.1 protein_id gnl|my_center|LOCUS_05340 34633 34226 gene locus_tag LOCUS_05350 34633 34226 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_05350 34857 34630 gene locus_tag LOCUS_05360 34857 34630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 38027 35112 gene locus_tag LOCUS_05370 38027 35112 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957779.1 protein_id gnl|my_center|LOCUS_05370 40956 38020 gene locus_tag LOCUS_05380 40956 38020 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762065.1 protein_id gnl|my_center|LOCUS_05380 42449 40953 gene locus_tag LOCUS_05390 42449 40953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 43852 42419 gene locus_tag LOCUS_05400 43852 42419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 45185 43839 gene locus_tag LOCUS_05410 45185 43839 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584332.1 protein_id gnl|my_center|LOCUS_05410 46461 45163 gene locus_tag LOCUS_05420 46461 45163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 47064 46558 gene locus_tag LOCUS_05430 47064 46558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 47697 47065 gene locus_tag LOCUS_05440 47697 47065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 49109 47700 gene locus_tag LOCUS_05450 49109 47700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 49174 49338 gene locus_tag LOCUS_05460 49174 49338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 49366 49995 gene locus_tag LOCUS_05470 49366 49995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 50084 50545 gene locus_tag LOCUS_05480 50084 50545 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937609.1 protein_id gnl|my_center|LOCUS_05480 50762 52117 gene locus_tag LOCUS_05490 50762 52117 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986917.1 protein_id gnl|my_center|LOCUS_05490 52544 53005 gene locus_tag LOCUS_05500 52544 53005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 56442 53002 gene locus_tag LOCUS_05510 56442 53002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 57386 56475 gene locus_tag LOCUS_05520 57386 56475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 57742 59025 gene locus_tag LOCUS_05530 57742 59025 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112252.1 protein_id gnl|my_center|LOCUS_05530 59151 60077 gene locus_tag LOCUS_05540 59151 60077 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055566.1 protein_id gnl|my_center|LOCUS_05540 60094 60975 gene locus_tag LOCUS_05550 60094 60975 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229020.1 protein_id gnl|my_center|LOCUS_05550 61507 61073 gene locus_tag LOCUS_05560 61507 61073 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670499.1 protein_id gnl|my_center|LOCUS_05560 62071 62667 gene locus_tag LOCUS_05570 62071 62667 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_05570 62683 64416 gene locus_tag LOCUS_05580 62683 64416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 64413 66101 gene locus_tag LOCUS_05590 64413 66101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 67012 66224 gene locus_tag LOCUS_05600 67012 66224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 67748 67398 gene locus_tag LOCUS_05610 67748 67398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 67903 68412 gene locus_tag LOCUS_05620 67903 68412 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941709.1 protein_id gnl|my_center|LOCUS_05620 68524 69414 gene locus_tag LOCUS_05630 gene rlmB 68524 69414 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679077.1 protein_id gnl|my_center|LOCUS_05630 70129 69560 gene locus_tag LOCUS_05640 70129 69560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 70437 71090 gene locus_tag LOCUS_05650 70437 71090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 72738 71179 gene locus_tag LOCUS_05660 gene citF 72738 71179 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922330.1 protein_id gnl|my_center|LOCUS_05660 73640 72738 gene locus_tag LOCUS_05670 gene citE 73640 72738 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898727.1 protein_id gnl|my_center|LOCUS_05670 73936 73637 gene locus_tag LOCUS_05680 gene citD 73936 73637 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566181.1 protein_id gnl|my_center|LOCUS_05680 75560 74058 gene locus_tag LOCUS_05690 75560 74058 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869091.1 protein_id gnl|my_center|LOCUS_05690 76087 75620 gene locus_tag LOCUS_05700 76087 75620 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925094.1 protein_id gnl|my_center|LOCUS_05700 77160 76150 gene locus_tag LOCUS_05710 77160 76150 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869089.1 protein_id gnl|my_center|LOCUS_05710 78273 77395 gene locus_tag LOCUS_05720 78273 77395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 78462 79952 gene locus_tag LOCUS_05730 78462 79952 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681057.1 protein_id gnl|my_center|LOCUS_05730 80267 81730 gene locus_tag LOCUS_05740 80267 81730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 81727 82446 gene locus_tag LOCUS_05750 81727 82446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 82491 83531 gene locus_tag LOCUS_05760 gene citC 82491 83531 CDS product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016310.1 protein_id gnl|my_center|LOCUS_05760 83518 84102 gene locus_tag LOCUS_05770 gene citX 83518 84102 CDS product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016309.1 protein_id gnl|my_center|LOCUS_05770 84099 85061 gene locus_tag LOCUS_05780 gene citG 84099 85061 CDS product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704364.1 protein_id gnl|my_center|LOCUS_05780 86324 85125 gene locus_tag LOCUS_05790 86324 85125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 87464 86679 gene locus_tag LOCUS_05800 87464 86679 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321321.1 protein_id gnl|my_center|LOCUS_05800 88092 87694 gene locus_tag LOCUS_05810 88092 87694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 89967 88339 gene locus_tag LOCUS_05820 89967 88339 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142130.1 protein_id gnl|my_center|LOCUS_05820 90684 90103 gene locus_tag LOCUS_05830 90684 90103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 91907 90822 gene locus_tag LOCUS_05840 gene rfbB 91907 90822 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679073.1 protein_id gnl|my_center|LOCUS_05840 92668 92063 gene locus_tag LOCUS_05850 gene rfbC 92668 92063 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_05850 93556 92681 gene locus_tag LOCUS_05860 gene rfbA 93556 92681 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679070.1 protein_id gnl|my_center|LOCUS_05860 96565 93737 gene locus_tag LOCUS_05870 96565 93737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 96766 98676 gene locus_tag LOCUS_05880 96766 98676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 98761 100260 gene locus_tag LOCUS_05890 gene glpK 98761 100260 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987067.1 protein_id gnl|my_center|LOCUS_05890 100341 101855 gene locus_tag LOCUS_05900 100341 101855 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948739.1 protein_id gnl|my_center|LOCUS_05900 101852 103306 gene locus_tag LOCUS_05910 101852 103306 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948740.1 protein_id gnl|my_center|LOCUS_05910 103309 103692 gene locus_tag LOCUS_05920 103309 103692 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016210.1 protein_id gnl|my_center|LOCUS_05920 104636 103902 gene locus_tag LOCUS_05930 104636 103902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 105418 104831 gene locus_tag LOCUS_05940 105418 104831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 106558 105515 gene locus_tag LOCUS_05950 106558 105515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 108478 106610 gene locus_tag LOCUS_05960 gene modF 108478 106610 CDS product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704776.1 protein_id gnl|my_center|LOCUS_05960 110417 108630 gene locus_tag LOCUS_05970 110417 108630 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_05970 112511 110709 gene locus_tag LOCUS_05980 112511 110709 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682243.1 protein_id gnl|my_center|LOCUS_05980 112603 113850 gene locus_tag LOCUS_05990 112603 113850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 114000 114686 gene locus_tag LOCUS_06000 114000 114686 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678782.1 protein_id gnl|my_center|LOCUS_06000 114783 115736 gene locus_tag LOCUS_06010 gene argC 114783 115736 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523123.1 protein_id gnl|my_center|LOCUS_06010 115898 117163 gene locus_tag LOCUS_06020 115898 117163 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682240.1 protein_id gnl|my_center|LOCUS_06020 117167 117763 gene locus_tag LOCUS_06030 gene fadR 117167 117763 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229547.1 protein_id gnl|my_center|LOCUS_06030 117766 118473 gene locus_tag LOCUS_06040 117766 118473 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764403.1 protein_id gnl|my_center|LOCUS_06040 118670 119713 gene locus_tag LOCUS_06050 gene msrB 118670 119713 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672271.1 protein_id gnl|my_center|LOCUS_06050 120232 119723 gene locus_tag LOCUS_06060 120232 119723 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940930.1 protein_id gnl|my_center|LOCUS_06060 120826 120560 gene locus_tag LOCUS_06070 120826 120560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 121842 121003 gene locus_tag LOCUS_06080 121842 121003 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082267.1 protein_id gnl|my_center|LOCUS_06080 124890 121996 gene locus_tag LOCUS_06090 gene ppdK 124890 121996 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082976.1 protein_id gnl|my_center|LOCUS_06090 126164 124989 gene locus_tag LOCUS_06100 126164 124989 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903257.1 protein_id gnl|my_center|LOCUS_06100 127362 126331 gene locus_tag LOCUS_06110 127362 126331 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_06110 127543 128841 gene locus_tag LOCUS_06120 127543 128841 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582790.1 protein_id gnl|my_center|LOCUS_06120 129522 128911 gene locus_tag LOCUS_06130 129522 128911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 130531 129560 gene locus_tag LOCUS_06140 130531 129560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 131569 130925 gene locus_tag LOCUS_06150 131569 130925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 131758 132591 gene locus_tag LOCUS_06160 131758 132591 CDS product purine nucleoside phosphorylase I, inosine and guanosine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230447.1 protein_id gnl|my_center|LOCUS_06160 133635 132586 gene locus_tag LOCUS_06170 133635 132586 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020423.1 protein_id gnl|my_center|LOCUS_06170 135029 133656 gene locus_tag LOCUS_06180 gene mgtE 135029 133656 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680769.1 protein_id gnl|my_center|LOCUS_06180 136045 135545 gene locus_tag LOCUS_06190 136045 135545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 136332 136042 gene locus_tag LOCUS_06200 136332 136042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 136480 136815 gene locus_tag LOCUS_06210 136480 136815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 136951 138282 gene locus_tag LOCUS_06220 136951 138282 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902958.1 protein_id gnl|my_center|LOCUS_06220 138675 138319 gene locus_tag LOCUS_06230 138675 138319 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681342.1 protein_id gnl|my_center|LOCUS_06230 139717 138896 gene locus_tag LOCUS_06240 139717 138896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06240 140016 139615 gene locus_tag LOCUS_06250 140016 139615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06250 140593 140063 gene locus_tag LOCUS_06260 140593 140063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 140755 141612 gene locus_tag LOCUS_06270 140755 141612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 142596 141631 gene locus_tag LOCUS_06280 142596 141631 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930477.1 protein_id gnl|my_center|LOCUS_06280 143223 142618 gene locus_tag LOCUS_06290 143223 142618 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_06290 144119 143934 gene locus_tag LOCUS_06300 144119 143934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 145229 144246 gene locus_tag LOCUS_06310 145229 144246 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_06310 145356 145541 gene locus_tag LOCUS_06320 145356 145541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 146499 146266 gene locus_tag LOCUS_06330 146499 146266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 147408 146914 gene locus_tag LOCUS_06340 147408 146914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 148487 147453 gene locus_tag LOCUS_06350 148487 147453 CDS product IS30-like element ISTde2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956682.1 protein_id gnl|my_center|LOCUS_06350 148745 149527 gene locus_tag LOCUS_06360 148745 149527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 149599 149937 gene locus_tag LOCUS_06370 149599 149937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 149954 150229 gene locus_tag LOCUS_06380 149954 150229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 151008 152207 gene locus_tag LOCUS_06390 151008 152207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 152497 152246 gene locus_tag LOCUS_06400 152497 152246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06400 153067 152621 gene locus_tag LOCUS_06410 153067 152621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06410 153345 153641 gene locus_tag LOCUS_06420 153345 153641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 157725 155230 gene locus_tag LOCUS_06430 gene gyrA 157725 155230 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681235.1 protein_id gnl|my_center|LOCUS_06430 159031 157898 gene locus_tag LOCUS_06440 159031 157898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 160683 159424 gene locus_tag LOCUS_06450 160683 159424 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_06450 161868 160774 gene locus_tag LOCUS_06460 161868 160774 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964038.1 protein_id gnl|my_center|LOCUS_06460 162861 161947 gene locus_tag LOCUS_06470 162861 161947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 163315 163061 gene locus_tag LOCUS_06480 163315 163061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 164145 163342 gene locus_tag LOCUS_06490 164145 163342 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806072.1 protein_id gnl|my_center|LOCUS_06490 164852 164142 gene locus_tag LOCUS_06500 164852 164142 CDS product BsaWI family type II restriction enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209612024.1 protein_id gnl|my_center|LOCUS_06500 166814 164886 gene locus_tag LOCUS_06510 gene gyrB 166814 164886 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666949.1 protein_id gnl|my_center|LOCUS_06510 167019 168374 gene locus_tag LOCUS_06520 gene dnaA 167019 168374 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680852.1 protein_id gnl|my_center|LOCUS_06520 168594 169697 gene locus_tag LOCUS_06530 gene dnaN 168594 169697 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681136.1 protein_id gnl|my_center|LOCUS_06530 169697 170809 gene locus_tag LOCUS_06540 gene recF 169697 170809 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681135.1 protein_id gnl|my_center|LOCUS_06540 170802 171371 gene locus_tag LOCUS_06550 170802 171371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 171464 171619 gene locus_tag LOCUS_06560 gene rpmH 171464 171619 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557032.1 protein_id gnl|my_center|LOCUS_06560 171640 172002 gene locus_tag LOCUS_06570 171640 172002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 172239 174032 gene locus_tag LOCUS_06580 gene yidC 172239 174032 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680325.1 protein_id gnl|my_center|LOCUS_06580 174034 174735 gene locus_tag LOCUS_06590 174034 174735 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667657.1 protein_id gnl|my_center|LOCUS_06590 174768 175586 gene locus_tag LOCUS_06600 174768 175586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 175684 176667 gene locus_tag LOCUS_06610 175684 176667 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680321.1 protein_id gnl|my_center|LOCUS_06610 176762 177610 gene locus_tag LOCUS_06620 gene rocF 176762 177610 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711572.1 protein_id gnl|my_center|LOCUS_06620 178293 177718 gene locus_tag LOCUS_06630 178293 177718 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083238.1 protein_id gnl|my_center|LOCUS_06630 180212 178323 gene locus_tag LOCUS_06640 180212 178323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 182064 180379 gene locus_tag LOCUS_06650 182064 180379 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817202.1 protein_id gnl|my_center|LOCUS_06650 182343 183917 gene locus_tag LOCUS_06660 182343 183917 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082429.1 protein_id gnl|my_center|LOCUS_06660 184006 185298 gene locus_tag LOCUS_06670 184006 185298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 185304 186287 gene locus_tag LOCUS_06680 185304 186287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 187021 186314 gene locus_tag LOCUS_06690 187021 186314 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869391.1 protein_id gnl|my_center|LOCUS_06690 187811 187014 gene locus_tag LOCUS_06700 187811 187014 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773590.1 protein_id gnl|my_center|LOCUS_06700 188891 187815 gene locus_tag LOCUS_06710 188891 187815 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869389.1 protein_id gnl|my_center|LOCUS_06710 189813 188899 gene locus_tag LOCUS_06720 189813 188899 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869388.1 protein_id gnl|my_center|LOCUS_06720 191114 189957 gene locus_tag LOCUS_06730 191114 189957 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869387.1 protein_id gnl|my_center|LOCUS_06730 191340 192275 gene locus_tag LOCUS_06740 gene cysK 191340 192275 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_06740 192879 192469 gene locus_tag LOCUS_06750 192879 192469 CDS product type II toxin-antitoxin system toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073053.1 protein_id gnl|my_center|LOCUS_06750 193273 192872 gene locus_tag LOCUS_06760 193273 192872 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065983.1 protein_id gnl|my_center|LOCUS_06760 193696 193442 gene locus_tag LOCUS_06770 193696 193442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 193962 193720 gene locus_tag LOCUS_06780 193962 193720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 194953 194012 gene locus_tag LOCUS_06790 194953 194012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 195803 195156 gene locus_tag LOCUS_06800 gene yfcE 195803 195156 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966036.1 protein_id gnl|my_center|LOCUS_06800 196624 195854 gene locus_tag LOCUS_06810 196624 195854 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957298.1 protein_id gnl|my_center|LOCUS_06810 197077 196649 gene locus_tag LOCUS_06820 197077 196649 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_06820 197948 197151 gene locus_tag LOCUS_06830 gene proC 197948 197151 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966526.1 protein_id gnl|my_center|LOCUS_06830 198818 197958 gene locus_tag LOCUS_06840 198818 197958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 200104 198815 gene locus_tag LOCUS_06850 200104 198815 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262086.1 protein_id gnl|my_center|LOCUS_06850 200654 200109 gene locus_tag LOCUS_06860 200654 200109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666906.1 protein_id gnl|my_center|LOCUS_06860 200851 202065 gene locus_tag LOCUS_06870 200851 202065 CDS product DUF3798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868876.1 protein_id gnl|my_center|LOCUS_06870 202233 203819 gene locus_tag LOCUS_06880 202233 203819 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868877.1 protein_id gnl|my_center|LOCUS_06880 203816 204862 gene locus_tag LOCUS_06890 203816 204862 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868878.1 protein_id gnl|my_center|LOCUS_06890 204859 205959 gene locus_tag LOCUS_06900 204859 205959 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868879.1 protein_id gnl|my_center|LOCUS_06900 206090 206641 gene locus_tag LOCUS_06910 206090 206641 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263481.1 protein_id gnl|my_center|LOCUS_06910 206729 207763 gene locus_tag LOCUS_06920 206729 207763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 207901 208164 gene locus_tag LOCUS_06930 207901 208164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 208383 208757 gene locus_tag LOCUS_06940 208383 208757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 211271 208923 gene locus_tag LOCUS_06950 211271 208923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 213067 211268 gene locus_tag LOCUS_06960 213067 211268 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680776.1 protein_id gnl|my_center|LOCUS_06960 214963 213251 gene locus_tag LOCUS_06970 214963 213251 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680894.1 protein_id gnl|my_center|LOCUS_06970 215130 215969 gene locus_tag LOCUS_06980 215130 215969 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_06980 216281 218422 gene locus_tag LOCUS_06990 216281 218422 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948404.1 protein_id gnl|my_center|LOCUS_06990 218589 219890 gene locus_tag LOCUS_07000 218589 219890 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958607.1 protein_id gnl|my_center|LOCUS_07000 220932 220222 gene locus_tag LOCUS_07010 220932 220222 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957169.1 protein_id gnl|my_center|LOCUS_07010 221120 223012 gene locus_tag LOCUS_07020 221120 223012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 224585 223056 gene locus_tag LOCUS_07030 224585 223056 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678947.1 protein_id gnl|my_center|LOCUS_07030 225294 224674 gene locus_tag LOCUS_07040 225294 224674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 226181 225309 gene locus_tag LOCUS_07050 gene uppP 226181 225309 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681055.1 protein_id gnl|my_center|LOCUS_07050 228598 226331 gene locus_tag LOCUS_07060 228598 226331 CDS product TIGR03545 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957002.1 protein_id gnl|my_center|LOCUS_07060 229126 228611 gene locus_tag LOCUS_07070 229126 228611 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679252.1 protein_id gnl|my_center|LOCUS_07070 229385 230287 gene locus_tag LOCUS_07080 229385 230287 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680076.1 protein_id gnl|my_center|LOCUS_07080 230474 241114 gene locus_tag LOCUS_07090 230474 241114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 241286 242263 gene locus_tag LOCUS_07100 241286 242263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_07100 242284 243135 gene locus_tag LOCUS_07110 242284 243135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 244523 243132 gene locus_tag LOCUS_07120 244523 243132 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209169.1 protein_id gnl|my_center|LOCUS_07120 244932 245645 gene locus_tag LOCUS_07130 244932 245645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 247121 245730 gene locus_tag LOCUS_07140 247121 245730 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666804.1 protein_id gnl|my_center|LOCUS_07140 247357 247962 gene locus_tag LOCUS_07150 247357 247962 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682263.1 protein_id gnl|my_center|LOCUS_07150 247987 248691 gene locus_tag LOCUS_07160 247987 248691 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680496.1 protein_id gnl|my_center|LOCUS_07160 248682 249578 gene locus_tag LOCUS_07170 248682 249578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 251583 249682 gene locus_tag LOCUS_07180 251583 249682 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171063.1 protein_id gnl|my_center|LOCUS_07180 253967 251760 gene locus_tag LOCUS_07190 253967 251760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 254220 259688 gene locus_tag LOCUS_07200 254220 259688 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679951.1 protein_id gnl|my_center|LOCUS_07200 259942 259703 gene locus_tag LOCUS_07210 259942 259703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 260112 261590 gene locus_tag LOCUS_07220 260112 261590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 261658 262134 gene locus_tag LOCUS_07230 261658 262134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 >Feature sequence04 <1 559 gene locus_tag LOCUS_07240 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680159.1:formylglycine-generating enzyme family protein 1208 2023 gene locus_tag LOCUS_07250 1208 2023 CDS product nitrogenase iron protein NifH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948411.1 protein_id gnl|my_center|LOCUS_07250 2020 3276 gene locus_tag LOCUS_07260 2020 3276 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812494.1 protein_id gnl|my_center|LOCUS_07260 3273 4475 gene locus_tag LOCUS_07270 3273 4475 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272909.1 protein_id gnl|my_center|LOCUS_07270 4543 5652 gene locus_tag LOCUS_07280 4543 5652 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495003.1 protein_id gnl|my_center|LOCUS_07280 5675 6778 gene locus_tag LOCUS_07290 5675 6778 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495003.1 protein_id gnl|my_center|LOCUS_07290 6910 8016 gene locus_tag LOCUS_07300 6910 8016 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104373281.1 protein_id gnl|my_center|LOCUS_07300 8013 9020 gene locus_tag LOCUS_07310 8013 9020 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627760.1 protein_id gnl|my_center|LOCUS_07310 9020 9808 gene locus_tag LOCUS_07320 9020 9808 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367330.1 protein_id gnl|my_center|LOCUS_07320 10024 10218 gene locus_tag LOCUS_07330 10024 10218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 12205 10154 gene locus_tag LOCUS_07340 12205 10154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 12440 17362 gene locus_tag LOCUS_07350 12440 17362 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679398.1 protein_id gnl|my_center|LOCUS_07350 17506 18999 gene locus_tag LOCUS_07360 17506 18999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679186.1 protein_id gnl|my_center|LOCUS_07360 19144 20409 gene locus_tag LOCUS_07370 19144 20409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 20739 22832 gene locus_tag LOCUS_07380 gene fusA 20739 22832 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 protein_id gnl|my_center|LOCUS_07380 23000 23683 gene locus_tag LOCUS_07390 23000 23683 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675739.1 protein_id gnl|my_center|LOCUS_07390 23740 28467 gene locus_tag LOCUS_07400 23740 28467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 29782 28559 gene locus_tag LOCUS_07410 29782 28559 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087257.1 protein_id gnl|my_center|LOCUS_07410 30814 29801 gene locus_tag LOCUS_07420 30814 29801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 31047 33056 gene locus_tag LOCUS_07430 31047 33056 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957152.1 protein_id gnl|my_center|LOCUS_07430 34514 33063 gene locus_tag LOCUS_07440 34514 33063 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679249.1 protein_id gnl|my_center|LOCUS_07440 35844 34534 gene locus_tag LOCUS_07450 35844 34534 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680951.1 protein_id gnl|my_center|LOCUS_07450 36053 37765 gene locus_tag LOCUS_07460 gene ilvB 36053 37765 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094808.1 protein_id gnl|my_center|LOCUS_07460 38390 37758 gene locus_tag LOCUS_07470 38390 37758 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670667.1 protein_id gnl|my_center|LOCUS_07470 39544 38411 gene locus_tag LOCUS_07480 39544 38411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 39715 40518 gene locus_tag LOCUS_07490 39715 40518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 40635 41093 gene locus_tag LOCUS_07500 40635 41093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 42861 41353 gene locus_tag LOCUS_07510 42861 41353 CDS product glycine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680713.1 protein_id gnl|my_center|LOCUS_07510 43136 43223 gene locus_tag LOCUS_t00190 43136 43223 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 43339 44166 gene locus_tag LOCUS_07520 43339 44166 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679808.1 protein_id gnl|my_center|LOCUS_07520 46131 44281 gene locus_tag LOCUS_07530 46131 44281 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682136.1 protein_id gnl|my_center|LOCUS_07530 46715 46143 gene locus_tag LOCUS_07540 46715 46143 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814293.1 protein_id gnl|my_center|LOCUS_07540 47911 46721 gene locus_tag LOCUS_07550 47911 46721 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682269.1 protein_id gnl|my_center|LOCUS_07550 48239 48985 gene locus_tag LOCUS_07560 48239 48985 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668967.1 protein_id gnl|my_center|LOCUS_07560 49308 50429 gene locus_tag LOCUS_07570 gene ugpC 49308 50429 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_07570 50570 52462 gene locus_tag LOCUS_07580 50570 52462 CDS product ribonuclease catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678953.1 protein_id gnl|my_center|LOCUS_07580 52464 53669 gene locus_tag LOCUS_07590 gene mnmA 52464 53669 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256566.1 protein_id gnl|my_center|LOCUS_07590 53889 54689 gene locus_tag LOCUS_07600 53889 54689 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099728.1 protein_id gnl|my_center|LOCUS_07600 55556 54693 gene locus_tag LOCUS_07610 55556 54693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679630.1 protein_id gnl|my_center|LOCUS_07610 56640 55579 gene locus_tag LOCUS_07620 56640 55579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 56673 57092 gene locus_tag LOCUS_07630 56673 57092 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674983.1 protein_id gnl|my_center|LOCUS_07630 57146 57811 gene locus_tag LOCUS_07640 57146 57811 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682388.1 protein_id gnl|my_center|LOCUS_07640 59189 57963 gene locus_tag LOCUS_07650 59189 57963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679110.1 protein_id gnl|my_center|LOCUS_07650 59218 59862 gene locus_tag LOCUS_07660 59218 59862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 59947 62946 gene locus_tag LOCUS_07670 gene uvrA 59947 62946 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956862.1 protein_id gnl|my_center|LOCUS_07670 63053 66394 gene locus_tag LOCUS_07680 63053 66394 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682325.1 protein_id gnl|my_center|LOCUS_07680 66689 67621 gene locus_tag LOCUS_07690 66689 67621 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678733.1 protein_id gnl|my_center|LOCUS_07690 67611 69374 gene locus_tag LOCUS_07700 67611 69374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 69367 69849 gene locus_tag LOCUS_07710 gene ybeY 69367 69849 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668517.1 protein_id gnl|my_center|LOCUS_07710 69861 70670 gene locus_tag LOCUS_07720 69861 70670 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678735.1 protein_id gnl|my_center|LOCUS_07720 70774 72795 gene locus_tag LOCUS_07730 70774 72795 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678736.1 protein_id gnl|my_center|LOCUS_07730 73872 72964 gene locus_tag LOCUS_07740 73872 72964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 73907 74257 gene locus_tag LOCUS_07750 73907 74257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668328.1 protein_id gnl|my_center|LOCUS_07750 74333 75418 gene locus_tag LOCUS_07760 gene prfB 74333 75418 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096641376.1 protein_id gnl|my_center|LOCUS_07760 75471 77132 gene locus_tag LOCUS_07770 75471 77132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 77152 78024 gene locus_tag LOCUS_07780 gene ftsY 77152 78024 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668333.1 protein_id gnl|my_center|LOCUS_07780 78028 79242 gene locus_tag LOCUS_07790 78028 79242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 79361 80536 gene locus_tag LOCUS_07800 79361 80536 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679815.1 protein_id gnl|my_center|LOCUS_07800 80529 81230 gene locus_tag LOCUS_07810 80529 81230 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668339.1 protein_id gnl|my_center|LOCUS_07810 81227 82558 gene locus_tag LOCUS_07820 81227 82558 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679814.1 protein_id gnl|my_center|LOCUS_07820 82661 83107 gene locus_tag LOCUS_07830 82661 83107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 83094 84185 gene locus_tag LOCUS_07840 83094 84185 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966467.1 protein_id gnl|my_center|LOCUS_07840 84202 86808 gene locus_tag LOCUS_07850 84202 86808 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889239.1 protein_id gnl|my_center|LOCUS_07850 86907 87914 gene locus_tag LOCUS_07860 86907 87914 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948969.1 protein_id gnl|my_center|LOCUS_07860 88298 88032 gene locus_tag LOCUS_07870 88298 88032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 88279 88659 gene locus_tag LOCUS_07880 88279 88659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 88652 89374 gene locus_tag LOCUS_07890 88652 89374 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437066.1 protein_id gnl|my_center|LOCUS_07890 89400 90011 gene locus_tag LOCUS_07900 89400 90011 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679200.1 protein_id gnl|my_center|LOCUS_07900 90008 92095 gene locus_tag LOCUS_07910 90008 92095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 92101 92685 gene locus_tag LOCUS_07920 92101 92685 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956988.1 protein_id gnl|my_center|LOCUS_07920 93117 92692 gene locus_tag LOCUS_07930 93117 92692 CDS product PUR family DNA/RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672091.1 protein_id gnl|my_center|LOCUS_07930 95121 93904 gene locus_tag LOCUS_07940 95121 93904 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680952.1 protein_id gnl|my_center|LOCUS_07940 95768 95139 gene locus_tag LOCUS_07950 95768 95139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680583.1 protein_id gnl|my_center|LOCUS_07950 96382 95765 gene locus_tag LOCUS_07960 gene tmk 96382 95765 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957272.1 protein_id gnl|my_center|LOCUS_07960 96951 96574 gene locus_tag LOCUS_07970 96951 96574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 96896 100828 gene locus_tag LOCUS_07980 96896 100828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680585.1 protein_id gnl|my_center|LOCUS_07980 100861 103287 gene locus_tag LOCUS_07990 gene bamA 100861 103287 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667239.1 protein_id gnl|my_center|LOCUS_07990 103524 104051 gene locus_tag LOCUS_08000 103524 104051 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667237.1 protein_id gnl|my_center|LOCUS_08000 104056 106641 gene locus_tag LOCUS_08010 gene mutS 104056 106641 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920616.1 protein_id gnl|my_center|LOCUS_08010 106862 107290 gene locus_tag LOCUS_08020 gene rplM 106862 107290 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682116.1 protein_id gnl|my_center|LOCUS_08020 107305 107697 gene locus_tag LOCUS_08030 gene rpsI 107305 107697 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682117.1 protein_id gnl|my_center|LOCUS_08030 107700 108302 gene locus_tag LOCUS_08040 107700 108302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 109362 108409 gene locus_tag LOCUS_08050 gene sppA 109362 108409 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989751.1 protein_id gnl|my_center|LOCUS_08050 110132 109404 gene locus_tag LOCUS_08060 110132 109404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 111142 110483 gene locus_tag LOCUS_08070 111142 110483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 111204 111725 gene locus_tag LOCUS_08080 111204 111725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 111673 112182 gene locus_tag LOCUS_08090 111673 112182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 112601 114034 gene locus_tag LOCUS_08100 112601 114034 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684564.1 protein_id gnl|my_center|LOCUS_08100 114046 114807 gene locus_tag LOCUS_08110 114046 114807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 116044 114800 gene locus_tag LOCUS_08120 116044 114800 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668533.1 protein_id gnl|my_center|LOCUS_08120 116600 117220 gene locus_tag LOCUS_08130 116600 117220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 117233 117907 gene locus_tag LOCUS_08140 117233 117907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 118414 118869 gene locus_tag LOCUS_08150 gene rimP 118414 118869 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670663.1 protein_id gnl|my_center|LOCUS_08150 118887 120368 gene locus_tag LOCUS_08160 gene nusA 118887 120368 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682413.1 protein_id gnl|my_center|LOCUS_08160 120383 122995 gene locus_tag LOCUS_08170 gene infB 120383 122995 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682412.1 protein_id gnl|my_center|LOCUS_08170 122964 123326 gene locus_tag LOCUS_08180 gene rbfA 122964 123326 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670660.1 protein_id gnl|my_center|LOCUS_08180 123319 124473 gene locus_tag LOCUS_08190 gene truB 123319 124473 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682411.1 protein_id gnl|my_center|LOCUS_08190 125819 124542 gene locus_tag LOCUS_08200 125819 124542 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_08200 126064 125991 gene locus_tag LOCUS_t00200 126064 125991 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 127201 126218 gene locus_tag LOCUS_08210 127201 126218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 128443 127217 gene locus_tag LOCUS_08220 128443 127217 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424103.1 protein_id gnl|my_center|LOCUS_08220 128667 130586 gene locus_tag LOCUS_08230 128667 130586 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679930.1 protein_id gnl|my_center|LOCUS_08230 131401 130793 gene locus_tag LOCUS_08240 gene coaE 131401 130793 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679322.1 protein_id gnl|my_center|LOCUS_08240 134265 131398 gene locus_tag LOCUS_08250 gene polA 134265 131398 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679321.1 protein_id gnl|my_center|LOCUS_08250 134726 134349 gene locus_tag LOCUS_08260 134726 134349 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681559.1 protein_id gnl|my_center|LOCUS_08260 134938 134726 gene locus_tag LOCUS_08270 134938 134726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 135618 135010 gene locus_tag LOCUS_08280 135618 135010 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680663.1 protein_id gnl|my_center|LOCUS_08280 135752 136753 gene locus_tag LOCUS_08290 135752 136753 CDS product TRAP transporter TatT component family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682338.1 protein_id gnl|my_center|LOCUS_08290 136800 137828 gene locus_tag LOCUS_08300 gene dctP 136800 137828 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682337.1 protein_id gnl|my_center|LOCUS_08300 137852 139681 gene locus_tag LOCUS_08310 137852 139681 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682335.1 protein_id gnl|my_center|LOCUS_08310 139720 141054 gene locus_tag LOCUS_08320 139720 141054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 141749 141078 gene locus_tag LOCUS_08330 141749 141078 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667037.1 protein_id gnl|my_center|LOCUS_08330 142719 141904 gene locus_tag LOCUS_08340 142719 141904 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_08340 142858 144120 gene locus_tag LOCUS_08350 142858 144120 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678712.1 protein_id gnl|my_center|LOCUS_08350 144113 144946 gene locus_tag LOCUS_08360 144113 144946 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679999.1 protein_id gnl|my_center|LOCUS_08360 145024 146283 gene locus_tag LOCUS_08370 145024 146283 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673537.1 protein_id gnl|my_center|LOCUS_08370 146767 146315 gene locus_tag LOCUS_08380 146767 146315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 147183 146881 gene locus_tag LOCUS_08390 147183 146881 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668137.1 protein_id gnl|my_center|LOCUS_08390 147536 147183 gene locus_tag LOCUS_08400 147536 147183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 147897 147538 gene locus_tag LOCUS_08410 gene rplT 147897 147538 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668132.1 protein_id gnl|my_center|LOCUS_08410 148110 147910 gene locus_tag LOCUS_08420 gene rpmI 148110 147910 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679992.1 protein_id gnl|my_center|LOCUS_08420 148654 148091 gene locus_tag LOCUS_08430 gene infC 148654 148091 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668127.1 protein_id gnl|my_center|LOCUS_08430 148799 149470 gene locus_tag LOCUS_08440 148799 149470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 150575 149544 gene locus_tag LOCUS_08450 150575 149544 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798895.1 protein_id gnl|my_center|LOCUS_08450 151183 151617 gene locus_tag LOCUS_08460 151183 151617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 151632 153506 gene locus_tag LOCUS_08470 gene flgK 151632 153506 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957216.1 protein_id gnl|my_center|LOCUS_08470 153606 154850 gene locus_tag LOCUS_08480 153606 154850 CDS product flagellar hook-associated protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680271.1 protein_id gnl|my_center|LOCUS_08480 154870 155316 gene locus_tag LOCUS_08490 154870 155316 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674247.1 protein_id gnl|my_center|LOCUS_08490 155317 155541 gene locus_tag LOCUS_08500 gene csrA 155317 155541 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667708.1 protein_id gnl|my_center|LOCUS_08500 156605 155727 gene locus_tag LOCUS_08510 156605 155727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 157230 156742 gene locus_tag LOCUS_08520 gene tsaE 157230 156742 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679136.1 protein_id gnl|my_center|LOCUS_08520 157490 157230 gene locus_tag LOCUS_08530 157490 157230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 158615 157530 gene locus_tag LOCUS_08540 158615 157530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 159204 158605 gene locus_tag LOCUS_08550 159204 158605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 161284 159224 gene locus_tag LOCUS_08560 gene fliD 161284 159224 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679139.1 protein_id gnl|my_center|LOCUS_08560 161698 161312 gene locus_tag LOCUS_08570 161698 161312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 162653 161805 gene locus_tag LOCUS_08580 162653 161805 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668950.1 protein_id gnl|my_center|LOCUS_08580 163792 162932 gene locus_tag LOCUS_08590 163792 162932 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668952.1 protein_id gnl|my_center|LOCUS_08590 164897 164250 gene locus_tag LOCUS_08600 gene rdgB 164897 164250 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957197.1 protein_id gnl|my_center|LOCUS_08600 165863 164964 gene locus_tag LOCUS_08610 165863 164964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 165991 166173 gene locus_tag LOCUS_08620 165991 166173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 167072 166086 gene locus_tag LOCUS_08630 167072 166086 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679142.1 protein_id gnl|my_center|LOCUS_08630 167525 167094 gene locus_tag LOCUS_08640 167525 167094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 168518 167574 gene locus_tag LOCUS_08650 gene argF 168518 167574 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080343.1 protein_id gnl|my_center|LOCUS_08650 168790 168716 gene locus_tag LOCUS_t00210 168790 168716 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 170019 169174 gene locus_tag LOCUS_08660 170019 169174 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669614.1 protein_id gnl|my_center|LOCUS_08660 170557 170003 gene locus_tag LOCUS_08670 170557 170003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 172881 170764 gene locus_tag LOCUS_08680 172881 170764 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678883.1 protein_id gnl|my_center|LOCUS_08680 173341 172874 gene locus_tag LOCUS_08690 gene nrdR 173341 172874 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678882.1 protein_id gnl|my_center|LOCUS_08690 175589 173442 gene locus_tag LOCUS_08700 gene lnt 175589 173442 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680216.1 protein_id gnl|my_center|LOCUS_08700 175619 176809 gene locus_tag LOCUS_08710 175619 176809 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667821.1 protein_id gnl|my_center|LOCUS_08710 176825 177592 gene locus_tag LOCUS_08720 gene surE 176825 177592 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545452.1 protein_id gnl|my_center|LOCUS_08720 177615 178319 gene locus_tag LOCUS_08730 177615 178319 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680214.1 protein_id gnl|my_center|LOCUS_08730 178323 180395 gene locus_tag LOCUS_08740 178323 180395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680210.1 protein_id gnl|my_center|LOCUS_08740 186381 180433 gene locus_tag LOCUS_08750 186381 180433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 188144 186378 gene locus_tag LOCUS_08760 188144 186378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 188463 189629 gene locus_tag LOCUS_08770 188463 189629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670701.1 protein_id gnl|my_center|LOCUS_08770 189703 190269 gene locus_tag LOCUS_08780 189703 190269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 190288 190986 gene locus_tag LOCUS_08790 gene trmB 190288 190986 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956879.1 protein_id gnl|my_center|LOCUS_08790 191044 192984 gene locus_tag LOCUS_08800 gene ligA 191044 192984 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679195.1 protein_id gnl|my_center|LOCUS_08800 193070 193687 gene locus_tag LOCUS_08810 193070 193687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 194807 193827 gene locus_tag LOCUS_08820 194807 193827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 196962 194827 gene locus_tag LOCUS_08830 gene recJ 196962 194827 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680035.1 protein_id gnl|my_center|LOCUS_08830 198354 197008 gene locus_tag LOCUS_08840 198354 197008 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680036.1 protein_id gnl|my_center|LOCUS_08840 199151 198351 gene locus_tag LOCUS_08850 199151 198351 CDS product DNA repair protein RecO C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681503.1 protein_id gnl|my_center|LOCUS_08850 200452 199604 gene locus_tag LOCUS_08860 200452 199604 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669815.1 protein_id gnl|my_center|LOCUS_08860 200837 201031 gene locus_tag LOCUS_08870 200837 201031 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666823.1 protein_id gnl|my_center|LOCUS_08870 201551 203422 gene locus_tag LOCUS_08880 gene dxs 201551 203422 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957098.1 protein_id gnl|my_center|LOCUS_08880 203419 204246 gene locus_tag LOCUS_08890 gene folP 203419 204246 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545277.1 protein_id gnl|my_center|LOCUS_08890 204297 205112 gene locus_tag LOCUS_08900 gene cdaA 204297 205112 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669723.1 protein_id gnl|my_center|LOCUS_08900 205090 206073 gene locus_tag LOCUS_08910 205090 206073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 206070 206444 gene locus_tag LOCUS_08920 206070 206444 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679605.1 protein_id gnl|my_center|LOCUS_08920 206492 207373 gene locus_tag LOCUS_08930 206492 207373 CDS product DUF2225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667865.1 protein_id gnl|my_center|LOCUS_08930 207404 208195 gene locus_tag LOCUS_08940 gene truA 207404 208195 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667863.1 protein_id gnl|my_center|LOCUS_08940 208348 210102 gene locus_tag LOCUS_08950 gene lepB 208348 210102 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680071.1 protein_id gnl|my_center|LOCUS_08950 210242 212110 gene locus_tag LOCUS_08960 210242 212110 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044971525.1 protein_id gnl|my_center|LOCUS_08960 212107 213567 gene locus_tag LOCUS_08970 212107 213567 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680998.1 protein_id gnl|my_center|LOCUS_08970 213564 213965 gene locus_tag LOCUS_08980 213564 213965 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680676.1 protein_id gnl|my_center|LOCUS_08980 214057 215796 gene locus_tag LOCUS_08990 214057 215796 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681003.1 protein_id gnl|my_center|LOCUS_08990 215806 217359 gene locus_tag LOCUS_09000 215806 217359 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109491.1 protein_id gnl|my_center|LOCUS_09000 217449 218549 gene locus_tag LOCUS_09010 217449 218549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 219041 218760 gene locus_tag LOCUS_09020 219041 218760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 219291 220235 gene locus_tag LOCUS_09030 219291 220235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 220400 220786 gene locus_tag LOCUS_09040 220400 220786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 220928 221170 gene locus_tag LOCUS_09050 220928 221170 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587616.1 protein_id gnl|my_center|LOCUS_09050 221170 221430 gene locus_tag LOCUS_09060 221170 221430 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 protein_id gnl|my_center|LOCUS_09060 221538 222032 gene locus_tag LOCUS_09070 221538 222032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09070 222162 222986 gene locus_tag LOCUS_09080 222162 222986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09080 223322 223483 gene locus_tag LOCUS_09090 223322 223483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 223819 224178 gene locus_tag LOCUS_09100 223819 224178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09100 224163 224336 gene locus_tag LOCUS_09110 224163 224336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09110 224320 224589 gene locus_tag LOCUS_09120 224320 224589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 224682 224915 gene locus_tag LOCUS_09130 224682 224915 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443825.1 protein_id gnl|my_center|LOCUS_09130 224909 225247 gene locus_tag LOCUS_09140 gene mazF 224909 225247 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240418.1 protein_id gnl|my_center|LOCUS_09140 225357 225731 gene locus_tag LOCUS_09150 225357 225731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 225889 226089 gene locus_tag LOCUS_09160 225889 226089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 227951 226029 gene locus_tag LOCUS_09170 227951 226029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 229797 227932 gene locus_tag LOCUS_09180 229797 227932 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678847.1 protein_id gnl|my_center|LOCUS_09180 230306 229794 gene locus_tag LOCUS_09190 gene lepB 230306 229794 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956947.1 protein_id gnl|my_center|LOCUS_09190 230352 231530 gene locus_tag LOCUS_09200 230352 231530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 231590 231853 gene locus_tag LOCUS_09210 231590 231853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 231850 234048 gene locus_tag LOCUS_09220 231850 234048 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957228.1 protein_id gnl|my_center|LOCUS_09220 235496 234057 gene locus_tag LOCUS_09230 235496 234057 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682292.1 protein_id gnl|my_center|LOCUS_09230 237195 236005 gene locus_tag LOCUS_09240 237195 236005 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948034.1 protein_id gnl|my_center|LOCUS_09240 238496 237219 gene locus_tag LOCUS_09250 238496 237219 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_09250 238729 239637 gene locus_tag LOCUS_09260 gene dapA 238729 239637 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869742.1 protein_id gnl|my_center|LOCUS_09260 239763 240863 gene locus_tag LOCUS_09270 gene asd 239763 240863 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699652.1 protein_id gnl|my_center|LOCUS_09270 240921 241718 gene locus_tag LOCUS_09280 240921 241718 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897160.1 protein_id gnl|my_center|LOCUS_09280 242604 241891 gene locus_tag LOCUS_09290 242604 241891 CDS product late competence development ComFB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668791.1 protein_id gnl|my_center|LOCUS_09290 244653 242629 gene locus_tag LOCUS_09300 244653 242629 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881159.1 protein_id gnl|my_center|LOCUS_09300 >Feature sequence05 <1 1333 gene locus_tag LOCUS_09310 <1 1333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010956992.1:toxin TcdB middle/N-terminal domain-containing protein 1338 1631 gene locus_tag LOCUS_09320 1338 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 1685 2215 gene locus_tag LOCUS_09330 1685 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 2212 3111 gene locus_tag LOCUS_09340 2212 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 3257 4348 gene locus_tag LOCUS_09350 3257 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 4850 4984 gene locus_tag LOCUS_09360 4850 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 5287 6084 gene locus_tag LOCUS_09370 gene flgF 5287 6084 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671871.1 protein_id gnl|my_center|LOCUS_09370 6111 6905 gene locus_tag LOCUS_09380 gene flgG 6111 6905 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670463.1 protein_id gnl|my_center|LOCUS_09380 6944 7471 gene locus_tag LOCUS_09390 6944 7471 CDS product rod-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682322.1 protein_id gnl|my_center|LOCUS_09390 7748 9871 gene locus_tag LOCUS_09400 7748 9871 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681061.1 protein_id gnl|my_center|LOCUS_09400 9822 10253 gene locus_tag LOCUS_09410 9822 10253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 10302 11387 gene locus_tag LOCUS_09420 gene trpS 10302 11387 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004573597.1 protein_id gnl|my_center|LOCUS_09420 11799 12326 gene locus_tag LOCUS_09430 11799 12326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 12397 12873 gene locus_tag LOCUS_09440 12397 12873 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669135.1 protein_id gnl|my_center|LOCUS_09440 13360 14400 gene locus_tag LOCUS_09450 13360 14400 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679269.1 protein_id gnl|my_center|LOCUS_09450 14412 15260 gene locus_tag LOCUS_09460 14412 15260 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679270.1 protein_id gnl|my_center|LOCUS_09460 15253 17013 gene locus_tag LOCUS_09470 gene recN 15253 17013 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678799.1 protein_id gnl|my_center|LOCUS_09470 17026 17829 gene locus_tag LOCUS_09480 17026 17829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668611.1 protein_id gnl|my_center|LOCUS_09480 17832 19049 gene locus_tag LOCUS_09490 17832 19049 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671534.1 protein_id gnl|my_center|LOCUS_09490 19155 20033 gene locus_tag LOCUS_09500 19155 20033 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678797.1 protein_id gnl|my_center|LOCUS_09500 20355 21893 gene locus_tag LOCUS_09510 20355 21893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 22042 22194 gene locus_tag LOCUS_09520 22042 22194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 22454 24073 gene locus_tag LOCUS_09530 22454 24073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 24063 25526 gene locus_tag LOCUS_09540 24063 25526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 25529 27124 gene locus_tag LOCUS_09550 25529 27124 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724033.1 protein_id gnl|my_center|LOCUS_09550 27126 28007 gene locus_tag LOCUS_09560 27126 28007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 27991 28809 gene locus_tag LOCUS_09570 27991 28809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 28806 30266 gene locus_tag LOCUS_09580 28806 30266 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268118.1 protein_id gnl|my_center|LOCUS_09580 30931 30350 gene locus_tag LOCUS_09590 30931 30350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 32699 30915 gene locus_tag LOCUS_09600 32699 30915 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679748.1 protein_id gnl|my_center|LOCUS_09600 32902 34146 gene locus_tag LOCUS_09610 gene tyrS 32902 34146 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682133.1 protein_id gnl|my_center|LOCUS_09610 35779 34250 gene locus_tag LOCUS_09620 35779 34250 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_09620 36095 35865 gene locus_tag LOCUS_09630 36095 35865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 37845 36106 gene locus_tag LOCUS_09640 37845 36106 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109303.1 protein_id gnl|my_center|LOCUS_09640 37990 38970 gene locus_tag LOCUS_09650 37990 38970 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_09650 40590 39418 gene locus_tag LOCUS_09660 40590 39418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 40801 41097 gene locus_tag LOCUS_09670 gene rpsT 40801 41097 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669392.1 protein_id gnl|my_center|LOCUS_09670 41268 41585 gene locus_tag LOCUS_09680 41268 41585 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002655986.1 protein_id gnl|my_center|LOCUS_09680 41582 43315 gene locus_tag LOCUS_09690 gene lnt 41582 43315 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679415.1 protein_id gnl|my_center|LOCUS_09690 43389 43814 gene locus_tag LOCUS_09700 43389 43814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 43980 45683 gene locus_tag LOCUS_09710 gene rho 43980 45683 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668994.1 protein_id gnl|my_center|LOCUS_09710 45789 45998 gene locus_tag LOCUS_09720 gene rpmE 45789 45998 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_09720 47333 46026 gene locus_tag LOCUS_09730 47333 46026 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679607.1 protein_id gnl|my_center|LOCUS_09730 47513 49351 gene locus_tag LOCUS_09740 47513 49351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 49850 50212 gene locus_tag LOCUS_09750 49850 50212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 50627 50271 gene locus_tag LOCUS_09760 50627 50271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 50877 50596 gene locus_tag LOCUS_09770 50877 50596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016525351.1 protein_id gnl|my_center|LOCUS_09770 51096 50890 gene locus_tag LOCUS_09780 51096 50890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 51084 51332 gene locus_tag LOCUS_09790 51084 51332 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666876.1 protein_id gnl|my_center|LOCUS_09790 51329 51733 gene locus_tag LOCUS_09800 51329 51733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956671.1 protein_id gnl|my_center|LOCUS_09800 51793 53436 gene locus_tag LOCUS_09810 51793 53436 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669145.1 protein_id gnl|my_center|LOCUS_09810 53439 54182 gene locus_tag LOCUS_09820 53439 54182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 54348 55379 gene locus_tag LOCUS_09830 54348 55379 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044971464.1 protein_id gnl|my_center|LOCUS_09830 55511 56077 gene locus_tag LOCUS_09840 55511 56077 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682399.1 protein_id gnl|my_center|LOCUS_09840 56074 56901 gene locus_tag LOCUS_09850 56074 56901 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942258.1 protein_id gnl|my_center|LOCUS_09850 57750 56941 gene locus_tag LOCUS_09860 57750 56941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 59201 57951 gene locus_tag LOCUS_09870 59201 57951 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854063.1 protein_id gnl|my_center|LOCUS_09870 59798 59265 gene locus_tag LOCUS_09880 59798 59265 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942547.1 protein_id gnl|my_center|LOCUS_09880 62060 59958 gene locus_tag LOCUS_09890 62060 59958 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680511.1 protein_id gnl|my_center|LOCUS_09890 63801 62515 gene locus_tag LOCUS_09900 63801 62515 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942548.1 protein_id gnl|my_center|LOCUS_09900 64179 63970 gene locus_tag LOCUS_09910 64179 63970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 65244 64222 gene locus_tag LOCUS_09920 gene rlmN 65244 64222 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679871.1 protein_id gnl|my_center|LOCUS_09920 66416 65253 gene locus_tag LOCUS_09930 66416 65253 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679870.1 protein_id gnl|my_center|LOCUS_09930 66912 66565 gene locus_tag LOCUS_09940 66912 66565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668283.1 protein_id gnl|my_center|LOCUS_09940 67641 67099 gene locus_tag LOCUS_09950 gene rsmD 67641 67099 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669684.1 protein_id gnl|my_center|LOCUS_09950 69374 67641 gene locus_tag LOCUS_09960 69374 67641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 69482 69775 gene locus_tag LOCUS_09970 gene rpsF 69482 69775 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669351.1 protein_id gnl|my_center|LOCUS_09970 69802 70269 gene locus_tag LOCUS_09980 gene ssb 69802 70269 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669349.1 protein_id gnl|my_center|LOCUS_09980 70296 70658 gene locus_tag LOCUS_09990 70296 70658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 70775 71350 gene locus_tag LOCUS_10000 gene rplI 70775 71350 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679371.1 protein_id gnl|my_center|LOCUS_10000 71518 72846 gene locus_tag LOCUS_10010 71518 72846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 72853 73344 gene locus_tag LOCUS_10020 72853 73344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 73344 74570 gene locus_tag LOCUS_10030 73344 74570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 74567 75850 gene locus_tag LOCUS_10040 74567 75850 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679701.1 protein_id gnl|my_center|LOCUS_10040 75847 77202 gene locus_tag LOCUS_10050 75847 77202 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_10050 78017 77340 gene locus_tag LOCUS_10060 78017 77340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 79312 78026 gene locus_tag LOCUS_10070 79312 78026 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674820.1 protein_id gnl|my_center|LOCUS_10070 81432 79561 gene locus_tag LOCUS_10080 81432 79561 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682151.1 protein_id gnl|my_center|LOCUS_10080 82651 81509 gene locus_tag LOCUS_10090 82651 81509 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682145.1 protein_id gnl|my_center|LOCUS_10090 83382 82858 gene locus_tag LOCUS_10100 83382 82858 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902209.1 protein_id gnl|my_center|LOCUS_10100 83862 83473 gene locus_tag LOCUS_10110 83862 83473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 85284 84049 gene locus_tag LOCUS_10120 85284 84049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 85576 85352 gene locus_tag LOCUS_10130 85576 85352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373720.1 protein_id gnl|my_center|LOCUS_10130 86058 85576 gene locus_tag LOCUS_10140 86058 85576 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803082.1 protein_id gnl|my_center|LOCUS_10140 86270 86055 gene locus_tag LOCUS_10150 86270 86055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 86428 87285 gene locus_tag LOCUS_10160 86428 87285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 87613 87257 gene locus_tag LOCUS_10170 87613 87257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 90994 88769 gene locus_tag LOCUS_10180 90994 88769 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679969.1 protein_id gnl|my_center|LOCUS_10180 91278 91538 gene locus_tag LOCUS_10190 gene rpsP 91278 91538 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670213.1 protein_id gnl|my_center|LOCUS_10190 91549 91782 gene locus_tag LOCUS_10200 91549 91782 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670215.1 protein_id gnl|my_center|LOCUS_10200 91806 92387 gene locus_tag LOCUS_10210 91806 92387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 92391 93146 gene locus_tag LOCUS_10220 gene trmD 92391 93146 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670221.1 protein_id gnl|my_center|LOCUS_10220 93181 93639 gene locus_tag LOCUS_10230 93181 93639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 93652 94896 gene locus_tag LOCUS_10240 93652 94896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 95048 95299 gene locus_tag LOCUS_10250 95048 95299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 95313 95576 gene locus_tag LOCUS_10260 95313 95576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 95573 95941 gene locus_tag LOCUS_10270 95573 95941 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675753.1 protein_id gnl|my_center|LOCUS_10270 95938 96135 gene locus_tag LOCUS_10280 95938 96135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 96401 96661 gene locus_tag LOCUS_10290 96401 96661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 96771 99800 gene locus_tag LOCUS_10300 96771 99800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 100959 99910 gene locus_tag LOCUS_10310 100959 99910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 100928 101572 gene locus_tag LOCUS_10320 100928 101572 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005485135.1 protein_id gnl|my_center|LOCUS_10320 101788 103809 gene locus_tag LOCUS_10330 gene fusA 101788 103809 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681223.1 protein_id gnl|my_center|LOCUS_10330 103905 103986 gene locus_tag LOCUS_t00220 103905 103986 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 104057 104896 gene locus_tag LOCUS_10340 104057 104896 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939274.1 protein_id gnl|my_center|LOCUS_10340 105051 106148 gene locus_tag LOCUS_10350 105051 106148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 106353 106592 gene locus_tag LOCUS_10360 106353 106592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 106614 108701 gene locus_tag LOCUS_10370 gene oadA 106614 108701 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_10370 108712 110139 gene locus_tag LOCUS_10380 108712 110139 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348847.1 protein_id gnl|my_center|LOCUS_10380 110308 111255 gene locus_tag LOCUS_10390 110308 111255 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289735.1 protein_id gnl|my_center|LOCUS_10390 111429 111268 gene locus_tag LOCUS_10400 111429 111268 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869872.1 protein_id gnl|my_center|LOCUS_10400 111731 111656 gene locus_tag LOCUS_t00230 111731 111656 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 111860 113482 gene locus_tag LOCUS_10410 gene lysS 111860 113482 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680521.1 protein_id gnl|my_center|LOCUS_10410 114358 113525 gene locus_tag LOCUS_10420 114358 113525 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956847.1 protein_id gnl|my_center|LOCUS_10420 115307 114351 gene locus_tag LOCUS_10430 115307 114351 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682259.1 protein_id gnl|my_center|LOCUS_10430 116943 115285 gene locus_tag LOCUS_10440 gene lsrA 116943 115285 CDS product autoinducer 2 ABC transporter ATP-binding protein LsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194917.1 protein_id gnl|my_center|LOCUS_10440 117966 116953 gene locus_tag LOCUS_10450 117966 116953 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682256.1 protein_id gnl|my_center|LOCUS_10450 118092 119261 gene locus_tag LOCUS_10460 gene nagA 118092 119261 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889694.1 protein_id gnl|my_center|LOCUS_10460 119294 120100 gene locus_tag LOCUS_10470 gene nagB 119294 120100 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681305.1 protein_id gnl|my_center|LOCUS_10470 120078 120626 gene locus_tag LOCUS_10480 120078 120626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 120726 122282 gene locus_tag LOCUS_10490 120726 122282 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682348.1 protein_id gnl|my_center|LOCUS_10490 122279 123169 gene locus_tag LOCUS_10500 122279 123169 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066573.1 protein_id gnl|my_center|LOCUS_10500 123147 123704 gene locus_tag LOCUS_10510 gene ruvC 123147 123704 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679556.1 protein_id gnl|my_center|LOCUS_10510 123816 124430 gene locus_tag LOCUS_10520 gene ruvA 123816 124430 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679554.1 protein_id gnl|my_center|LOCUS_10520 124590 126749 gene locus_tag LOCUS_10530 124590 126749 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681324.1 protein_id gnl|my_center|LOCUS_10530 126798 127844 gene locus_tag LOCUS_10540 gene ruvB 126798 127844 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679608.1 protein_id gnl|my_center|LOCUS_10540 127941 128246 gene locus_tag LOCUS_10550 127941 128246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 128227 128679 gene locus_tag LOCUS_10560 128227 128679 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971025.1 protein_id gnl|my_center|LOCUS_10560 128774 129889 gene locus_tag LOCUS_10570 gene queA 128774 129889 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957235.1 protein_id gnl|my_center|LOCUS_10570 130237 129881 gene locus_tag LOCUS_10580 130237 129881 CDS product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766711.1 protein_id gnl|my_center|LOCUS_10580 131060 130254 gene locus_tag LOCUS_10590 gene xdhB 131060 130254 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393457.1 protein_id gnl|my_center|LOCUS_10590 131538 131050 gene locus_tag LOCUS_10600 131538 131050 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669971.1 protein_id gnl|my_center|LOCUS_10600 133604 131535 gene locus_tag LOCUS_10610 133604 131535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 134823 133597 gene locus_tag LOCUS_10620 134823 133597 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681964.1 protein_id gnl|my_center|LOCUS_10620 136486 134816 gene locus_tag LOCUS_10630 136486 134816 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681937.1 protein_id gnl|my_center|LOCUS_10630 136565 137671 gene locus_tag LOCUS_10640 136565 137671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 137664 138512 gene locus_tag LOCUS_10650 137664 138512 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262760.1 protein_id gnl|my_center|LOCUS_10650 138457 138987 gene locus_tag LOCUS_10660 gene flgB 138457 138987 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668460.1 protein_id gnl|my_center|LOCUS_10660 139006 139467 gene locus_tag LOCUS_10670 gene flgC 139006 139467 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671661.1 protein_id gnl|my_center|LOCUS_10670 139524 139883 gene locus_tag LOCUS_10680 gene fliE 139524 139883 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671660.1 protein_id gnl|my_center|LOCUS_10680 140009 141721 gene locus_tag LOCUS_10690 gene fliF 140009 141721 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678706.1 protein_id gnl|my_center|LOCUS_10690 141723 142835 gene locus_tag LOCUS_10700 gene fliG 141723 142835 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668469.1 protein_id gnl|my_center|LOCUS_10700 142865 143797 gene locus_tag LOCUS_10710 gene fliH 142865 143797 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668471.1 protein_id gnl|my_center|LOCUS_10710 143837 145246 gene locus_tag LOCUS_10720 gene fliI 143837 145246 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678707.1 protein_id gnl|my_center|LOCUS_10720 145243 145671 gene locus_tag LOCUS_10730 145243 145671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 145649 145831 gene locus_tag LOCUS_10740 145649 145831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 147464 145803 gene locus_tag LOCUS_10750 147464 145803 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674349.1 protein_id gnl|my_center|LOCUS_10750 147537 147466 gene locus_tag LOCUS_t00240 147537 147466 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 147763 149358 gene locus_tag LOCUS_10760 gene malQ 147763 149358 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680318.1 protein_id gnl|my_center|LOCUS_10760 149567 150232 gene locus_tag LOCUS_10770 149567 150232 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679463.1 protein_id gnl|my_center|LOCUS_10770 150229 150807 gene locus_tag LOCUS_10780 150229 150807 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679462.1 protein_id gnl|my_center|LOCUS_10780 150853 151593 gene locus_tag LOCUS_10790 gene deoD 150853 151593 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681557.1 protein_id gnl|my_center|LOCUS_10790 151705 152358 gene locus_tag LOCUS_10800 151705 152358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 152616 153524 gene locus_tag LOCUS_10810 152616 153524 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681782.1 protein_id gnl|my_center|LOCUS_10810 153542 154126 gene locus_tag LOCUS_10820 153542 154126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 154376 154564 gene locus_tag LOCUS_10830 154376 154564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 154574 155770 gene locus_tag LOCUS_10840 154574 155770 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_10840 155784 156848 gene locus_tag LOCUS_10850 155784 156848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680451.1 protein_id gnl|my_center|LOCUS_10850 156842 157645 gene locus_tag LOCUS_10860 156842 157645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 157620 157862 gene locus_tag LOCUS_10870 157620 157862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 158097 157870 gene locus_tag LOCUS_10880 158097 157870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 158273 158719 gene locus_tag LOCUS_10890 158273 158719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 158733 160259 gene locus_tag LOCUS_10900 158733 160259 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682434.1 protein_id gnl|my_center|LOCUS_10900 160873 160268 gene locus_tag LOCUS_10910 160873 160268 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681155.1 protein_id gnl|my_center|LOCUS_10910 163104 161590 gene locus_tag LOCUS_10920 163104 161590 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681159.1 protein_id gnl|my_center|LOCUS_10920 164828 163104 gene locus_tag LOCUS_10930 164828 163104 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681161.1 protein_id gnl|my_center|LOCUS_10930 166573 164825 gene locus_tag LOCUS_10940 166573 164825 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681164.1 protein_id gnl|my_center|LOCUS_10940 167222 166653 gene locus_tag LOCUS_10950 167222 166653 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902402.1 protein_id gnl|my_center|LOCUS_10950 167446 167519 gene locus_tag LOCUS_t00250 167446 167519 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 167523 168107 gene locus_tag LOCUS_10960 gene yihX 167523 168107 CDS product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175743.1 protein_id gnl|my_center|LOCUS_10960 168186 170645 gene locus_tag LOCUS_10970 168186 170645 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679730.1 protein_id gnl|my_center|LOCUS_10970 170791 171444 gene locus_tag LOCUS_10980 170791 171444 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679729.1 protein_id gnl|my_center|LOCUS_10980 171655 171482 gene locus_tag LOCUS_10990 171655 171482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667639.1 protein_id gnl|my_center|LOCUS_10990 171845 172669 gene locus_tag LOCUS_11000 171845 172669 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_11000 173009 172758 gene locus_tag LOCUS_11010 173009 172758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 174895 173138 gene locus_tag LOCUS_11020 gene thrS 174895 173138 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682400.1 protein_id gnl|my_center|LOCUS_11020 175336 176427 gene locus_tag LOCUS_11030 175336 176427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 176622 177860 gene locus_tag LOCUS_11040 176622 177860 CDS product DUF3440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358606.1 protein_id gnl|my_center|LOCUS_11040 177844 178359 gene locus_tag LOCUS_11050 177844 178359 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358603.1 protein_id gnl|my_center|LOCUS_11050 178565 179839 gene locus_tag LOCUS_11060 178565 179839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence06 365 1978 gene locus_tag LOCUS_11070 365 1978 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705702.1 protein_id gnl|my_center|LOCUS_11070 2077 3621 gene locus_tag LOCUS_11080 2077 3621 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_11080 3626 4558 gene locus_tag LOCUS_11090 3626 4558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 4794 6098 gene locus_tag LOCUS_11100 4794 6098 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679737.1 protein_id gnl|my_center|LOCUS_11100 6200 8869 gene locus_tag LOCUS_11110 gene leuS 6200 8869 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680258.1 protein_id gnl|my_center|LOCUS_11110 8999 9667 gene locus_tag LOCUS_11120 8999 9667 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_11120 9678 10235 gene locus_tag LOCUS_11130 9678 10235 CDS product Fic/DOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647970.1 protein_id gnl|my_center|LOCUS_11130 11665 10298 gene locus_tag LOCUS_11140 11665 10298 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_11140 12268 11792 gene locus_tag LOCUS_11150 12268 11792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 12288 14099 gene locus_tag LOCUS_11160 12288 14099 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667902.1 protein_id gnl|my_center|LOCUS_11160 14198 14806 gene locus_tag LOCUS_11170 14198 14806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 14918 16495 gene locus_tag LOCUS_11180 gene gltX 14918 16495 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681104.1 protein_id gnl|my_center|LOCUS_11180 16714 17250 gene locus_tag LOCUS_11190 16714 17250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 17272 17736 gene locus_tag LOCUS_11200 17272 17736 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868208.1 protein_id gnl|my_center|LOCUS_11200 17760 18212 gene locus_tag LOCUS_11210 17760 18212 CDS product DUF3021 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793164.1 protein_id gnl|my_center|LOCUS_11210 19793 18324 gene locus_tag LOCUS_11220 19793 18324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 19955 21562 gene locus_tag LOCUS_11230 19955 21562 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667101.1 protein_id gnl|my_center|LOCUS_11230 22851 21682 gene locus_tag LOCUS_11240 22851 21682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 23177 22848 gene locus_tag LOCUS_11250 23177 22848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 24646 23378 gene locus_tag LOCUS_11260 24646 23378 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440033.1 protein_id gnl|my_center|LOCUS_11260 24849 24649 gene locus_tag LOCUS_11270 24849 24649 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263301.1 protein_id gnl|my_center|LOCUS_11270 26372 24990 gene locus_tag LOCUS_11280 gene miaB 26372 24990 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679246.1 protein_id gnl|my_center|LOCUS_11280 27304 26375 gene locus_tag LOCUS_11290 gene folE2 27304 26375 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_11290 28227 27301 gene locus_tag LOCUS_11300 gene folD 28227 27301 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_11300 28333 28923 gene locus_tag LOCUS_11310 28333 28923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 28934 30052 gene locus_tag LOCUS_11320 28934 30052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 30138 32891 gene locus_tag LOCUS_11330 30138 32891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 34294 32942 gene locus_tag LOCUS_11340 34294 32942 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022042.1 protein_id gnl|my_center|LOCUS_11340 35332 34475 gene locus_tag LOCUS_11350 35332 34475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 35576 36361 gene locus_tag LOCUS_11360 35576 36361 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861195.1 protein_id gnl|my_center|LOCUS_11360 37354 36371 gene locus_tag LOCUS_11370 37354 36371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 38619 37351 gene locus_tag LOCUS_11380 38619 37351 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393768.1 protein_id gnl|my_center|LOCUS_11380 38803 40608 gene locus_tag LOCUS_11390 38803 40608 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682087.1 protein_id gnl|my_center|LOCUS_11390 41106 40723 gene locus_tag LOCUS_11400 41106 40723 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_11400 41469 41257 gene locus_tag LOCUS_11410 41469 41257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 41789 42910 gene locus_tag LOCUS_11420 41789 42910 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680316.1 protein_id gnl|my_center|LOCUS_11420 42961 44088 gene locus_tag LOCUS_11430 gene hflX 42961 44088 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262724.1 protein_id gnl|my_center|LOCUS_11430 44327 44827 gene locus_tag LOCUS_11440 44327 44827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 45493 44987 gene locus_tag LOCUS_11450 45493 44987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681597.1 protein_id gnl|my_center|LOCUS_11450 45595 46266 gene locus_tag LOCUS_11460 45595 46266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681599.1 protein_id gnl|my_center|LOCUS_11460 46269 46946 gene locus_tag LOCUS_11470 46269 46946 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272297.1 protein_id gnl|my_center|LOCUS_11470 46939 48495 gene locus_tag LOCUS_11480 46939 48495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 49508 48579 gene locus_tag LOCUS_11490 49508 48579 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667792.1 protein_id gnl|my_center|LOCUS_11490 50271 49657 gene locus_tag LOCUS_11500 50271 49657 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669797.1 protein_id gnl|my_center|LOCUS_11500 51293 50307 gene locus_tag LOCUS_11510 51293 50307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 52465 51293 gene locus_tag LOCUS_11520 52465 51293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957140.1 protein_id gnl|my_center|LOCUS_11520 53124 52462 gene locus_tag LOCUS_11530 53124 52462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 53455 55083 gene locus_tag LOCUS_11540 gene groL 53455 55083 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670719.1 protein_id gnl|my_center|LOCUS_11540 55275 56258 gene locus_tag LOCUS_11550 55275 56258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674814.1 protein_id gnl|my_center|LOCUS_11550 57659 56331 gene locus_tag LOCUS_11560 57659 56331 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680054.1 protein_id gnl|my_center|LOCUS_11560 57905 60163 gene locus_tag LOCUS_11570 57905 60163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 60349 61332 gene locus_tag LOCUS_11580 gene galE 60349 61332 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931718.1 protein_id gnl|my_center|LOCUS_11580 61577 62809 gene locus_tag LOCUS_11590 61577 62809 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680921.1 protein_id gnl|my_center|LOCUS_11590 62943 63752 gene locus_tag LOCUS_11600 62943 63752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 63754 64032 gene locus_tag LOCUS_11610 63754 64032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 66935 64128 gene locus_tag LOCUS_11620 66935 64128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 67217 67879 gene locus_tag LOCUS_11630 67217 67879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 67994 69811 gene locus_tag LOCUS_11640 gene nadN 67994 69811 CDS product NAD nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868956.1 protein_id gnl|my_center|LOCUS_11640 70004 70858 gene locus_tag LOCUS_11650 gene ispE 70004 70858 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678892.1 protein_id gnl|my_center|LOCUS_11650 70888 71199 gene locus_tag LOCUS_11660 gene spoVG 70888 71199 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_11660 71247 71320 gene locus_tag LOCUS_t00260 71247 71320 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 71387 71941 gene locus_tag LOCUS_11670 71387 71941 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678895.1 protein_id gnl|my_center|LOCUS_11670 72145 73629 gene locus_tag LOCUS_11680 gene tilS 72145 73629 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678896.1 protein_id gnl|my_center|LOCUS_11680 73641 75785 gene locus_tag LOCUS_11690 73641 75785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 75964 77505 gene locus_tag LOCUS_11700 75964 77505 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678901.1 protein_id gnl|my_center|LOCUS_11700 77610 79418 gene locus_tag LOCUS_11710 gene lepA 77610 79418 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957093.1 protein_id gnl|my_center|LOCUS_11710 80481 79579 gene locus_tag LOCUS_11720 gene era 80481 79579 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679589.1 protein_id gnl|my_center|LOCUS_11720 82228 80789 gene locus_tag LOCUS_11730 82228 80789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 83040 82225 gene locus_tag LOCUS_11740 83040 82225 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_11740 85588 83177 gene locus_tag LOCUS_11750 85588 83177 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679762.1 protein_id gnl|my_center|LOCUS_11750 86726 85986 gene locus_tag LOCUS_11760 86726 85986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681839.1 protein_id gnl|my_center|LOCUS_11760 86874 90275 gene locus_tag LOCUS_11770 86874 90275 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682402.1 protein_id gnl|my_center|LOCUS_11770 90272 90892 gene locus_tag LOCUS_11780 90272 90892 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680767.1 protein_id gnl|my_center|LOCUS_11780 91209 90877 gene locus_tag LOCUS_11790 91209 90877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 91802 92509 gene locus_tag LOCUS_11800 91802 92509 CDS product DUF2259 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020948739.1 protein_id gnl|my_center|LOCUS_11800 92833 92570 gene locus_tag LOCUS_11810 92833 92570 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812263.1 protein_id gnl|my_center|LOCUS_11810 93111 92836 gene locus_tag LOCUS_11820 93111 92836 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113434.1 protein_id gnl|my_center|LOCUS_11820 94849 93338 gene locus_tag LOCUS_11830 94849 93338 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728204.1 protein_id gnl|my_center|LOCUS_11830 95008 96030 gene locus_tag LOCUS_11840 95008 96030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 96123 96890 gene locus_tag LOCUS_11850 96123 96890 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680051.1 protein_id gnl|my_center|LOCUS_11850 96926 97483 gene locus_tag LOCUS_11860 gene lspA 96926 97483 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680623.1 protein_id gnl|my_center|LOCUS_11860 97470 97877 gene locus_tag LOCUS_11870 97470 97877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 97881 98612 gene locus_tag LOCUS_11880 97881 98612 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_11880 98747 99220 gene locus_tag LOCUS_11890 98747 99220 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173597.1 protein_id gnl|my_center|LOCUS_11890 99472 100323 gene locus_tag LOCUS_11900 99472 100323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 100521 102050 gene locus_tag LOCUS_11910 100521 102050 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_11910 102047 102691 gene locus_tag LOCUS_11920 102047 102691 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272632.1 protein_id gnl|my_center|LOCUS_11920 102688 103746 gene locus_tag LOCUS_11930 102688 103746 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680895.1 protein_id gnl|my_center|LOCUS_11930 103845 105527 gene locus_tag LOCUS_11940 103845 105527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680819.1 protein_id gnl|my_center|LOCUS_11940 106466 105741 gene locus_tag LOCUS_11950 106466 105741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11950 107675 106479 gene locus_tag LOCUS_11960 107675 106479 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680173.1 protein_id gnl|my_center|LOCUS_11960 108505 107780 gene locus_tag LOCUS_11970 108505 107780 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681678.1 protein_id gnl|my_center|LOCUS_11970 109496 108507 gene locus_tag LOCUS_11980 109496 108507 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680174.1 protein_id gnl|my_center|LOCUS_11980 111048 109594 gene locus_tag LOCUS_11990 111048 109594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 112793 111207 gene locus_tag LOCUS_12000 gene murJ 112793 111207 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681318.1 protein_id gnl|my_center|LOCUS_12000 114105 112906 gene locus_tag LOCUS_12010 114105 112906 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118841.1 protein_id gnl|my_center|LOCUS_12010 114416 114691 gene locus_tag LOCUS_12020 114416 114691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 114927 116840 gene locus_tag LOCUS_12030 114927 116840 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680717.1 protein_id gnl|my_center|LOCUS_12030 118311 116962 gene locus_tag LOCUS_12040 118311 116962 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680439.1 protein_id gnl|my_center|LOCUS_12040 118586 119494 gene locus_tag LOCUS_12050 118586 119494 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364453.1 protein_id gnl|my_center|LOCUS_12050 119635 120792 gene locus_tag LOCUS_12060 119635 120792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 121010 122278 gene locus_tag LOCUS_12070 121010 122278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 122275 123504 gene locus_tag LOCUS_12080 122275 123504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 123647 124486 gene locus_tag LOCUS_12090 123647 124486 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676763.1 protein_id gnl|my_center|LOCUS_12090 124500 126011 gene locus_tag LOCUS_12100 gene gltA 124500 126011 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681438.1 protein_id gnl|my_center|LOCUS_12100 126037 126900 gene locus_tag LOCUS_12110 126037 126900 CDS product GerMN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675533.1 protein_id gnl|my_center|LOCUS_12110 128154 126988 gene locus_tag LOCUS_12120 128154 126988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 130016 128172 gene locus_tag LOCUS_12130 130016 128172 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957184.1 protein_id gnl|my_center|LOCUS_12130 130236 137591 gene locus_tag LOCUS_12140 130236 137591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 137641 138030 gene locus_tag LOCUS_12150 137641 138030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 138015 139061 gene locus_tag LOCUS_12160 138015 139061 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680508.1 protein_id gnl|my_center|LOCUS_12160 140577 139273 gene locus_tag LOCUS_12170 140577 139273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 140718 141269 gene locus_tag LOCUS_12180 140718 141269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 141266 141532 gene locus_tag LOCUS_12190 141266 141532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 142725 141631 gene locus_tag LOCUS_12200 gene prfA 142725 141631 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680455.1 protein_id gnl|my_center|LOCUS_12200 143015 144412 gene locus_tag LOCUS_12210 143015 144412 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440276.1 protein_id gnl|my_center|LOCUS_12210 144445 146160 gene locus_tag LOCUS_12220 144445 146160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 146197 146571 gene locus_tag LOCUS_12230 146197 146571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 146590 148440 gene locus_tag LOCUS_12240 gene mnmG 146590 148440 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682089.1 protein_id gnl|my_center|LOCUS_12240 149510 148479 gene locus_tag LOCUS_12250 149510 148479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 151367 149577 gene locus_tag LOCUS_12260 gene pepF 151367 149577 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044971600.1 protein_id gnl|my_center|LOCUS_12260 151535 152857 gene locus_tag LOCUS_12270 gene rmuC 151535 152857 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193862.1 protein_id gnl|my_center|LOCUS_12270 153950 152868 gene locus_tag LOCUS_12280 153950 152868 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016302.1 protein_id gnl|my_center|LOCUS_12280 155656 153977 gene locus_tag LOCUS_12290 155656 153977 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016301.1 protein_id gnl|my_center|LOCUS_12290 156807 155764 gene locus_tag LOCUS_12300 156807 155764 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016300.1 protein_id gnl|my_center|LOCUS_12300 157046 158272 gene locus_tag LOCUS_12310 157046 158272 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678992.1 protein_id gnl|my_center|LOCUS_12310 158284 160389 gene locus_tag LOCUS_12320 158284 160389 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678989.1 protein_id gnl|my_center|LOCUS_12320 161513 160473 gene locus_tag LOCUS_12330 161513 160473 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202979.1 protein_id gnl|my_center|LOCUS_12330 162509 161766 gene locus_tag LOCUS_12340 162509 161766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 165117 162583 gene locus_tag LOCUS_12350 165117 162583 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788368.1 protein_id gnl|my_center|LOCUS_12350 165518 165952 gene locus_tag LOCUS_12360 165518 165952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 165952 168093 gene locus_tag LOCUS_12370 165952 168093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 168095 169576 gene locus_tag LOCUS_12380 168095 169576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 169573 170772 gene locus_tag LOCUS_12390 169573 170772 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942428.1 protein_id gnl|my_center|LOCUS_12390 170769 171206 gene locus_tag LOCUS_12400 gene gspG 170769 171206 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088760.1 protein_id gnl|my_center|LOCUS_12400 171178 171378 gene locus_tag LOCUS_12410 171178 171378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 171365 171766 gene locus_tag LOCUS_12420 171365 171766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 172641 171874 gene locus_tag LOCUS_12430 172641 171874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 173628 172921 gene locus_tag LOCUS_12440 173628 172921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 >Feature sequence07 657 307 gene locus_tag LOCUS_12450 657 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 5547 871 gene locus_tag LOCUS_12460 5547 871 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957154.1 protein_id gnl|my_center|LOCUS_12460 8480 5547 gene locus_tag LOCUS_12470 8480 5547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679927.1 protein_id gnl|my_center|LOCUS_12470 8692 9990 gene locus_tag LOCUS_12480 8692 9990 CDS product UPF0164 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679928.1 protein_id gnl|my_center|LOCUS_12480 11583 9982 gene locus_tag LOCUS_12490 11583 9982 CDS product DUF1957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682403.1 protein_id gnl|my_center|LOCUS_12490 12256 11597 gene locus_tag LOCUS_12500 12256 11597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 12351 13088 gene locus_tag LOCUS_12510 12351 13088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 13613 13179 gene locus_tag LOCUS_12520 13613 13179 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668975.1 protein_id gnl|my_center|LOCUS_12520 14115 13633 gene locus_tag LOCUS_12530 14115 13633 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668974.1 protein_id gnl|my_center|LOCUS_12530 15543 14134 gene locus_tag LOCUS_12540 15543 14134 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671242.1 protein_id gnl|my_center|LOCUS_12540 17934 15556 gene locus_tag LOCUS_12550 17934 15556 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671244.1 protein_id gnl|my_center|LOCUS_12550 18071 19291 gene locus_tag LOCUS_12560 18071 19291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 20916 19594 gene locus_tag LOCUS_12570 20916 19594 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940837.1 protein_id gnl|my_center|LOCUS_12570 20969 22156 gene locus_tag LOCUS_12580 20969 22156 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_12580 23025 22198 gene locus_tag LOCUS_12590 gene murI 23025 22198 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679098.1 protein_id gnl|my_center|LOCUS_12590 23369 24034 gene locus_tag LOCUS_12600 23369 24034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 24031 24600 gene locus_tag LOCUS_12610 24031 24600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678723.1 protein_id gnl|my_center|LOCUS_12610 26424 24613 gene locus_tag LOCUS_12620 26424 24613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 26470 27063 gene locus_tag LOCUS_12630 26470 27063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 27615 27124 gene locus_tag LOCUS_12640 gene ilvN 27615 27124 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_12640 30140 27621 gene locus_tag LOCUS_12650 gene thrA 30140 27621 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209237.1 protein_id gnl|my_center|LOCUS_12650 30237 31124 gene locus_tag LOCUS_12660 30237 31124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 31121 31912 gene locus_tag LOCUS_12670 31121 31912 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770693.1 protein_id gnl|my_center|LOCUS_12670 31896 32738 gene locus_tag LOCUS_12680 31896 32738 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903855.1 protein_id gnl|my_center|LOCUS_12680 32898 33515 gene locus_tag LOCUS_12690 32898 33515 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831217.1 protein_id gnl|my_center|LOCUS_12690 34227 33526 gene locus_tag LOCUS_12700 34227 33526 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015968.1 protein_id gnl|my_center|LOCUS_12700 36231 34240 gene locus_tag LOCUS_12710 36231 34240 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957030.1 protein_id gnl|my_center|LOCUS_12710 37459 36422 gene locus_tag LOCUS_12720 gene miaA 37459 36422 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679096.1 protein_id gnl|my_center|LOCUS_12720 38691 37435 gene locus_tag LOCUS_12730 38691 37435 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_12730 38931 40139 gene locus_tag LOCUS_12740 38931 40139 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903642.1 protein_id gnl|my_center|LOCUS_12740 40619 42553 gene locus_tag LOCUS_12750 40619 42553 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903247.1 protein_id gnl|my_center|LOCUS_12750 42659 43879 gene locus_tag LOCUS_12760 42659 43879 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903248.1 protein_id gnl|my_center|LOCUS_12760 46650 43990 gene locus_tag LOCUS_12770 gene clpB 46650 43990 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680241.1 protein_id gnl|my_center|LOCUS_12770 47902 46733 gene locus_tag LOCUS_12780 47902 46733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 48143 47922 gene locus_tag LOCUS_12790 48143 47922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 51171 48166 gene locus_tag LOCUS_12800 51171 48166 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679557.1 protein_id gnl|my_center|LOCUS_12800 52389 51199 gene locus_tag LOCUS_12810 52389 51199 CDS product FliG C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678791.1 protein_id gnl|my_center|LOCUS_12810 54076 52520 gene locus_tag LOCUS_12820 54076 52520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 55253 54159 gene locus_tag LOCUS_12830 gene leuB 55253 54159 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_12830 56243 55356 gene locus_tag LOCUS_12840 56243 55356 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693969.1 protein_id gnl|my_center|LOCUS_12840 56430 56230 gene locus_tag LOCUS_12850 56430 56230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 57128 56424 gene locus_tag LOCUS_12860 57128 56424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12860 58897 57299 gene locus_tag LOCUS_12870 gene cimA 58897 57299 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966451.1 protein_id gnl|my_center|LOCUS_12870 59067 59939 gene locus_tag LOCUS_12880 59067 59939 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_12880 60005 60775 gene locus_tag LOCUS_12890 60005 60775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 60972 61955 gene locus_tag LOCUS_12900 60972 61955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 62580 62185 gene locus_tag LOCUS_12910 62580 62185 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281042.1 protein_id gnl|my_center|LOCUS_12910 62828 62580 gene locus_tag LOCUS_12920 62828 62580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 63359 62892 gene locus_tag LOCUS_12930 63359 62892 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_12930 64038 63442 gene locus_tag LOCUS_12940 64038 63442 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678865.1 protein_id gnl|my_center|LOCUS_12940 64212 64943 gene locus_tag LOCUS_12950 64212 64943 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964066.1 protein_id gnl|my_center|LOCUS_12950 65126 66112 gene locus_tag LOCUS_12960 65126 66112 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679323.1 protein_id gnl|my_center|LOCUS_12960 66282 67688 gene locus_tag LOCUS_12970 66282 67688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 67829 69484 gene locus_tag LOCUS_12980 67829 69484 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272219.1 protein_id gnl|my_center|LOCUS_12980 69540 71018 gene locus_tag LOCUS_12990 69540 71018 CDS product subtype B tannase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898589.1 protein_id gnl|my_center|LOCUS_12990 72169 71021 gene locus_tag LOCUS_13000 72169 71021 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_13000 72336 73049 gene locus_tag LOCUS_13010 72336 73049 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361291.1 protein_id gnl|my_center|LOCUS_13010 74662 73349 gene locus_tag LOCUS_13020 gene pyrP 74662 73349 CDS product uracil permease PyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221479.1 protein_id gnl|my_center|LOCUS_13020 74873 75415 gene locus_tag LOCUS_13030 74873 75415 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483406.1 protein_id gnl|my_center|LOCUS_13030 75503 75922 gene locus_tag LOCUS_13040 75503 75922 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815090.1 protein_id gnl|my_center|LOCUS_13040 75990 78767 gene locus_tag LOCUS_13050 75990 78767 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957294.1 protein_id gnl|my_center|LOCUS_13050 79134 78811 gene locus_tag LOCUS_13060 79134 78811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 79283 79540 gene locus_tag LOCUS_13070 79283 79540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 79716 81083 gene locus_tag LOCUS_13080 79716 81083 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_13080 82351 81290 gene locus_tag LOCUS_13090 82351 81290 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918169.1 protein_id gnl|my_center|LOCUS_13090 85160 82758 gene locus_tag LOCUS_13100 85160 82758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 86262 85168 gene locus_tag LOCUS_13110 86262 85168 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860748.1 protein_id gnl|my_center|LOCUS_13110 88170 86344 gene locus_tag LOCUS_13120 88170 86344 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880932.1 protein_id gnl|my_center|LOCUS_13120 89404 88274 gene locus_tag LOCUS_13130 89404 88274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 90613 89447 gene locus_tag LOCUS_13140 90613 89447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 93607 90752 gene locus_tag LOCUS_13150 93607 90752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 95231 93636 gene locus_tag LOCUS_13160 95231 93636 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680122.1 protein_id gnl|my_center|LOCUS_13160 97119 95242 gene locus_tag LOCUS_13170 97119 95242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 98957 97134 gene locus_tag LOCUS_13180 98957 97134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 101628 98959 gene locus_tag LOCUS_13190 101628 98959 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976911.1 protein_id gnl|my_center|LOCUS_13190 103741 101918 gene locus_tag LOCUS_13200 gene argS 103741 101918 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682282.1 protein_id gnl|my_center|LOCUS_13200 103906 103977 gene locus_tag LOCUS_t00270 103906 103977 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 104047 104121 gene locus_tag LOCUS_t00280 104047 104121 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 104873 105370 gene locus_tag LOCUS_13210 104873 105370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 105411 107150 gene locus_tag LOCUS_13220 105411 107150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 107159 107998 gene locus_tag LOCUS_13230 107159 107998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 108163 108792 gene locus_tag LOCUS_13240 108163 108792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 109075 110034 gene locus_tag LOCUS_13250 gene rsgA 109075 110034 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679106.1 protein_id gnl|my_center|LOCUS_13250 110041 112422 gene locus_tag LOCUS_13260 110041 112422 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679109.1 protein_id gnl|my_center|LOCUS_13260 112489 112959 gene locus_tag LOCUS_13270 112489 112959 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762699.1 protein_id gnl|my_center|LOCUS_13270 113172 114761 gene locus_tag LOCUS_13280 113172 114761 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680556.1 protein_id gnl|my_center|LOCUS_13280 115947 115129 gene locus_tag LOCUS_13290 115947 115129 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815786.1 protein_id gnl|my_center|LOCUS_13290 116627 115959 gene locus_tag LOCUS_13300 116627 115959 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430270.1 protein_id gnl|my_center|LOCUS_13300 117437 116628 gene locus_tag LOCUS_13310 117437 116628 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_13310 118977 117559 gene locus_tag LOCUS_13320 gene argH 118977 117559 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_13320 119062 119967 gene locus_tag LOCUS_13330 119062 119967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 120338 120045 gene locus_tag LOCUS_13340 120338 120045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681130.1 protein_id gnl|my_center|LOCUS_13340 120631 120335 gene locus_tag LOCUS_13350 120631 120335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 122335 120827 gene locus_tag LOCUS_13360 122335 120827 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666927.1 protein_id gnl|my_center|LOCUS_13360 122923 122552 gene locus_tag LOCUS_13370 122923 122552 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964778.1 protein_id gnl|my_center|LOCUS_13370 125020 123017 gene locus_tag LOCUS_13380 gene ilvB 125020 123017 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272051.1 protein_id gnl|my_center|LOCUS_13380 126786 125107 gene locus_tag LOCUS_13390 gene ilvD 126786 125107 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_13390 127697 126969 gene locus_tag LOCUS_13400 127697 126969 CDS product tRNA 2-thiocytidine biosynthesis TtcA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666040.1 protein_id gnl|my_center|LOCUS_13400 127836 127761 gene locus_tag LOCUS_t00290 127836 127761 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 128970 127927 gene locus_tag LOCUS_13410 128970 127927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 129109 129327 gene locus_tag LOCUS_13420 129109 129327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670390.1 protein_id gnl|my_center|LOCUS_13420 129643 130770 gene locus_tag LOCUS_13430 gene thiI 129643 130770 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680552.1 protein_id gnl|my_center|LOCUS_13430 131085 130852 gene locus_tag LOCUS_13440 131085 130852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679683.1 protein_id gnl|my_center|LOCUS_13440 131278 131087 gene locus_tag LOCUS_13450 131278 131087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 132669 131518 gene locus_tag LOCUS_13460 132669 131518 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256548.1 protein_id gnl|my_center|LOCUS_13460 134367 132691 gene locus_tag LOCUS_13470 134367 132691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668497.1 protein_id gnl|my_center|LOCUS_13470 134428 135336 gene locus_tag LOCUS_13480 134428 135336 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680465.1 protein_id gnl|my_center|LOCUS_13480 135348 137450 gene locus_tag LOCUS_13490 gene priA 135348 137450 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680463.1 protein_id gnl|my_center|LOCUS_13490 >Feature sequence08 319 3156 gene locus_tag LOCUS_13500 319 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 4709 3276 gene locus_tag LOCUS_13510 gene argA 4709 3276 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874409.1 protein_id gnl|my_center|LOCUS_13510 5869 5291 gene locus_tag LOCUS_13520 5869 5291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 6567 5977 gene locus_tag LOCUS_13530 6567 5977 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680249.1 protein_id gnl|my_center|LOCUS_13530 6609 6791 gene locus_tag LOCUS_13540 6609 6791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 6861 7025 gene locus_tag LOCUS_13550 6861 7025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 7347 9182 gene locus_tag LOCUS_13560 7347 9182 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814508.1 protein_id gnl|my_center|LOCUS_13560 9261 10556 gene locus_tag LOCUS_13570 gene eno 9261 10556 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_13570 12713 10806 gene locus_tag LOCUS_13580 12713 10806 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948262.1 protein_id gnl|my_center|LOCUS_13580 13361 12798 gene locus_tag LOCUS_13590 gene ahpC 13361 12798 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817384.1 protein_id gnl|my_center|LOCUS_13590 13681 13466 gene locus_tag LOCUS_13600 13681 13466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 13735 15006 gene locus_tag LOCUS_13610 13735 15006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 15401 15087 gene locus_tag LOCUS_13620 15401 15087 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963800.1 protein_id gnl|my_center|LOCUS_13620 16196 15462 gene locus_tag LOCUS_13630 gene aat 16196 15462 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211346.1 protein_id gnl|my_center|LOCUS_13630 18873 16183 gene locus_tag LOCUS_13640 18873 16183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 19209 18892 gene locus_tag LOCUS_13650 19209 18892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 19325 20080 gene locus_tag LOCUS_13660 19325 20080 CDS product phosphopantothenate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287044.1 protein_id gnl|my_center|LOCUS_13660 20073 20627 gene locus_tag LOCUS_13670 gene coaC 20073 20627 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359573.1 protein_id gnl|my_center|LOCUS_13670 21851 20673 gene locus_tag LOCUS_13680 21851 20673 CDS product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490229.1 protein_id gnl|my_center|LOCUS_13680 23029 21932 gene locus_tag LOCUS_13690 gene serC 23029 21932 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_13690 23769 23161 gene locus_tag LOCUS_13700 23769 23161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 25563 24112 gene locus_tag LOCUS_13710 25563 24112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 26612 25572 gene locus_tag LOCUS_13720 26612 25572 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942498.1 protein_id gnl|my_center|LOCUS_13720 27215 26853 gene locus_tag LOCUS_13730 27215 26853 CDS product DUF1304 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836732.1 protein_id gnl|my_center|LOCUS_13730 27423 28445 gene locus_tag LOCUS_13740 27423 28445 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_13740 29005 28541 gene locus_tag LOCUS_13750 29005 28541 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295275.1 protein_id gnl|my_center|LOCUS_13750 29843 29196 gene locus_tag LOCUS_13760 29843 29196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 31286 29880 gene locus_tag LOCUS_13770 31286 29880 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_13770 31716 31279 gene locus_tag LOCUS_13780 31716 31279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 32050 31703 gene locus_tag LOCUS_13790 32050 31703 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869442.1 protein_id gnl|my_center|LOCUS_13790 35743 32768 gene locus_tag LOCUS_13800 35743 32768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 36270 35764 gene locus_tag LOCUS_13810 36270 35764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 38042 36813 gene locus_tag LOCUS_13820 38042 36813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 38915 38547 gene locus_tag LOCUS_13830 38915 38547 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866321.1 protein_id gnl|my_center|LOCUS_13830 40440 38908 gene locus_tag LOCUS_13840 40440 38908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 41242 40505 gene locus_tag LOCUS_13850 41242 40505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 41594 41292 gene locus_tag LOCUS_13860 41594 41292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 41980 41675 gene locus_tag LOCUS_13870 41980 41675 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944876.1 protein_id gnl|my_center|LOCUS_13870 42190 42660 gene locus_tag LOCUS_13880 42190 42660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 42650 43189 gene locus_tag LOCUS_13890 42650 43189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13890 43348 44061 gene locus_tag LOCUS_13900 43348 44061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114933.1 protein_id gnl|my_center|LOCUS_13900 44347 44153 gene locus_tag LOCUS_13910 44347 44153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 45117 44347 gene locus_tag LOCUS_13920 45117 44347 CDS product TdeIII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682206.1 protein_id gnl|my_center|LOCUS_13920 46705 45119 gene locus_tag LOCUS_13930 46705 45119 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682204.1 protein_id gnl|my_center|LOCUS_13930 46948 47382 gene locus_tag LOCUS_13940 46948 47382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 47363 47692 gene locus_tag LOCUS_13950 47363 47692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 47794 48408 gene locus_tag LOCUS_13960 47794 48408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 48493 48954 gene locus_tag LOCUS_13970 48493 48954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 49312 50088 gene locus_tag LOCUS_13980 49312 50088 CDS product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678739.1 protein_id gnl|my_center|LOCUS_13980 50852 50163 gene locus_tag LOCUS_13990 50852 50163 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943846.1 protein_id gnl|my_center|LOCUS_13990 52492 50849 gene locus_tag LOCUS_14000 52492 50849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 54073 52571 gene locus_tag LOCUS_14010 54073 52571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 55638 54070 gene locus_tag LOCUS_14020 55638 54070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 57505 55691 gene locus_tag LOCUS_14030 57505 55691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 58463 57510 gene locus_tag LOCUS_14040 58463 57510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 59353 58802 gene locus_tag LOCUS_14050 59353 58802 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668265.1 protein_id gnl|my_center|LOCUS_14050 59773 60528 gene locus_tag LOCUS_14060 59773 60528 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679885.1 protein_id gnl|my_center|LOCUS_14060 61552 60518 gene locus_tag LOCUS_14070 61552 60518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 62428 61688 gene locus_tag LOCUS_14080 62428 61688 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675248.1 protein_id gnl|my_center|LOCUS_14080 62576 63604 gene locus_tag LOCUS_14090 62576 63604 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969388.1 protein_id gnl|my_center|LOCUS_14090 63673 65406 gene locus_tag LOCUS_14100 63673 65406 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626058.1 protein_id gnl|my_center|LOCUS_14100 65421 66509 gene locus_tag LOCUS_14110 65421 66509 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974159.1 protein_id gnl|my_center|LOCUS_14110 66609 68036 gene locus_tag LOCUS_14120 66609 68036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 68388 68618 gene locus_tag LOCUS_14130 68388 68618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 69183 70631 gene locus_tag LOCUS_14140 69183 70631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 70854 71420 gene locus_tag LOCUS_14150 gene def 70854 71420 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669259.1 protein_id gnl|my_center|LOCUS_14150 71485 72507 gene locus_tag LOCUS_14160 gene fmt 71485 72507 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679327.1 protein_id gnl|my_center|LOCUS_14160 72815 73804 gene locus_tag LOCUS_14170 72815 73804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 73807 75090 gene locus_tag LOCUS_14180 73807 75090 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_14180 75090 76382 gene locus_tag LOCUS_14190 75090 76382 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_14190 77579 76479 gene locus_tag LOCUS_14200 77579 76479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 78381 77566 gene locus_tag LOCUS_14210 78381 77566 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_14210 78537 79016 gene locus_tag LOCUS_14220 78537 79016 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940930.1 protein_id gnl|my_center|LOCUS_14220 79614 79024 gene locus_tag LOCUS_14230 gene recR 79614 79024 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956990.1 protein_id gnl|my_center|LOCUS_14230 79936 79625 gene locus_tag LOCUS_14240 79936 79625 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669078.1 protein_id gnl|my_center|LOCUS_14240 82127 79986 gene locus_tag LOCUS_14250 82127 79986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 82860 82321 gene locus_tag LOCUS_14260 82860 82321 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_14260 84125 82857 gene locus_tag LOCUS_14270 gene lysA 84125 82857 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462285.1 protein_id gnl|my_center|LOCUS_14270 85666 84386 gene locus_tag LOCUS_14280 gene murA 85666 84386 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669886.1 protein_id gnl|my_center|LOCUS_14280 86978 85716 gene locus_tag LOCUS_14290 gene pepT 86978 85716 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723986.1 protein_id gnl|my_center|LOCUS_14290 87508 88746 gene locus_tag LOCUS_14300 87508 88746 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673523.1 protein_id gnl|my_center|LOCUS_14300 88935 90506 gene locus_tag LOCUS_14310 88935 90506 CDS product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208352.1 protein_id gnl|my_center|LOCUS_14310 90846 92738 gene locus_tag LOCUS_14320 90846 92738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 93281 92775 gene locus_tag LOCUS_14330 93281 92775 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669617.1 protein_id gnl|my_center|LOCUS_14330 94570 93494 gene locus_tag LOCUS_14340 94570 93494 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669780.1 protein_id gnl|my_center|LOCUS_14340 95921 94668 gene locus_tag LOCUS_14350 95921 94668 CDS product small ribosomal subunit Rsm22 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680936.1 protein_id gnl|my_center|LOCUS_14350 96252 95911 gene locus_tag LOCUS_14360 96252 95911 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680938.1 protein_id gnl|my_center|LOCUS_14360 97724 96267 gene locus_tag LOCUS_14370 gene der 97724 96267 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680939.1 protein_id gnl|my_center|LOCUS_14370 99456 97741 gene locus_tag LOCUS_14380 gene ptsP 99456 97741 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152804487.1 protein_id gnl|my_center|LOCUS_14380 101486 99543 gene locus_tag LOCUS_14390 101486 99543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 102580 101510 gene locus_tag LOCUS_14400 102580 101510 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680516.1 protein_id gnl|my_center|LOCUS_14400 102713 104167 gene locus_tag LOCUS_14410 102713 104167 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_14410 104701 104270 gene locus_tag LOCUS_14420 104701 104270 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_14420 106055 104742 gene locus_tag LOCUS_14430 106055 104742 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931806.1 protein_id gnl|my_center|LOCUS_14430 106715 106137 gene locus_tag LOCUS_14440 106715 106137 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965300.1 protein_id gnl|my_center|LOCUS_14440 108519 106792 gene locus_tag LOCUS_14450 gene iorA 108519 106792 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_14450 109274 108549 gene locus_tag LOCUS_14460 109274 108549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 110040 109327 gene locus_tag LOCUS_14470 110040 109327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 111038 110088 gene locus_tag LOCUS_14480 111038 110088 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681789.1 protein_id gnl|my_center|LOCUS_14480 111786 111031 gene locus_tag LOCUS_14490 111786 111031 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681790.1 protein_id gnl|my_center|LOCUS_14490 112734 111868 gene locus_tag LOCUS_14500 112734 111868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 113078 112731 gene locus_tag LOCUS_14510 113078 112731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 113788 113117 gene locus_tag LOCUS_14520 113788 113117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 114899 113889 gene locus_tag LOCUS_14530 114899 113889 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_14530 115912 114896 gene locus_tag LOCUS_14540 115912 114896 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_14540 116969 115920 gene locus_tag LOCUS_14550 116969 115920 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556930.1 protein_id gnl|my_center|LOCUS_14550 117922 116993 gene locus_tag LOCUS_14560 gene oppB 117922 116993 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816417.1 protein_id gnl|my_center|LOCUS_14560 119762 118182 gene locus_tag LOCUS_14570 119762 118182 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656717.1 protein_id gnl|my_center|LOCUS_14570 >Feature sequence09 459 647 gene locus_tag LOCUS_14580 459 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 1231 1158 gene locus_tag LOCUS_t00300 1231 1158 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1551 4817 gene locus_tag LOCUS_14590 1551 4817 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109349.1 protein_id gnl|my_center|LOCUS_14590 4756 5751 gene locus_tag LOCUS_14600 4756 5751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 5802 5939 gene locus_tag LOCUS_14610 5802 5939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 5959 7644 gene locus_tag LOCUS_14620 5959 7644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 7647 8288 gene locus_tag LOCUS_14630 7647 8288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 8337 9011 gene locus_tag LOCUS_14640 8337 9011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14640 9069 10799 gene locus_tag LOCUS_14650 9069 10799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 10869 11927 gene locus_tag LOCUS_14660 10869 11927 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103242.1 protein_id gnl|my_center|LOCUS_14660 11996 12202 gene locus_tag LOCUS_14670 11996 12202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 12181 12906 gene locus_tag LOCUS_14680 12181 12906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14680 13183 13398 gene locus_tag LOCUS_14690 13183 13398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 13497 14246 gene locus_tag LOCUS_14700 13497 14246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 14249 14572 gene locus_tag LOCUS_14710 14249 14572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 15421 14942 gene locus_tag LOCUS_14720 15421 14942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 16549 15767 gene locus_tag LOCUS_14730 16549 15767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 17565 16546 gene locus_tag LOCUS_14740 17565 16546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 18485 17565 gene locus_tag LOCUS_14750 18485 17565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 19127 18930 gene locus_tag LOCUS_14760 19127 18930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 21584 20199 gene locus_tag LOCUS_14770 gene mnmE 21584 20199 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680027.1 protein_id gnl|my_center|LOCUS_14770 23944 21590 gene locus_tag LOCUS_14780 23944 21590 CDS product putative glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044971495.1 protein_id gnl|my_center|LOCUS_14780 28787 24015 gene locus_tag LOCUS_14790 28787 24015 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680753.1 protein_id gnl|my_center|LOCUS_14790 28909 29676 gene locus_tag LOCUS_14800 28909 29676 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963607.1 protein_id gnl|my_center|LOCUS_14800 31314 30055 gene locus_tag LOCUS_14810 31314 30055 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490912.1 protein_id gnl|my_center|LOCUS_14810 33074 31440 gene locus_tag LOCUS_14820 33074 31440 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904005.1 protein_id gnl|my_center|LOCUS_14820 33536 33159 gene locus_tag LOCUS_14830 33536 33159 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668289.1 protein_id gnl|my_center|LOCUS_14830 33801 34517 gene locus_tag LOCUS_14840 33801 34517 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904004.1 protein_id gnl|my_center|LOCUS_14840 34545 36284 gene locus_tag LOCUS_14850 34545 36284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 36313 37464 gene locus_tag LOCUS_14860 36313 37464 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920600.1 protein_id gnl|my_center|LOCUS_14860 38068 39264 gene locus_tag LOCUS_14870 gene tuf 38068 39264 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669993.1 protein_id gnl|my_center|LOCUS_14870 39331 39639 gene locus_tag LOCUS_14880 gene rpsJ 39331 39639 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669994.1 protein_id gnl|my_center|LOCUS_14880 39736 40356 gene locus_tag LOCUS_14890 gene rplC 39736 40356 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669995.1 protein_id gnl|my_center|LOCUS_14890 40376 41017 gene locus_tag LOCUS_14900 gene rplD 40376 41017 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669996.1 protein_id gnl|my_center|LOCUS_14900 41017 41307 gene locus_tag LOCUS_14910 41017 41307 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672216.1 protein_id gnl|my_center|LOCUS_14910 41334 42158 gene locus_tag LOCUS_14920 gene rplB 41334 42158 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669998.1 protein_id gnl|my_center|LOCUS_14920 42167 42478 gene locus_tag LOCUS_14930 gene rpsS 42167 42478 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669999.1 protein_id gnl|my_center|LOCUS_14930 42490 42879 gene locus_tag LOCUS_14940 gene rplV 42490 42879 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670000.1 protein_id gnl|my_center|LOCUS_14940 42881 43603 gene locus_tag LOCUS_14950 gene rpsC 42881 43603 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670002.1 protein_id gnl|my_center|LOCUS_14950 43605 44021 gene locus_tag LOCUS_14960 gene rplP 43605 44021 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670003.1 protein_id gnl|my_center|LOCUS_14960 44032 44268 gene locus_tag LOCUS_14970 44032 44268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 44279 44554 gene locus_tag LOCUS_14980 gene rpsQ 44279 44554 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670009.1 protein_id gnl|my_center|LOCUS_14980 44565 44933 gene locus_tag LOCUS_14990 gene rplN 44565 44933 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670011.1 protein_id gnl|my_center|LOCUS_14990 44945 45262 gene locus_tag LOCUS_15000 gene rplX 44945 45262 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670017.1 protein_id gnl|my_center|LOCUS_15000 45262 45813 gene locus_tag LOCUS_15010 gene rplE 45262 45813 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670018.1 protein_id gnl|my_center|LOCUS_15010 45824 46009 gene locus_tag LOCUS_15020 45824 46009 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557082.1 protein_id gnl|my_center|LOCUS_15020 46022 46420 gene locus_tag LOCUS_15030 gene rpsH 46022 46420 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670022.1 protein_id gnl|my_center|LOCUS_15030 46433 46972 gene locus_tag LOCUS_15040 gene rplF 46433 46972 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670023.1 protein_id gnl|my_center|LOCUS_15040 46984 47352 gene locus_tag LOCUS_15050 gene rplR 46984 47352 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670026.1 protein_id gnl|my_center|LOCUS_15050 47378 48019 gene locus_tag LOCUS_15060 47378 48019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 48022 48207 gene locus_tag LOCUS_15070 gene rpmD 48022 48207 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670028.1 protein_id gnl|my_center|LOCUS_15070 48207 48767 gene locus_tag LOCUS_15080 gene rplO 48207 48767 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682039.1 protein_id gnl|my_center|LOCUS_15080 48781 50115 gene locus_tag LOCUS_15090 gene secY 48781 50115 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670031.1 protein_id gnl|my_center|LOCUS_15090 50293 50661 gene locus_tag LOCUS_15100 gene rpsM 50293 50661 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670034.1 protein_id gnl|my_center|LOCUS_15100 50769 51155 gene locus_tag LOCUS_15110 gene rpsK 50769 51155 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670039.1 protein_id gnl|my_center|LOCUS_15110 51168 51803 gene locus_tag LOCUS_15120 gene rpsD 51168 51803 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545818.1 protein_id gnl|my_center|LOCUS_15120 51819 52874 gene locus_tag LOCUS_15130 51819 52874 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682041.1 protein_id gnl|my_center|LOCUS_15130 52864 53376 gene locus_tag LOCUS_15140 52864 53376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 53379 53636 gene locus_tag LOCUS_15150 53379 53636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 53978 55114 gene locus_tag LOCUS_15160 53978 55114 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_15160 55321 56244 gene locus_tag LOCUS_15170 55321 56244 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_15170 56317 57306 gene locus_tag LOCUS_15180 56317 57306 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018191.1 protein_id gnl|my_center|LOCUS_15180 57299 58096 gene locus_tag LOCUS_15190 57299 58096 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773590.1 protein_id gnl|my_center|LOCUS_15190 58096 58809 gene locus_tag LOCUS_15200 58096 58809 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_15200 58867 59511 gene locus_tag LOCUS_15210 58867 59511 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257688.1 protein_id gnl|my_center|LOCUS_15210 59554 61017 gene locus_tag LOCUS_15220 59554 61017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 61035 61508 gene locus_tag LOCUS_15230 61035 61508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 61552 63522 gene locus_tag LOCUS_15240 gene tkt 61552 63522 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678841.1 protein_id gnl|my_center|LOCUS_15240 64635 63649 gene locus_tag LOCUS_15250 gene lgt 64635 63649 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013967724.1 protein_id gnl|my_center|LOCUS_15250 65795 64647 gene locus_tag LOCUS_15260 65795 64647 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678981.1 protein_id gnl|my_center|LOCUS_15260 66821 65802 gene locus_tag LOCUS_15270 66821 65802 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680474.1 protein_id gnl|my_center|LOCUS_15270 67315 66914 gene locus_tag LOCUS_15280 67315 66914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 67501 67947 gene locus_tag LOCUS_15290 67501 67947 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666808.1 protein_id gnl|my_center|LOCUS_15290 68009 68542 gene locus_tag LOCUS_15300 68009 68542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 68643 69407 gene locus_tag LOCUS_15310 68643 69407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 69594 70724 gene locus_tag LOCUS_15320 69594 70724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 70786 73005 gene locus_tag LOCUS_15330 70786 73005 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680923.1 protein_id gnl|my_center|LOCUS_15330 73436 73002 gene locus_tag LOCUS_15340 73436 73002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 75579 73693 gene locus_tag LOCUS_15350 75579 73693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681756.1 protein_id gnl|my_center|LOCUS_15350 75722 76870 gene locus_tag LOCUS_15360 gene hisC 75722 76870 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063930.1 protein_id gnl|my_center|LOCUS_15360 76950 77642 gene locus_tag LOCUS_15370 76950 77642 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680480.1 protein_id gnl|my_center|LOCUS_15370 78489 77716 gene locus_tag LOCUS_15380 78489 77716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 78967 80541 gene locus_tag LOCUS_15390 78967 80541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 80565 82382 gene locus_tag LOCUS_15400 80565 82382 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_15400 82508 83590 gene locus_tag LOCUS_15410 82508 83590 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669285.1 protein_id gnl|my_center|LOCUS_15410 83605 84036 gene locus_tag LOCUS_15420 gene nusB 83605 84036 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679351.1 protein_id gnl|my_center|LOCUS_15420 84164 85927 gene locus_tag LOCUS_15430 84164 85927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 86369 86094 gene locus_tag LOCUS_15440 86369 86094 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670325.1 protein_id gnl|my_center|LOCUS_15440 86715 87320 gene locus_tag LOCUS_15450 gene thrH 86715 87320 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_15450 87570 87731 gene locus_tag LOCUS_15460 87570 87731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 88703 87705 gene locus_tag LOCUS_15470 88703 87705 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687768.1 protein_id gnl|my_center|LOCUS_15470 90558 88693 gene locus_tag LOCUS_15480 90558 88693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 90760 90939 gene locus_tag LOCUS_15490 90760 90939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 90947 91885 gene locus_tag LOCUS_15500 90947 91885 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681007.1 protein_id gnl|my_center|LOCUS_15500 91893 93632 gene locus_tag LOCUS_15510 91893 93632 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681013.1 protein_id gnl|my_center|LOCUS_15510 93922 94620 gene locus_tag LOCUS_15520 93922 94620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 94868 95554 gene locus_tag LOCUS_15530 94868 95554 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681814.1 protein_id gnl|my_center|LOCUS_15530 95660 97612 gene locus_tag LOCUS_15540 gene dnaK 95660 97612 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681815.1 protein_id gnl|my_center|LOCUS_15540 97907 99055 gene locus_tag LOCUS_15550 gene dnaJ 97907 99055 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002686888.1 protein_id gnl|my_center|LOCUS_15550 99190 100572 gene locus_tag LOCUS_15560 99190 100572 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672386.1 protein_id gnl|my_center|LOCUS_15560 100717 102825 gene locus_tag LOCUS_15570 100717 102825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 103598 104998 gene locus_tag LOCUS_15580 103598 104998 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672386.1 protein_id gnl|my_center|LOCUS_15580 105000 107174 gene locus_tag LOCUS_15590 105000 107174 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681817.1 protein_id gnl|my_center|LOCUS_15590 107219 107545 gene locus_tag LOCUS_15600 107219 107545 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681819.1 protein_id gnl|my_center|LOCUS_15600 108503 107550 gene locus_tag LOCUS_15610 108503 107550 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677008.1 protein_id gnl|my_center|LOCUS_15610 108770 109852 gene locus_tag LOCUS_15620 108770 109852 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495003.1 protein_id gnl|my_center|LOCUS_15620 109940 110374 gene locus_tag LOCUS_15630 109940 110374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 110533 111453 gene locus_tag LOCUS_15640 110533 111453 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437173.1 protein_id gnl|my_center|LOCUS_15640 111628 111383 gene locus_tag LOCUS_15650 111628 111383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 >Feature sequence10 304 1029 gene locus_tag LOCUS_15660 304 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 2474 1086 gene locus_tag LOCUS_15670 gene emmdR 2474 1086 CDS product multidrug efflux MATE transporter EmmdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120727113.1 protein_id gnl|my_center|LOCUS_15670 3206 2484 gene locus_tag LOCUS_15680 3206 2484 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986547.1 protein_id gnl|my_center|LOCUS_15680 3858 3193 gene locus_tag LOCUS_15690 3858 3193 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 protein_id gnl|my_center|LOCUS_15690 4715 3948 gene locus_tag LOCUS_15700 4715 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 5757 4858 gene locus_tag LOCUS_15710 5757 4858 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004121002.1 protein_id gnl|my_center|LOCUS_15710 8219 5754 gene locus_tag LOCUS_15720 8219 5754 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680347.1 protein_id gnl|my_center|LOCUS_15720 10358 8259 gene locus_tag LOCUS_15730 gene glgX 10358 8259 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680950.1 protein_id gnl|my_center|LOCUS_15730 11778 10519 gene locus_tag LOCUS_15740 11778 10519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 11845 12711 gene locus_tag LOCUS_15750 11845 12711 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680625.1 protein_id gnl|my_center|LOCUS_15750 12739 14472 gene locus_tag LOCUS_15760 12739 14472 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679741.1 protein_id gnl|my_center|LOCUS_15760 14644 15264 gene locus_tag LOCUS_15770 14644 15264 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667667.1 protein_id gnl|my_center|LOCUS_15770 15285 16175 gene locus_tag LOCUS_15780 15285 16175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 16199 16966 gene locus_tag LOCUS_15790 16199 16966 CDS product DbpA RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680577.1 protein_id gnl|my_center|LOCUS_15790 16975 17649 gene locus_tag LOCUS_15800 16975 17649 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680333.1 protein_id gnl|my_center|LOCUS_15800 18426 17716 gene locus_tag LOCUS_15810 18426 17716 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679247.1 protein_id gnl|my_center|LOCUS_15810 19260 18481 gene locus_tag LOCUS_15820 19260 18481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 19348 21003 gene locus_tag LOCUS_15830 19348 21003 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669793.1 protein_id gnl|my_center|LOCUS_15830 21017 21919 gene locus_tag LOCUS_15840 21017 21919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 22373 21897 gene locus_tag LOCUS_15850 22373 21897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 22660 23436 gene locus_tag LOCUS_15860 22660 23436 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679455.1 protein_id gnl|my_center|LOCUS_15860 23763 23515 gene locus_tag LOCUS_15870 23763 23515 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761253.1 protein_id gnl|my_center|LOCUS_15870 25357 23885 gene locus_tag LOCUS_15880 25357 23885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 25625 25347 gene locus_tag LOCUS_15890 25625 25347 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939083.1 protein_id gnl|my_center|LOCUS_15890 27119 25638 gene locus_tag LOCUS_15900 gene ilvC 27119 25638 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455226.1 protein_id gnl|my_center|LOCUS_15900 28841 27468 gene locus_tag LOCUS_15910 gene ffh 28841 27468 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668253.1 protein_id gnl|my_center|LOCUS_15910 29951 28896 gene locus_tag LOCUS_15920 29951 28896 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679888.1 protein_id gnl|my_center|LOCUS_15920 31416 30679 gene locus_tag LOCUS_15930 31416 30679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 32839 31406 gene locus_tag LOCUS_15940 32839 31406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 33016 33369 gene locus_tag LOCUS_15950 33016 33369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 33570 34952 gene locus_tag LOCUS_15960 33570 34952 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_15960 35096 35845 gene locus_tag LOCUS_15970 gene nudC 35096 35845 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033458993.1 protein_id gnl|my_center|LOCUS_15970 37380 36178 gene locus_tag LOCUS_15980 37380 36178 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263014.1 protein_id gnl|my_center|LOCUS_15980 37707 39251 gene locus_tag LOCUS_15990 37707 39251 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_15990 39214 39381 gene locus_tag LOCUS_16000 39214 39381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 39368 39775 gene locus_tag LOCUS_16010 39368 39775 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390712.1 protein_id gnl|my_center|LOCUS_16010 39921 41093 gene locus_tag LOCUS_16020 39921 41093 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_16020 41117 41917 gene locus_tag LOCUS_16030 gene etfB 41117 41917 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986693.1 protein_id gnl|my_center|LOCUS_16030 41937 43040 gene locus_tag LOCUS_16040 41937 43040 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417347.1 protein_id gnl|my_center|LOCUS_16040 44373 43282 gene locus_tag LOCUS_16050 44373 43282 CDS product endonuclease subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387048.1 protein_id gnl|my_center|LOCUS_16050 45719 44466 gene locus_tag LOCUS_16060 45719 44466 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771113.1 protein_id gnl|my_center|LOCUS_16060 47708 46011 gene locus_tag LOCUS_16070 gene leuA 47708 46011 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963596.1 protein_id gnl|my_center|LOCUS_16070 47845 48117 gene locus_tag LOCUS_16080 47845 48117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 48621 48151 gene locus_tag LOCUS_16090 gene rpsG 48621 48151 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670537.1 protein_id gnl|my_center|LOCUS_16090 49027 48653 gene locus_tag LOCUS_16100 gene rpsL 49027 48653 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670535.1 protein_id gnl|my_center|LOCUS_16100 53484 49210 gene locus_tag LOCUS_16110 gene rpoC 53484 49210 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680359.1 protein_id gnl|my_center|LOCUS_16110 57053 53502 gene locus_tag LOCUS_16120 gene rpoB 57053 53502 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680361.1 protein_id gnl|my_center|LOCUS_16120 57519 57139 gene locus_tag LOCUS_16130 gene rplL 57519 57139 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667605.1 protein_id gnl|my_center|LOCUS_16130 58393 57680 gene locus_tag LOCUS_16140 gene rplJ 58393 57680 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680363.1 protein_id gnl|my_center|LOCUS_16140 59075 58395 gene locus_tag LOCUS_16150 gene rplA 59075 58395 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667601.1 protein_id gnl|my_center|LOCUS_16150 59519 59088 gene locus_tag LOCUS_16160 gene rplK 59519 59088 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667599.1 protein_id gnl|my_center|LOCUS_16160 60220 59663 gene locus_tag LOCUS_16170 gene nusG 60220 59663 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667597.1 protein_id gnl|my_center|LOCUS_16170 60407 60225 gene locus_tag LOCUS_16180 60407 60225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 60501 60428 gene locus_tag LOCUS_t00310 60501 60428 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 60684 60508 gene locus_tag LOCUS_16190 gene rpmG 60684 60508 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667594.1 protein_id gnl|my_center|LOCUS_16190 60804 60731 gene locus_tag LOCUS_t00320 60804 60731 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 61565 61143 gene locus_tag LOCUS_16200 61565 61143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 61937 62932 gene locus_tag LOCUS_16210 61937 62932 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_16210 63032 63424 gene locus_tag LOCUS_16220 63032 63424 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015709088.1 protein_id gnl|my_center|LOCUS_16220 64328 63411 gene locus_tag LOCUS_16230 gene pfkB 64328 63411 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861975.1 protein_id gnl|my_center|LOCUS_16230 64574 64656 gene locus_tag LOCUS_t00330 64574 64656 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 64865 66250 gene locus_tag LOCUS_16240 64865 66250 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202731.1 protein_id gnl|my_center|LOCUS_16240 67252 66332 gene locus_tag LOCUS_16250 67252 66332 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027948.1 protein_id gnl|my_center|LOCUS_16250 68161 67616 gene locus_tag LOCUS_16260 68161 67616 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894834.1 protein_id gnl|my_center|LOCUS_16260 69072 68275 gene locus_tag LOCUS_16270 69072 68275 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027946.1 protein_id gnl|my_center|LOCUS_16270 69787 69119 gene locus_tag LOCUS_16280 69787 69119 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027947.1 protein_id gnl|my_center|LOCUS_16280 70778 69864 gene locus_tag LOCUS_16290 70778 69864 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 protein_id gnl|my_center|LOCUS_16290 72089 70992 gene locus_tag LOCUS_16300 72089 70992 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948815.1 protein_id gnl|my_center|LOCUS_16300 73513 72572 gene locus_tag LOCUS_16310 73513 72572 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682241.1 protein_id gnl|my_center|LOCUS_16310 73911 74816 gene locus_tag LOCUS_16320 73911 74816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 74995 75540 gene locus_tag LOCUS_16330 74995 75540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 75607 75987 gene locus_tag LOCUS_16340 75607 75987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 76223 77500 gene locus_tag LOCUS_16350 76223 77500 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_16350 79277 77724 gene locus_tag LOCUS_16360 79277 77724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 79373 79301 gene locus_tag LOCUS_t00340 79373 79301 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 79999 80949 gene locus_tag LOCUS_16370 79999 80949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 81798 82463 gene locus_tag LOCUS_16380 81798 82463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 >Feature sequence11 839 171 gene locus_tag LOCUS_16390 839 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 2101 1229 gene locus_tag LOCUS_16400 gene hisG 2101 1229 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_16400 2432 3052 gene locus_tag LOCUS_16410 gene hisB 2432 3052 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674505.1 protein_id gnl|my_center|LOCUS_16410 5401 3392 gene locus_tag LOCUS_16420 5401 3392 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_16420 6160 6708 gene locus_tag LOCUS_16430 6160 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 6705 8042 gene locus_tag LOCUS_16440 6705 8042 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765463.1 protein_id gnl|my_center|LOCUS_16440 8264 8761 gene locus_tag LOCUS_16450 8264 8761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 10066 8885 gene locus_tag LOCUS_16460 10066 8885 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759897.1 protein_id gnl|my_center|LOCUS_16460 10746 11486 gene locus_tag LOCUS_16470 gene fabG 10746 11486 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460603.1 protein_id gnl|my_center|LOCUS_16470 11672 12112 gene locus_tag LOCUS_16480 11672 12112 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902929.1 protein_id gnl|my_center|LOCUS_16480 12317 12595 gene locus_tag LOCUS_16490 12317 12595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 12592 13020 gene locus_tag LOCUS_16500 12592 13020 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142378.1 protein_id gnl|my_center|LOCUS_16500 13125 14387 gene locus_tag LOCUS_16510 13125 14387 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074037.1 protein_id gnl|my_center|LOCUS_16510 18762 14857 gene locus_tag LOCUS_16520 18762 14857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 20934 18763 gene locus_tag LOCUS_16530 20934 18763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 21450 22793 gene locus_tag LOCUS_16540 21450 22793 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003289.1 protein_id gnl|my_center|LOCUS_16540 22793 23698 gene locus_tag LOCUS_16550 22793 23698 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679573.1 protein_id gnl|my_center|LOCUS_16550 24230 23886 gene locus_tag LOCUS_16560 24230 23886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 24546 25526 gene locus_tag LOCUS_16570 24546 25526 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948151.1 protein_id gnl|my_center|LOCUS_16570 25603 25917 gene locus_tag LOCUS_16580 25603 25917 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362471.1 protein_id gnl|my_center|LOCUS_16580 25907 26113 gene locus_tag LOCUS_16590 25907 26113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 26134 26310 gene locus_tag LOCUS_16600 26134 26310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 27171 26323 gene locus_tag LOCUS_16610 27171 26323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 28024 27353 gene locus_tag LOCUS_16620 28024 27353 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_16620 28237 29085 gene locus_tag LOCUS_16630 28237 29085 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459260.1 protein_id gnl|my_center|LOCUS_16630 29098 29784 gene locus_tag LOCUS_16640 29098 29784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 31613 29826 gene locus_tag LOCUS_16650 31613 29826 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680883.1 protein_id gnl|my_center|LOCUS_16650 32548 31610 gene locus_tag LOCUS_16660 gene trxB 32548 31610 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_16660 32724 32653 gene locus_tag LOCUS_t00350 32724 32653 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 33696 32896 gene locus_tag LOCUS_16670 33696 32896 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678868.1 protein_id gnl|my_center|LOCUS_16670 34892 33741 gene locus_tag LOCUS_16680 34892 33741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 35341 34889 gene locus_tag LOCUS_16690 35341 34889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 39277 35744 gene locus_tag LOCUS_16700 gene nifJ 39277 35744 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681868.1 protein_id gnl|my_center|LOCUS_16700 39754 39605 gene locus_tag LOCUS_16710 39754 39605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 39961 40158 gene locus_tag LOCUS_16720 39961 40158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 42131 40215 gene locus_tag LOCUS_16730 42131 40215 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957030.1 protein_id gnl|my_center|LOCUS_16730 43322 42462 gene locus_tag LOCUS_16740 43322 42462 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670454.1 protein_id gnl|my_center|LOCUS_16740 44048 43641 gene locus_tag LOCUS_16750 44048 43641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044971528.1 protein_id gnl|my_center|LOCUS_16750 46175 44334 gene locus_tag LOCUS_16760 gene glmS 46175 44334 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048324.1 protein_id gnl|my_center|LOCUS_16760 48278 46188 gene locus_tag LOCUS_16770 48278 46188 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_16770 48928 48356 gene locus_tag LOCUS_16780 48928 48356 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_16780 49082 49966 gene locus_tag LOCUS_16790 49082 49966 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047741.1 protein_id gnl|my_center|LOCUS_16790 51909 50170 gene locus_tag LOCUS_16800 51909 50170 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682224.1 protein_id gnl|my_center|LOCUS_16800 53845 51923 gene locus_tag LOCUS_16810 53845 51923 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682225.1 protein_id gnl|my_center|LOCUS_16810 54992 54060 gene locus_tag LOCUS_16820 54992 54060 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969467.1 protein_id gnl|my_center|LOCUS_16820 55851 55024 gene locus_tag LOCUS_16830 55851 55024 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192007.1 protein_id gnl|my_center|LOCUS_16830 56826 55921 gene locus_tag LOCUS_16840 56826 55921 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003052879.1 protein_id gnl|my_center|LOCUS_16840 58203 56923 gene locus_tag LOCUS_16850 58203 56923 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921874.1 protein_id gnl|my_center|LOCUS_16850 58414 59094 gene locus_tag LOCUS_16860 58414 59094 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356424.1 protein_id gnl|my_center|LOCUS_16860 59103 60311 gene locus_tag LOCUS_16870 59103 60311 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119310.1 protein_id gnl|my_center|LOCUS_16870 60416 61195 gene locus_tag LOCUS_16880 gene dapB 60416 61195 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933509.1 protein_id gnl|my_center|LOCUS_16880 61346 62899 gene locus_tag LOCUS_16890 gene cls 61346 62899 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262851.1 protein_id gnl|my_center|LOCUS_16890 63067 65184 gene locus_tag LOCUS_16900 63067 65184 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680161.1 protein_id gnl|my_center|LOCUS_16900 65851 65708 gene locus_tag LOCUS_16910 65851 65708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 67762 65879 gene locus_tag LOCUS_16920 67762 65879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16920 68051 67746 gene locus_tag LOCUS_16930 68051 67746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 70188 68062 gene locus_tag LOCUS_16940 70188 68062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 71130 70249 gene locus_tag LOCUS_16950 71130 70249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 71757 71140 gene locus_tag LOCUS_16960 71757 71140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 72502 72077 gene locus_tag LOCUS_16970 72502 72077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 73454 72711 gene locus_tag LOCUS_16980 73454 72711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 74305 73484 gene locus_tag LOCUS_16990 74305 73484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 74784 74323 gene locus_tag LOCUS_17000 74784 74323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17000 76732 75068 gene locus_tag LOCUS_17010 76732 75068 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811470.1 protein_id gnl|my_center|LOCUS_17010 77094 76813 gene locus_tag LOCUS_17020 77094 76813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 77491 77153 gene locus_tag LOCUS_17030 77491 77153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 78241 77597 gene locus_tag LOCUS_17040 78241 77597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 78865 78431 gene locus_tag LOCUS_17050 78865 78431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 79028 78956 gene locus_tag LOCUS_t00360 79028 78956 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 79457 80182 gene locus_tag LOCUS_17060 79457 80182 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722821.1 protein_id gnl|my_center|LOCUS_17060 >Feature sequence12 80 973 gene locus_tag LOCUS_17070 80 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 3513 1540 gene locus_tag LOCUS_17080 gene htpG 3513 1540 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957241.1 protein_id gnl|my_center|LOCUS_17080 3755 4114 gene locus_tag LOCUS_17090 3755 4114 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681342.1 protein_id gnl|my_center|LOCUS_17090 4122 5606 gene locus_tag LOCUS_17100 4122 5606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 5742 6575 gene locus_tag LOCUS_17110 5742 6575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 6626 8089 gene locus_tag LOCUS_17120 6626 8089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 8189 10210 gene locus_tag LOCUS_17130 8189 10210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 10271 10522 gene locus_tag LOCUS_17140 10271 10522 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681558.1 protein_id gnl|my_center|LOCUS_17140 11167 10589 gene locus_tag LOCUS_17150 11167 10589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 11180 11884 gene locus_tag LOCUS_17160 11180 11884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 12253 12341 gene locus_tag LOCUS_t00370 12253 12341 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13580 12747 gene locus_tag LOCUS_17170 13580 12747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 14425 13574 gene locus_tag LOCUS_17180 14425 13574 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679334.1 protein_id gnl|my_center|LOCUS_17180 14976 14422 gene locus_tag LOCUS_17190 14976 14422 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679338.1 protein_id gnl|my_center|LOCUS_17190 15153 16109 gene locus_tag LOCUS_17200 15153 16109 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459799.1 protein_id gnl|my_center|LOCUS_17200 16422 17060 gene locus_tag LOCUS_17210 16422 17060 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892118.1 protein_id gnl|my_center|LOCUS_17210 17155 18600 gene locus_tag LOCUS_17220 gene trkA 17155 18600 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676352.1 protein_id gnl|my_center|LOCUS_17220 18643 20088 gene locus_tag LOCUS_17230 18643 20088 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680943.1 protein_id gnl|my_center|LOCUS_17230 20460 20164 gene locus_tag LOCUS_17240 20460 20164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 20755 22524 gene locus_tag LOCUS_17250 20755 22524 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995243.1 protein_id gnl|my_center|LOCUS_17250 22521 24233 gene locus_tag LOCUS_17260 gene cydC 22521 24233 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667625.1 protein_id gnl|my_center|LOCUS_17260 24230 24694 gene locus_tag LOCUS_17270 24230 24694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 25148 25768 gene locus_tag LOCUS_17280 25148 25768 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017058.1 protein_id gnl|my_center|LOCUS_17280 25768 26172 gene locus_tag LOCUS_17290 25768 26172 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768982.1 protein_id gnl|my_center|LOCUS_17290 26156 26809 gene locus_tag LOCUS_17300 26156 26809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 27582 29612 gene locus_tag LOCUS_17310 27582 29612 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555650.1 protein_id gnl|my_center|LOCUS_17310 29662 30645 gene locus_tag LOCUS_17320 29662 30645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 30738 32054 gene locus_tag LOCUS_17330 30738 32054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 32244 34694 gene locus_tag LOCUS_17340 32244 34694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 34743 36503 gene locus_tag LOCUS_17350 gene ettA 34743 36503 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_17350 36972 36897 gene locus_tag LOCUS_t00380 36972 36897 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 37845 37432 gene locus_tag LOCUS_17360 37845 37432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 38005 38706 gene locus_tag LOCUS_17370 38005 38706 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666599.1 protein_id gnl|my_center|LOCUS_17370 38711 39535 gene locus_tag LOCUS_17380 38711 39535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681048.1 protein_id gnl|my_center|LOCUS_17380 39884 41773 gene locus_tag LOCUS_17390 39884 41773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 41793 43694 gene locus_tag LOCUS_17400 41793 43694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 43776 44657 gene locus_tag LOCUS_17410 43776 44657 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_17410 44868 45833 gene locus_tag LOCUS_17420 44868 45833 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811776.1 protein_id gnl|my_center|LOCUS_17420 45852 46814 gene locus_tag LOCUS_17430 45852 46814 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811777.1 protein_id gnl|my_center|LOCUS_17430 46816 47613 gene locus_tag LOCUS_17440 46816 47613 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289388.1 protein_id gnl|my_center|LOCUS_17440 47805 48353 gene locus_tag LOCUS_17450 47805 48353 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680597.1 protein_id gnl|my_center|LOCUS_17450 48420 49340 gene locus_tag LOCUS_17460 48420 49340 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681821.1 protein_id gnl|my_center|LOCUS_17460 49598 50440 gene locus_tag LOCUS_17470 49598 50440 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779459.1 protein_id gnl|my_center|LOCUS_17470 50466 52355 gene locus_tag LOCUS_17480 50466 52355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 52614 53147 gene locus_tag LOCUS_17490 52614 53147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 53279 53767 gene locus_tag LOCUS_17500 gene nuoE 53279 53767 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986413.1 protein_id gnl|my_center|LOCUS_17500 53767 54312 gene locus_tag LOCUS_17510 53767 54312 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865378.1 protein_id gnl|my_center|LOCUS_17510 54382 54765 gene locus_tag LOCUS_17520 54382 54765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082448.1 protein_id gnl|my_center|LOCUS_17520 54775 56556 gene locus_tag LOCUS_17530 gene nuoF 54775 56556 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868905.1 protein_id gnl|my_center|LOCUS_17530 56569 58335 gene locus_tag LOCUS_17540 56569 58335 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_17540 58663 58872 gene locus_tag LOCUS_17550 58663 58872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 58890 59111 gene locus_tag LOCUS_17560 58890 59111 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_17560 59121 61328 gene locus_tag LOCUS_17570 gene feoB 59121 61328 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460242.1 protein_id gnl|my_center|LOCUS_17570 61578 62147 gene locus_tag LOCUS_17580 61578 62147 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_17580 62192 62608 gene locus_tag LOCUS_17590 62192 62608 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459277.1 protein_id gnl|my_center|LOCUS_17590 62768 63142 gene locus_tag LOCUS_17600 62768 63142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 63304 64167 gene locus_tag LOCUS_17610 63304 64167 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357673.1 protein_id gnl|my_center|LOCUS_17610 64215 64586 gene locus_tag LOCUS_17620 64215 64586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 64836 65678 gene locus_tag LOCUS_17630 64836 65678 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680775.1 protein_id gnl|my_center|LOCUS_17630 66013 65792 gene locus_tag LOCUS_17640 66013 65792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 67006 66071 gene locus_tag LOCUS_17650 67006 66071 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044979586.1 protein_id gnl|my_center|LOCUS_17650 68157 67006 gene locus_tag LOCUS_17660 68157 67006 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679664.1 protein_id gnl|my_center|LOCUS_17660 69689 68157 gene locus_tag LOCUS_17670 69689 68157 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920612.1 protein_id gnl|my_center|LOCUS_17670 70928 69960 gene locus_tag LOCUS_17680 70928 69960 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861372.1 protein_id gnl|my_center|LOCUS_17680 71731 71228 gene locus_tag LOCUS_17690 71731 71228 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244797.1 protein_id gnl|my_center|LOCUS_17690 72098 72418 gene locus_tag LOCUS_17700 72098 72418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 72523 73545 gene locus_tag LOCUS_17710 72523 73545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 74174 73692 gene locus_tag LOCUS_17720 74174 73692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence13 1310 297 gene locus_tag LOCUS_17730 1310 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 3277 1625 gene locus_tag LOCUS_17740 3277 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 4280 3279 gene locus_tag LOCUS_17750 4280 3279 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678753.1 protein_id gnl|my_center|LOCUS_17750 5311 4328 gene locus_tag LOCUS_17760 5311 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 6204 5308 gene locus_tag LOCUS_17770 6204 5308 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678741.1 protein_id gnl|my_center|LOCUS_17770 7199 6207 gene locus_tag LOCUS_17780 7199 6207 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666315.1 protein_id gnl|my_center|LOCUS_17780 7239 8582 gene locus_tag LOCUS_17790 7239 8582 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812135.1 protein_id gnl|my_center|LOCUS_17790 8626 9843 gene locus_tag LOCUS_17800 8626 9843 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674509.1 protein_id gnl|my_center|LOCUS_17800 10849 9845 gene locus_tag LOCUS_17810 10849 9845 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680574.1 protein_id gnl|my_center|LOCUS_17810 11150 14728 gene locus_tag LOCUS_17820 gene dnaE 11150 14728 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957315.1 protein_id gnl|my_center|LOCUS_17820 14772 15371 gene locus_tag LOCUS_17830 14772 15371 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666956.1 protein_id gnl|my_center|LOCUS_17830 15381 17645 gene locus_tag LOCUS_17840 gene recG 15381 17645 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680562.1 protein_id gnl|my_center|LOCUS_17840 18522 17683 gene locus_tag LOCUS_17850 18522 17683 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670326.1 protein_id gnl|my_center|LOCUS_17850 20688 18808 gene locus_tag LOCUS_17860 20688 18808 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678969.1 protein_id gnl|my_center|LOCUS_17860 21106 20894 gene locus_tag LOCUS_17870 gene rpsU 21106 20894 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673965.1 protein_id gnl|my_center|LOCUS_17870 21983 21372 gene locus_tag LOCUS_17880 21983 21372 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430090.1 protein_id gnl|my_center|LOCUS_17880 23052 21964 gene locus_tag LOCUS_17890 23052 21964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679444.1 protein_id gnl|my_center|LOCUS_17890 23510 23052 gene locus_tag LOCUS_17900 23510 23052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 23605 24561 gene locus_tag LOCUS_17910 23605 24561 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681114.1 protein_id gnl|my_center|LOCUS_17910 24558 25709 gene locus_tag LOCUS_17920 24558 25709 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681112.1 protein_id gnl|my_center|LOCUS_17920 26218 25712 gene locus_tag LOCUS_17930 26218 25712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 26760 26218 gene locus_tag LOCUS_17940 26760 26218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680920.1 protein_id gnl|my_center|LOCUS_17940 27809 26763 gene locus_tag LOCUS_17950 27809 26763 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673293.1 protein_id gnl|my_center|LOCUS_17950 29027 28038 gene locus_tag LOCUS_17960 gene murB 29027 28038 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680945.1 protein_id gnl|my_center|LOCUS_17960 29269 30852 gene locus_tag LOCUS_17970 29269 30852 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666765.1 protein_id gnl|my_center|LOCUS_17970 30950 31516 gene locus_tag LOCUS_17980 30950 31516 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666766.1 protein_id gnl|my_center|LOCUS_17980 31497 32198 gene locus_tag LOCUS_17990 31497 32198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 32312 33904 gene locus_tag LOCUS_18000 32312 33904 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680944.1 protein_id gnl|my_center|LOCUS_18000 33957 34745 gene locus_tag LOCUS_18010 gene pyrH 33957 34745 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668261.1 protein_id gnl|my_center|LOCUS_18010 34893 36227 gene locus_tag LOCUS_18020 34893 36227 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943345.1 protein_id gnl|my_center|LOCUS_18020 37443 36739 gene locus_tag LOCUS_18030 37443 36739 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694124.1 protein_id gnl|my_center|LOCUS_18030 37885 37418 gene locus_tag LOCUS_18040 37885 37418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 38294 38028 gene locus_tag LOCUS_18050 38294 38028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 39312 38407 gene locus_tag LOCUS_18060 39312 38407 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024414.1 protein_id gnl|my_center|LOCUS_18060 40773 39895 gene locus_tag LOCUS_18070 40773 39895 CDS product DUF4349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680721.1 protein_id gnl|my_center|LOCUS_18070 41100 42893 gene locus_tag LOCUS_18080 41100 42893 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508136.1 protein_id gnl|my_center|LOCUS_18080 43101 43925 gene locus_tag LOCUS_18090 43101 43925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 44565 44110 gene locus_tag LOCUS_18100 gene rnhA 44565 44110 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680554.1 protein_id gnl|my_center|LOCUS_18100 45902 44799 gene locus_tag LOCUS_18110 45902 44799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 46303 47400 gene locus_tag LOCUS_18120 46303 47400 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902186.1 protein_id gnl|my_center|LOCUS_18120 47883 49157 gene locus_tag LOCUS_18130 47883 49157 CDS product leucine-rich repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957306.1 protein_id gnl|my_center|LOCUS_18130 51760 49241 gene locus_tag LOCUS_18140 51760 49241 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682327.1 protein_id gnl|my_center|LOCUS_18140 52033 52275 gene locus_tag LOCUS_18150 52033 52275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 53524 52304 gene locus_tag LOCUS_18160 53524 52304 CDS product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670666.1 protein_id gnl|my_center|LOCUS_18160 53601 54341 gene locus_tag LOCUS_18170 53601 54341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 55576 54431 gene locus_tag LOCUS_18180 55576 54431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 56246 55569 gene locus_tag LOCUS_18190 gene pth 56246 55569 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672368.1 protein_id gnl|my_center|LOCUS_18190 57734 56661 gene locus_tag LOCUS_18200 57734 56661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 58445 57798 gene locus_tag LOCUS_18210 58445 57798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 58877 58503 gene locus_tag LOCUS_18220 58877 58503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 61123 59144 gene locus_tag LOCUS_18230 61123 59144 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459352.1 protein_id gnl|my_center|LOCUS_18230 61115 61297 gene locus_tag LOCUS_18240 61115 61297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 61610 61260 gene locus_tag LOCUS_18250 61610 61260 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_18250 62012 64672 gene locus_tag LOCUS_18260 62012 64672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 65727 64825 gene locus_tag LOCUS_18270 65727 64825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 67804 65744 gene locus_tag LOCUS_18280 67804 65744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 68537 67806 gene locus_tag LOCUS_18290 68537 67806 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_18290 69490 68534 gene locus_tag LOCUS_18300 69490 68534 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_18300 70051 69650 gene locus_tag LOCUS_18310 70051 69650 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_18310 72880 71831 gene locus_tag LOCUS_18320 72880 71831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 <73794 72883 gene locus_tag LOCUS_18330 <73794 72883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029409206.1:RHS repeat-associated core domain-containing protein >Feature sequence14 <1 922 gene locus_tag LOCUS_18340 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015942796.1:InlB B-repeat-containing protein 1439 1074 gene locus_tag LOCUS_18350 1439 1074 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964886.1 protein_id gnl|my_center|LOCUS_18350 1550 2329 gene locus_tag LOCUS_18360 1550 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 2348 3145 gene locus_tag LOCUS_18370 2348 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 3868 3623 gene locus_tag LOCUS_18380 3868 3623 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971760.1 protein_id gnl|my_center|LOCUS_18380 4289 4891 gene locus_tag LOCUS_18390 4289 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 6136 4949 gene locus_tag LOCUS_18400 gene rlmJ 6136 4949 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037826.1 protein_id gnl|my_center|LOCUS_18400 8180 6138 gene locus_tag LOCUS_18410 8180 6138 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120563.1 protein_id gnl|my_center|LOCUS_18410 8275 8347 gene locus_tag LOCUS_t00390 8275 8347 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 8411 10348 gene locus_tag LOCUS_18420 8411 10348 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869125.1 protein_id gnl|my_center|LOCUS_18420 10385 11353 gene locus_tag LOCUS_18430 10385 11353 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_18430 11721 11347 gene locus_tag LOCUS_18440 11721 11347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 12729 11725 gene locus_tag LOCUS_18450 12729 11725 CDS product phosphatidylinositol-specific phospholipase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710555.1 protein_id gnl|my_center|LOCUS_18450 15593 12735 gene locus_tag LOCUS_18460 gene secA 15593 12735 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679596.1 protein_id gnl|my_center|LOCUS_18460 15650 16927 gene locus_tag LOCUS_18470 15650 16927 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682130.1 protein_id gnl|my_center|LOCUS_18470 16946 17512 gene locus_tag LOCUS_18480 16946 17512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 17526 17963 gene locus_tag LOCUS_18490 17526 17963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669743.1 protein_id gnl|my_center|LOCUS_18490 17976 18389 gene locus_tag LOCUS_18500 17976 18389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 19823 18516 gene locus_tag LOCUS_18510 gene hisS 19823 18516 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679075.1 protein_id gnl|my_center|LOCUS_18510 19876 20679 gene locus_tag LOCUS_18520 19876 20679 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_18520 20752 21897 gene locus_tag LOCUS_18530 20752 21897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 24398 21894 gene locus_tag LOCUS_18540 24398 21894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 25875 24400 gene locus_tag LOCUS_18550 25875 24400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920589.1 protein_id gnl|my_center|LOCUS_18550 25944 28040 gene locus_tag LOCUS_18560 gene uvrC 25944 28040 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680446.1 protein_id gnl|my_center|LOCUS_18560 28806 28150 gene locus_tag LOCUS_18570 28806 28150 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902990.1 protein_id gnl|my_center|LOCUS_18570 29471 28806 gene locus_tag LOCUS_18580 29471 28806 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861637.1 protein_id gnl|my_center|LOCUS_18580 30896 29529 gene locus_tag LOCUS_18590 30896 29529 CDS product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015878.1 protein_id gnl|my_center|LOCUS_18590 31217 34141 gene locus_tag LOCUS_18600 31217 34141 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680942.1 protein_id gnl|my_center|LOCUS_18600 35017 34319 gene locus_tag LOCUS_18610 35017 34319 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_18610 38115 35017 gene locus_tag LOCUS_18620 38115 35017 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681375.1 protein_id gnl|my_center|LOCUS_18620 39918 38128 gene locus_tag LOCUS_18630 39918 38128 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681379.1 protein_id gnl|my_center|LOCUS_18630 41297 39915 gene locus_tag LOCUS_18640 41297 39915 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065307.1 protein_id gnl|my_center|LOCUS_18640 43747 41306 gene locus_tag LOCUS_18650 43747 41306 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681381.1 protein_id gnl|my_center|LOCUS_18650 43950 47594 gene locus_tag LOCUS_18660 43950 47594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 48527 48099 gene locus_tag LOCUS_18670 gene mutT 48527 48099 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681243.1 protein_id gnl|my_center|LOCUS_18670 49653 48628 gene locus_tag LOCUS_18680 49653 48628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 50972 49851 gene locus_tag LOCUS_18690 50972 49851 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_18690 51402 52022 gene locus_tag LOCUS_18700 51402 52022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 52062 52331 gene locus_tag LOCUS_18710 52062 52331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 54621 52312 gene locus_tag LOCUS_18720 54621 52312 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680253.1 protein_id gnl|my_center|LOCUS_18720 56125 54707 gene locus_tag LOCUS_18730 gene rimO 56125 54707 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680609.1 protein_id gnl|my_center|LOCUS_18730 57212 56118 gene locus_tag LOCUS_18740 57212 56118 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680601.1 protein_id gnl|my_center|LOCUS_18740 57907 57224 gene locus_tag LOCUS_18750 57907 57224 CDS product outer-membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673641.1 protein_id gnl|my_center|LOCUS_18750 60053 58035 gene locus_tag LOCUS_18760 gene ftsH 60053 58035 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666001.1 protein_id gnl|my_center|LOCUS_18760 60230 60670 gene locus_tag LOCUS_18770 gene fliS 60230 60670 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080180.1 protein_id gnl|my_center|LOCUS_18770 60715 61194 gene locus_tag LOCUS_18780 60715 61194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680977.1 protein_id gnl|my_center|LOCUS_18780 61201 61716 gene locus_tag LOCUS_18790 gene folA 61201 61716 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073447.1 protein_id gnl|my_center|LOCUS_18790 61812 63065 gene locus_tag LOCUS_18800 61812 63065 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667421.1 protein_id gnl|my_center|LOCUS_18800 63052 65058 gene locus_tag LOCUS_18810 63052 65058 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680470.1 protein_id gnl|my_center|LOCUS_18810 65112 65945 gene locus_tag LOCUS_18820 65112 65945 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107810.1 protein_id gnl|my_center|LOCUS_18820 66326 65970 gene locus_tag LOCUS_18830 66326 65970 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679887.1 protein_id gnl|my_center|LOCUS_18830 66452 66670 gene locus_tag LOCUS_18840 gene infA 66452 66670 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668257.1 protein_id gnl|my_center|LOCUS_18840 67260 66679 gene locus_tag LOCUS_18850 67260 66679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 67860 67291 gene locus_tag LOCUS_18860 67860 67291 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678761.1 protein_id gnl|my_center|LOCUS_18860 >Feature sequence15 245 1972 gene locus_tag LOCUS_18870 245 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 1999 3630 gene locus_tag LOCUS_18880 1999 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 5275 3911 gene locus_tag LOCUS_18890 5275 3911 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_18890 9577 5297 gene locus_tag LOCUS_18900 gene carB 9577 5297 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862003.1 protein_id gnl|my_center|LOCUS_18900 10469 9603 gene locus_tag LOCUS_18910 10469 9603 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703715.1 protein_id gnl|my_center|LOCUS_18910 11224 10466 gene locus_tag LOCUS_18920 11224 10466 CDS product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765435.1 protein_id gnl|my_center|LOCUS_18920 12348 11233 gene locus_tag LOCUS_18930 12348 11233 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261512.1 protein_id gnl|my_center|LOCUS_18930 12388 15492 gene locus_tag LOCUS_18940 12388 15492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 16053 16310 gene locus_tag LOCUS_18950 16053 16310 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551687.1 protein_id gnl|my_center|LOCUS_18950 16331 16579 gene locus_tag LOCUS_18960 16331 16579 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707160.1 protein_id gnl|my_center|LOCUS_18960 16758 18815 gene locus_tag LOCUS_18970 16758 18815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 19153 20211 gene locus_tag LOCUS_18980 gene ulaG 19153 20211 CDS product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010427455.1 protein_id gnl|my_center|LOCUS_18980 20238 21281 gene locus_tag LOCUS_18990 20238 21281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837545.1 protein_id gnl|my_center|LOCUS_18990 21347 22816 gene locus_tag LOCUS_19000 21347 22816 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288827.1 protein_id gnl|my_center|LOCUS_19000 22979 23290 gene locus_tag LOCUS_19010 22979 23290 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899074.1 protein_id gnl|my_center|LOCUS_19010 23312 24157 gene locus_tag LOCUS_19020 gene ybhA 23312 24157 CDS product bifunctional pyridoxal phosphate/fructose-1,6-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005049371.1 protein_id gnl|my_center|LOCUS_19020 24220 24690 gene locus_tag LOCUS_19030 gene ulaC 24220 24690 CDS product PTS ascorbate transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776505.1 protein_id gnl|my_center|LOCUS_19030 24716 24976 gene locus_tag LOCUS_19040 24716 24976 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_19040 25231 26865 gene locus_tag LOCUS_19050 gene ptsP 25231 26865 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174221.1 protein_id gnl|my_center|LOCUS_19050 26862 27713 gene locus_tag LOCUS_19060 26862 27713 CDS product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095306.1 protein_id gnl|my_center|LOCUS_19060 28397 30136 gene locus_tag LOCUS_19070 gene pheT 28397 30136 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957104.1 protein_id gnl|my_center|LOCUS_19070 30642 30908 gene locus_tag LOCUS_19080 30642 30908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 30999 31172 gene locus_tag LOCUS_19090 30999 31172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 31183 31722 gene locus_tag LOCUS_19100 31183 31722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 31856 33682 gene locus_tag LOCUS_19110 gene aspS 31856 33682 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679265.1 protein_id gnl|my_center|LOCUS_19110 33895 34635 gene locus_tag LOCUS_19120 33895 34635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 34668 35846 gene locus_tag LOCUS_19130 34668 35846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 36216 36527 gene locus_tag LOCUS_19140 gene trxA 36216 36527 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405369.1 protein_id gnl|my_center|LOCUS_19140 36620 37213 gene locus_tag LOCUS_19150 36620 37213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 37893 39398 gene locus_tag LOCUS_19160 37893 39398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 39441 40118 gene locus_tag LOCUS_19170 39441 40118 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059661.1 protein_id gnl|my_center|LOCUS_19170 40111 40962 gene locus_tag LOCUS_19180 40111 40962 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_19180 41282 41593 gene locus_tag LOCUS_19190 41282 41593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 42967 41660 gene locus_tag LOCUS_19200 42967 41660 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116269310.1 protein_id gnl|my_center|LOCUS_19200 43671 43090 gene locus_tag LOCUS_19210 43671 43090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 44635 43655 gene locus_tag LOCUS_19220 44635 43655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19220 45448 44705 gene locus_tag LOCUS_19230 45448 44705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19230 45563 46993 gene locus_tag LOCUS_19240 45563 46993 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671898.1 protein_id gnl|my_center|LOCUS_19240 47005 47568 gene locus_tag LOCUS_19250 47005 47568 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023189990.1 protein_id gnl|my_center|LOCUS_19250 47660 50398 gene locus_tag LOCUS_19260 47660 50398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 50388 51323 gene locus_tag LOCUS_19270 gene manA 50388 51323 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232833.1 protein_id gnl|my_center|LOCUS_19270 51329 52039 gene locus_tag LOCUS_19280 51329 52039 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_19280 52131 53360 gene locus_tag LOCUS_19290 52131 53360 CDS product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681770.1 protein_id gnl|my_center|LOCUS_19290 53532 55037 gene locus_tag LOCUS_19300 53532 55037 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048209.1 protein_id gnl|my_center|LOCUS_19300 55055 56317 gene locus_tag LOCUS_19310 55055 56317 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940986.1 protein_id gnl|my_center|LOCUS_19310 56460 58094 gene locus_tag LOCUS_19320 56460 58094 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461744.1 protein_id gnl|my_center|LOCUS_19320 59066 58197 gene locus_tag LOCUS_19330 gene amrB 59066 58197 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680506.1 protein_id gnl|my_center|LOCUS_19330 61901 59199 gene locus_tag LOCUS_19340 61901 59199 CDS product DUF3160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680507.1 protein_id gnl|my_center|LOCUS_19340 63679 62213 gene locus_tag LOCUS_19350 63679 62213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 64472 63876 gene locus_tag LOCUS_19360 64472 63876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 65179 64469 gene locus_tag LOCUS_19370 65179 64469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 67000 65255 gene locus_tag LOCUS_19380 67000 65255 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682014.1 protein_id gnl|my_center|LOCUS_19380 >Feature sequence16 458 790 gene locus_tag LOCUS_19390 458 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 813 3533 gene locus_tag LOCUS_19400 813 3533 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_19400 5036 3711 gene locus_tag LOCUS_19410 5036 3711 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022819390.1 protein_id gnl|my_center|LOCUS_19410 5840 5061 gene locus_tag LOCUS_19420 5840 5061 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204588.1 protein_id gnl|my_center|LOCUS_19420 6088 6834 gene locus_tag LOCUS_19430 gene gpmA 6088 6834 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670958.1 protein_id gnl|my_center|LOCUS_19430 7786 6872 gene locus_tag LOCUS_19440 7786 6872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 8148 7795 gene locus_tag LOCUS_19450 8148 7795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 10364 8163 gene locus_tag LOCUS_19460 10364 8163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 14308 10448 gene locus_tag LOCUS_19470 14308 10448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 14504 15355 gene locus_tag LOCUS_19480 14504 15355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680551.1 protein_id gnl|my_center|LOCUS_19480 15370 17595 gene locus_tag LOCUS_19490 15370 17595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 18426 17719 gene locus_tag LOCUS_19500 18426 17719 CDS product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584036.1 protein_id gnl|my_center|LOCUS_19500 19154 18627 gene locus_tag LOCUS_19510 19154 18627 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_19510 20227 19154 gene locus_tag LOCUS_19520 20227 19154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 21504 20473 gene locus_tag LOCUS_19530 gene asnA 21504 20473 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108145.1 protein_id gnl|my_center|LOCUS_19530 22092 21559 gene locus_tag LOCUS_19540 22092 21559 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678446.1 protein_id gnl|my_center|LOCUS_19540 23191 22163 gene locus_tag LOCUS_19550 gene tsaD 23191 22163 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680472.1 protein_id gnl|my_center|LOCUS_19550 23731 23213 gene locus_tag LOCUS_19560 23731 23213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 24004 27819 gene locus_tag LOCUS_19570 24004 27819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 27913 28374 gene locus_tag LOCUS_19580 27913 28374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 28579 29571 gene locus_tag LOCUS_19590 28579 29571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 29568 30761 gene locus_tag LOCUS_19600 29568 30761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 31963 31676 gene locus_tag LOCUS_19610 31963 31676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 32075 32473 gene locus_tag LOCUS_19620 32075 32473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 32526 34979 gene locus_tag LOCUS_19630 32526 34979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 34976 36670 gene locus_tag LOCUS_19640 34976 36670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 37513 36785 gene locus_tag LOCUS_19650 37513 36785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 38362 39066 gene locus_tag LOCUS_19660 38362 39066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 39433 40359 gene locus_tag LOCUS_19670 gene cas1 39433 40359 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_19670 40361 40699 gene locus_tag LOCUS_19680 gene cas2 40361 40699 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 protein_id gnl|my_center|LOCUS_19680 40801 >41155 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gctattatacatcaaaattagaaatcaaaccacaac >Feature sequence17 1185 232 gene locus_tag LOCUS_19690 1185 232 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_19690 1654 1160 gene locus_tag LOCUS_19700 1654 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 2106 3002 gene locus_tag LOCUS_19710 2106 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 2996 3760 gene locus_tag LOCUS_19720 gene hisF 2996 3760 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937595.1 protein_id gnl|my_center|LOCUS_19720 4143 3832 gene locus_tag LOCUS_19730 4143 3832 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063142.1 protein_id gnl|my_center|LOCUS_19730 4450 4118 gene locus_tag LOCUS_19740 4450 4118 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928690.1 protein_id gnl|my_center|LOCUS_19740 5384 4824 gene locus_tag LOCUS_19750 5384 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 6103 7029 gene locus_tag LOCUS_19760 6103 7029 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801609.1 protein_id gnl|my_center|LOCUS_19760 7026 7781 gene locus_tag LOCUS_19770 7026 7781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 8969 7941 gene locus_tag LOCUS_19780 8969 7941 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969388.1 protein_id gnl|my_center|LOCUS_19780 10184 9102 gene locus_tag LOCUS_19790 10184 9102 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_19790 11972 10287 gene locus_tag LOCUS_19800 11972 10287 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626058.1 protein_id gnl|my_center|LOCUS_19800 12127 12984 gene locus_tag LOCUS_19810 12127 12984 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296639.1 protein_id gnl|my_center|LOCUS_19810 12981 14432 gene locus_tag LOCUS_19820 gene gnd 12981 14432 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225759.1 protein_id gnl|my_center|LOCUS_19820 15112 14711 gene locus_tag LOCUS_19830 gene queD 15112 14711 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938647.1 protein_id gnl|my_center|LOCUS_19830 15809 15153 gene locus_tag LOCUS_19840 15809 15153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 18080 15888 gene locus_tag LOCUS_19850 18080 15888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 18239 19840 gene locus_tag LOCUS_19860 gene murD 18239 19840 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956725.1 protein_id gnl|my_center|LOCUS_19860 20430 20191 gene locus_tag LOCUS_19870 20430 20191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 20695 21453 gene locus_tag LOCUS_19880 20695 21453 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065707.1 protein_id gnl|my_center|LOCUS_19880 21450 21782 gene locus_tag LOCUS_19890 21450 21782 CDS product branched-chain amino acid transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065708.1 protein_id gnl|my_center|LOCUS_19890 21986 23179 gene locus_tag LOCUS_19900 21986 23179 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081574.1 protein_id gnl|my_center|LOCUS_19900 23176 24120 gene locus_tag LOCUS_19910 23176 24120 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015835.1 protein_id gnl|my_center|LOCUS_19910 24117 24989 gene locus_tag LOCUS_19920 24117 24989 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627435.1 protein_id gnl|my_center|LOCUS_19920 25410 27206 gene locus_tag LOCUS_19930 25410 27206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 27799 28851 gene locus_tag LOCUS_19940 27799 28851 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943878.1 protein_id gnl|my_center|LOCUS_19940 28926 29222 gene locus_tag LOCUS_19950 28926 29222 CDS product DUF4298 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837143.1 protein_id gnl|my_center|LOCUS_19950 29311 30630 gene locus_tag LOCUS_19960 29311 30630 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681866.1 protein_id gnl|my_center|LOCUS_19960 31287 30685 gene locus_tag LOCUS_19970 31287 30685 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681594.1 protein_id gnl|my_center|LOCUS_19970 31344 32009 gene locus_tag LOCUS_19980 gene radC 31344 32009 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682286.1 protein_id gnl|my_center|LOCUS_19980 32117 33727 gene locus_tag LOCUS_19990 32117 33727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 33847 35100 gene locus_tag LOCUS_20000 33847 35100 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679693.1 protein_id gnl|my_center|LOCUS_20000 35350 37347 gene locus_tag LOCUS_20010 gene uvrB 35350 37347 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678935.1 protein_id gnl|my_center|LOCUS_20010 37902 37483 gene locus_tag LOCUS_20020 37902 37483 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671531.1 protein_id gnl|my_center|LOCUS_20020 38205 38026 gene locus_tag LOCUS_20030 38205 38026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 >Feature sequence18 1341 520 gene locus_tag LOCUS_20040 1341 520 CDS product cytidylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956669.1 protein_id gnl|my_center|LOCUS_20040 1508 2077 gene locus_tag LOCUS_20050 1508 2077 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680868.1 protein_id gnl|my_center|LOCUS_20050 2887 2189 gene locus_tag LOCUS_20060 2887 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 3861 2884 gene locus_tag LOCUS_20070 3861 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 4002 4226 gene locus_tag LOCUS_20080 4002 4226 CDS product PC4/YdbC family ssDNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667298.1 protein_id gnl|my_center|LOCUS_20080 5864 4506 gene locus_tag LOCUS_20090 gene radA 5864 4506 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680482.1 protein_id gnl|my_center|LOCUS_20090 7454 6081 gene locus_tag LOCUS_20100 7454 6081 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_20100 7562 9031 gene locus_tag LOCUS_20110 gene rpoN 7562 9031 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054367.1 protein_id gnl|my_center|LOCUS_20110 9222 9515 gene locus_tag LOCUS_20120 9222 9515 CDS product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671537.1 protein_id gnl|my_center|LOCUS_20120 9540 10598 gene locus_tag LOCUS_20130 gene hprK 9540 10598 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062490.1 protein_id gnl|my_center|LOCUS_20130 10619 10885 gene locus_tag LOCUS_20140 10619 10885 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668605.1 protein_id gnl|my_center|LOCUS_20140 10888 11499 gene locus_tag LOCUS_20150 gene lexA 10888 11499 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654116.1 protein_id gnl|my_center|LOCUS_20150 11514 12524 gene locus_tag LOCUS_20160 gene holA 11514 12524 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681969.1 protein_id gnl|my_center|LOCUS_20160 13792 12620 gene locus_tag LOCUS_20170 13792 12620 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_20170 14060 13830 gene locus_tag LOCUS_20180 14060 13830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 15574 14228 gene locus_tag LOCUS_20190 gene gdhA 15574 14228 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_20190 15738 16826 gene locus_tag LOCUS_20200 gene rpsA 15738 16826 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941857.1 protein_id gnl|my_center|LOCUS_20200 17149 16835 gene locus_tag LOCUS_20210 17149 16835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 17272 18441 gene locus_tag LOCUS_20220 gene metK 17272 18441 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680429.1 protein_id gnl|my_center|LOCUS_20220 18459 19097 gene locus_tag LOCUS_20230 gene nth 18459 19097 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255051.1 protein_id gnl|my_center|LOCUS_20230 19182 20066 gene locus_tag LOCUS_20240 19182 20066 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680208.1 protein_id gnl|my_center|LOCUS_20240 21769 20171 gene locus_tag LOCUS_20250 21769 20171 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454621.1 protein_id gnl|my_center|LOCUS_20250 23201 21849 gene locus_tag LOCUS_20260 23201 21849 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667136.1 protein_id gnl|my_center|LOCUS_20260 24423 23239 gene locus_tag LOCUS_20270 24423 23239 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_20270 24917 24423 gene locus_tag LOCUS_20280 24917 24423 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_20280 26452 25217 gene locus_tag LOCUS_20290 26452 25217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 30981 26437 gene locus_tag LOCUS_20300 30981 26437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 >Feature sequence19 807 583 gene locus_tag LOCUS_20310 807 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681036.1 protein_id gnl|my_center|LOCUS_20310 1027 809 gene locus_tag LOCUS_20320 1027 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 1850 2473 gene locus_tag LOCUS_20330 1850 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 2463 3386 gene locus_tag LOCUS_20340 2463 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 4666 3539 gene locus_tag LOCUS_20350 4666 3539 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986366.1 protein_id gnl|my_center|LOCUS_20350 4714 5829 gene locus_tag LOCUS_20360 4714 5829 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956987.1 protein_id gnl|my_center|LOCUS_20360 7291 6038 gene locus_tag LOCUS_20370 gene clpX 7291 6038 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679368.1 protein_id gnl|my_center|LOCUS_20370 7893 7288 gene locus_tag LOCUS_20380 gene clpP 7893 7288 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679367.1 protein_id gnl|my_center|LOCUS_20380 9330 7969 gene locus_tag LOCUS_20390 gene tig 9330 7969 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679366.1 protein_id gnl|my_center|LOCUS_20390 9561 9490 gene locus_tag LOCUS_t00400 9561 9490 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9661 9590 gene locus_tag LOCUS_t00410 9661 9590 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9771 9689 gene locus_tag LOCUS_t00420 9771 9689 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9882 9810 gene locus_tag LOCUS_t00430 9882 9810 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 10081 10006 gene locus_tag LOCUS_t00440 10081 10006 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10172 10100 gene locus_tag LOCUS_t00450 10172 10100 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 10981 10307 gene locus_tag LOCUS_20400 10981 10307 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670541.1 protein_id gnl|my_center|LOCUS_20400 13080 10993 gene locus_tag LOCUS_20410 gene fusA 13080 10993 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682356.1 protein_id gnl|my_center|LOCUS_20410 13340 13627 gene locus_tag LOCUS_20420 13340 13627 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582790.1 protein_id gnl|my_center|LOCUS_20420 13679 14593 gene locus_tag LOCUS_20430 13679 14593 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680667.1 protein_id gnl|my_center|LOCUS_20430 15103 14606 gene locus_tag LOCUS_20440 15103 14606 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 protein_id gnl|my_center|LOCUS_20440 16431 15205 gene locus_tag LOCUS_20450 16431 15205 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966565.1 protein_id gnl|my_center|LOCUS_20450 17506 16424 gene locus_tag LOCUS_20460 gene sufD 17506 16424 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681871.1 protein_id gnl|my_center|LOCUS_20460 18987 17569 gene locus_tag LOCUS_20470 gene sufB 18987 17569 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 protein_id gnl|my_center|LOCUS_20470 19751 18999 gene locus_tag LOCUS_20480 gene sufC 19751 18999 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966562.1 protein_id gnl|my_center|LOCUS_20480 20444 21661 gene locus_tag LOCUS_20490 20444 21661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 >Feature sequence20 384 1877 gene locus_tag LOCUS_20500 384 1877 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674379.1 protein_id gnl|my_center|LOCUS_20500 2723 1899 gene locus_tag LOCUS_20510 2723 1899 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673320.1 protein_id gnl|my_center|LOCUS_20510 3894 2746 gene locus_tag LOCUS_20520 3894 2746 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870021.1 protein_id gnl|my_center|LOCUS_20520 4277 3990 gene locus_tag LOCUS_20530 4277 3990 CDS product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666518.1 protein_id gnl|my_center|LOCUS_20530 5025 4300 gene locus_tag LOCUS_20540 gene rsmI 5025 4300 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681097.1 protein_id gnl|my_center|LOCUS_20540 5561 5130 gene locus_tag LOCUS_20550 gene fabZ 5561 5130 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670104.1 protein_id gnl|my_center|LOCUS_20550 6994 5741 gene locus_tag LOCUS_20560 gene fabF 6994 5741 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673329.1 protein_id gnl|my_center|LOCUS_20560 7979 7020 gene locus_tag LOCUS_20570 7979 7020 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681776.1 protein_id gnl|my_center|LOCUS_20570 8359 8757 gene locus_tag LOCUS_20580 8359 8757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 10289 8937 gene locus_tag LOCUS_20590 10289 8937 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681109.1 protein_id gnl|my_center|LOCUS_20590 >Feature sequence21 331 1821 gene locus_tag LOCUS_20600 331 1821 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_20600 2113 3426 gene locus_tag LOCUS_20610 2113 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 4143 3874 gene locus_tag LOCUS_20620 4143 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 4577 4326 gene locus_tag LOCUS_20630 4577 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 4796 4581 gene locus_tag LOCUS_20640 4796 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640