>Feature sequence01 1104 370 gene locus_tag LOCUS_0010 1104 370 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992285.1 protein_id gnl|my_center|LOCUS_0010 1362 1862 gene locus_tag LOCUS_0020 1362 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0020 3558 2359 gene locus_tag LOCUS_0030 3558 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0030 4057 3674 gene locus_tag LOCUS_0040 4057 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0040 4319 4050 gene locus_tag LOCUS_0050 4319 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0050 4641 5396 gene locus_tag LOCUS_0060 4641 5396 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957934.1 protein_id gnl|my_center|LOCUS_0060 5383 5931 gene locus_tag LOCUS_0070 5383 5931 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261942.1 protein_id gnl|my_center|LOCUS_0070 6940 6347 gene locus_tag LOCUS_0080 6940 6347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0080 7285 7848 gene locus_tag LOCUS_0090 7285 7848 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223369.1 protein_id gnl|my_center|LOCUS_0090 8245 7904 gene locus_tag LOCUS_0100 8245 7904 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481539.1 protein_id gnl|my_center|LOCUS_0100 10893 8278 gene locus_tag LOCUS_0110 gene clpB 10893 8278 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941319.1 protein_id gnl|my_center|LOCUS_0110 11032 11649 gene locus_tag LOCUS_0120 11032 11649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0120 14595 11689 gene locus_tag LOCUS_0130 14595 11689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0130 14598 15563 gene locus_tag LOCUS_0140 14598 15563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0140 15574 15999 gene locus_tag LOCUS_0150 gene smpB 15574 15999 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379627.1 protein_id gnl|my_center|LOCUS_0150 18362 16557 gene locus_tag LOCUS_0160 18362 16557 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015020.1 protein_id gnl|my_center|LOCUS_0160 19495 18359 gene locus_tag LOCUS_0170 19495 18359 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965529.1 protein_id gnl|my_center|LOCUS_0170 20167 19763 gene locus_tag LOCUS_0180 20167 19763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0180 20845 20288 gene locus_tag LOCUS_0190 20845 20288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621286.1 protein_id gnl|my_center|LOCUS_0190 21028 21999 gene locus_tag LOCUS_0200 gene galT 21028 21999 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438360.1 protein_id gnl|my_center|LOCUS_0200 22012 23100 gene locus_tag LOCUS_0210 22012 23100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0210 24043 23180 gene locus_tag LOCUS_0220 24043 23180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0220 24732 24196 gene locus_tag LOCUS_0230 24732 24196 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080770.1 protein_id gnl|my_center|LOCUS_0230 24974 24729 gene locus_tag LOCUS_0240 24974 24729 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080491.1 protein_id gnl|my_center|LOCUS_0240 25299 24976 gene locus_tag LOCUS_0250 25299 24976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0250 25503 28061 gene locus_tag LOCUS_0260 25503 28061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0260 28054 29364 gene locus_tag LOCUS_0270 28054 29364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0270 30231 29359 gene locus_tag LOCUS_0280 30231 29359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0280 30750 30232 gene locus_tag LOCUS_0290 30750 30232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0290 32152 30887 gene locus_tag LOCUS_0300 32152 30887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0300 32733 32149 gene locus_tag LOCUS_0310 32733 32149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0310 32967 32743 gene locus_tag LOCUS_0320 32967 32743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0320 34014 33193 gene locus_tag LOCUS_0330 34014 33193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0330 35263 34142 gene locus_tag LOCUS_0340 35263 34142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0340 35431 35724 gene locus_tag LOCUS_0350 35431 35724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0350 35731 36375 gene locus_tag LOCUS_0360 35731 36375 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863385.1 protein_id gnl|my_center|LOCUS_0360 37592 36381 gene locus_tag LOCUS_0370 gene tgt 37592 36381 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776643.1 protein_id gnl|my_center|LOCUS_0370 38679 37792 gene locus_tag LOCUS_0380 38679 37792 CDS product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890749.1 protein_id gnl|my_center|LOCUS_0380 38711 39265 gene locus_tag LOCUS_0390 38711 39265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0390 39267 39767 gene locus_tag LOCUS_0400 39267 39767 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762785.1 protein_id gnl|my_center|LOCUS_0400 39959 39813 gene locus_tag LOCUS_0410 39959 39813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0410 40087 41589 gene locus_tag LOCUS_0420 40087 41589 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546463.1 protein_id gnl|my_center|LOCUS_0420 41795 41613 gene locus_tag LOCUS_0430 41795 41613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0430 45530 42048 gene locus_tag LOCUS_0440 45530 42048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0440 45649 46194 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cctttttccccatatttttcgggg 46436 47377 gene locus_tag LOCUS_0450 46436 47377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0450 47994 47641 gene locus_tag LOCUS_0460 47994 47641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0460 48014 48487 gene locus_tag LOCUS_0470 48014 48487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0470 48492 48869 gene locus_tag LOCUS_0480 48492 48869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0480 48871 49689 gene locus_tag LOCUS_0490 48871 49689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0490 50417 49947 gene locus_tag LOCUS_0500 50417 49947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0500 53348 51558 gene locus_tag LOCUS_0510 gene proS 53348 51558 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814310.1 protein_id gnl|my_center|LOCUS_0510 53571 54074 gene locus_tag LOCUS_0520 53571 54074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0520 54781 54071 gene locus_tag LOCUS_0530 54781 54071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0530 56033 54765 gene locus_tag LOCUS_0540 56033 54765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0540 56361 56161 gene locus_tag LOCUS_0550 56361 56161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0550 >Feature sequence02 1789 842 gene locus_tag LOCUS_0560 1789 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0560 2688 1789 gene locus_tag LOCUS_0570 2688 1789 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_0570 4160 2787 gene locus_tag LOCUS_0580 4160 2787 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258704.1 protein_id gnl|my_center|LOCUS_0580 4845 4189 gene locus_tag LOCUS_0590 4845 4189 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957632.1 protein_id gnl|my_center|LOCUS_0590 4895 5596 gene locus_tag LOCUS_0600 4895 5596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0600 5721 7445 gene locus_tag LOCUS_0610 gene dnaG 5721 7445 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546187.1 protein_id gnl|my_center|LOCUS_0610 7420 8511 gene locus_tag LOCUS_0620 gene rpoD 7420 8511 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764065.1 protein_id gnl|my_center|LOCUS_0620 8823 8748 gene locus_tag LOCUS_t0010 8823 8748 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9104 8907 gene locus_tag LOCUS_0630 9104 8907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0630 9280 9897 gene locus_tag LOCUS_0640 gene lexA 9280 9897 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413738.1 protein_id gnl|my_center|LOCUS_0640 10200 12797 gene locus_tag LOCUS_0650 10200 12797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0650 12977 14110 gene locus_tag LOCUS_0660 12977 14110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0660 15377 14166 gene locus_tag LOCUS_0670 15377 14166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0670 15517 16650 gene locus_tag LOCUS_0680 15517 16650 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947961.1 protein_id gnl|my_center|LOCUS_0680 16788 17210 gene locus_tag LOCUS_0690 16788 17210 CDS product DUF1761 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553178.1 protein_id gnl|my_center|LOCUS_0690 17219 17728 gene locus_tag LOCUS_0700 17219 17728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0700 17736 19514 gene locus_tag LOCUS_0710 17736 19514 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_0710 19793 19966 gene locus_tag LOCUS_0720 19793 19966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0720 20012 21115 gene locus_tag LOCUS_0730 20012 21115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_0730 21102 22715 gene locus_tag LOCUS_0740 21102 22715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0740 23286 24311 gene locus_tag LOCUS_0750 23286 24311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0750 24323 25624 gene locus_tag LOCUS_0760 gene obgE 24323 25624 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082646.1 protein_id gnl|my_center|LOCUS_0760 25893 27854 gene locus_tag LOCUS_0770 25893 27854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0770 28174 28098 gene locus_tag LOCUS_t0020 28174 28098 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 29070 28261 gene locus_tag LOCUS_0780 29070 28261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0780 30303 29071 gene locus_tag LOCUS_0790 gene icaA 30303 29071 CDS product poly-beta-1,6 N-acetyl-D-glucosamine synthase IcaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159430.1 protein_id gnl|my_center|LOCUS_0790 31030 30293 gene locus_tag LOCUS_0800 31030 30293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0800 31796 31020 gene locus_tag LOCUS_0810 31796 31020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0810 32081 32317 gene locus_tag LOCUS_0820 32081 32317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0820 32337 33698 gene locus_tag LOCUS_0830 32337 33698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0830 34123 34260 gene locus_tag LOCUS_0840 34123 34260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0840 34349 34425 gene locus_tag LOCUS_t0030 34349 34425 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 34450 36876 gene locus_tag LOCUS_0850 gene leuS 34450 36876 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082796.1 protein_id gnl|my_center|LOCUS_0850 37018 37182 gene locus_tag LOCUS_0860 37018 37182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0860 37197 37673 gene locus_tag LOCUS_0870 gene nusB 37197 37673 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909412.1 protein_id gnl|my_center|LOCUS_0870 37657 38166 gene locus_tag LOCUS_0880 37657 38166 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284381.1 protein_id gnl|my_center|LOCUS_0880 38166 38888 gene locus_tag LOCUS_0890 gene rnc 38166 38888 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354946.1 protein_id gnl|my_center|LOCUS_0890 38917 39549 gene locus_tag LOCUS_0900 38917 39549 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763353.1 protein_id gnl|my_center|LOCUS_0900 39569 40033 gene locus_tag LOCUS_0910 39569 40033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0910 41027 40590 gene locus_tag LOCUS_0920 41027 40590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0920 41097 41171 gene locus_tag LOCUS_t0040 41097 41171 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 41287 41628 gene locus_tag LOCUS_0930 gene rpsF 41287 41628 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_0930 41628 42068 gene locus_tag LOCUS_0940 41628 42068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0940 42091 42339 gene locus_tag LOCUS_0950 42091 42339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0950 42346 42903 gene locus_tag LOCUS_0960 gene efp 42346 42903 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886767.1 protein_id gnl|my_center|LOCUS_0960 43214 43138 gene locus_tag LOCUS_t0050 43214 43138 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 43393 44535 gene locus_tag LOCUS_0970 43393 44535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0970 44648 48715 gene locus_tag LOCUS_0980 44648 48715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0980 48721 48978 gene locus_tag LOCUS_0990 48721 48978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0990 <50280 49387 gene locus_tag LOCUS_1000 <50280 49387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048370.1:glycine--tRNA ligase >Feature sequence03 573 289 gene locus_tag LOCUS_1010 573 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1010 950 1780 gene locus_tag LOCUS_1020 950 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1020 1901 2740 gene locus_tag LOCUS_1030 1901 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1030 2837 3205 gene locus_tag LOCUS_1040 2837 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1040 3426 3602 gene locus_tag LOCUS_1050 3426 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1050 3634 5250 gene locus_tag LOCUS_1060 3634 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1060 5269 5193 gene locus_tag LOCUS_t0060 5269 5193 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5598 5302 gene locus_tag LOCUS_1070 gene sodX 5598 5302 CDS product nickel-type superoxide dismutase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235619530.1 protein_id gnl|my_center|LOCUS_1070 6056 5604 gene locus_tag LOCUS_1080 gene sodN 6056 5604 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_1080 6192 7625 gene locus_tag LOCUS_1090 6192 7625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1090 7641 8570 gene locus_tag LOCUS_1100 7641 8570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1100 9871 10689 gene locus_tag LOCUS_1110 9871 10689 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966848.1 protein_id gnl|my_center|LOCUS_1110 10689 12182 gene locus_tag LOCUS_1120 10689 12182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1120 12386 12895 gene locus_tag LOCUS_1130 12386 12895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1130 13553 13281 gene locus_tag LOCUS_1140 13553 13281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1140 13748 13672 gene locus_tag LOCUS_t0070 13748 13672 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13874 13784 gene locus_tag LOCUS_t0080 13874 13784 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15892 14261 gene locus_tag LOCUS_1150 15892 14261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1150 16510 15902 gene locus_tag LOCUS_1160 16510 15902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1160 17226 16522 gene locus_tag LOCUS_1170 17226 16522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1170 17933 17235 gene locus_tag LOCUS_1180 17933 17235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1180 19313 17988 gene locus_tag LOCUS_1190 19313 17988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1190 20082 19411 gene locus_tag LOCUS_1200 20082 19411 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810564.1 protein_id gnl|my_center|LOCUS_1200 20917 21375 gene locus_tag LOCUS_1210 20917 21375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1210 21378 23033 gene locus_tag LOCUS_1220 21378 23033 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065424.1 protein_id gnl|my_center|LOCUS_1220 23117 25783 gene locus_tag LOCUS_1230 23117 25783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1230 25780 26247 gene locus_tag LOCUS_1240 25780 26247 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132361.1 protein_id gnl|my_center|LOCUS_1240 26244 27155 gene locus_tag LOCUS_1250 26244 27155 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080497.1 protein_id gnl|my_center|LOCUS_1250 27148 27936 gene locus_tag LOCUS_1260 27148 27936 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258912.1 protein_id gnl|my_center|LOCUS_1260 28231 27986 gene locus_tag LOCUS_1270 28231 27986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1270 29793 28522 gene locus_tag LOCUS_1280 29793 28522 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 protein_id gnl|my_center|LOCUS_1280 30491 30144 gene locus_tag LOCUS_1290 30491 30144 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288180.1 protein_id gnl|my_center|LOCUS_1290 30645 31076 gene locus_tag LOCUS_1300 30645 31076 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224900.1 protein_id gnl|my_center|LOCUS_1300 31270 32160 gene locus_tag LOCUS_1310 31270 32160 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582702.1 protein_id gnl|my_center|LOCUS_1310 32157 32909 gene locus_tag LOCUS_1320 32157 32909 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673992.1 protein_id gnl|my_center|LOCUS_1320 33141 32935 gene locus_tag LOCUS_1330 33141 32935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1330 33387 34193 gene locus_tag LOCUS_1340 gene ygiD 33387 34193 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339058.1 protein_id gnl|my_center|LOCUS_1340 35314 35595 gene locus_tag LOCUS_1350 35314 35595 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660478.1 protein_id gnl|my_center|LOCUS_1350 35599 37626 gene locus_tag LOCUS_1360 35599 37626 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082373898.1 protein_id gnl|my_center|LOCUS_1360 37623 39092 gene locus_tag LOCUS_1370 37623 39092 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437604.1 protein_id gnl|my_center|LOCUS_1370 40763 39180 gene locus_tag LOCUS_1380 40763 39180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1380 41348 41001 gene locus_tag LOCUS_1390 41348 41001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1390 42159 41473 gene locus_tag LOCUS_1400 42159 41473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1400 43030 42128 gene locus_tag LOCUS_1410 43030 42128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1410 >Feature sequence04 201 653 gene locus_tag LOCUS_1420 201 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_1420 646 3771 gene locus_tag LOCUS_1430 646 3771 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870273.1 protein_id gnl|my_center|LOCUS_1430 3796 4098 gene locus_tag LOCUS_1440 3796 4098 CDS product DUF2087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679502.1 protein_id gnl|my_center|LOCUS_1440 4067 5398 gene locus_tag LOCUS_1450 4067 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1450 5398 5751 gene locus_tag LOCUS_1460 5398 5751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1460 6332 5871 gene locus_tag LOCUS_1470 6332 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1470 6633 6352 gene locus_tag LOCUS_1480 6633 6352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1480 7110 7415 gene locus_tag LOCUS_1490 7110 7415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1490 8201 7710 gene locus_tag LOCUS_1500 gene msrA 8201 7710 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729814.1 protein_id gnl|my_center|LOCUS_1500 8581 8198 gene locus_tag LOCUS_1510 gene msrB 8581 8198 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707354.1 protein_id gnl|my_center|LOCUS_1510 8679 10529 gene locus_tag LOCUS_1520 8679 10529 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642848.1 protein_id gnl|my_center|LOCUS_1520 11018 11374 gene locus_tag LOCUS_1530 11018 11374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1530 11979 11482 gene locus_tag LOCUS_1540 11979 11482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1540 12164 12625 gene locus_tag LOCUS_1550 12164 12625 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131474.1 protein_id gnl|my_center|LOCUS_1550 12679 13035 gene locus_tag LOCUS_1560 12679 13035 CDS product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971845.1 protein_id gnl|my_center|LOCUS_1560 13970 13233 gene locus_tag LOCUS_1570 13970 13233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1570 14514 14083 gene locus_tag LOCUS_1580 14514 14083 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120329.1 protein_id gnl|my_center|LOCUS_1580 14691 15230 gene locus_tag LOCUS_1590 14691 15230 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272617.1 protein_id gnl|my_center|LOCUS_1590 15247 15780 gene locus_tag LOCUS_1600 15247 15780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1600 17085 15880 gene locus_tag LOCUS_1610 17085 15880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1610 17552 17686 gene locus_tag LOCUS_1620 17552 17686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1620 17864 18076 gene locus_tag LOCUS_1630 17864 18076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1630 20435 18681 gene locus_tag LOCUS_1640 gene aspS 20435 18681 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932992.1 protein_id gnl|my_center|LOCUS_1640 21542 20595 gene locus_tag LOCUS_1650 21542 20595 CDS product DUF5996 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929027.1 protein_id gnl|my_center|LOCUS_1650 22194 22451 gene locus_tag LOCUS_1660 22194 22451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1660 22566 22970 gene locus_tag LOCUS_1670 22566 22970 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_1670 23998 23738 gene locus_tag LOCUS_1680 23998 23738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1680 24867 24016 gene locus_tag LOCUS_1690 gene galU 24867 24016 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001920788.1 protein_id gnl|my_center|LOCUS_1690 25150 24854 gene locus_tag LOCUS_1700 25150 24854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1700 25469 25185 gene locus_tag LOCUS_1710 25469 25185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1710 25648 27492 gene locus_tag LOCUS_1720 25648 27492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1720 27839 27750 gene locus_tag LOCUS_t0090 27839 27750 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 28100 30262 gene locus_tag LOCUS_1730 28100 30262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1730 30298 30663 gene locus_tag LOCUS_1740 30298 30663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1740 32470 30671 gene locus_tag LOCUS_1750 32470 30671 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477482.1 protein_id gnl|my_center|LOCUS_1750 32838 32545 gene locus_tag LOCUS_1760 32838 32545 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079596.1 protein_id gnl|my_center|LOCUS_1760 33150 32992 gene locus_tag LOCUS_1770 33150 32992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1770 33252 33176 gene locus_tag LOCUS_t0100 33252 33176 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 34055 33450 gene locus_tag LOCUS_1780 34055 33450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1780 34703 34188 gene locus_tag LOCUS_1790 34703 34188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1790 37340 35940 gene locus_tag LOCUS_1800 37340 35940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1800 40032 37321 gene locus_tag LOCUS_1810 40032 37321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1810 37355 37454 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40963 40169 gene locus_tag LOCUS_1820 40963 40169 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963355.1 protein_id gnl|my_center|LOCUS_1820 41196 41591 gene locus_tag LOCUS_tm0010 41196 41591 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 41621 41696 gene locus_tag LOCUS_t0110 41621 41696 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 <43191 41639 gene locus_tag LOCUS_1830 <43191 41639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393070.1:recombinase family protein >Feature sequence05 875 2215 gene locus_tag LOCUS_1840 875 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1840 2290 4356 gene locus_tag LOCUS_1850 2290 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1850 4349 6577 gene locus_tag LOCUS_1860 4349 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1860 6612 7784 gene locus_tag LOCUS_1870 6612 7784 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_1870 7834 8046 gene locus_tag LOCUS_1880 gene rpmB 7834 8046 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854974.1 protein_id gnl|my_center|LOCUS_1880 8867 8340 gene locus_tag LOCUS_1890 8867 8340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1890 9023 10462 gene locus_tag LOCUS_1900 9023 10462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1900 10607 11242 gene locus_tag LOCUS_1910 10607 11242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1910 11615 12217 gene locus_tag LOCUS_1920 11615 12217 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930880.1 protein_id gnl|my_center|LOCUS_1920 12406 12481 gene locus_tag LOCUS_t0120 12406 12481 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12505 13221 gene locus_tag LOCUS_1930 12505 13221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1930 13479 15182 gene locus_tag LOCUS_1940 13479 15182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1940 15260 15766 gene locus_tag LOCUS_1950 15260 15766 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976789.1 protein_id gnl|my_center|LOCUS_1950 15794 16099 gene locus_tag LOCUS_1960 15794 16099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1960 16165 16845 gene locus_tag LOCUS_1970 16165 16845 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948057.1 protein_id gnl|my_center|LOCUS_1970 16838 17944 gene locus_tag LOCUS_1980 16838 17944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1980 18500 17991 gene locus_tag LOCUS_1990 18500 17991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1990 18871 19356 gene locus_tag LOCUS_2000 18871 19356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2000 20052 20480 gene locus_tag LOCUS_2010 20052 20480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2010 20806 22377 gene locus_tag LOCUS_2020 20806 22377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2020 22388 22819 gene locus_tag LOCUS_2030 22388 22819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2030 23111 22803 gene locus_tag LOCUS_2040 23111 22803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2040 23446 23847 gene locus_tag LOCUS_2050 23446 23847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2050 24264 25085 gene locus_tag LOCUS_2060 24264 25085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2060 25272 27692 gene locus_tag LOCUS_2070 25272 27692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2070 28593 27673 gene locus_tag LOCUS_2080 28593 27673 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939854.1 protein_id gnl|my_center|LOCUS_2080 29222 28788 gene locus_tag LOCUS_2090 29222 28788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2090 29902 29249 gene locus_tag LOCUS_2100 29902 29249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2100 29973 30377 gene locus_tag LOCUS_2110 29973 30377 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064752.1 protein_id gnl|my_center|LOCUS_2110 30377 31141 gene locus_tag LOCUS_2120 30377 31141 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119813.1 protein_id gnl|my_center|LOCUS_2120 31146 31691 gene locus_tag LOCUS_2130 31146 31691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2130 31695 32420 gene locus_tag LOCUS_2140 31695 32420 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143609.1 protein_id gnl|my_center|LOCUS_2140 33871 34929 gene locus_tag LOCUS_2150 33871 34929 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030441.1 protein_id gnl|my_center|LOCUS_2150 35067 36011 gene locus_tag LOCUS_2160 35067 36011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2160 36039 37568 gene locus_tag LOCUS_2170 36039 37568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2170 37574 38860 gene locus_tag LOCUS_2180 37574 38860 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545053.1 protein_id gnl|my_center|LOCUS_2180 39796 39095 gene locus_tag LOCUS_2190 gene rsmI 39796 39095 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081030.1 protein_id gnl|my_center|LOCUS_2190 40011 40400 gene locus_tag LOCUS_2200 40011 40400 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_2200 41677 40643 gene locus_tag LOCUS_2210 41677 40643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2210 >Feature sequence06 302 2134 gene locus_tag LOCUS_2220 gene mnmG 302 2134 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249657.1 protein_id gnl|my_center|LOCUS_2220 2318 2485 gene locus_tag LOCUS_2230 2318 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2230 2694 2530 gene locus_tag LOCUS_2240 2694 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_2240 3207 3662 gene locus_tag LOCUS_2250 3207 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2250 4876 4223 gene locus_tag LOCUS_2260 4876 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2260 5901 4873 gene locus_tag LOCUS_2270 5901 4873 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096867.1 protein_id gnl|my_center|LOCUS_2270 6308 9817 gene locus_tag LOCUS_2280 gene dnaE 6308 9817 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129735450.1 protein_id gnl|my_center|LOCUS_2280 10595 11710 gene locus_tag LOCUS_2290 10595 11710 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258067.1 protein_id gnl|my_center|LOCUS_2290 11787 12110 gene locus_tag LOCUS_2300 11787 12110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2300 12110 13207 gene locus_tag LOCUS_2310 gene prfA 12110 13207 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199033.1 protein_id gnl|my_center|LOCUS_2310 13132 13974 gene locus_tag LOCUS_2320 gene prmC 13132 13974 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257490.1 protein_id gnl|my_center|LOCUS_2320 14260 13964 gene locus_tag LOCUS_2330 14260 13964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2330 14479 15210 gene locus_tag LOCUS_2340 gene rpsB 14479 15210 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111661.1 protein_id gnl|my_center|LOCUS_2340 15241 15825 gene locus_tag LOCUS_2350 gene tsf 15241 15825 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545220.1 protein_id gnl|my_center|LOCUS_2350 15828 16379 gene locus_tag LOCUS_2360 gene frr 15828 16379 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965096.1 protein_id gnl|my_center|LOCUS_2360 16380 17066 gene locus_tag LOCUS_2370 16380 17066 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906326.1 protein_id gnl|my_center|LOCUS_2370 17063 18145 gene locus_tag LOCUS_2380 gene rseP 17063 18145 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430605.1 protein_id gnl|my_center|LOCUS_2380 18158 18787 gene locus_tag LOCUS_2390 18158 18787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2390 18926 19147 gene locus_tag LOCUS_2400 18926 19147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2400 19140 19703 gene locus_tag LOCUS_2410 gene nusG 19140 19703 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810198.1 protein_id gnl|my_center|LOCUS_2410 19705 20133 gene locus_tag LOCUS_2420 gene rplK 19705 20133 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012548197.1 protein_id gnl|my_center|LOCUS_2420 20197 21018 gene locus_tag LOCUS_2430 gene rplA 20197 21018 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931846.1 protein_id gnl|my_center|LOCUS_2430 21143 21778 gene locus_tag LOCUS_2440 gene tmk 21143 21778 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947128.1 protein_id gnl|my_center|LOCUS_2440 21786 22334 gene locus_tag LOCUS_2450 21786 22334 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183527.1 protein_id gnl|my_center|LOCUS_2450 22543 23748 gene locus_tag LOCUS_2460 22543 23748 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924918.1 protein_id gnl|my_center|LOCUS_2460 23765 25387 gene locus_tag LOCUS_2470 23765 25387 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256261.1 protein_id gnl|my_center|LOCUS_2470 25384 26982 gene locus_tag LOCUS_2480 gene pyrG 25384 26982 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320045.1 protein_id gnl|my_center|LOCUS_2480 27468 27839 gene locus_tag LOCUS_2490 27468 27839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2490 27843 29054 gene locus_tag LOCUS_2500 27843 29054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2500 29041 29325 gene locus_tag LOCUS_2510 gene rpmA 29041 29325 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874345.1 protein_id gnl|my_center|LOCUS_2510 29373 30254 gene locus_tag LOCUS_2520 29373 30254 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001827266.1 protein_id gnl|my_center|LOCUS_2520 30627 30217 gene locus_tag LOCUS_2530 30627 30217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2530 30801 31877 gene locus_tag LOCUS_2540 30801 31877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2540 32891 33115 gene locus_tag LOCUS_2550 32891 33115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2550 33870 33130 gene locus_tag LOCUS_2560 33870 33130 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404464.1 protein_id gnl|my_center|LOCUS_2560 34190 34900 gene locus_tag LOCUS_2570 34190 34900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2570 34909 36096 gene locus_tag LOCUS_2580 34909 36096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2580 36150 36713 gene locus_tag LOCUS_2590 36150 36713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2590 >Feature sequence07 2811 838 gene locus_tag LOCUS_2600 gene topA 2811 838 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547140.1 protein_id gnl|my_center|LOCUS_2600 3752 2829 gene locus_tag LOCUS_2610 gene dprA 3752 2829 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259053.1 protein_id gnl|my_center|LOCUS_2610 4572 4036 gene locus_tag LOCUS_2620 4572 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2620 6063 4597 gene locus_tag LOCUS_2630 gene gltX 6063 4597 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227935.1 protein_id gnl|my_center|LOCUS_2630 7662 6064 gene locus_tag LOCUS_2640 7662 6064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2640 8384 7866 gene locus_tag LOCUS_2650 8384 7866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2650 9399 8368 gene locus_tag LOCUS_2660 gene rodA 9399 8368 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016844.1 protein_id gnl|my_center|LOCUS_2660 12378 9490 gene locus_tag LOCUS_2670 gene ileS 12378 9490 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583781.1 protein_id gnl|my_center|LOCUS_2670 12623 12417 gene locus_tag LOCUS_2680 12623 12417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2680 13286 13098 gene locus_tag LOCUS_2690 13286 13098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2690 14044 13364 gene locus_tag LOCUS_2700 gene trmB 14044 13364 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962539.1 protein_id gnl|my_center|LOCUS_2700 15813 14047 gene locus_tag LOCUS_2710 15813 14047 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932766.1 protein_id gnl|my_center|LOCUS_2710 16840 15806 gene locus_tag LOCUS_2720 16840 15806 CDS product ATP citrate lyase citrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932767.1 protein_id gnl|my_center|LOCUS_2720 17658 17047 gene locus_tag LOCUS_2730 17658 17047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2730 19028 17751 gene locus_tag LOCUS_2740 19028 17751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2740 20557 19025 gene locus_tag LOCUS_2750 20557 19025 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460714.1 protein_id gnl|my_center|LOCUS_2750 21608 20952 gene locus_tag LOCUS_2760 21608 20952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2760 22242 21967 gene locus_tag LOCUS_2770 22242 21967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2770 22325 23491 gene locus_tag LOCUS_2780 22325 23491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2780 26530 23498 gene locus_tag LOCUS_2790 26530 23498 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030467.1 protein_id gnl|my_center|LOCUS_2790 27165 26746 gene locus_tag LOCUS_2800 gene nrdR 27165 26746 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459010.1 protein_id gnl|my_center|LOCUS_2800 28775 27324 gene locus_tag LOCUS_2810 28775 27324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2810 <30057 29117 gene locus_tag LOCUS_2820 <30057 29117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001294722.1:cell division protein FtsA >Feature sequence08 2292 2741 gene locus_tag LOCUS_2830 2292 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2830 5927 3642 gene locus_tag LOCUS_2840 5927 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2840 6458 6368 gene locus_tag LOCUS_t0130 6458 6368 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7497 6499 gene locus_tag LOCUS_2850 7497 6499 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880453.1 protein_id gnl|my_center|LOCUS_2850 9465 7837 gene locus_tag LOCUS_2860 gene groL 9465 7837 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357641.1 protein_id gnl|my_center|LOCUS_2860 9747 9478 gene locus_tag LOCUS_2870 9747 9478 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964086.1 protein_id gnl|my_center|LOCUS_2870 10450 9809 gene locus_tag LOCUS_2880 10450 9809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2880 11805 10447 gene locus_tag LOCUS_2890 11805 10447 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255954.1 protein_id gnl|my_center|LOCUS_2890 12032 13057 gene locus_tag LOCUS_2900 12032 13057 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462256.1 protein_id gnl|my_center|LOCUS_2900 13060 14076 gene locus_tag LOCUS_2910 13060 14076 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393885.1 protein_id gnl|my_center|LOCUS_2910 15102 14089 gene locus_tag LOCUS_2920 gene tsaD 15102 14089 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943403.1 protein_id gnl|my_center|LOCUS_2920 15191 15115 gene locus_tag LOCUS_t0140 15191 15115 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 16044 15952 gene locus_tag LOCUS_t0150 16044 15952 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 17312 16215 gene locus_tag LOCUS_2930 gene dnaN 17312 16215 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258498.1 protein_id gnl|my_center|LOCUS_2930 18813 17515 gene locus_tag LOCUS_2940 gene dnaA 18813 17515 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582428.1 protein_id gnl|my_center|LOCUS_2940 18978 19181 gene locus_tag LOCUS_2950 18978 19181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2950 19193 19564 gene locus_tag LOCUS_2960 19193 19564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2960 19569 19775 gene locus_tag LOCUS_2970 19569 19775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2970 19779 20552 gene locus_tag LOCUS_2980 19779 20552 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903598.1 protein_id gnl|my_center|LOCUS_2980 20545 20979 gene locus_tag LOCUS_2990 20545 20979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2990 21141 22166 gene locus_tag LOCUS_3000 gene recF 21141 22166 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478831.1 protein_id gnl|my_center|LOCUS_3000 22435 25122 gene locus_tag LOCUS_3010 22435 25122 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141744.1 protein_id gnl|my_center|LOCUS_3010 25106 26437 gene locus_tag LOCUS_3020 25106 26437 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272490.1 protein_id gnl|my_center|LOCUS_3020 26471 27322 gene locus_tag LOCUS_3030 26471 27322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3030 27395 27471 gene locus_tag LOCUS_t0160 27395 27471 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 27931 27554 gene locus_tag LOCUS_3040 27931 27554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3040 >Feature sequence09 504 1139 gene locus_tag LOCUS_3050 504 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3050 1206 1493 gene locus_tag LOCUS_3060 1206 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3060 1503 3995 gene locus_tag LOCUS_3070 gene polA 1503 3995 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583247.1 protein_id gnl|my_center|LOCUS_3070 4000 4845 gene locus_tag LOCUS_3080 gene mutM 4000 4845 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816814.1 protein_id gnl|my_center|LOCUS_3080 4892 5188 gene locus_tag LOCUS_3090 4892 5188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3090 5185 6003 gene locus_tag LOCUS_3100 gene tpiA 5185 6003 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243394.1 protein_id gnl|my_center|LOCUS_3100 6294 6818 gene locus_tag LOCUS_3110 6294 6818 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173971.1 protein_id gnl|my_center|LOCUS_3110 6815 8731 gene locus_tag LOCUS_3120 gene pcrA 6815 8731 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002265517.1 protein_id gnl|my_center|LOCUS_3120 10128 8728 gene locus_tag LOCUS_3130 gene pyk 10128 8728 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_3130 10326 12635 gene locus_tag LOCUS_3140 10326 12635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3140 13017 13724 gene locus_tag LOCUS_3150 13017 13724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3150 14034 15260 gene locus_tag LOCUS_3160 14034 15260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3160 15459 15534 gene locus_tag LOCUS_t0170 15459 15534 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 17119 15875 gene locus_tag LOCUS_3170 gene tyrS 17119 15875 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881135.1 protein_id gnl|my_center|LOCUS_3170 17335 19224 gene locus_tag LOCUS_3180 gene thrS 17335 19224 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229473.1 protein_id gnl|my_center|LOCUS_3180 19217 20683 gene locus_tag LOCUS_3190 gene lysS 19217 20683 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_3190 20667 21557 gene locus_tag LOCUS_3200 gene galU 20667 21557 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890959.1 protein_id gnl|my_center|LOCUS_3200 21559 22596 gene locus_tag LOCUS_3210 21559 22596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3210 23201 23722 gene locus_tag LOCUS_3220 23201 23722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3220 23725 24711 gene locus_tag LOCUS_3230 23725 24711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3230 24975 25370 gene locus_tag LOCUS_3240 24975 25370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3240 25699 26040 gene locus_tag LOCUS_3250 25699 26040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3250 26045 26905 gene locus_tag LOCUS_3260 26045 26905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3260 >Feature sequence10 3372 3563 gene locus_tag LOCUS_3270 3372 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3270 3867 3529 gene locus_tag LOCUS_3280 3867 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3280 4808 5209 gene locus_tag LOCUS_3290 4808 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3290 5551 5210 gene locus_tag LOCUS_3300 5551 5210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3300 6187 5813 gene locus_tag LOCUS_3310 6187 5813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3310 6936 6187 gene locus_tag LOCUS_3320 6936 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3320 9047 7053 gene locus_tag LOCUS_3330 gene uvrB 9047 7053 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179030.1 protein_id gnl|my_center|LOCUS_3330 9911 9054 gene locus_tag LOCUS_3340 9911 9054 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883372.1 protein_id gnl|my_center|LOCUS_3340 10284 10030 gene locus_tag LOCUS_3350 10284 10030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3350 10544 10410 gene locus_tag LOCUS_3360 10544 10410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3360 10821 11870 gene locus_tag LOCUS_3370 gene ddlA 10821 11870 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413693.1 protein_id gnl|my_center|LOCUS_3370 13121 11865 gene locus_tag LOCUS_3380 13121 11865 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443995.1 protein_id gnl|my_center|LOCUS_3380 14419 13118 gene locus_tag LOCUS_3390 gene radA 14419 13118 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962283.1 protein_id gnl|my_center|LOCUS_3390 16840 14429 gene locus_tag LOCUS_3400 16840 14429 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870144.1 protein_id gnl|my_center|LOCUS_3400 17936 16803 gene locus_tag LOCUS_3410 17936 16803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3410 18341 17985 gene locus_tag LOCUS_3420 18341 17985 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764002.1 protein_id gnl|my_center|LOCUS_3420 19170 18607 gene locus_tag LOCUS_3430 19170 18607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3430 20113 19196 gene locus_tag LOCUS_3440 gene ftsX 20113 19196 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732506.1 protein_id gnl|my_center|LOCUS_3440 20763 20110 gene locus_tag LOCUS_3450 gene ftsE 20763 20110 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173889.1 protein_id gnl|my_center|LOCUS_3450 21266 20799 gene locus_tag LOCUS_3460 gene greA 21266 20799 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_3460 21452 21850 gene locus_tag LOCUS_3470 21452 21850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3470 22056 21847 gene locus_tag LOCUS_3480 22056 21847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3480 22741 22208 gene locus_tag LOCUS_3490 22741 22208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3490 22957 22872 gene locus_tag LOCUS_r0010 22957 22872 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 72 percent of the 5S ribosomal RNA 26066 22987 gene locus_tag LOCUS_r0020 26066 22987 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 <27134 26334 gene locus_tag LOCUS_3500 <27134 26334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000860115.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase >Feature sequence11 663 223 gene locus_tag LOCUS_3510 663 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_3510 767 1411 gene locus_tag LOCUS_3520 gene murI 767 1411 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964198.1 protein_id gnl|my_center|LOCUS_3520 2183 1380 gene locus_tag LOCUS_3530 gene folD 2183 1380 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225836.1 protein_id gnl|my_center|LOCUS_3530 2346 2270 gene locus_tag LOCUS_t0180 2346 2270 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 4545 2461 gene locus_tag LOCUS_3540 4545 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3540 5038 4709 gene locus_tag LOCUS_3550 5038 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3550 6191 5139 gene locus_tag LOCUS_3560 6191 5139 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_3560 7342 6191 gene locus_tag LOCUS_3570 7342 6191 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596607.1 protein_id gnl|my_center|LOCUS_3570 8519 8310 gene locus_tag LOCUS_3580 8519 8310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3580 8594 9523 gene locus_tag LOCUS_3590 8594 9523 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 protein_id gnl|my_center|LOCUS_3590 9741 10580 gene locus_tag LOCUS_3600 9741 10580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3600 10646 10963 gene locus_tag LOCUS_3610 10646 10963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3610 11742 11092 gene locus_tag LOCUS_3620 11742 11092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3620 12730 11843 gene locus_tag LOCUS_3630 12730 11843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3630 12891 13136 gene locus_tag LOCUS_3640 12891 13136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3640 14742 13114 gene locus_tag LOCUS_3650 14742 13114 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226873.1 protein_id gnl|my_center|LOCUS_3650 16473 15465 gene locus_tag LOCUS_r0030 16473 15465 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 63 percent of the 16S ribosomal RNA 17558 16755 gene locus_tag LOCUS_3660 17558 16755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3660 20070 17551 gene locus_tag LOCUS_3670 gene gyrA 20070 17551 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244540.1 protein_id gnl|my_center|LOCUS_3670 22165 20075 gene locus_tag LOCUS_3680 gene gyrB 22165 20075 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_3680 23825 22311 gene locus_tag LOCUS_3690 gene ilvA 23825 22311 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707857.1 protein_id gnl|my_center|LOCUS_3690 24213 23818 gene locus_tag LOCUS_3700 24213 23818 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869964.1 protein_id gnl|my_center|LOCUS_3700 24345 24252 gene locus_tag LOCUS_t0190 24345 24252 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 25695 24436 gene locus_tag LOCUS_3710 25695 24436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3710 >Feature sequence12 3896 3261 gene locus_tag LOCUS_3720 3896 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3720 6088 3899 gene locus_tag LOCUS_3730 6088 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3730 8525 6195 gene locus_tag LOCUS_3740 8525 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3740 6233 6332 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8925 8551 gene locus_tag LOCUS_3750 8925 8551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3750 10133 9018 gene locus_tag LOCUS_3760 gene ychF 10133 9018 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776292.1 protein_id gnl|my_center|LOCUS_3760 11260 10418 gene locus_tag LOCUS_3770 11260 10418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3770 11938 11456 gene locus_tag LOCUS_3780 gene ruvC 11938 11456 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902123.1 protein_id gnl|my_center|LOCUS_3780 12639 11941 gene locus_tag LOCUS_3790 12639 11941 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668967.1 protein_id gnl|my_center|LOCUS_3790 14388 12778 gene locus_tag LOCUS_3800 14388 12778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3800 15007 15083 gene locus_tag LOCUS_t0200 15007 15083 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 15549 15373 gene locus_tag LOCUS_3810 15549 15373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3810 16150 15491 gene locus_tag LOCUS_3820 16150 15491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3820 19495 17714 gene locus_tag LOCUS_3830 gene lepA 19495 17714 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019133.1 protein_id gnl|my_center|LOCUS_3830 21044 19479 gene locus_tag LOCUS_3840 gene murJ 21044 19479 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403539.1 protein_id gnl|my_center|LOCUS_3840 22881 21076 gene locus_tag LOCUS_3850 gene ftsH 22881 21076 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257906.1 protein_id gnl|my_center|LOCUS_3850 23857 22910 gene locus_tag LOCUS_3860 23857 22910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3860 >Feature sequence13 1014 415 gene locus_tag LOCUS_3870 1014 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3870 2032 1055 gene locus_tag LOCUS_3880 2032 1055 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_3880 2632 2033 gene locus_tag LOCUS_3890 2632 2033 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875742.1 protein_id gnl|my_center|LOCUS_3890 4379 2796 gene locus_tag LOCUS_3900 4379 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3900 4763 4677 gene locus_tag LOCUS_t0210 4763 4677 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 7837 6137 gene locus_tag LOCUS_3910 7837 6137 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258196.1 protein_id gnl|my_center|LOCUS_3910 8067 7846 gene locus_tag LOCUS_3920 8067 7846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3920 8440 8069 gene locus_tag LOCUS_3930 8440 8069 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289566.1 protein_id gnl|my_center|LOCUS_3930 8706 8440 gene locus_tag LOCUS_3940 8706 8440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3940 10140 8728 gene locus_tag LOCUS_3950 gene gatB 10140 8728 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_3950 10547 10137 gene locus_tag LOCUS_3960 10547 10137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3960 11941 10541 gene locus_tag LOCUS_3970 gene gatA 11941 10541 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_3970 12249 11938 gene locus_tag LOCUS_3980 12249 11938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3980 14294 12270 gene locus_tag LOCUS_3990 gene ligA 14294 12270 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393509.1 protein_id gnl|my_center|LOCUS_3990 14630 14298 gene locus_tag LOCUS_4000 14630 14298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4000 16359 14635 gene locus_tag LOCUS_4010 16359 14635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4010 17490 16399 gene locus_tag LOCUS_4020 gene rpsA 17490 16399 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258334.1 protein_id gnl|my_center|LOCUS_4020 18097 17720 gene locus_tag LOCUS_4030 18097 17720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4030 18292 19191 gene locus_tag LOCUS_4040 gene pyrB 18292 19191 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251146.1 protein_id gnl|my_center|LOCUS_4040 19271 20404 gene locus_tag LOCUS_4050 19271 20404 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_4050 21503 20784 gene locus_tag LOCUS_4060 21503 20784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4060 21792 21460 gene locus_tag LOCUS_4070 21792 21460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4070 22815 22891 gene locus_tag LOCUS_t0220 22815 22891 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence14 213 830 gene locus_tag LOCUS_4080 gene rpsC 213 830 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806910.1 protein_id gnl|my_center|LOCUS_4080 835 1242 gene locus_tag LOCUS_4090 gene rplP 835 1242 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008549252.1 protein_id gnl|my_center|LOCUS_4090 1250 1447 gene locus_tag LOCUS_4100 1250 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4100 1444 1689 gene locus_tag LOCUS_4110 1444 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4110 1686 2054 gene locus_tag LOCUS_4120 gene rplN 1686 2054 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393927.1 protein_id gnl|my_center|LOCUS_4120 2054 2416 gene locus_tag LOCUS_4130 gene rplX 2054 2416 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156486.1 protein_id gnl|my_center|LOCUS_4130 2413 2970 gene locus_tag LOCUS_4140 gene rplE 2413 2970 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886968.1 protein_id gnl|my_center|LOCUS_4140 2963 3232 gene locus_tag LOCUS_4150 gene rpsN 2963 3232 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085703.1 protein_id gnl|my_center|LOCUS_4150 3242 3628 gene locus_tag LOCUS_4160 gene rpsH 3242 3628 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583359.1 protein_id gnl|my_center|LOCUS_4160 3628 4164 gene locus_tag LOCUS_4170 gene rplF 3628 4164 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546082.1 protein_id gnl|my_center|LOCUS_4170 4166 4510 gene locus_tag LOCUS_4180 gene rplR 4166 4510 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129924.1 protein_id gnl|my_center|LOCUS_4180 4511 5062 gene locus_tag LOCUS_4190 gene rpsE 4511 5062 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583362.1 protein_id gnl|my_center|LOCUS_4190 5059 5505 gene locus_tag LOCUS_4200 gene rplO 5059 5505 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166895.1 protein_id gnl|my_center|LOCUS_4200 5477 6802 gene locus_tag LOCUS_4210 gene secY 5477 6802 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555469.1 protein_id gnl|my_center|LOCUS_4210 6844 7068 gene locus_tag LOCUS_4220 gene infA 6844 7068 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393913.1 protein_id gnl|my_center|LOCUS_4220 7193 7579 gene locus_tag LOCUS_4230 gene rpsM 7193 7579 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_4230 7634 8023 gene locus_tag LOCUS_4240 gene rpsK 7634 8023 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701334.1 protein_id gnl|my_center|LOCUS_4240 8025 8642 gene locus_tag LOCUS_4250 gene rpsD 8025 8642 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933816.1 protein_id gnl|my_center|LOCUS_4250 8654 9571 gene locus_tag LOCUS_4260 8654 9571 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_4260 9574 10044 gene locus_tag LOCUS_4270 gene rplQ 9574 10044 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013732.1 protein_id gnl|my_center|LOCUS_4270 10041 10490 gene locus_tag LOCUS_4280 gene rplM 10041 10490 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943505.1 protein_id gnl|my_center|LOCUS_4280 10487 10882 gene locus_tag LOCUS_4290 gene rpsI 10487 10882 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549055.1 protein_id gnl|my_center|LOCUS_4290 10981 12129 gene locus_tag LOCUS_4300 10981 12129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4300 12813 12136 gene locus_tag LOCUS_4310 gene lepB 12813 12136 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_4310 12896 14371 gene locus_tag LOCUS_4320 12896 14371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4320 14355 15107 gene locus_tag LOCUS_4330 14355 15107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4330 15116 16345 gene locus_tag LOCUS_4340 gene serS 15116 16345 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583734.1 protein_id gnl|my_center|LOCUS_4340 16342 16704 gene locus_tag LOCUS_4350 16342 16704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4350 16710 19259 gene locus_tag LOCUS_4360 gene secA 16710 19259 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583762.1 protein_id gnl|my_center|LOCUS_4360 19700 20248 gene locus_tag LOCUS_4370 19700 20248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4370 20467 21456 gene locus_tag LOCUS_4380 20467 21456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4380 >Feature sequence15 889 116 gene locus_tag LOCUS_4390 889 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4390 2925 895 gene locus_tag LOCUS_4400 gene recG 2925 895 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583501.1 protein_id gnl|my_center|LOCUS_4400 3433 2900 gene locus_tag LOCUS_4410 3433 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4410 3863 6688 gene locus_tag LOCUS_4420 gene uvrA 3863 6688 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061214.1 protein_id gnl|my_center|LOCUS_4420 7765 6755 gene locus_tag LOCUS_4430 7765 6755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4430 8210 7749 gene locus_tag LOCUS_4440 8210 7749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4440 8492 9580 gene locus_tag LOCUS_4450 8492 9580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4450 9620 10621 gene locus_tag LOCUS_4460 9620 10621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4460 10643 12082 gene locus_tag LOCUS_4470 10643 12082 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869758.1 protein_id gnl|my_center|LOCUS_4470 12605 12198 gene locus_tag LOCUS_4480 12605 12198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4480 13995 12610 gene locus_tag LOCUS_4490 gene atpD 13995 12610 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_4490 14885 14010 gene locus_tag LOCUS_4500 gene atpG 14885 14010 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035800.1 protein_id gnl|my_center|LOCUS_4500 16392 14875 gene locus_tag LOCUS_4510 gene atpA 16392 14875 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851836.1 protein_id gnl|my_center|LOCUS_4510 16777 16394 gene locus_tag LOCUS_4520 16777 16394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4520 17369 16770 gene locus_tag LOCUS_4530 17369 16770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4530 17608 17390 gene locus_tag LOCUS_4540 17608 17390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4540 18442 17636 gene locus_tag LOCUS_4550 gene atpB 18442 17636 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406681.1 protein_id gnl|my_center|LOCUS_4550 >Feature sequence16 <1 928 gene locus_tag LOCUS_4560 <1 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258544.1:GDP-mannose 4,6-dehydratase 1951 914 gene locus_tag LOCUS_4570 gene gmd 1951 914 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107662.1 protein_id gnl|my_center|LOCUS_4570 5357 2031 gene locus_tag LOCUS_4580 5357 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4580 6403 5447 gene locus_tag LOCUS_4590 6403 5447 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868306.1 protein_id gnl|my_center|LOCUS_4590 7667 6459 gene locus_tag LOCUS_4600 7667 6459 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261978.1 protein_id gnl|my_center|LOCUS_4600 8458 7664 gene locus_tag LOCUS_4610 8458 7664 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027237.1 protein_id gnl|my_center|LOCUS_4610 8743 9156 gene locus_tag LOCUS_4620 8743 9156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4620 9214 9576 gene locus_tag LOCUS_4630 9214 9576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4630 10157 9795 gene locus_tag LOCUS_4640 10157 9795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4640 10348 10791 gene locus_tag LOCUS_4650 10348 10791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4650 12613 10925 gene locus_tag LOCUS_4660 gene argS 12613 10925 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837654.1 protein_id gnl|my_center|LOCUS_4660 12703 12628 gene locus_tag LOCUS_t0230 12703 12628 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 12789 12714 gene locus_tag LOCUS_t0240 12789 12714 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13631 12876 gene locus_tag LOCUS_4670 13631 12876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4670 14131 13628 gene locus_tag LOCUS_4680 14131 13628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4680 14919 14131 gene locus_tag LOCUS_4690 14919 14131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4690 15391 14930 gene locus_tag LOCUS_4700 15391 14930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4700 16702 15482 gene locus_tag LOCUS_4710 16702 15482 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888498.1 protein_id gnl|my_center|LOCUS_4710 17774 16704 gene locus_tag LOCUS_4720 17774 16704 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583239.1 protein_id gnl|my_center|LOCUS_4720 <19135 17755 gene locus_tag LOCUS_4730 <19135 17755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583238.1:type II secretion system ATPase GspE >Feature sequence17 3184 446 gene locus_tag LOCUS_4740 3184 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4740 3279 4019 gene locus_tag LOCUS_4750 3279 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4750 4012 5316 gene locus_tag LOCUS_4760 4012 5316 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964280.1 protein_id gnl|my_center|LOCUS_4760 5313 6020 gene locus_tag LOCUS_4770 5313 6020 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817427.1 protein_id gnl|my_center|LOCUS_4770 6057 6713 gene locus_tag LOCUS_4780 6057 6713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4780 6694 7716 gene locus_tag LOCUS_4790 6694 7716 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989612.1 protein_id gnl|my_center|LOCUS_4790 7691 9856 gene locus_tag LOCUS_4800 7691 9856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4800 9846 10823 gene locus_tag LOCUS_4810 9846 10823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4810 10900 11892 gene locus_tag LOCUS_4820 gene recA 10900 11892 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918971.1 protein_id gnl|my_center|LOCUS_4820 11867 12358 gene locus_tag LOCUS_4830 11867 12358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4830 12446 13576 gene locus_tag LOCUS_4840 12446 13576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4840 13581 13961 gene locus_tag LOCUS_4850 13581 13961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4850 13958 14872 gene locus_tag LOCUS_4860 13958 14872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4860 14965 14891 gene locus_tag LOCUS_t0250 14965 14891 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 15036 17627 gene locus_tag LOCUS_4870 15036 17627 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965695.1 protein_id gnl|my_center|LOCUS_4870 18951 17896 gene locus_tag LOCUS_4880 18951 17896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4880 >Feature sequence18 2431 1403 gene locus_tag LOCUS_4890 gene pheS 2431 1403 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114409.1 protein_id gnl|my_center|LOCUS_4890 2896 2450 gene locus_tag LOCUS_4900 2896 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4900 3532 5433 gene locus_tag LOCUS_4910 3532 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4910 5437 6018 gene locus_tag LOCUS_4920 5437 6018 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791480.1 protein_id gnl|my_center|LOCUS_4920 6635 6078 gene locus_tag LOCUS_4930 6635 6078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4930 8617 6653 gene locus_tag LOCUS_4940 8617 6653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4940 11160 8644 gene locus_tag LOCUS_4950 11160 8644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4950 11489 11256 gene locus_tag LOCUS_4960 11489 11256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4960 14104 13172 gene locus_tag LOCUS_4970 14104 13172 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459951.1 protein_id gnl|my_center|LOCUS_4970 14852 14097 gene locus_tag LOCUS_4980 14852 14097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4980 15096 14839 gene locus_tag LOCUS_4990 15096 14839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4990 16141 15098 gene locus_tag LOCUS_5000 gene trpS 16141 15098 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817343.1 protein_id gnl|my_center|LOCUS_5000 <17375 16615 gene locus_tag LOCUS_5010 <17375 16615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_137607921.1:Ig-like domain-containing protein >Feature sequence19 2833 1520 gene locus_tag LOCUS_5020 2833 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5020 4010 2934 gene locus_tag LOCUS_5030 4010 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5030 5092 4031 gene locus_tag LOCUS_5040 5092 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5040 6082 5204 gene locus_tag LOCUS_5050 gene mltG 6082 5204 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 protein_id gnl|my_center|LOCUS_5050 6826 6209 gene locus_tag LOCUS_5060 6826 6209 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722740.1 protein_id gnl|my_center|LOCUS_5060 7166 6843 gene locus_tag LOCUS_5070 7166 6843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5070 8169 7177 gene locus_tag LOCUS_5080 8169 7177 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991122.1 protein_id gnl|my_center|LOCUS_5080 9381 8338 gene locus_tag LOCUS_5090 9381 8338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5090 11226 9721 gene locus_tag LOCUS_5100 gene rny 11226 9721 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_5100 11491 12453 gene locus_tag LOCUS_5110 11491 12453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5110 12446 12805 gene locus_tag LOCUS_5120 12446 12805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5120 12798 13220 gene locus_tag LOCUS_5130 12798 13220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5130 13192 13572 gene locus_tag LOCUS_5140 13192 13572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5140 14120 13569 gene locus_tag LOCUS_5150 14120 13569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5150 15120 14128 gene locus_tag LOCUS_5160 gene ruvB 15120 14128 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_5160 15701 15117 gene locus_tag LOCUS_5170 gene ruvA 15701 15117 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131995.1 protein_id gnl|my_center|LOCUS_5170 >Feature sequence20 113 1534 gene locus_tag LOCUS_5180 113 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5180 1765 3321 gene locus_tag LOCUS_5190 1765 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5190 3348 3755 gene locus_tag LOCUS_5200 3348 3755 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546622.1 protein_id gnl|my_center|LOCUS_5200 3724 4440 gene locus_tag LOCUS_5210 3724 4440 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053851.1 protein_id gnl|my_center|LOCUS_5210 4437 5297 gene locus_tag LOCUS_5220 4437 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5220 5649 6959 gene locus_tag LOCUS_5230 gene der 5649 6959 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727996.1 protein_id gnl|my_center|LOCUS_5230 6956 7495 gene locus_tag LOCUS_5240 gene pth 6956 7495 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254063.1 protein_id gnl|my_center|LOCUS_5240 8125 9195 gene locus_tag LOCUS_5250 8125 9195 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966353.1 protein_id gnl|my_center|LOCUS_5250 9364 9437 gene locus_tag LOCUS_t0260 9364 9437 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 9542 9632 gene locus_tag LOCUS_t0270 9542 9632 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9643 9719 gene locus_tag LOCUS_t0280 9643 9719 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 9741 9817 gene locus_tag LOCUS_t0290 9741 9817 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 9819 9894 gene locus_tag LOCUS_t0300 9819 9894 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 10312 11664 gene locus_tag LOCUS_5260 10312 11664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5260 12642 11800 gene locus_tag LOCUS_5270 12642 11800 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065352.1 protein_id gnl|my_center|LOCUS_5270 12947 13432 gene locus_tag LOCUS_5280 12947 13432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5280 13450 15186 gene locus_tag LOCUS_5290 13450 15186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5290 >Feature sequence21 1337 2029 gene locus_tag LOCUS_5300 1337 2029 CDS product LssY C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226319327.1 protein_id gnl|my_center|LOCUS_5300 2870 2148 gene locus_tag LOCUS_5310 2870 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5310 3355 3633 gene locus_tag LOCUS_5320 3355 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5320 4324 3626 gene locus_tag LOCUS_5330 4324 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5330 4348 4767 gene locus_tag LOCUS_5340 4348 4767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5340 4764 5462 gene locus_tag LOCUS_5350 4764 5462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5350 5527 6312 gene locus_tag LOCUS_5360 5527 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5360 6465 7901 gene locus_tag LOCUS_5370 6465 7901 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583255.1 protein_id gnl|my_center|LOCUS_5370 7902 9032 gene locus_tag LOCUS_5380 7902 9032 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966352.1 protein_id gnl|my_center|LOCUS_5380 9008 10465 gene locus_tag LOCUS_5390 9008 10465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5390 10502 11170 gene locus_tag LOCUS_5400 gene gmk 10502 11170 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904066.1 protein_id gnl|my_center|LOCUS_5400 11526 11182 gene locus_tag LOCUS_5410 gene rplT 11526 11182 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300683.1 protein_id gnl|my_center|LOCUS_5410 11722 11528 gene locus_tag LOCUS_5420 gene rpmI 11722 11528 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545453.1 protein_id gnl|my_center|LOCUS_5420 11885 12784 gene locus_tag LOCUS_5430 11885 12784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5430 12877 13740 gene locus_tag LOCUS_5440 12877 13740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5440 >Feature sequence22 1214 435 gene locus_tag LOCUS_5450 gene map 1214 435 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140415.1 protein_id gnl|my_center|LOCUS_5450 1791 1204 gene locus_tag LOCUS_5460 1791 1204 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854403.1 protein_id gnl|my_center|LOCUS_5460 2312 1788 gene locus_tag LOCUS_5470 2312 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5470 2787 2317 gene locus_tag LOCUS_5480 2787 2317 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081070.1 protein_id gnl|my_center|LOCUS_5480 3028 2798 gene locus_tag LOCUS_5490 3028 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5490 3183 3848 gene locus_tag LOCUS_5500 3183 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5500 3879 4298 gene locus_tag LOCUS_5510 3879 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5510 5972 4248 gene locus_tag LOCUS_5520 5972 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5520 6281 5994 gene locus_tag LOCUS_5530 6281 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5530 7230 6349 gene locus_tag LOCUS_5540 gene secF 7230 6349 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258878.1 protein_id gnl|my_center|LOCUS_5540 8558 7227 gene locus_tag LOCUS_5550 gene secD 8558 7227 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144152.1 protein_id gnl|my_center|LOCUS_5550 8607 10538 gene locus_tag LOCUS_5560 8607 10538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5560 10657 11139 gene locus_tag LOCUS_5570 gene def 10657 11139 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527648.1 protein_id gnl|my_center|LOCUS_5570 11132 12046 gene locus_tag LOCUS_5580 gene fmt 11132 12046 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583791.1 protein_id gnl|my_center|LOCUS_5580 12828 12052 gene locus_tag LOCUS_5590 12828 12052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5590 13062 12838 gene locus_tag LOCUS_5600 13062 12838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5600 14204 13605 gene locus_tag LOCUS_5610 14204 13605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5610 >Feature sequence23 928 1899 gene locus_tag LOCUS_5620 928 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5620 2036 1896 gene locus_tag LOCUS_5630 2036 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5630 2325 2400 gene locus_tag LOCUS_t0310 2325 2400 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3087 2833 gene locus_tag LOCUS_5640 3087 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5640 2986 4101 gene locus_tag LOCUS_5650 gene hisS 2986 4101 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966027.1 protein_id gnl|my_center|LOCUS_5650 4101 4889 gene locus_tag LOCUS_5660 4101 4889 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_5660 5035 5244 gene locus_tag LOCUS_5670 5035 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5670 5262 5969 gene locus_tag LOCUS_5680 5262 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5680 6021 7034 gene locus_tag LOCUS_5690 gene gap 6021 7034 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259560.1 protein_id gnl|my_center|LOCUS_5690 7027 7476 gene locus_tag LOCUS_5700 7027 7476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5700 7469 8107 gene locus_tag LOCUS_5710 gene rpe 7469 8107 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811794.1 protein_id gnl|my_center|LOCUS_5710 8116 8973 gene locus_tag LOCUS_5720 8116 8973 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546285.1 protein_id gnl|my_center|LOCUS_5720 8970 9908 gene locus_tag LOCUS_5730 8970 9908 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_5730 9905 10945 gene locus_tag LOCUS_5740 9905 10945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5740 10981 11376 gene locus_tag LOCUS_5750 10981 11376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5750 11399 11785 gene locus_tag LOCUS_5760 11399 11785 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872143.1 protein_id gnl|my_center|LOCUS_5760 11791 12468 gene locus_tag LOCUS_5770 gene trmD 11791 12468 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_5770 12473 13216 gene locus_tag LOCUS_5780 12473 13216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5780 >Feature sequence24 <1 3693 gene locus_tag LOCUS_5790 <1 3693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256762.1:DNA-directed RNA polymerase subunit beta' 3732 4139 gene locus_tag LOCUS_5800 gene rpsL 3732 4139 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720973.1 protein_id gnl|my_center|LOCUS_5800 4139 4615 gene locus_tag LOCUS_5810 gene rpsG 4139 4615 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258227.1 protein_id gnl|my_center|LOCUS_5810 4635 6698 gene locus_tag LOCUS_5820 gene fusA 4635 6698 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_5820 6780 7955 gene locus_tag LOCUS_5830 gene tuf 6780 7955 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933844.1 protein_id gnl|my_center|LOCUS_5830 7960 8280 gene locus_tag LOCUS_5840 gene rpsJ 7960 8280 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567567.1 protein_id gnl|my_center|LOCUS_5840 8868 10292 gene locus_tag LOCUS_5850 8868 10292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5850 10462 11025 gene locus_tag LOCUS_5860 gene rplC 10462 11025 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356199.1 protein_id gnl|my_center|LOCUS_5860 11022 11705 gene locus_tag LOCUS_5870 gene rplD 11022 11705 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166912.1 protein_id gnl|my_center|LOCUS_5870 11686 11967 gene locus_tag LOCUS_5880 11686 11967 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088149.1 protein_id gnl|my_center|LOCUS_5880 11960 12787 gene locus_tag LOCUS_5890 gene rplB 11960 12787 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393934.1 protein_id gnl|my_center|LOCUS_5890 >Feature sequence25 1156 134 gene locus_tag LOCUS_5900 1156 134 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546380.1 protein_id gnl|my_center|LOCUS_5900 1740 1231 gene locus_tag LOCUS_5910 gene recR 1740 1231 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897999.1 protein_id gnl|my_center|LOCUS_5910 2129 1836 gene locus_tag LOCUS_5920 2129 1836 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391577.1 protein_id gnl|my_center|LOCUS_5920 2557 2219 gene locus_tag LOCUS_5930 2557 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5930 3325 2591 gene locus_tag LOCUS_5940 3325 2591 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_5940 4807 3332 gene locus_tag LOCUS_5950 4807 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5950 5261 4815 gene locus_tag LOCUS_5960 5261 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5960 6610 5258 gene locus_tag LOCUS_5970 gene dnaB 6610 5258 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583712.1 protein_id gnl|my_center|LOCUS_5970 8073 6613 gene locus_tag LOCUS_5980 8073 6613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5980 9955 8219 gene locus_tag LOCUS_5990 9955 8219 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890834.1 protein_id gnl|my_center|LOCUS_5990 10289 9969 gene locus_tag LOCUS_6000 10289 9969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6000 11378 10470 gene locus_tag LOCUS_6010 gene rsmH 11378 10470 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481788.1 protein_id gnl|my_center|LOCUS_6010 <12812 11946 gene locus_tag LOCUS_6020 <12812 11946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_047816759.1:DUF11 domain-containing protein >Feature sequence26 26 116 gene locus_tag LOCUS_t0320 26 116 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 481 1020 gene locus_tag LOCUS_6030 481 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6030 2978 1017 gene locus_tag LOCUS_6040 gene mrdA 2978 1017 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945987.1 protein_id gnl|my_center|LOCUS_6040 3186 3410 gene locus_tag LOCUS_6050 3186 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6050 4245 3454 gene locus_tag LOCUS_6060 gene mreC 4245 3454 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263142.1 protein_id gnl|my_center|LOCUS_6060 5298 4246 gene locus_tag LOCUS_6070 5298 4246 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_6070 7297 5753 gene locus_tag LOCUS_6080 7297 5753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6080 8159 7440 gene locus_tag LOCUS_6090 gene pyrH 8159 7440 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392548.1 protein_id gnl|my_center|LOCUS_6090 9514 8177 gene locus_tag LOCUS_6100 9514 8177 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946542.1 protein_id gnl|my_center|LOCUS_6100 10074 10454 gene locus_tag LOCUS_6110 10074 10454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6110 11241 10510 gene locus_tag LOCUS_6120 11241 10510 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932971.1 protein_id gnl|my_center|LOCUS_6120 11291 11365 gene locus_tag LOCUS_t0330 11291 11365 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 12210 11344 gene locus_tag LOCUS_6130 12210 11344 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922805.1 protein_id gnl|my_center|LOCUS_6130 >Feature sequence27 1318 545 gene locus_tag LOCUS_6140 1318 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6140 2192 1584 gene locus_tag LOCUS_6150 2192 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6150 2645 2292 gene locus_tag LOCUS_6160 2645 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6160 3124 2642 gene locus_tag LOCUS_6170 3124 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6170 3573 3499 gene locus_tag LOCUS_t0340 3573 3499 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5450 3648 gene locus_tag LOCUS_6180 5450 3648 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258301.1 protein_id gnl|my_center|LOCUS_6180 5504 5956 gene locus_tag LOCUS_6190 5504 5956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921482.1 protein_id gnl|my_center|LOCUS_6190 7018 6239 gene locus_tag LOCUS_6200 7018 6239 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227726.1 protein_id gnl|my_center|LOCUS_6200 7949 7011 gene locus_tag LOCUS_6210 7949 7011 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_6210 8974 7976 gene locus_tag LOCUS_6220 8974 7976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6220 9133 9876 gene locus_tag LOCUS_6230 9133 9876 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_6230 10448 9873 gene locus_tag LOCUS_6240 10448 9873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6240 10985 10461 gene locus_tag LOCUS_6250 10985 10461 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668689.1 protein_id gnl|my_center|LOCUS_6250 <11539 10982 gene locus_tag LOCUS_6260 <11539 10982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031431.1:FAD-dependent oxidoreductase >Feature sequence28 201 111 gene locus_tag LOCUS_t0350 201 111 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1348 269 gene locus_tag LOCUS_6270 1348 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6270 2281 1556 gene locus_tag LOCUS_6280 2281 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6280 2692 5571 gene locus_tag LOCUS_6290 2692 5571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6290 7332 5560 gene locus_tag LOCUS_6300 7332 5560 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947342.1 protein_id gnl|my_center|LOCUS_6300 7427 7762 gene locus_tag LOCUS_6310 7427 7762 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557347.1 protein_id gnl|my_center|LOCUS_6310 8501 7839 gene locus_tag LOCUS_6320 8501 7839 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202235.1 protein_id gnl|my_center|LOCUS_6320 8953 9399 gene locus_tag LOCUS_6330 8953 9399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6330 10518 9538 gene locus_tag LOCUS_6340 10518 9538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6340 >Feature sequence29 2693 882 gene locus_tag LOCUS_6350 gene typA 2693 882 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183842.1 protein_id gnl|my_center|LOCUS_6350 3042 2770 gene locus_tag LOCUS_6360 3042 2770 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582790.1 protein_id gnl|my_center|LOCUS_6360 3967 3392 gene locus_tag LOCUS_6370 3967 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6370 3997 4887 gene locus_tag LOCUS_6380 3997 4887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6380 4884 6011 gene locus_tag LOCUS_6390 4884 6011 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907730.1 protein_id gnl|my_center|LOCUS_6390 5989 7131 gene locus_tag LOCUS_6400 5989 7131 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027828.1 protein_id gnl|my_center|LOCUS_6400 7166 7864 gene locus_tag LOCUS_6410 7166 7864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6410 7851 8510 gene locus_tag LOCUS_6420 7851 8510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6420 8503 8823 gene locus_tag LOCUS_6430 8503 8823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6430 8825 9424 gene locus_tag LOCUS_6440 8825 9424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6440 9773 9408 gene locus_tag LOCUS_6450 9773 9408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6450 >Feature sequence30 219 875 gene locus_tag LOCUS_6460 gene truB 219 875 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882967.1 protein_id gnl|my_center|LOCUS_6460 900 1163 gene locus_tag LOCUS_6470 gene rpsO 900 1163 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388351.1 protein_id gnl|my_center|LOCUS_6470 1317 3482 gene locus_tag LOCUS_6480 1317 3482 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460388.1 protein_id gnl|my_center|LOCUS_6480 3493 4053 gene locus_tag LOCUS_6490 gene udg 3493 4053 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980322.1 protein_id gnl|my_center|LOCUS_6490 4084 5958 gene locus_tag LOCUS_6500 4084 5958 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_6500 6422 7147 gene locus_tag LOCUS_6510 6422 7147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6510 7149 7646 gene locus_tag LOCUS_6520 7149 7646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6520 7646 9529 gene locus_tag LOCUS_6530 gene dnaK 7646 9529 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502156.1 protein_id gnl|my_center|LOCUS_6530 >Feature sequence31 1136 615 gene locus_tag LOCUS_6540 1136 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6540 1598 1200 gene locus_tag LOCUS_6550 gene rplL 1598 1200 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393946.1 protein_id gnl|my_center|LOCUS_6550 2142 1615 gene locus_tag LOCUS_6560 gene rplJ 2142 1615 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870241.1 protein_id gnl|my_center|LOCUS_6560 2749 2525 gene locus_tag LOCUS_6570 2749 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6570 4071 2962 gene locus_tag LOCUS_6580 4071 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6580 5174 4083 gene locus_tag LOCUS_6590 5174 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6590 5845 5180 gene locus_tag LOCUS_6600 5845 5180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6600 6744 5842 gene locus_tag LOCUS_6610 gene htpX 6744 5842 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254032.1 protein_id gnl|my_center|LOCUS_6610 7291 6728 gene locus_tag LOCUS_6620 7291 6728 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989628.1 protein_id gnl|my_center|LOCUS_6620 7526 8101 gene locus_tag LOCUS_6630 7526 8101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6630 8913 8278 gene locus_tag LOCUS_6640 8913 8278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6640 9605 8910 gene locus_tag LOCUS_6650 9605 8910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6650 9747 9672 gene locus_tag LOCUS_t0360 9747 9672 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence32 687 301 gene locus_tag LOCUS_6660 687 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6660 2115 856 gene locus_tag LOCUS_6670 2115 856 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225657.1 protein_id gnl|my_center|LOCUS_6670 2526 2248 gene locus_tag LOCUS_6680 2526 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6680 3130 2519 gene locus_tag LOCUS_6690 gene nadD 3130 2519 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223158.1 protein_id gnl|my_center|LOCUS_6690 4968 3136 gene locus_tag LOCUS_6700 gene glmS 4968 3136 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838750.1 protein_id gnl|my_center|LOCUS_6700 5329 6351 gene locus_tag LOCUS_6710 5329 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6710 6218 6317 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6407 7342 gene locus_tag LOCUS_6720 6407 7342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6720 8490 7369 gene locus_tag LOCUS_6730 8490 7369 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020271.1 protein_id gnl|my_center|LOCUS_6730 9012 9134 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggtgagactggggctacgggagct >Feature sequence33 <1 1432 gene locus_tag LOCUS_6740 <1 1432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869759.1:cysteine--tRNA ligase 1429 2838 gene locus_tag LOCUS_6750 gene murC 1429 2838 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018214193.1 protein_id gnl|my_center|LOCUS_6750 2835 3833 gene locus_tag LOCUS_6760 gene murB 2835 3833 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207033.1 protein_id gnl|my_center|LOCUS_6760 3844 4761 gene locus_tag LOCUS_6770 gene trxB 3844 4761 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082829.1 protein_id gnl|my_center|LOCUS_6770 4758 5234 gene locus_tag LOCUS_6780 4758 5234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6780 5231 6583 gene locus_tag LOCUS_6790 5231 6583 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207237.1 protein_id gnl|my_center|LOCUS_6790 7144 6836 gene locus_tag LOCUS_6800 gene rplU 7144 6836 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691838.1 protein_id gnl|my_center|LOCUS_6800 >Feature sequence34 1654 1265 gene locus_tag LOCUS_6810 1654 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6810 2729 1662 gene locus_tag LOCUS_6820 gene prfB 2729 1662 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181244843.1 protein_id gnl|my_center|LOCUS_6820 3825 2890 gene locus_tag LOCUS_6830 gene xerC 3825 2890 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460421.1 protein_id gnl|my_center|LOCUS_6830 <6324 4055 gene locus_tag LOCUS_6840 <6324 4055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_047816759.1:DUF11 domain-containing protein >Feature sequence35 1660 644 gene locus_tag LOCUS_6850 1660 644 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258891.1 protein_id gnl|my_center|LOCUS_6850 2931 1657 gene locus_tag LOCUS_6860 gene murA 2931 1657 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880817.1 protein_id gnl|my_center|LOCUS_6860 4366 2966 gene locus_tag LOCUS_6870 4366 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6870 5224 4370 gene locus_tag LOCUS_6880 5224 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6880 5352 5439 gene locus_tag LOCUS_t0370 5352 5439 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5678 5418 gene locus_tag LOCUS_6890 5678 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6890 6146 5886 gene locus_tag LOCUS_6900 6146 5886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6900 >Feature sequence36 2151 820 gene locus_tag LOCUS_6910 gene mnmE 2151 820 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880529.1 protein_id gnl|my_center|LOCUS_6910 4998 2161 gene locus_tag LOCUS_6920 4998 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6920 5158 5072 gene locus_tag LOCUS_t0380 5158 5072 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence37 267 2804 gene locus_tag LOCUS_6930 267 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6930 3787 2978 gene locus_tag LOCUS_6940 3787 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6940 4902 3784 gene locus_tag LOCUS_6950 gene spoVE 4902 3784 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244810.1 protein_id gnl|my_center|LOCUS_6950 >Feature sequence38 59 727 gene locus_tag LOCUS_6960 59 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6960 746 1333 gene locus_tag LOCUS_6970 gene clpP 746 1333 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631995.1 protein_id gnl|my_center|LOCUS_6970 1482 4847 gene locus_tag LOCUS_6980 gene rpoB 1482 4847 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393945.1 protein_id gnl|my_center|LOCUS_6980 >Feature sequence39 609 289 gene locus_tag LOCUS_6990 609 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6990 3836 624 gene locus_tag LOCUS_7000 3836 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7000 4873 3833 gene locus_tag LOCUS_7010 4873 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7010 >Feature sequence40 1231 134 gene locus_tag LOCUS_7020 1231 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7020 3461 1482 gene locus_tag LOCUS_7030 3461 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7030 3909 3454 gene locus_tag LOCUS_7040 3909 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7040 >Feature sequence41 <1 926 gene locus_tag LOCUS_7050 <1 926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000908969.1:phenylalanine--tRNA ligase subunit beta 994 2367 gene locus_tag LOCUS_7060 994 2367 CDS product peptidoglycan binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358307.1 protein_id gnl|my_center|LOCUS_7060 2400 2936 gene locus_tag LOCUS_7070 2400 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7070 3268 2972 gene locus_tag LOCUS_7080 3268 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7080 3482 3913 gene locus_tag LOCUS_7090 gene ruvX 3482 3913 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940329.1 protein_id gnl|my_center|LOCUS_7090 >Feature sequence42 164 1957 gene locus_tag LOCUS_7100 164 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7100 1974 2831 gene locus_tag LOCUS_7110 1974 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7110 >Feature sequence43 348 1388 gene locus_tag LOCUS_7120 gene pilM 348 1388 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_7120 1385 1978 gene locus_tag LOCUS_7130 1385 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7130 1968 2663 gene locus_tag LOCUS_7140 1968 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7140 2663 2854 gene locus_tag LOCUS_7150 2663 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7150