>Feature sequence001 205 1554 gene locus_tag LOCUS_00010 205 1554 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_00010 1673 3292 gene locus_tag LOCUS_00020 1673 3292 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117861.1 protein_id gnl|my_center|LOCUS_00020 5004 3418 gene locus_tag LOCUS_00030 5004 3418 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582712.1 protein_id gnl|my_center|LOCUS_00030 5702 5025 gene locus_tag LOCUS_00040 5702 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 8944 5699 gene locus_tag LOCUS_00050 8944 5699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 9514 8987 gene locus_tag LOCUS_00060 gene nuoE 9514 8987 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766748.1 protein_id gnl|my_center|LOCUS_00060 12266 9933 gene locus_tag LOCUS_00070 12266 9933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 12504 13511 gene locus_tag LOCUS_00080 12504 13511 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972768.1 protein_id gnl|my_center|LOCUS_00080 13508 14623 gene locus_tag LOCUS_00090 13508 14623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 14620 15972 gene locus_tag LOCUS_00100 14620 15972 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122964585.1 protein_id gnl|my_center|LOCUS_00100 15974 16975 gene locus_tag LOCUS_00110 15974 16975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 17024 17869 gene locus_tag LOCUS_00120 17024 17869 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388497.1 protein_id gnl|my_center|LOCUS_00120 17872 18615 gene locus_tag LOCUS_00130 17872 18615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 18712 19959 gene locus_tag LOCUS_00140 18712 19959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 19977 20897 gene locus_tag LOCUS_00150 19977 20897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 21028 20840 gene locus_tag LOCUS_00160 21028 20840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 21215 22648 gene locus_tag LOCUS_00170 21215 22648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 23095 25128 gene locus_tag LOCUS_00180 23095 25128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 25174 27753 gene locus_tag LOCUS_00190 25174 27753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 28380 27778 gene locus_tag LOCUS_00200 28380 27778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 29679 28522 gene locus_tag LOCUS_00210 29679 28522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 30556 29681 gene locus_tag LOCUS_00220 30556 29681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 30940 32424 gene locus_tag LOCUS_00230 30940 32424 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100479.1 protein_id gnl|my_center|LOCUS_00230 32427 32576 gene locus_tag LOCUS_00240 32427 32576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 33505 32636 gene locus_tag LOCUS_00250 33505 32636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 33755 35056 gene locus_tag LOCUS_00260 gene melA 33755 35056 CDS product alpha-galactosidase MelA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246000.1 protein_id gnl|my_center|LOCUS_00260 35197 35715 gene locus_tag LOCUS_00270 35197 35715 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923583.1 protein_id gnl|my_center|LOCUS_00270 36189 35728 gene locus_tag LOCUS_00280 36189 35728 CDS product putative molybdenum carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142723.1 protein_id gnl|my_center|LOCUS_00280 37291 36266 gene locus_tag LOCUS_00290 37291 36266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 37972 37376 gene locus_tag LOCUS_00300 37972 37376 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015938.1 protein_id gnl|my_center|LOCUS_00300 38991 38017 gene locus_tag LOCUS_00310 38991 38017 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944069.1 protein_id gnl|my_center|LOCUS_00310 39895 39194 gene locus_tag LOCUS_00320 39895 39194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 42405 40006 gene locus_tag LOCUS_00330 42405 40006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 42815 44446 gene locus_tag LOCUS_00340 gene pruA 42815 44446 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224530.1 protein_id gnl|my_center|LOCUS_00340 44663 45793 gene locus_tag LOCUS_00350 44663 45793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 45653 45576 gene locus_tag LOCUS_t00010 45653 45576 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 48145 45812 gene locus_tag LOCUS_00360 48145 45812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 49562 48162 gene locus_tag LOCUS_00370 gene lpdA 49562 48162 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258694.1 protein_id gnl|my_center|LOCUS_00370 50930 49578 gene locus_tag LOCUS_00380 50930 49578 CDS product dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002309917.1 protein_id gnl|my_center|LOCUS_00380 52117 50930 gene locus_tag LOCUS_00390 52117 50930 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246548.1 protein_id gnl|my_center|LOCUS_00390 53003 52212 gene locus_tag LOCUS_00400 53003 52212 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958026.1 protein_id gnl|my_center|LOCUS_00400 54015 53023 gene locus_tag LOCUS_00410 54015 53023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 54898 54005 gene locus_tag LOCUS_00420 54898 54005 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 protein_id gnl|my_center|LOCUS_00420 56268 54895 gene locus_tag LOCUS_00430 56268 54895 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225265.1 protein_id gnl|my_center|LOCUS_00430 56455 58464 gene locus_tag LOCUS_00440 56455 58464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 58578 60455 gene locus_tag LOCUS_00450 gene mutL 58578 60455 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942644.1 protein_id gnl|my_center|LOCUS_00450 60452 61369 gene locus_tag LOCUS_00460 gene miaA 60452 61369 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_00460 61958 61383 gene locus_tag LOCUS_00470 61958 61383 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_00470 62246 63814 gene locus_tag LOCUS_00480 62246 63814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 64148 64906 gene locus_tag LOCUS_00490 gene flgF 64148 64906 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816186.1 protein_id gnl|my_center|LOCUS_00490 64924 65715 gene locus_tag LOCUS_00500 gene flgG 64924 65715 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546478.1 protein_id gnl|my_center|LOCUS_00500 65735 66706 gene locus_tag LOCUS_00510 65735 66706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 66724 67362 gene locus_tag LOCUS_00520 66724 67362 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943674.1 protein_id gnl|my_center|LOCUS_00520 67378 68481 gene locus_tag LOCUS_00530 67378 68481 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_00530 68481 68849 gene locus_tag LOCUS_00540 68481 68849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 68894 69403 gene locus_tag LOCUS_00550 68894 69403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 69410 70324 gene locus_tag LOCUS_00560 gene flgL 69410 70324 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 protein_id gnl|my_center|LOCUS_00560 70682 70329 gene locus_tag LOCUS_00570 70682 70329 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 protein_id gnl|my_center|LOCUS_00570 71073 70696 gene locus_tag LOCUS_00580 71073 70696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 71288 71800 gene locus_tag LOCUS_00590 71288 71800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 72275 71820 gene locus_tag LOCUS_00600 72275 71820 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481270.1 protein_id gnl|my_center|LOCUS_00600 72417 72989 gene locus_tag LOCUS_00610 72417 72989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 73975 73037 gene locus_tag LOCUS_00620 73975 73037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 74146 75627 gene locus_tag LOCUS_00630 gene gltX 74146 75627 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_00630 75624 76613 gene locus_tag LOCUS_00640 75624 76613 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_00640 76621 77553 gene locus_tag LOCUS_00650 gene pfkB 76621 77553 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392148.1 protein_id gnl|my_center|LOCUS_00650 81979 78359 gene locus_tag LOCUS_00660 81979 78359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 85707 82090 gene locus_tag LOCUS_00670 85707 82090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 86769 85765 gene locus_tag LOCUS_00680 gene lpxK 86769 85765 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_00680 87965 86766 gene locus_tag LOCUS_00690 gene dprA 87965 86766 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_00690 89306 88038 gene locus_tag LOCUS_00700 89306 88038 CDS product DUF3880 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938740.1 protein_id gnl|my_center|LOCUS_00700 >Feature sequence002 1107 643 gene locus_tag LOCUS_00710 1107 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 2261 1110 gene locus_tag LOCUS_00720 2261 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 2842 3246 gene locus_tag LOCUS_00730 2842 3246 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228775.1 protein_id gnl|my_center|LOCUS_00730 4491 3310 gene locus_tag LOCUS_00740 4491 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 5317 4901 gene locus_tag LOCUS_00750 gene rnk 5317 4901 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941393.1 protein_id gnl|my_center|LOCUS_00750 6184 5333 gene locus_tag LOCUS_00760 6184 5333 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039949449.1 protein_id gnl|my_center|LOCUS_00760 6454 8508 gene locus_tag LOCUS_00770 6454 8508 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401304.1 protein_id gnl|my_center|LOCUS_00770 9415 8810 gene locus_tag LOCUS_00780 9415 8810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 9735 9487 gene locus_tag LOCUS_00790 9735 9487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 10229 9765 gene locus_tag LOCUS_00800 10229 9765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 10456 10226 gene locus_tag LOCUS_00810 10456 10226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 11040 10489 gene locus_tag LOCUS_00820 11040 10489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 11249 11037 gene locus_tag LOCUS_00830 11249 11037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 11503 11246 gene locus_tag LOCUS_00840 11503 11246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 11730 11500 gene locus_tag LOCUS_00850 11730 11500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 12182 11802 gene locus_tag LOCUS_00860 12182 11802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 12207 12389 gene locus_tag LOCUS_00870 12207 12389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 12630 12427 gene locus_tag LOCUS_00880 12630 12427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 14279 13473 gene locus_tag LOCUS_00890 gene istB 14279 13473 CDS product IS21-like element IS21 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544830.1 protein_id gnl|my_center|LOCUS_00890 15763 14282 gene locus_tag LOCUS_00900 15763 14282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 16264 18039 gene locus_tag LOCUS_00910 16264 18039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 18036 18503 gene locus_tag LOCUS_00920 18036 18503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 18500 19021 gene locus_tag LOCUS_00930 18500 19021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 20792 19821 gene locus_tag LOCUS_00940 20792 19821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 21325 20879 gene locus_tag LOCUS_00950 21325 20879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 22108 21833 gene locus_tag LOCUS_00960 22108 21833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 22896 24023 gene locus_tag LOCUS_00970 22896 24023 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_00970 24030 25109 gene locus_tag LOCUS_00980 24030 25109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 25261 26238 gene locus_tag LOCUS_00990 25261 26238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 26249 26887 gene locus_tag LOCUS_01000 26249 26887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 26884 27762 gene locus_tag LOCUS_01010 26884 27762 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563083.1 protein_id gnl|my_center|LOCUS_01010 27763 28632 gene locus_tag LOCUS_01020 27763 28632 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674209.1 protein_id gnl|my_center|LOCUS_01020 28623 29417 gene locus_tag LOCUS_01030 28623 29417 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965651.1 protein_id gnl|my_center|LOCUS_01030 30429 29986 gene locus_tag LOCUS_01040 30429 29986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 33399 30442 gene locus_tag LOCUS_01050 33399 30442 CDS product DUF499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148590534.1 protein_id gnl|my_center|LOCUS_01050 34203 33703 gene locus_tag LOCUS_01060 34203 33703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 34897 34211 gene locus_tag LOCUS_01070 34897 34211 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073934.1 protein_id gnl|my_center|LOCUS_01070 39222 34900 gene locus_tag LOCUS_01080 39222 34900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 40634 39225 gene locus_tag LOCUS_01090 40634 39225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 44135 40638 gene locus_tag LOCUS_01100 44135 40638 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065207.1 protein_id gnl|my_center|LOCUS_01100 46945 44849 gene locus_tag LOCUS_01110 46945 44849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 47485 47072 gene locus_tag LOCUS_01120 47485 47072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 49089 47482 gene locus_tag LOCUS_01130 49089 47482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 50125 49079 gene locus_tag LOCUS_01140 50125 49079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 50649 50179 gene locus_tag LOCUS_01150 50649 50179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 51421 50642 gene locus_tag LOCUS_01160 51421 50642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 51810 51418 gene locus_tag LOCUS_01170 51810 51418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 52206 51847 gene locus_tag LOCUS_01180 52206 51847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 52529 52203 gene locus_tag LOCUS_01190 52529 52203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 53532 52753 gene locus_tag LOCUS_01200 53532 52753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 55390 53798 gene locus_tag LOCUS_01210 55390 53798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 55638 55562 gene locus_tag LOCUS_t00020 55638 55562 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 56803 55616 gene locus_tag LOCUS_01220 gene mutY 56803 55616 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056920.1 protein_id gnl|my_center|LOCUS_01220 57324 56812 gene locus_tag LOCUS_01230 57324 56812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 57428 58402 gene locus_tag LOCUS_01240 57428 58402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 58435 58578 gene locus_tag LOCUS_01250 58435 58578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 58603 58935 gene locus_tag LOCUS_01260 gene trxA 58603 58935 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311093.1 protein_id gnl|my_center|LOCUS_01260 59424 58936 gene locus_tag LOCUS_01270 gene sixA 59424 58936 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141750.1 protein_id gnl|my_center|LOCUS_01270 59629 59702 gene locus_tag LOCUS_t00030 59629 59702 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 60799 59705 gene locus_tag LOCUS_01280 gene dnaN 60799 59705 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549381.1 protein_id gnl|my_center|LOCUS_01280 62428 61082 gene locus_tag LOCUS_01290 gene dnaA 62428 61082 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815138.1 protein_id gnl|my_center|LOCUS_01290 62973 64097 gene locus_tag LOCUS_01300 62973 64097 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902891.1 protein_id gnl|my_center|LOCUS_01300 64099 64947 gene locus_tag LOCUS_01310 64099 64947 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_01310 65003 65599 gene locus_tag LOCUS_01320 65003 65599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 66303 65644 gene locus_tag LOCUS_01330 66303 65644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 66400 66472 gene locus_tag LOCUS_t00040 66400 66472 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 73334 66504 gene locus_tag LOCUS_01340 73334 66504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 73418 74014 gene locus_tag LOCUS_01350 73418 74014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 74043 74771 gene locus_tag LOCUS_01360 74043 74771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 74842 76821 gene locus_tag LOCUS_01370 74842 76821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 76811 77596 gene locus_tag LOCUS_01380 76811 77596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 78983 77637 gene locus_tag LOCUS_01390 78983 77637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 79450 78998 gene locus_tag LOCUS_01400 79450 78998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 79992 79447 gene locus_tag LOCUS_01410 79992 79447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 81848 80124 gene locus_tag LOCUS_01420 81848 80124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 83305 81905 gene locus_tag LOCUS_01430 83305 81905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 >Feature sequence003 850 2829 gene locus_tag LOCUS_01440 850 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 3706 2858 gene locus_tag LOCUS_01450 3706 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 3878 5818 gene locus_tag LOCUS_01460 3878 5818 CDS product DUF4838 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774925.1 protein_id gnl|my_center|LOCUS_01460 5925 6527 gene locus_tag LOCUS_01470 gene msrA 5925 6527 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021447.1 protein_id gnl|my_center|LOCUS_01470 6665 7171 gene locus_tag LOCUS_01480 6665 7171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 7359 7132 gene locus_tag LOCUS_01490 7359 7132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 8544 7363 gene locus_tag LOCUS_01500 8544 7363 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582709.1 protein_id gnl|my_center|LOCUS_01500 8765 9196 gene locus_tag LOCUS_01510 8765 9196 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929155.1 protein_id gnl|my_center|LOCUS_01510 9201 11888 gene locus_tag LOCUS_01520 9201 11888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 11962 13245 gene locus_tag LOCUS_01530 11962 13245 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118398.1 protein_id gnl|my_center|LOCUS_01530 13220 14974 gene locus_tag LOCUS_01540 13220 14974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 16287 14866 gene locus_tag LOCUS_01550 16287 14866 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_01550 16863 16381 gene locus_tag LOCUS_01560 16863 16381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 17182 18552 gene locus_tag LOCUS_01570 17182 18552 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_01570 18725 19723 gene locus_tag LOCUS_01580 18725 19723 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141616.1 protein_id gnl|my_center|LOCUS_01580 20745 19765 gene locus_tag LOCUS_01590 20745 19765 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460199.1 protein_id gnl|my_center|LOCUS_01590 22121 20751 gene locus_tag LOCUS_01600 22121 20751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 23931 22261 gene locus_tag LOCUS_01610 gene ilvD 23931 22261 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932306.1 protein_id gnl|my_center|LOCUS_01610 24062 24442 gene locus_tag LOCUS_01620 24062 24442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 24486 24683 gene locus_tag LOCUS_01630 24486 24683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 25499 24696 gene locus_tag LOCUS_01640 25499 24696 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 protein_id gnl|my_center|LOCUS_01640 26247 25531 gene locus_tag LOCUS_01650 26247 25531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 26974 26237 gene locus_tag LOCUS_01660 26974 26237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 28053 27214 gene locus_tag LOCUS_01670 28053 27214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 28526 28074 gene locus_tag LOCUS_01680 28526 28074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 29622 28606 gene locus_tag LOCUS_01690 29622 28606 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774414.1 protein_id gnl|my_center|LOCUS_01690 29927 30307 gene locus_tag LOCUS_01700 29927 30307 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460856.1 protein_id gnl|my_center|LOCUS_01700 30330 31175 gene locus_tag LOCUS_01710 30330 31175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 31214 32377 gene locus_tag LOCUS_01720 31214 32377 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044960.1 protein_id gnl|my_center|LOCUS_01720 34219 32471 gene locus_tag LOCUS_01730 34219 32471 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119625.1 protein_id gnl|my_center|LOCUS_01730 35827 34484 gene locus_tag LOCUS_01740 35827 34484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 39089 35916 gene locus_tag LOCUS_01750 gene lacZ 39089 35916 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_01750 39643 43035 gene locus_tag LOCUS_01760 39643 43035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 43493 43071 gene locus_tag LOCUS_01770 43493 43071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 44676 43555 gene locus_tag LOCUS_01780 44676 43555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 44817 47690 gene locus_tag LOCUS_01790 44817 47690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 47709 50531 gene locus_tag LOCUS_01800 47709 50531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 50682 52016 gene locus_tag LOCUS_01810 50682 52016 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921573.1 protein_id gnl|my_center|LOCUS_01810 52065 52256 gene locus_tag LOCUS_01820 52065 52256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 53539 52253 gene locus_tag LOCUS_01830 53539 52253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 53898 55187 gene locus_tag LOCUS_01840 53898 55187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 55180 57513 gene locus_tag LOCUS_01850 55180 57513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 57546 58715 gene locus_tag LOCUS_01860 gene galK 57546 58715 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259543.1 protein_id gnl|my_center|LOCUS_01860 62458 58742 gene locus_tag LOCUS_01870 62458 58742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 64428 62455 gene locus_tag LOCUS_01880 64428 62455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 65063 68326 gene locus_tag LOCUS_01890 65063 68326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 70747 68438 gene locus_tag LOCUS_01900 70747 68438 CDS product bifunctional dihydroorotate dehydrogenase B NAD binding subunit/NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764496.1 protein_id gnl|my_center|LOCUS_01900 71038 72183 gene locus_tag LOCUS_01910 71038 72183 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063838431.1 protein_id gnl|my_center|LOCUS_01910 72189 72485 gene locus_tag LOCUS_01920 72189 72485 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325302.1 protein_id gnl|my_center|LOCUS_01920 72482 73876 gene locus_tag LOCUS_01930 72482 73876 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325301.1 protein_id gnl|my_center|LOCUS_01930 74087 76039 gene locus_tag LOCUS_01940 74087 76039 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898626.1 protein_id gnl|my_center|LOCUS_01940 76070 76576 gene locus_tag LOCUS_01950 76070 76576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 >Feature sequence004 570 142 gene locus_tag LOCUS_01960 570 142 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035740.1 protein_id gnl|my_center|LOCUS_01960 843 586 gene locus_tag LOCUS_01970 843 586 CDS product CD225/dispanin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057927.1 protein_id gnl|my_center|LOCUS_01970 1321 2388 gene locus_tag LOCUS_01980 gene gcvT 1321 2388 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941043.1 protein_id gnl|my_center|LOCUS_01980 2402 2794 gene locus_tag LOCUS_01990 gene gcvH 2402 2794 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173499.1 protein_id gnl|my_center|LOCUS_01990 2791 4074 gene locus_tag LOCUS_02000 gene gcvPA 2791 4074 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941045.1 protein_id gnl|my_center|LOCUS_02000 4100 5533 gene locus_tag LOCUS_02010 gene gcvPB 4100 5533 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941046.1 protein_id gnl|my_center|LOCUS_02010 5541 6266 gene locus_tag LOCUS_02020 5541 6266 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223980.1 protein_id gnl|my_center|LOCUS_02020 6491 7237 gene locus_tag LOCUS_02030 6491 7237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 7249 7665 gene locus_tag LOCUS_02040 7249 7665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 8041 9060 gene locus_tag LOCUS_02050 8041 9060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 9057 9728 gene locus_tag LOCUS_02060 9057 9728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 9730 10533 gene locus_tag LOCUS_02070 gene murI 9730 10533 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_02070 10533 12182 gene locus_tag LOCUS_02080 10533 12182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 12179 13162 gene locus_tag LOCUS_02090 gene tsaD 12179 13162 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393644.1 protein_id gnl|my_center|LOCUS_02090 13260 14327 gene locus_tag LOCUS_02100 13260 14327 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_02100 14332 16518 gene locus_tag LOCUS_02110 14332 16518 CDS product glycoside hydrolase family 92 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048697949.1 protein_id gnl|my_center|LOCUS_02110 16566 17462 gene locus_tag LOCUS_02120 16566 17462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 17459 17608 gene locus_tag LOCUS_02130 17459 17608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 17605 17817 gene locus_tag LOCUS_02140 17605 17817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 18763 17882 gene locus_tag LOCUS_02150 18763 17882 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087636.1 protein_id gnl|my_center|LOCUS_02150 18878 20641 gene locus_tag LOCUS_02160 18878 20641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 20967 20638 gene locus_tag LOCUS_02170 20967 20638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 21304 22278 gene locus_tag LOCUS_02180 21304 22278 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037025.1 protein_id gnl|my_center|LOCUS_02180 24368 22374 gene locus_tag LOCUS_02190 24368 22374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 24550 24990 gene locus_tag LOCUS_02200 24550 24990 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118554.1 protein_id gnl|my_center|LOCUS_02200 25420 25974 gene locus_tag LOCUS_02210 25420 25974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 26194 26736 gene locus_tag LOCUS_02220 26194 26736 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946639.1 protein_id gnl|my_center|LOCUS_02220 26751 27965 gene locus_tag LOCUS_02230 26751 27965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 28599 28123 gene locus_tag LOCUS_02240 28599 28123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 29521 28631 gene locus_tag LOCUS_02250 29521 28631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 30088 29693 gene locus_tag LOCUS_02260 30088 29693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 30896 30300 gene locus_tag LOCUS_02270 30896 30300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 31595 31023 gene locus_tag LOCUS_02280 31595 31023 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257601.1 protein_id gnl|my_center|LOCUS_02280 33079 31592 gene locus_tag LOCUS_02290 gene trpE 33079 31592 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_02290 33489 33094 gene locus_tag LOCUS_02300 33489 33094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 34585 33785 gene locus_tag LOCUS_02310 34585 33785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 35986 34643 gene locus_tag LOCUS_02320 gene accC 35986 34643 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393033.1 protein_id gnl|my_center|LOCUS_02320 36486 36019 gene locus_tag LOCUS_02330 36486 36019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 37100 36537 gene locus_tag LOCUS_02340 gene efp 37100 36537 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894417.1 protein_id gnl|my_center|LOCUS_02340 38170 37097 gene locus_tag LOCUS_02350 38170 37097 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393048.1 protein_id gnl|my_center|LOCUS_02350 38601 38167 gene locus_tag LOCUS_02360 gene aroQ 38601 38167 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_02360 41204 38613 gene locus_tag LOCUS_02370 41204 38613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 42336 41158 gene locus_tag LOCUS_02380 42336 41158 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966159.1 protein_id gnl|my_center|LOCUS_02380 43461 42352 gene locus_tag LOCUS_02390 43461 42352 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256755.1 protein_id gnl|my_center|LOCUS_02390 44555 43458 gene locus_tag LOCUS_02400 44555 43458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 45679 44546 gene locus_tag LOCUS_02410 45679 44546 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_02410 46102 45863 gene locus_tag LOCUS_02420 46102 45863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 45995 47029 gene locus_tag LOCUS_02430 gene hrcA 45995 47029 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_02430 47035 47709 gene locus_tag LOCUS_02440 47035 47709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 47800 49749 gene locus_tag LOCUS_02450 gene dnaK 47800 49749 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_02450 49861 51009 gene locus_tag LOCUS_02460 gene dnaJ 49861 51009 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_02460 52426 51029 gene locus_tag LOCUS_02470 52426 51029 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 protein_id gnl|my_center|LOCUS_02470 52706 54064 gene locus_tag LOCUS_02480 52706 54064 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546821.1 protein_id gnl|my_center|LOCUS_02480 54843 54076 gene locus_tag LOCUS_02490 54843 54076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 55870 54965 gene locus_tag LOCUS_02500 55870 54965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 59384 55920 gene locus_tag LOCUS_02510 59384 55920 CDS product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943656.1 protein_id gnl|my_center|LOCUS_02510 59975 59475 gene locus_tag LOCUS_02520 59975 59475 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330832.1 protein_id gnl|my_center|LOCUS_02520 60233 61678 gene locus_tag LOCUS_02530 60233 61678 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149560515.1 protein_id gnl|my_center|LOCUS_02530 61710 62612 gene locus_tag LOCUS_02540 61710 62612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 62616 63284 gene locus_tag LOCUS_02550 62616 63284 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142665.1 protein_id gnl|my_center|LOCUS_02550 63587 64594 gene locus_tag LOCUS_02560 63587 64594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 >Feature sequence005 1382 3964 gene locus_tag LOCUS_02570 1382 3964 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943854.1 protein_id gnl|my_center|LOCUS_02570 4093 4785 gene locus_tag LOCUS_02580 4093 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 6186 4789 gene locus_tag LOCUS_02590 6186 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 6397 7941 gene locus_tag LOCUS_02600 6397 7941 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442661.1 protein_id gnl|my_center|LOCUS_02600 8049 9491 gene locus_tag LOCUS_02610 8049 9491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 9659 12598 gene locus_tag LOCUS_02620 9659 12598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 12846 14210 gene locus_tag LOCUS_02630 12846 14210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 14760 14284 gene locus_tag LOCUS_02640 gene sixA 14760 14284 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878502.1 protein_id gnl|my_center|LOCUS_02640 15919 14819 gene locus_tag LOCUS_02650 15919 14819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 19676 15912 gene locus_tag LOCUS_02660 19676 15912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 21141 20164 gene locus_tag LOCUS_02670 21141 20164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 21797 22552 gene locus_tag LOCUS_02680 21797 22552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 22589 24031 gene locus_tag LOCUS_02690 22589 24031 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275393.1 protein_id gnl|my_center|LOCUS_02690 24125 25972 gene locus_tag LOCUS_02700 24125 25972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 27502 25988 gene locus_tag LOCUS_02710 gene malQ 27502 25988 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_02710 28321 27542 gene locus_tag LOCUS_02720 28321 27542 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889246.1 protein_id gnl|my_center|LOCUS_02720 28962 28318 gene locus_tag LOCUS_02730 28962 28318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 29533 28943 gene locus_tag LOCUS_02740 gene nadD 29533 28943 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390005.1 protein_id gnl|my_center|LOCUS_02740 30779 29526 gene locus_tag LOCUS_02750 30779 29526 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_02750 31981 30854 gene locus_tag LOCUS_02760 gene proB 31981 30854 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_02760 33215 31962 gene locus_tag LOCUS_02770 gene obgE 33215 31962 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392098.1 protein_id gnl|my_center|LOCUS_02770 33503 33240 gene locus_tag LOCUS_02780 gene rpmA 33503 33240 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940600.1 protein_id gnl|my_center|LOCUS_02780 33828 33517 gene locus_tag LOCUS_02790 gene rplU 33828 33517 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964569.1 protein_id gnl|my_center|LOCUS_02790 34742 33918 gene locus_tag LOCUS_02800 34742 33918 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020996.1 protein_id gnl|my_center|LOCUS_02800 35279 38752 gene locus_tag LOCUS_02810 35279 38752 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941263.1 protein_id gnl|my_center|LOCUS_02810 39642 38749 gene locus_tag LOCUS_02820 gene cynR 39642 38749 CDS product transcriptional regulator CynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256690.1 protein_id gnl|my_center|LOCUS_02820 39752 40822 gene locus_tag LOCUS_02830 gene purM 39752 40822 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461474.1 protein_id gnl|my_center|LOCUS_02830 40830 43766 gene locus_tag LOCUS_02840 40830 43766 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942279.1 protein_id gnl|my_center|LOCUS_02840 43822 44613 gene locus_tag LOCUS_02850 43822 44613 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942280.1 protein_id gnl|my_center|LOCUS_02850 46047 44641 gene locus_tag LOCUS_02860 46047 44641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 46828 48042 gene locus_tag LOCUS_02870 46828 48042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 49510 48170 gene locus_tag LOCUS_02880 gene gdhA 49510 48170 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094817.1 protein_id gnl|my_center|LOCUS_02880 50677 49733 gene locus_tag LOCUS_02890 50677 49733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 51918 50704 gene locus_tag LOCUS_02900 51918 50704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 52162 53469 gene locus_tag LOCUS_02910 52162 53469 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_02910 54985 53501 gene locus_tag LOCUS_02920 54985 53501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 55048 55147 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 56202 57098 gene locus_tag LOCUS_02930 56202 57098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 58135 57170 gene locus_tag LOCUS_02940 58135 57170 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225414074.1 protein_id gnl|my_center|LOCUS_02940 >Feature sequence006 <1 962 gene locus_tag LOCUS_02950 <1 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014876792.1:BadF/BadG/BcrA/BcrD ATPase family protein 1305 4034 gene locus_tag LOCUS_02960 1305 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 6177 4048 gene locus_tag LOCUS_02970 6177 4048 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444553.1 protein_id gnl|my_center|LOCUS_02970 7662 6346 gene locus_tag LOCUS_02980 gene ftsA 7662 6346 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039098.1 protein_id gnl|my_center|LOCUS_02980 9934 7772 gene locus_tag LOCUS_02990 9934 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 10760 10152 gene locus_tag LOCUS_03000 gene cysC 10760 10152 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468764.1 protein_id gnl|my_center|LOCUS_03000 10986 12521 gene locus_tag LOCUS_03010 10986 12521 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_03010 12702 14648 gene locus_tag LOCUS_03020 12702 14648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 14929 16425 gene locus_tag LOCUS_03030 14929 16425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 16508 18355 gene locus_tag LOCUS_03040 16508 18355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 18608 19879 gene locus_tag LOCUS_03050 gene tyrS 18608 19879 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186029.1 protein_id gnl|my_center|LOCUS_03050 20011 22242 gene locus_tag LOCUS_03060 20011 22242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 22390 23430 gene locus_tag LOCUS_03070 22390 23430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 24327 23440 gene locus_tag LOCUS_03080 24327 23440 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883532.1 protein_id gnl|my_center|LOCUS_03080 26639 24342 gene locus_tag LOCUS_03090 26639 24342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145375047.1 protein_id gnl|my_center|LOCUS_03090 26825 28057 gene locus_tag LOCUS_03100 26825 28057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 28172 29230 gene locus_tag LOCUS_03110 28172 29230 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942836.1 protein_id gnl|my_center|LOCUS_03110 30940 29255 gene locus_tag LOCUS_03120 30940 29255 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584095.1 protein_id gnl|my_center|LOCUS_03120 32692 31247 gene locus_tag LOCUS_03130 32692 31247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 34294 32711 gene locus_tag LOCUS_03140 34294 32711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 38103 34714 gene locus_tag LOCUS_03150 38103 34714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 39250 38177 gene locus_tag LOCUS_03160 39250 38177 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121662.1 protein_id gnl|my_center|LOCUS_03160 40328 39252 gene locus_tag LOCUS_03170 40328 39252 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086980.1 protein_id gnl|my_center|LOCUS_03170 40540 42234 gene locus_tag LOCUS_03180 40540 42234 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939361.1 protein_id gnl|my_center|LOCUS_03180 42250 43254 gene locus_tag LOCUS_03190 42250 43254 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_03190 43264 44313 gene locus_tag LOCUS_03200 43264 44313 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_03200 44333 44719 gene locus_tag LOCUS_03210 44333 44719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 44726 45754 gene locus_tag LOCUS_03220 44726 45754 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932339.1 protein_id gnl|my_center|LOCUS_03220 45751 46746 gene locus_tag LOCUS_03230 45751 46746 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_03230 46802 46901 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 47140 48087 gene locus_tag LOCUS_03240 gene trxB 47140 48087 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940581.1 protein_id gnl|my_center|LOCUS_03240 48209 49720 gene locus_tag LOCUS_03250 48209 49720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 51013 49730 gene locus_tag LOCUS_03260 gene gabT 51013 49730 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103055.1 protein_id gnl|my_center|LOCUS_03260 51692 51279 gene locus_tag LOCUS_03270 51692 51279 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419409.1 protein_id gnl|my_center|LOCUS_03270 53160 51958 gene locus_tag LOCUS_03280 53160 51958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 54356 53175 gene locus_tag LOCUS_03290 gene nagA 54356 53175 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417418.1 protein_id gnl|my_center|LOCUS_03290 55310 54498 gene locus_tag LOCUS_03300 gene fetB 55310 54498 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191253.1 protein_id gnl|my_center|LOCUS_03300 55966 55310 gene locus_tag LOCUS_03310 gene fetA 55966 55310 CDS product iron ABC transporter ATP-binding protein FetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157540.1 protein_id gnl|my_center|LOCUS_03310 57349 55979 gene locus_tag LOCUS_03320 57349 55979 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404619.1 protein_id gnl|my_center|LOCUS_03320 >Feature sequence007 918 199 gene locus_tag LOCUS_03330 918 199 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_03330 3065 918 gene locus_tag LOCUS_03340 3065 918 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392959.1 protein_id gnl|my_center|LOCUS_03340 3966 4757 gene locus_tag LOCUS_03350 3966 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 4771 5376 gene locus_tag LOCUS_03360 4771 5376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 5391 6455 gene locus_tag LOCUS_03370 5391 6455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 6459 6785 gene locus_tag LOCUS_03380 6459 6785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 6782 8566 gene locus_tag LOCUS_03390 6782 8566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 8550 9971 gene locus_tag LOCUS_03400 8550 9971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 9985 10950 gene locus_tag LOCUS_03410 9985 10950 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897409.1 protein_id gnl|my_center|LOCUS_03410 10947 12344 gene locus_tag LOCUS_03420 10947 12344 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259740.1 protein_id gnl|my_center|LOCUS_03420 12341 13387 gene locus_tag LOCUS_03430 12341 13387 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784748.1 protein_id gnl|my_center|LOCUS_03430 13408 14169 gene locus_tag LOCUS_03440 13408 14169 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256259.1 protein_id gnl|my_center|LOCUS_03440 14341 14832 gene locus_tag LOCUS_03450 gene purE 14341 14832 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_03450 16451 14853 gene locus_tag LOCUS_03460 16451 14853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 17771 16515 gene locus_tag LOCUS_03470 17771 16515 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763569.1 protein_id gnl|my_center|LOCUS_03470 18804 17818 gene locus_tag LOCUS_03480 18804 17818 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186989.1 protein_id gnl|my_center|LOCUS_03480 19494 22406 gene locus_tag LOCUS_03490 19494 22406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 22500 23453 gene locus_tag LOCUS_03500 22500 23453 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_03500 23494 24327 gene locus_tag LOCUS_03510 23494 24327 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_03510 24342 25220 gene locus_tag LOCUS_03520 24342 25220 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545817.1 protein_id gnl|my_center|LOCUS_03520 25290 26042 gene locus_tag LOCUS_03530 25290 26042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 26128 27090 gene locus_tag LOCUS_03540 26128 27090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 27162 27359 gene locus_tag LOCUS_03550 27162 27359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 29572 27386 gene locus_tag LOCUS_03560 29572 27386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 29984 29799 gene locus_tag LOCUS_03570 29984 29799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 30554 30006 gene locus_tag LOCUS_03580 30554 30006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 30803 31129 gene locus_tag LOCUS_03590 30803 31129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 31177 31974 gene locus_tag LOCUS_03600 31177 31974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 32113 32346 gene locus_tag LOCUS_03610 32113 32346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 33723 32425 gene locus_tag LOCUS_03620 33723 32425 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081252.1 protein_id gnl|my_center|LOCUS_03620 34535 33720 gene locus_tag LOCUS_03630 34535 33720 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949071.1 protein_id gnl|my_center|LOCUS_03630 35578 34532 gene locus_tag LOCUS_03640 35578 34532 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074694.1 protein_id gnl|my_center|LOCUS_03640 36268 37521 gene locus_tag LOCUS_03650 36268 37521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 38734 37463 gene locus_tag LOCUS_03660 38734 37463 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_03660 41948 38817 gene locus_tag LOCUS_03670 41948 38817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 42752 42006 gene locus_tag LOCUS_03680 42752 42006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 43742 42804 gene locus_tag LOCUS_03690 43742 42804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 46027 43742 gene locus_tag LOCUS_03700 46027 43742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 47658 46252 gene locus_tag LOCUS_03710 47658 46252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 54941 47655 gene locus_tag LOCUS_03720 54941 47655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 47992 48091 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence008 <1 1108 gene locus_tag LOCUS_03730 <1 1108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228613.1:ABC transporter ATP-binding protein 1105 2994 gene locus_tag LOCUS_03740 1105 2994 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931951.1 protein_id gnl|my_center|LOCUS_03740 3509 5197 gene locus_tag LOCUS_03750 3509 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 5444 7378 gene locus_tag LOCUS_03760 5444 7378 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250356.1 protein_id gnl|my_center|LOCUS_03760 7554 8549 gene locus_tag LOCUS_03770 7554 8549 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658378.1 protein_id gnl|my_center|LOCUS_03770 9528 8554 gene locus_tag LOCUS_03780 9528 8554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 10445 9576 gene locus_tag LOCUS_03790 10445 9576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 10577 11878 gene locus_tag LOCUS_03800 10577 11878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 11930 12790 gene locus_tag LOCUS_03810 11930 12790 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125281.1 protein_id gnl|my_center|LOCUS_03810 12768 15104 gene locus_tag LOCUS_03820 12768 15104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 17996 15171 gene locus_tag LOCUS_03830 17996 15171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 19057 18089 gene locus_tag LOCUS_03840 19057 18089 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143314.1 protein_id gnl|my_center|LOCUS_03840 19240 20094 gene locus_tag LOCUS_03850 19240 20094 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417210.1 protein_id gnl|my_center|LOCUS_03850 20461 22002 gene locus_tag LOCUS_03860 20461 22002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 22191 22553 gene locus_tag LOCUS_03870 22191 22553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 23360 22578 gene locus_tag LOCUS_03880 23360 22578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 25482 23362 gene locus_tag LOCUS_03890 25482 23362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 25608 28361 gene locus_tag LOCUS_03900 gene secA 25608 28361 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945439.1 protein_id gnl|my_center|LOCUS_03900 28334 29851 gene locus_tag LOCUS_03910 28334 29851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 29856 30587 gene locus_tag LOCUS_03920 29856 30587 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_03920 30584 32281 gene locus_tag LOCUS_03930 30584 32281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 33426 33821 gene locus_tag LOCUS_03940 33426 33821 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082423.1 protein_id gnl|my_center|LOCUS_03940 33902 34528 gene locus_tag LOCUS_03950 33902 34528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 34679 35923 gene locus_tag LOCUS_03960 34679 35923 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027323.1 protein_id gnl|my_center|LOCUS_03960 35951 37165 gene locus_tag LOCUS_03970 35951 37165 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027323.1 protein_id gnl|my_center|LOCUS_03970 37188 38876 gene locus_tag LOCUS_03980 37188 38876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 38898 39989 gene locus_tag LOCUS_03990 38898 39989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 40197 42215 gene locus_tag LOCUS_04000 40197 42215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 42684 42307 gene locus_tag LOCUS_04010 42684 42307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 42967 43866 gene locus_tag LOCUS_04020 42967 43866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 44448 43984 gene locus_tag LOCUS_04030 44448 43984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 45038 44586 gene locus_tag LOCUS_04040 45038 44586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 45597 45028 gene locus_tag LOCUS_04050 gene rpoE 45597 45028 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_04050 46553 45639 gene locus_tag LOCUS_04060 46553 45639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 46906 47313 gene locus_tag LOCUS_04070 46906 47313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 47399 50161 gene locus_tag LOCUS_04080 47399 50161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 50242 52608 gene locus_tag LOCUS_04090 50242 52608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 53617 52616 gene locus_tag LOCUS_04100 gene mgrA 53617 52616 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395477.1 protein_id gnl|my_center|LOCUS_04100 53875 53950 gene locus_tag LOCUS_t00050 53875 53950 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence009 826 365 gene locus_tag LOCUS_04110 gene rpiB 826 365 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_04110 2006 1869 gene locus_tag LOCUS_04120 2006 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 2296 4230 gene locus_tag LOCUS_04130 2296 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 4249 5802 gene locus_tag LOCUS_04140 4249 5802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 5783 7165 gene locus_tag LOCUS_04150 gene mnmE 5783 7165 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258674.1 protein_id gnl|my_center|LOCUS_04150 8381 7227 gene locus_tag LOCUS_04160 8381 7227 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027502.1 protein_id gnl|my_center|LOCUS_04160 9975 8632 gene locus_tag LOCUS_04170 9975 8632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 10355 10038 gene locus_tag LOCUS_04180 10355 10038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 11914 10352 gene locus_tag LOCUS_04190 11914 10352 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971788.1 protein_id gnl|my_center|LOCUS_04190 13174 11987 gene locus_tag LOCUS_04200 13174 11987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 13312 13178 gene locus_tag LOCUS_04210 13312 13178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 14352 13309 gene locus_tag LOCUS_04220 14352 13309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 14719 15471 gene locus_tag LOCUS_04230 14719 15471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 15506 16981 gene locus_tag LOCUS_04240 gene glpK 15506 16981 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945391.1 protein_id gnl|my_center|LOCUS_04240 19317 17320 gene locus_tag LOCUS_04250 19317 17320 CDS product exopolysaccharide transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530604.1 protein_id gnl|my_center|LOCUS_04250 20745 19369 gene locus_tag LOCUS_04260 20745 19369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 21470 20751 gene locus_tag LOCUS_04270 21470 20751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 22611 21631 gene locus_tag LOCUS_04280 22611 21631 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808328.1 protein_id gnl|my_center|LOCUS_04280 23670 22681 gene locus_tag LOCUS_04290 23670 22681 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929836.1 protein_id gnl|my_center|LOCUS_04290 25854 24118 gene locus_tag LOCUS_04300 25854 24118 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118830.1 protein_id gnl|my_center|LOCUS_04300 27574 26024 gene locus_tag LOCUS_04310 gene rng 27574 26024 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_04310 28245 27610 gene locus_tag LOCUS_04320 28245 27610 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392092.1 protein_id gnl|my_center|LOCUS_04320 29429 28275 gene locus_tag LOCUS_04330 gene rodA 29429 28275 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_04330 31369 29426 gene locus_tag LOCUS_04340 gene mrdA 31369 29426 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_04340 31886 31380 gene locus_tag LOCUS_04350 31886 31380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 32811 31888 gene locus_tag LOCUS_04360 32811 31888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 33908 32880 gene locus_tag LOCUS_04370 33908 32880 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938090.1 protein_id gnl|my_center|LOCUS_04370 34268 35341 gene locus_tag LOCUS_04380 34268 35341 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583627.1 protein_id gnl|my_center|LOCUS_04380 36208 35345 gene locus_tag LOCUS_04390 36208 35345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 36521 37027 gene locus_tag LOCUS_04400 gene fldA 36521 37027 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648709.1 protein_id gnl|my_center|LOCUS_04400 37074 37928 gene locus_tag LOCUS_04410 37074 37928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 39136 37949 gene locus_tag LOCUS_04420 39136 37949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 39924 39136 gene locus_tag LOCUS_04430 39924 39136 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039642892.1 protein_id gnl|my_center|LOCUS_04430 40051 41337 gene locus_tag LOCUS_04440 40051 41337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 41531 42490 gene locus_tag LOCUS_04450 41531 42490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 43729 42464 gene locus_tag LOCUS_04460 43729 42464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 44224 43736 gene locus_tag LOCUS_04470 44224 43736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 44387 45247 gene locus_tag LOCUS_04480 gene truA 44387 45247 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118979.1 protein_id gnl|my_center|LOCUS_04480 45787 46635 gene locus_tag LOCUS_04490 gene rfbD 45787 46635 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943001.1 protein_id gnl|my_center|LOCUS_04490 46632 47633 gene locus_tag LOCUS_04500 gene rfbB 46632 47633 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_04500 47774 48787 gene locus_tag LOCUS_04510 gene aroF 47774 48787 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943764.1 protein_id gnl|my_center|LOCUS_04510 48804 49535 gene locus_tag LOCUS_04520 48804 49535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 49630 50349 gene locus_tag LOCUS_04530 49630 50349 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392865.1 protein_id gnl|my_center|LOCUS_04530 51405 50362 gene locus_tag LOCUS_04540 51405 50362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 53981 51402 gene locus_tag LOCUS_04550 53981 51402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 >Feature sequence010 1929 355 gene locus_tag LOCUS_04560 1929 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 2159 3193 gene locus_tag LOCUS_04570 2159 3193 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_04570 3245 4504 gene locus_tag LOCUS_04580 3245 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 4728 9407 gene locus_tag LOCUS_04590 4728 9407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 9491 10147 gene locus_tag LOCUS_04600 9491 10147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 10192 13338 gene locus_tag LOCUS_04610 10192 13338 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989870.1 protein_id gnl|my_center|LOCUS_04610 14596 13370 gene locus_tag LOCUS_04620 14596 13370 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919501.1 protein_id gnl|my_center|LOCUS_04620 15585 14779 gene locus_tag LOCUS_04630 15585 14779 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123954.1 protein_id gnl|my_center|LOCUS_04630 18000 15652 gene locus_tag LOCUS_04640 18000 15652 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974050.1 protein_id gnl|my_center|LOCUS_04640 18180 18767 gene locus_tag LOCUS_04650 18180 18767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 22037 18774 gene locus_tag LOCUS_04660 gene mfd 22037 18774 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391629.1 protein_id gnl|my_center|LOCUS_04660 22692 22138 gene locus_tag LOCUS_04670 gene rpsD 22692 22138 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090512.1 protein_id gnl|my_center|LOCUS_04670 24454 23081 gene locus_tag LOCUS_04680 24454 23081 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_04680 26337 24622 gene locus_tag LOCUS_04690 26337 24622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 27138 26473 gene locus_tag LOCUS_04700 27138 26473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 28701 27157 gene locus_tag LOCUS_04710 gene zwf 28701 27157 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_04710 30123 28819 gene locus_tag LOCUS_04720 30123 28819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 31449 30283 gene locus_tag LOCUS_04730 31449 30283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 33563 31722 gene locus_tag LOCUS_04740 33563 31722 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804055.1 protein_id gnl|my_center|LOCUS_04740 33787 33563 gene locus_tag LOCUS_04750 33787 33563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 33970 34887 gene locus_tag LOCUS_04760 gene metF 33970 34887 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615859.1 protein_id gnl|my_center|LOCUS_04760 34943 35179 gene locus_tag LOCUS_04770 34943 35179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 35434 35240 gene locus_tag LOCUS_04780 35434 35240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 36285 35578 gene locus_tag LOCUS_04790 36285 35578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 36504 38222 gene locus_tag LOCUS_04800 36504 38222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 38271 39071 gene locus_tag LOCUS_04810 38271 39071 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682046.1 protein_id gnl|my_center|LOCUS_04810 40166 39090 gene locus_tag LOCUS_04820 40166 39090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 42615 40189 gene locus_tag LOCUS_04830 42615 40189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 46013 42639 gene locus_tag LOCUS_04840 46013 42639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 46766 46221 gene locus_tag LOCUS_04850 46766 46221 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439149.1 protein_id gnl|my_center|LOCUS_04850 47327 50872 gene locus_tag LOCUS_04860 47327 50872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 >Feature sequence011 2854 2991 gene locus_tag LOCUS_04870 2854 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 3378 4955 gene locus_tag LOCUS_04880 gene serA 3378 4955 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_04880 5014 6243 gene locus_tag LOCUS_04890 gene icd 5014 6243 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229433.1 protein_id gnl|my_center|LOCUS_04890 6363 7121 gene locus_tag LOCUS_04900 6363 7121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 7883 7125 gene locus_tag LOCUS_04910 7883 7125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 8637 7816 gene locus_tag LOCUS_04920 8637 7816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 9365 8634 gene locus_tag LOCUS_04930 9365 8634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 9842 9534 gene locus_tag LOCUS_04940 9842 9534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 10229 9864 gene locus_tag LOCUS_04950 10229 9864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 10555 11727 gene locus_tag LOCUS_04960 gene amrB 10555 11727 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880857.1 protein_id gnl|my_center|LOCUS_04960 11755 13812 gene locus_tag LOCUS_04970 11755 13812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 16995 13828 gene locus_tag LOCUS_04980 16995 13828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 19597 17009 gene locus_tag LOCUS_04990 19597 17009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 23039 19638 gene locus_tag LOCUS_05000 23039 19638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 25553 23094 gene locus_tag LOCUS_05010 25553 23094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 26428 26201 gene locus_tag LOCUS_05020 26428 26201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 26322 27761 gene locus_tag LOCUS_05030 26322 27761 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615908.1 protein_id gnl|my_center|LOCUS_05030 29182 27818 gene locus_tag LOCUS_05040 29182 27818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 29768 29340 gene locus_tag LOCUS_05050 29768 29340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 31022 30081 gene locus_tag LOCUS_05060 31022 30081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 31321 33333 gene locus_tag LOCUS_05070 31321 33333 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160859024.1 protein_id gnl|my_center|LOCUS_05070 36394 34058 gene locus_tag LOCUS_05080 36394 34058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 42468 36391 gene locus_tag LOCUS_05090 42468 36391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 44881 42596 gene locus_tag LOCUS_05100 44881 42596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 48606 44983 gene locus_tag LOCUS_05110 48606 44983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 48923 49000 gene locus_tag LOCUS_t00060 48923 49000 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 49356 50726 gene locus_tag LOCUS_05120 49356 50726 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846351.1 protein_id gnl|my_center|LOCUS_05120 >Feature sequence012 2086 1436 gene locus_tag LOCUS_05130 gene purO 2086 1436 CDS product IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876651.1 protein_id gnl|my_center|LOCUS_05130 2210 3502 gene locus_tag LOCUS_05140 2210 3502 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065465.1 protein_id gnl|my_center|LOCUS_05140 3514 4683 gene locus_tag LOCUS_05150 3514 4683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 6217 4766 gene locus_tag LOCUS_05160 gene gnd 6217 4766 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675469.1 protein_id gnl|my_center|LOCUS_05160 7448 6387 gene locus_tag LOCUS_05170 7448 6387 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153479.1 protein_id gnl|my_center|LOCUS_05170 7703 8593 gene locus_tag LOCUS_05180 7703 8593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 8677 10074 gene locus_tag LOCUS_05190 8677 10074 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921299.1 protein_id gnl|my_center|LOCUS_05190 10286 10651 gene locus_tag LOCUS_05200 10286 10651 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_05200 12177 10783 gene locus_tag LOCUS_05210 12177 10783 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 protein_id gnl|my_center|LOCUS_05210 12389 13567 gene locus_tag LOCUS_05220 12389 13567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 14853 13579 gene locus_tag LOCUS_05230 14853 13579 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777076.1 protein_id gnl|my_center|LOCUS_05230 16008 14860 gene locus_tag LOCUS_05240 gene pdxB 16008 14860 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699136.1 protein_id gnl|my_center|LOCUS_05240 16911 16018 gene locus_tag LOCUS_05250 16911 16018 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027122.1 protein_id gnl|my_center|LOCUS_05250 17790 16960 gene locus_tag LOCUS_05260 17790 16960 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582612.1 protein_id gnl|my_center|LOCUS_05260 18176 20029 gene locus_tag LOCUS_05270 18176 20029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 20099 21442 gene locus_tag LOCUS_05280 20099 21442 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_05280 22675 21455 gene locus_tag LOCUS_05290 22675 21455 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948371.1 protein_id gnl|my_center|LOCUS_05290 22989 23405 gene locus_tag LOCUS_05300 22989 23405 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838350.1 protein_id gnl|my_center|LOCUS_05300 23523 24242 gene locus_tag LOCUS_05310 gene ric 23523 24242 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073961.1 protein_id gnl|my_center|LOCUS_05310 24315 24602 gene locus_tag LOCUS_05320 24315 24602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 25950 24610 gene locus_tag LOCUS_05330 25950 24610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 26360 25980 gene locus_tag LOCUS_05340 26360 25980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 26589 27764 gene locus_tag LOCUS_05350 26589 27764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 27911 28153 gene locus_tag LOCUS_05360 27911 28153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 28286 29653 gene locus_tag LOCUS_05370 28286 29653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 29681 30493 gene locus_tag LOCUS_05380 29681 30493 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817305.1 protein_id gnl|my_center|LOCUS_05380 31517 30522 gene locus_tag LOCUS_05390 31517 30522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 31764 32258 gene locus_tag LOCUS_05400 31764 32258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 33077 32277 gene locus_tag LOCUS_05410 33077 32277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 34625 33282 gene locus_tag LOCUS_05420 34625 33282 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530690.1 protein_id gnl|my_center|LOCUS_05420 35698 34691 gene locus_tag LOCUS_05430 35698 34691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 35913 37760 gene locus_tag LOCUS_05440 35913 37760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 37809 39191 gene locus_tag LOCUS_05450 37809 39191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 40811 39327 gene locus_tag LOCUS_05460 40811 39327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 41194 40952 gene locus_tag LOCUS_05470 41194 40952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 41096 41518 gene locus_tag LOCUS_05480 41096 41518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 41622 42602 gene locus_tag LOCUS_05490 41622 42602 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404321.1 protein_id gnl|my_center|LOCUS_05490 42673 43629 gene locus_tag LOCUS_05500 42673 43629 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665638.1 protein_id gnl|my_center|LOCUS_05500 43745 44686 gene locus_tag LOCUS_05510 43745 44686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 44754 45980 gene locus_tag LOCUS_05520 44754 45980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 46144 47772 gene locus_tag LOCUS_05530 46144 47772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 47769 48323 gene locus_tag LOCUS_05540 47769 48323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 48342 49187 gene locus_tag LOCUS_05550 48342 49187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 49690 49223 gene locus_tag LOCUS_05560 49690 49223 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720132.1 protein_id gnl|my_center|LOCUS_05560 >Feature sequence013 <1 2171 gene locus_tag LOCUS_05570 <1 2171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938194.1:ATP-dependent RecD-like DNA helicase 3694 3158 gene locus_tag LOCUS_05580 3694 3158 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_05580 5242 3794 gene locus_tag LOCUS_05590 5242 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 5826 5329 gene locus_tag LOCUS_05600 gene ruvC 5826 5329 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_05600 6581 5826 gene locus_tag LOCUS_05610 6581 5826 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545318.1 protein_id gnl|my_center|LOCUS_05610 6834 8357 gene locus_tag LOCUS_05620 6834 8357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 8377 9855 gene locus_tag LOCUS_05630 8377 9855 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 protein_id gnl|my_center|LOCUS_05630 10173 10859 gene locus_tag LOCUS_05640 10173 10859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 11366 11004 gene locus_tag LOCUS_05650 11366 11004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 12416 11439 gene locus_tag LOCUS_05660 12416 11439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 12887 12432 gene locus_tag LOCUS_05670 12887 12432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 13017 13484 gene locus_tag LOCUS_05680 gene greA 13017 13484 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964455.1 protein_id gnl|my_center|LOCUS_05680 13698 16931 gene locus_tag LOCUS_05690 gene carB 13698 16931 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_05690 17052 18359 gene locus_tag LOCUS_05700 17052 18359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 19097 18369 gene locus_tag LOCUS_05710 19097 18369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 19712 20878 gene locus_tag LOCUS_05720 19712 20878 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407019.1 protein_id gnl|my_center|LOCUS_05720 20868 21371 gene locus_tag LOCUS_05730 20868 21371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 22667 21381 gene locus_tag LOCUS_05740 22667 21381 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_05740 23447 25468 gene locus_tag LOCUS_05750 23447 25468 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203354.1 protein_id gnl|my_center|LOCUS_05750 25461 29489 gene locus_tag LOCUS_05760 25461 29489 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_05760 29486 30970 gene locus_tag LOCUS_05770 29486 30970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 30989 31627 gene locus_tag LOCUS_05780 30989 31627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 31823 34729 gene locus_tag LOCUS_05790 31823 34729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 35242 35430 gene locus_tag LOCUS_05800 35242 35430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 35461 35841 gene locus_tag LOCUS_05810 35461 35841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 37248 35872 gene locus_tag LOCUS_05820 37248 35872 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257411.1 protein_id gnl|my_center|LOCUS_05820 40535 37359 gene locus_tag LOCUS_05830 40535 37359 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_05830 41842 40532 gene locus_tag LOCUS_05840 41842 40532 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922398.1 protein_id gnl|my_center|LOCUS_05840 43498 41894 gene locus_tag LOCUS_05850 43498 41894 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615477.1 protein_id gnl|my_center|LOCUS_05850 44218 43559 gene locus_tag LOCUS_05860 44218 43559 CDS product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937368.1 protein_id gnl|my_center|LOCUS_05860 44540 44238 gene locus_tag LOCUS_05870 44540 44238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 44660 45619 gene locus_tag LOCUS_05880 44660 45619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 45606 46484 gene locus_tag LOCUS_05890 45606 46484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 46499 47254 gene locus_tag LOCUS_05900 46499 47254 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081428946.1 protein_id gnl|my_center|LOCUS_05900 47254 48075 gene locus_tag LOCUS_05910 47254 48075 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007204.1 protein_id gnl|my_center|LOCUS_05910 48063 48707 gene locus_tag LOCUS_05920 48063 48707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 49486 48785 gene locus_tag LOCUS_05930 49486 48785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 >Feature sequence014 <1 2653 gene locus_tag LOCUS_05940 <1 2653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943442.1:PAS domain S-box protein 2785 3393 gene locus_tag LOCUS_05950 2785 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 3714 3971 gene locus_tag LOCUS_05960 3714 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 4173 6512 gene locus_tag LOCUS_05970 4173 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 7186 6500 gene locus_tag LOCUS_05980 7186 6500 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208506.1 protein_id gnl|my_center|LOCUS_05980 8868 7183 gene locus_tag LOCUS_05990 8868 7183 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122298.1 protein_id gnl|my_center|LOCUS_05990 10390 9029 gene locus_tag LOCUS_06000 10390 9029 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922235.1 protein_id gnl|my_center|LOCUS_06000 11929 10502 gene locus_tag LOCUS_06010 11929 10502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 14332 12041 gene locus_tag LOCUS_06020 14332 12041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 14222 14464 gene locus_tag LOCUS_06030 14222 14464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 14625 14724 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14877 15314 gene locus_tag LOCUS_06040 14877 15314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 15311 15727 gene locus_tag LOCUS_06050 15311 15727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 16105 15740 gene locus_tag LOCUS_06060 16105 15740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 16912 16127 gene locus_tag LOCUS_06070 16912 16127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 17665 17066 gene locus_tag LOCUS_06080 17665 17066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 18612 17695 gene locus_tag LOCUS_06090 18612 17695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 19630 18680 gene locus_tag LOCUS_06100 19630 18680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 20983 19805 gene locus_tag LOCUS_06110 20983 19805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 21251 22291 gene locus_tag LOCUS_06120 gene fba 21251 22291 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333980.1 protein_id gnl|my_center|LOCUS_06120 24015 22474 gene locus_tag LOCUS_06130 24015 22474 CDS product PhoPQ-activated protein PqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817293.1 protein_id gnl|my_center|LOCUS_06130 25655 24153 gene locus_tag LOCUS_06140 25655 24153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 28132 25787 gene locus_tag LOCUS_06150 28132 25787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 28268 28849 gene locus_tag LOCUS_06160 28268 28849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 28991 33025 gene locus_tag LOCUS_06170 28991 33025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 33098 34510 gene locus_tag LOCUS_06180 33098 34510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 35180 34512 gene locus_tag LOCUS_06190 35180 34512 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350585.1 protein_id gnl|my_center|LOCUS_06190 36446 35322 gene locus_tag LOCUS_06200 gene murG 36446 35322 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640857.1 protein_id gnl|my_center|LOCUS_06200 37610 36474 gene locus_tag LOCUS_06210 gene spoVE 37610 36474 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753520.1 protein_id gnl|my_center|LOCUS_06210 38958 37615 gene locus_tag LOCUS_06220 gene murD 38958 37615 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_06220 40453 38963 gene locus_tag LOCUS_06230 40453 38963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 41810 40467 gene locus_tag LOCUS_06240 41810 40467 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943698.1 protein_id gnl|my_center|LOCUS_06240 43279 41816 gene locus_tag LOCUS_06250 43279 41816 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_06250 45479 43242 gene locus_tag LOCUS_06260 45479 43242 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545621.1 protein_id gnl|my_center|LOCUS_06260 45868 45479 gene locus_tag LOCUS_06270 45868 45479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 46792 45875 gene locus_tag LOCUS_06280 gene rsmH 46792 45875 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943702.1 protein_id gnl|my_center|LOCUS_06280 47138 46794 gene locus_tag LOCUS_06290 47138 46794 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903963.1 protein_id gnl|my_center|LOCUS_06290 47703 47128 gene locus_tag LOCUS_06300 gene mraZ 47703 47128 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180984760.1 protein_id gnl|my_center|LOCUS_06300 49324 48608 gene locus_tag LOCUS_06310 49324 48608 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_06310 >Feature sequence015 <1 573 gene locus_tag LOCUS_06320 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122269.1:sugar phosphate isomerase/epimerase 1867 617 gene locus_tag LOCUS_06330 1867 617 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941367.1 protein_id gnl|my_center|LOCUS_06330 2051 3028 gene locus_tag LOCUS_06340 2051 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 3206 4375 gene locus_tag LOCUS_06350 3206 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 5097 4399 gene locus_tag LOCUS_06360 5097 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 5712 5101 gene locus_tag LOCUS_06370 5712 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 6287 5709 gene locus_tag LOCUS_06380 6287 5709 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329277.1 protein_id gnl|my_center|LOCUS_06380 6768 6388 gene locus_tag LOCUS_06390 6768 6388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 8234 6837 gene locus_tag LOCUS_06400 gene cysS 8234 6837 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883567.1 protein_id gnl|my_center|LOCUS_06400 8407 10176 gene locus_tag LOCUS_06410 8407 10176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 10259 11584 gene locus_tag LOCUS_06420 10259 11584 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817206.1 protein_id gnl|my_center|LOCUS_06420 11733 12146 gene locus_tag LOCUS_06430 11733 12146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 12326 14599 gene locus_tag LOCUS_06440 12326 14599 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_06440 16959 14629 gene locus_tag LOCUS_06450 16959 14629 CDS product alginate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972694.1 protein_id gnl|my_center|LOCUS_06450 19225 17084 gene locus_tag LOCUS_06460 19225 17084 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921322.1 protein_id gnl|my_center|LOCUS_06460 20913 19273 gene locus_tag LOCUS_06470 20913 19273 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804130.1 protein_id gnl|my_center|LOCUS_06470 21284 20925 gene locus_tag LOCUS_06480 21284 20925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 21647 22948 gene locus_tag LOCUS_06490 21647 22948 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253865.1 protein_id gnl|my_center|LOCUS_06490 25055 22959 gene locus_tag LOCUS_06500 25055 22959 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615420.1 protein_id gnl|my_center|LOCUS_06500 25217 25681 gene locus_tag LOCUS_06510 25217 25681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 25748 27205 gene locus_tag LOCUS_06520 25748 27205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 27558 27226 gene locus_tag LOCUS_06530 27558 27226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 27804 27586 gene locus_tag LOCUS_06540 27804 27586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 28163 29212 gene locus_tag LOCUS_06550 gene xylA 28163 29212 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977662.1 protein_id gnl|my_center|LOCUS_06550 29825 29526 gene locus_tag LOCUS_06560 29825 29526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 30044 31480 gene locus_tag LOCUS_06570 gene mpl 30044 31480 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933145.1 protein_id gnl|my_center|LOCUS_06570 31669 33024 gene locus_tag LOCUS_06580 31669 33024 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_06580 34187 33051 gene locus_tag LOCUS_06590 34187 33051 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330812.1 protein_id gnl|my_center|LOCUS_06590 35319 34213 gene locus_tag LOCUS_06600 gene carA 35319 34213 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_06600 36615 35344 gene locus_tag LOCUS_06610 36615 35344 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_06610 37616 36627 gene locus_tag LOCUS_06620 37616 36627 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 protein_id gnl|my_center|LOCUS_06620 38205 37618 gene locus_tag LOCUS_06630 gene pyrR 38205 37618 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257759.1 protein_id gnl|my_center|LOCUS_06630 38747 38454 gene locus_tag LOCUS_06640 38747 38454 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721993.1 protein_id gnl|my_center|LOCUS_06640 39147 39809 gene locus_tag LOCUS_06650 39147 39809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 40578 39877 gene locus_tag LOCUS_06660 40578 39877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 41346 40717 gene locus_tag LOCUS_06670 41346 40717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 41850 41431 gene locus_tag LOCUS_06680 gene rnk 41850 41431 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941393.1 protein_id gnl|my_center|LOCUS_06680 43086 42025 gene locus_tag LOCUS_06690 43086 42025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 43282 44052 gene locus_tag LOCUS_06700 43282 44052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 44079 45317 gene locus_tag LOCUS_06710 44079 45317 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528130.1 protein_id gnl|my_center|LOCUS_06710 45383 46216 gene locus_tag LOCUS_06720 45383 46216 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_06720 46213 47232 gene locus_tag LOCUS_06730 46213 47232 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_06730 47236 48015 gene locus_tag LOCUS_06740 47236 48015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 >Feature sequence016 2575 1286 gene locus_tag LOCUS_06750 2575 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 3138 4079 gene locus_tag LOCUS_06760 3138 4079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 4628 4182 gene locus_tag LOCUS_06770 4628 4182 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_06770 4977 5939 gene locus_tag LOCUS_06780 4977 5939 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928612.1 protein_id gnl|my_center|LOCUS_06780 6050 7351 gene locus_tag LOCUS_06790 6050 7351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 8423 7374 gene locus_tag LOCUS_06800 8423 7374 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121134.1 protein_id gnl|my_center|LOCUS_06800 10710 8605 gene locus_tag LOCUS_06810 10710 8605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895537.1 protein_id gnl|my_center|LOCUS_06810 10822 11844 gene locus_tag LOCUS_06820 gene glpQ 10822 11844 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706146.1 protein_id gnl|my_center|LOCUS_06820 11929 13215 gene locus_tag LOCUS_06830 11929 13215 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972798.1 protein_id gnl|my_center|LOCUS_06830 13217 14140 gene locus_tag LOCUS_06840 13217 14140 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969762.1 protein_id gnl|my_center|LOCUS_06840 14145 14975 gene locus_tag LOCUS_06850 14145 14975 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989564.1 protein_id gnl|my_center|LOCUS_06850 15932 14985 gene locus_tag LOCUS_06860 15932 14985 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533022.1 protein_id gnl|my_center|LOCUS_06860 20465 16014 gene locus_tag LOCUS_06870 20465 16014 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030438.1 protein_id gnl|my_center|LOCUS_06870 22090 20528 gene locus_tag LOCUS_06880 22090 20528 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802003.1 protein_id gnl|my_center|LOCUS_06880 23031 22132 gene locus_tag LOCUS_06890 23031 22132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 23187 25574 gene locus_tag LOCUS_06900 23187 25574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 25613 26542 gene locus_tag LOCUS_06910 25613 26542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 26863 29343 gene locus_tag LOCUS_06920 26863 29343 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392586.1 protein_id gnl|my_center|LOCUS_06920 29340 29834 gene locus_tag LOCUS_06930 29340 29834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 30016 30609 gene locus_tag LOCUS_06940 gene pgsA 30016 30609 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362543.1 protein_id gnl|my_center|LOCUS_06940 30611 31732 gene locus_tag LOCUS_06950 gene alr 30611 31732 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_06950 31765 32304 gene locus_tag LOCUS_06960 31765 32304 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142986.1 protein_id gnl|my_center|LOCUS_06960 34226 32301 gene locus_tag LOCUS_06970 34226 32301 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880592.1 protein_id gnl|my_center|LOCUS_06970 35770 34310 gene locus_tag LOCUS_06980 35770 34310 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_06980 36357 35770 gene locus_tag LOCUS_06990 36357 35770 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250601.1 protein_id gnl|my_center|LOCUS_06990 36845 37897 gene locus_tag LOCUS_07000 36845 37897 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868854.1 protein_id gnl|my_center|LOCUS_07000 39060 37894 gene locus_tag LOCUS_07010 gene coaBC 39060 37894 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965027.1 protein_id gnl|my_center|LOCUS_07010 39301 39077 gene locus_tag LOCUS_07020 39301 39077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 39990 39391 gene locus_tag LOCUS_07030 gene gmk 39990 39391 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458969.1 protein_id gnl|my_center|LOCUS_07030 40869 39991 gene locus_tag LOCUS_07040 40869 39991 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965023.1 protein_id gnl|my_center|LOCUS_07040 42531 41128 gene locus_tag LOCUS_07050 42531 41128 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_07050 42819 43205 gene locus_tag LOCUS_07060 42819 43205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 44526 43303 gene locus_tag LOCUS_07070 44526 43303 CDS product RelA/SpoT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679418.1 protein_id gnl|my_center|LOCUS_07070 47231 44697 gene locus_tag LOCUS_07080 47231 44697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 >Feature sequence017 199 32 gene locus_tag LOCUS_07090 gene rpmG 199 32 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402813.1 protein_id gnl|my_center|LOCUS_07090 1740 403 gene locus_tag LOCUS_07100 1740 403 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921601.1 protein_id gnl|my_center|LOCUS_07100 2738 1794 gene locus_tag LOCUS_07110 2738 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 2966 4348 gene locus_tag LOCUS_07120 2966 4348 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457391.1 protein_id gnl|my_center|LOCUS_07120 4376 5056 gene locus_tag LOCUS_07130 4376 5056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 5031 5618 gene locus_tag LOCUS_07140 gene thpR 5031 5618 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082411.1 protein_id gnl|my_center|LOCUS_07140 5606 5893 gene locus_tag LOCUS_07150 5606 5893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 5907 6563 gene locus_tag LOCUS_07160 5907 6563 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_07160 6609 7400 gene locus_tag LOCUS_07170 6609 7400 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930637.1 protein_id gnl|my_center|LOCUS_07170 7848 7423 gene locus_tag LOCUS_07180 7848 7423 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118554.1 protein_id gnl|my_center|LOCUS_07180 9349 8693 gene locus_tag LOCUS_07190 gene lolD 9349 8693 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210923.1 protein_id gnl|my_center|LOCUS_07190 10500 9346 gene locus_tag LOCUS_07200 10500 9346 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941993.1 protein_id gnl|my_center|LOCUS_07200 12861 11068 gene locus_tag LOCUS_07210 12861 11068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 13145 14302 gene locus_tag LOCUS_07220 13145 14302 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462098.1 protein_id gnl|my_center|LOCUS_07220 14423 16303 gene locus_tag LOCUS_07230 14423 16303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 17596 16355 gene locus_tag LOCUS_07240 17596 16355 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613585.1 protein_id gnl|my_center|LOCUS_07240 19044 17752 gene locus_tag LOCUS_07250 19044 17752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 20363 19041 gene locus_tag LOCUS_07260 20363 19041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 21231 20365 gene locus_tag LOCUS_07270 21231 20365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 22156 21239 gene locus_tag LOCUS_07280 22156 21239 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_07280 23028 22153 gene locus_tag LOCUS_07290 23028 22153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 23943 23029 gene locus_tag LOCUS_07300 23943 23029 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974987.1 protein_id gnl|my_center|LOCUS_07300 26857 23951 gene locus_tag LOCUS_07310 26857 23951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 27294 28706 gene locus_tag LOCUS_07320 27294 28706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 28711 30000 gene locus_tag LOCUS_07330 28711 30000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 33167 30015 gene locus_tag LOCUS_07340 33167 30015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 35584 33317 gene locus_tag LOCUS_07350 35584 33317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 36639 35641 gene locus_tag LOCUS_07360 36639 35641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 38822 36798 gene locus_tag LOCUS_07370 gene ppk1 38822 36798 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529580.1 protein_id gnl|my_center|LOCUS_07370 38975 40045 gene locus_tag LOCUS_07380 38975 40045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 41380 40157 gene locus_tag LOCUS_07390 41380 40157 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767191.1 protein_id gnl|my_center|LOCUS_07390 41596 45114 gene locus_tag LOCUS_07400 41596 45114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 46288 45209 gene locus_tag LOCUS_07410 46288 45209 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_07410 <47061 46441 gene locus_tag LOCUS_07420 <47061 46441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942461.1:UDP-glucose/GDP-mannose dehydrogenase family protein >Feature sequence018 743 288 gene locus_tag LOCUS_07430 743 288 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880763.1 protein_id gnl|my_center|LOCUS_07430 1040 1540 gene locus_tag LOCUS_07440 1040 1540 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943250.1 protein_id gnl|my_center|LOCUS_07440 1621 3012 gene locus_tag LOCUS_07450 1621 3012 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895854.1 protein_id gnl|my_center|LOCUS_07450 4589 3015 gene locus_tag LOCUS_07460 4589 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 5063 6622 gene locus_tag LOCUS_07470 gene rny 5063 6622 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941798.1 protein_id gnl|my_center|LOCUS_07470 6653 7444 gene locus_tag LOCUS_07480 6653 7444 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_07480 7472 11059 gene locus_tag LOCUS_07490 gene smc 7472 11059 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232028.1 protein_id gnl|my_center|LOCUS_07490 12156 11578 gene locus_tag LOCUS_07500 12156 11578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 12943 12158 gene locus_tag LOCUS_07510 12943 12158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 14315 13266 gene locus_tag LOCUS_07520 14315 13266 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_07520 16956 14398 gene locus_tag LOCUS_07530 16956 14398 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_07530 18365 17067 gene locus_tag LOCUS_07540 18365 17067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 18645 23543 gene locus_tag LOCUS_07550 18645 23543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 25402 23621 gene locus_tag LOCUS_07560 25402 23621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 25787 29116 gene locus_tag LOCUS_07570 25787 29116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 25800 25899 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29188 31548 gene locus_tag LOCUS_07580 29188 31548 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108651.1 protein_id gnl|my_center|LOCUS_07580 31825 34020 gene locus_tag LOCUS_07590 31825 34020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 34110 35141 gene locus_tag LOCUS_07600 34110 35141 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118345.1 protein_id gnl|my_center|LOCUS_07600 37272 35161 gene locus_tag LOCUS_07610 37272 35161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 37904 37443 gene locus_tag LOCUS_07620 37904 37443 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946939.1 protein_id gnl|my_center|LOCUS_07620 39723 38023 gene locus_tag LOCUS_07630 39723 38023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 39711 40013 gene locus_tag LOCUS_07640 39711 40013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 40252 40351 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 41753 40629 gene locus_tag LOCUS_07650 gene rlmD 41753 40629 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942393.1 protein_id gnl|my_center|LOCUS_07650 42343 41825 gene locus_tag LOCUS_07660 42343 41825 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_07660 42470 42546 gene locus_tag LOCUS_t00070 42470 42546 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 44674 42623 gene locus_tag LOCUS_07670 44674 42623 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922617.1 protein_id gnl|my_center|LOCUS_07670 46595 44841 gene locus_tag LOCUS_07680 46595 44841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 >Feature sequence019 523 47 gene locus_tag LOCUS_07690 523 47 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666808.1 protein_id gnl|my_center|LOCUS_07690 1153 527 gene locus_tag LOCUS_07700 gene atpD 1153 527 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173332.1 protein_id gnl|my_center|LOCUS_07700 2632 1187 gene locus_tag LOCUS_07710 2632 1187 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173333.1 protein_id gnl|my_center|LOCUS_07710 4416 2638 gene locus_tag LOCUS_07720 4416 2638 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228560.1 protein_id gnl|my_center|LOCUS_07720 4743 4423 gene locus_tag LOCUS_07730 4743 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 5800 4736 gene locus_tag LOCUS_07740 5800 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 6411 5797 gene locus_tag LOCUS_07750 6411 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 6767 6411 gene locus_tag LOCUS_07760 6767 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 8689 6761 gene locus_tag LOCUS_07770 8689 6761 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868885.1 protein_id gnl|my_center|LOCUS_07770 9006 8686 gene locus_tag LOCUS_07780 9006 8686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 11030 9261 gene locus_tag LOCUS_07790 11030 9261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 11619 12401 gene locus_tag LOCUS_07800 gene thyX 11619 12401 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390602.1 protein_id gnl|my_center|LOCUS_07800 12423 14489 gene locus_tag LOCUS_07810 gene nrdJ 12423 14489 CDS product ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549289.1 protein_id gnl|my_center|LOCUS_07810 14531 14630 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15808 15092 gene locus_tag LOCUS_07820 15808 15092 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943860.1 protein_id gnl|my_center|LOCUS_07820 17113 15908 gene locus_tag LOCUS_07830 17113 15908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 18285 17110 gene locus_tag LOCUS_07840 18285 17110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 18444 21044 gene locus_tag LOCUS_07850 18444 21044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 21402 23360 gene locus_tag LOCUS_07860 21402 23360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 23650 23387 gene locus_tag LOCUS_07870 23650 23387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 27194 23637 gene locus_tag LOCUS_07880 27194 23637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 28792 27191 gene locus_tag LOCUS_07890 gene amrB 28792 27191 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444593.1 protein_id gnl|my_center|LOCUS_07890 29026 28829 gene locus_tag LOCUS_07900 29026 28829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 30006 29017 gene locus_tag LOCUS_07910 gene amrS 30006 29017 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 protein_id gnl|my_center|LOCUS_07910 31019 30069 gene locus_tag LOCUS_07920 31019 30069 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545174.1 protein_id gnl|my_center|LOCUS_07920 31814 31029 gene locus_tag LOCUS_07930 31814 31029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 32941 31811 gene locus_tag LOCUS_07940 32941 31811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 33536 34948 gene locus_tag LOCUS_07950 33536 34948 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129728335.1 protein_id gnl|my_center|LOCUS_07950 34945 35841 gene locus_tag LOCUS_07960 34945 35841 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225105.1 protein_id gnl|my_center|LOCUS_07960 35831 36733 gene locus_tag LOCUS_07970 35831 36733 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_07970 37376 36825 gene locus_tag LOCUS_07980 37376 36825 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_07980 37587 39812 gene locus_tag LOCUS_07990 37587 39812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 40225 41520 gene locus_tag LOCUS_08000 40225 41520 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_08000 41621 42889 gene locus_tag LOCUS_08010 41621 42889 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391965.1 protein_id gnl|my_center|LOCUS_08010 42918 43337 gene locus_tag LOCUS_08020 42918 43337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 43535 43861 gene locus_tag LOCUS_08030 43535 43861 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_08030 43848 44264 gene locus_tag LOCUS_08040 43848 44264 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903015.1 protein_id gnl|my_center|LOCUS_08040 44509 45945 gene locus_tag LOCUS_08050 44509 45945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 >Feature sequence020 2109 220 gene locus_tag LOCUS_08060 2109 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 2842 2336 gene locus_tag LOCUS_08070 2842 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 2841 3308 gene locus_tag LOCUS_08080 2841 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 3959 4972 gene locus_tag LOCUS_08090 3959 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 5032 8136 gene locus_tag LOCUS_08100 5032 8136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 8259 14477 gene locus_tag LOCUS_08110 8259 14477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 14712 15611 gene locus_tag LOCUS_08120 14712 15611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 15701 18055 gene locus_tag LOCUS_08130 15701 18055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 20471 20800 gene locus_tag LOCUS_08140 20471 20800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 21816 20866 gene locus_tag LOCUS_08150 21816 20866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 22697 21858 gene locus_tag LOCUS_08160 22697 21858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 24415 22733 gene locus_tag LOCUS_08170 24415 22733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 29871 24454 gene locus_tag LOCUS_08180 29871 24454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 36834 29998 gene locus_tag LOCUS_08190 36834 29998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 38548 36875 gene locus_tag LOCUS_08200 38548 36875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 44070 38587 gene locus_tag LOCUS_08210 44070 38587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 >Feature sequence021 <1 628 gene locus_tag LOCUS_08220 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112572.1:Tol-Pal system beta propeller repeat protein TolB 779 2947 gene locus_tag LOCUS_08230 779 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 3211 4716 gene locus_tag LOCUS_08240 3211 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 5077 5631 gene locus_tag LOCUS_08250 gene rsmD 5077 5631 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_08250 5720 6169 gene locus_tag LOCUS_08260 gene nrdR 5720 6169 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_08260 6313 8616 gene locus_tag LOCUS_08270 6313 8616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 9240 8677 gene locus_tag LOCUS_08280 9240 8677 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869265.1 protein_id gnl|my_center|LOCUS_08280 9958 9254 gene locus_tag LOCUS_08290 9958 9254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079789.1 protein_id gnl|my_center|LOCUS_08290 10981 10031 gene locus_tag LOCUS_08300 10981 10031 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584146.1 protein_id gnl|my_center|LOCUS_08300 12366 11182 gene locus_tag LOCUS_08310 12366 11182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 12877 12485 gene locus_tag LOCUS_08320 12877 12485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 15069 13003 gene locus_tag LOCUS_08330 15069 13003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 16799 15078 gene locus_tag LOCUS_08340 16799 15078 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_08340 18929 16830 gene locus_tag LOCUS_08350 gene nuoF 18929 16830 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_08350 19419 18919 gene locus_tag LOCUS_08360 gene nuoE 19419 18919 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250565.1 protein_id gnl|my_center|LOCUS_08360 20054 19416 gene locus_tag LOCUS_08370 20054 19416 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365189.1 protein_id gnl|my_center|LOCUS_08370 20354 21673 gene locus_tag LOCUS_08380 20354 21673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 21922 22671 gene locus_tag LOCUS_08390 21922 22671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 22752 25070 gene locus_tag LOCUS_08400 22752 25070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 26515 25412 gene locus_tag LOCUS_08410 26515 25412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 27795 26512 gene locus_tag LOCUS_08420 27795 26512 CDS product sn-glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066917.1 protein_id gnl|my_center|LOCUS_08420 28284 27814 gene locus_tag LOCUS_08430 28284 27814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 28605 28704 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28964 29134 gene locus_tag LOCUS_08440 28964 29134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 29364 30245 gene locus_tag LOCUS_08450 29364 30245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 33018 30328 gene locus_tag LOCUS_08460 33018 30328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 34516 33185 gene locus_tag LOCUS_08470 34516 33185 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_08470 34789 37239 gene locus_tag LOCUS_08480 34789 37239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 37911 37282 gene locus_tag LOCUS_08490 37911 37282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 38795 37908 gene locus_tag LOCUS_08500 38795 37908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 39056 42130 gene locus_tag LOCUS_08510 39056 42130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 43340 42150 gene locus_tag LOCUS_08520 43340 42150 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119310.1 protein_id gnl|my_center|LOCUS_08520 43626 43351 gene locus_tag LOCUS_08530 43626 43351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 44650 43667 gene locus_tag LOCUS_08540 44650 43667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 >Feature sequence022 4180 3536 gene locus_tag LOCUS_08550 4180 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 4698 4507 gene locus_tag LOCUS_08560 4698 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 5067 6002 gene locus_tag LOCUS_08570 5067 6002 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_08570 5999 6832 gene locus_tag LOCUS_08580 5999 6832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 6837 8483 gene locus_tag LOCUS_08590 6837 8483 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_08590 8480 10309 gene locus_tag LOCUS_08600 8480 10309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 10451 11806 gene locus_tag LOCUS_08610 gene xseA 10451 11806 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_08610 11799 12116 gene locus_tag LOCUS_08620 11799 12116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 12113 13015 gene locus_tag LOCUS_08630 12113 13015 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_08630 13191 15311 gene locus_tag LOCUS_08640 13191 15311 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_08640 15324 17099 gene locus_tag LOCUS_08650 gene dsbD 15324 17099 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926979.1 protein_id gnl|my_center|LOCUS_08650 20415 17158 gene locus_tag LOCUS_08660 20415 17158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 21795 20533 gene locus_tag LOCUS_08670 21795 20533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 21972 22136 gene locus_tag LOCUS_08680 21972 22136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 22157 23065 gene locus_tag LOCUS_08690 22157 23065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 23465 23121 gene locus_tag LOCUS_08700 23465 23121 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931551.1 protein_id gnl|my_center|LOCUS_08700 24636 23620 gene locus_tag LOCUS_08710 24636 23620 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289230.1 protein_id gnl|my_center|LOCUS_08710 25497 24739 gene locus_tag LOCUS_08720 25497 24739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 27318 25597 gene locus_tag LOCUS_08730 27318 25597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929090.1 protein_id gnl|my_center|LOCUS_08730 27637 29166 gene locus_tag LOCUS_08740 27637 29166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 30439 29207 gene locus_tag LOCUS_08750 30439 29207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 30829 30533 gene locus_tag LOCUS_08760 30829 30533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 31090 30881 gene locus_tag LOCUS_08770 31090 30881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 32061 31318 gene locus_tag LOCUS_08780 32061 31318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 32281 35067 gene locus_tag LOCUS_08790 32281 35067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 35592 35080 gene locus_tag LOCUS_08800 35592 35080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 36887 35721 gene locus_tag LOCUS_08810 36887 35721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 38735 37044 gene locus_tag LOCUS_08820 gene flgK 38735 37044 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851396.1 protein_id gnl|my_center|LOCUS_08820 39895 38936 gene locus_tag LOCUS_08830 39895 38936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 40548 39898 gene locus_tag LOCUS_08840 gene eda 40548 39898 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_08840 40792 41553 gene locus_tag LOCUS_08850 40792 41553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 41674 42912 gene locus_tag LOCUS_08860 41674 42912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 44016 42970 gene locus_tag LOCUS_08870 44016 42970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 <44568 44013 gene locus_tag LOCUS_08880 <44568 44013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142866.1:ABC transporter permease subunit >Feature sequence023 1238 345 gene locus_tag LOCUS_08890 1238 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 1575 1499 gene locus_tag LOCUS_t00080 1575 1499 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2097 1864 gene locus_tag LOCUS_08900 2097 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 4460 2262 gene locus_tag LOCUS_08910 4460 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 5776 4457 gene locus_tag LOCUS_08920 5776 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 7554 6127 gene locus_tag LOCUS_08930 gene amt 7554 6127 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056043.1 protein_id gnl|my_center|LOCUS_08930 7985 7644 gene locus_tag LOCUS_08940 7985 7644 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603495.1 protein_id gnl|my_center|LOCUS_08940 8550 9110 gene locus_tag LOCUS_08950 8550 9110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 9112 10539 gene locus_tag LOCUS_08960 9112 10539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 10673 12670 gene locus_tag LOCUS_08970 10673 12670 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921322.1 protein_id gnl|my_center|LOCUS_08970 14180 12789 gene locus_tag LOCUS_08980 14180 12789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 14573 16255 gene locus_tag LOCUS_08990 gene ilvB 14573 16255 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937667.1 protein_id gnl|my_center|LOCUS_08990 16382 16696 gene locus_tag LOCUS_09000 gene ilvN 16382 16696 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937668.1 protein_id gnl|my_center|LOCUS_09000 16972 18030 gene locus_tag LOCUS_09010 gene ychF 16972 18030 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256516.1 protein_id gnl|my_center|LOCUS_09010 18267 19247 gene locus_tag LOCUS_09020 18267 19247 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803698.1 protein_id gnl|my_center|LOCUS_09020 19283 20266 gene locus_tag LOCUS_09030 19283 20266 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803699.1 protein_id gnl|my_center|LOCUS_09030 20393 20572 gene locus_tag LOCUS_09040 20393 20572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 21172 20645 gene locus_tag LOCUS_09050 21172 20645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 22199 21156 gene locus_tag LOCUS_09060 22199 21156 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_09060 23356 22316 gene locus_tag LOCUS_09070 gene gspF 23356 22316 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065941.1 protein_id gnl|my_center|LOCUS_09070 24093 23353 gene locus_tag LOCUS_09080 24093 23353 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_09080 26062 24194 gene locus_tag LOCUS_09090 26062 24194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 26306 26878 gene locus_tag LOCUS_09100 26306 26878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 26898 28952 gene locus_tag LOCUS_09110 26898 28952 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928535.1 protein_id gnl|my_center|LOCUS_09110 29486 35371 gene locus_tag LOCUS_09120 29486 35371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 35436 37877 gene locus_tag LOCUS_09130 35436 37877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 38380 39285 gene locus_tag LOCUS_09140 38380 39285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 39367 41883 gene locus_tag LOCUS_09150 gene gspD 39367 41883 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086028586.1 protein_id gnl|my_center|LOCUS_09150 >Feature sequence024 545 1981 gene locus_tag LOCUS_09160 gene cls 545 1981 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029629072.1 protein_id gnl|my_center|LOCUS_09160 2164 2709 gene locus_tag LOCUS_09170 2164 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 4989 2737 gene locus_tag LOCUS_09180 4989 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 6014 5025 gene locus_tag LOCUS_09190 6014 5025 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085059.1 protein_id gnl|my_center|LOCUS_09190 6991 6011 gene locus_tag LOCUS_09200 6991 6011 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174243.1 protein_id gnl|my_center|LOCUS_09200 7184 8548 gene locus_tag LOCUS_09210 7184 8548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 8619 9329 gene locus_tag LOCUS_09220 8619 9329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 9305 10486 gene locus_tag LOCUS_09230 9305 10486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 10483 12504 gene locus_tag LOCUS_09240 10483 12504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 12669 13958 gene locus_tag LOCUS_09250 12669 13958 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_09250 16503 14050 gene locus_tag LOCUS_09260 16503 14050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 18258 16546 gene locus_tag LOCUS_09270 18258 16546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 19635 18517 gene locus_tag LOCUS_09280 19635 18517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 20489 19692 gene locus_tag LOCUS_09290 gene dapB 20489 19692 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940836.1 protein_id gnl|my_center|LOCUS_09290 21390 20518 gene locus_tag LOCUS_09300 gene dapA 21390 20518 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939154.1 protein_id gnl|my_center|LOCUS_09300 22305 24404 gene locus_tag LOCUS_09310 22305 24404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 24409 26466 gene locus_tag LOCUS_09320 24409 26466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 26557 27921 gene locus_tag LOCUS_09330 26557 27921 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120139.1 protein_id gnl|my_center|LOCUS_09330 29651 28023 gene locus_tag LOCUS_09340 29651 28023 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_09340 30404 29757 gene locus_tag LOCUS_09350 30404 29757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 32845 30401 gene locus_tag LOCUS_09360 32845 30401 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392112.1 protein_id gnl|my_center|LOCUS_09360 33037 32903 gene locus_tag LOCUS_09370 33037 32903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 34659 33520 gene locus_tag LOCUS_09380 34659 33520 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794948.1 protein_id gnl|my_center|LOCUS_09380 35707 34781 gene locus_tag LOCUS_09390 35707 34781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 35933 36766 gene locus_tag LOCUS_09400 35933 36766 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031344.1 protein_id gnl|my_center|LOCUS_09400 36908 37534 gene locus_tag LOCUS_09410 36908 37534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 38699 37542 gene locus_tag LOCUS_09420 38699 37542 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259064.1 protein_id gnl|my_center|LOCUS_09420 41188 38789 gene locus_tag LOCUS_09430 41188 38789 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486377.1 protein_id gnl|my_center|LOCUS_09430 41607 42458 gene locus_tag LOCUS_09440 41607 42458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 >Feature sequence025 3640 3113 gene locus_tag LOCUS_09450 3640 3113 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969651.1 protein_id gnl|my_center|LOCUS_09450 4558 3836 gene locus_tag LOCUS_09460 4558 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 5658 4555 gene locus_tag LOCUS_09470 5658 4555 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462098.1 protein_id gnl|my_center|LOCUS_09470 6168 5713 gene locus_tag LOCUS_09480 6168 5713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 7099 6269 gene locus_tag LOCUS_09490 7099 6269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 7417 7232 gene locus_tag LOCUS_09500 7417 7232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 8056 7544 gene locus_tag LOCUS_09510 8056 7544 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_09510 10206 8179 gene locus_tag LOCUS_09520 10206 8179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 11497 13149 gene locus_tag LOCUS_09530 11497 13149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 13350 13871 gene locus_tag LOCUS_09540 13350 13871 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391707.1 protein_id gnl|my_center|LOCUS_09540 13879 14922 gene locus_tag LOCUS_09550 13879 14922 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391708.1 protein_id gnl|my_center|LOCUS_09550 14989 17445 gene locus_tag LOCUS_09560 gene clpC 14989 17445 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235011.1 protein_id gnl|my_center|LOCUS_09560 17445 19748 gene locus_tag LOCUS_09570 gene bamA 17445 19748 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_09570 20048 20623 gene locus_tag LOCUS_09580 20048 20623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 20683 21735 gene locus_tag LOCUS_09590 gene lpxD 20683 21735 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_09590 21710 23062 gene locus_tag LOCUS_09600 21710 23062 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933326.1 protein_id gnl|my_center|LOCUS_09600 24229 23099 gene locus_tag LOCUS_09610 24229 23099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 25738 24506 gene locus_tag LOCUS_09620 gene ispG 25738 24506 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688953.1 protein_id gnl|my_center|LOCUS_09620 26327 25872 gene locus_tag LOCUS_09630 26327 25872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 26698 26345 gene locus_tag LOCUS_09640 26698 26345 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947715.1 protein_id gnl|my_center|LOCUS_09640 30258 26782 gene locus_tag LOCUS_09650 30258 26782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 30538 32556 gene locus_tag LOCUS_09660 30538 32556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 32578 34482 gene locus_tag LOCUS_09670 32578 34482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 34843 36891 gene locus_tag LOCUS_09680 34843 36891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 37097 38218 gene locus_tag LOCUS_09690 37097 38218 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723115.1 protein_id gnl|my_center|LOCUS_09690 38500 40842 gene locus_tag LOCUS_09700 38500 40842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 40968 41726 gene locus_tag LOCUS_09710 gene kdsB 40968 41726 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_09710 >Feature sequence026 482 400 gene locus_tag LOCUS_t00090 482 400 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1490 681 gene locus_tag LOCUS_09720 1490 681 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_09720 4397 1545 gene locus_tag LOCUS_09730 4397 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 4850 4500 gene locus_tag LOCUS_09740 4850 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 7301 5829 gene locus_tag LOCUS_09750 7301 5829 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943144.1 protein_id gnl|my_center|LOCUS_09750 8236 7529 gene locus_tag LOCUS_09760 8236 7529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 8767 9168 gene locus_tag LOCUS_09770 8767 9168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 9224 9931 gene locus_tag LOCUS_09780 9224 9931 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814769.1 protein_id gnl|my_center|LOCUS_09780 11394 9955 gene locus_tag LOCUS_09790 11394 9955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 14304 11989 gene locus_tag LOCUS_09800 14304 11989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 14477 14839 gene locus_tag LOCUS_09810 14477 14839 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065230.1 protein_id gnl|my_center|LOCUS_09810 15229 17556 gene locus_tag LOCUS_09820 15229 17556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 17663 19642 gene locus_tag LOCUS_09830 17663 19642 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080133.1 protein_id gnl|my_center|LOCUS_09830 19725 20696 gene locus_tag LOCUS_09840 19725 20696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 21726 20791 gene locus_tag LOCUS_09850 21726 20791 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020974.1 protein_id gnl|my_center|LOCUS_09850 22460 21723 gene locus_tag LOCUS_09860 22460 21723 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081657.1 protein_id gnl|my_center|LOCUS_09860 24611 22611 gene locus_tag LOCUS_09870 24611 22611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 25986 24643 gene locus_tag LOCUS_09880 25986 24643 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 protein_id gnl|my_center|LOCUS_09880 26375 27646 gene locus_tag LOCUS_09890 26375 27646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 27674 28363 gene locus_tag LOCUS_09900 27674 28363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 28363 30039 gene locus_tag LOCUS_09910 28363 30039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 30054 30278 gene locus_tag LOCUS_09920 30054 30278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 30297 31001 gene locus_tag LOCUS_09930 30297 31001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 31142 31525 gene locus_tag LOCUS_09940 31142 31525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 31539 32585 gene locus_tag LOCUS_09950 31539 32585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 32652 33071 gene locus_tag LOCUS_09960 32652 33071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 33071 33757 gene locus_tag LOCUS_09970 33071 33757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 33760 35496 gene locus_tag LOCUS_09980 33760 35496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 35539 36060 gene locus_tag LOCUS_09990 35539 36060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 36041 36517 gene locus_tag LOCUS_10000 36041 36517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 36535 36900 gene locus_tag LOCUS_10010 36535 36900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 37032 38024 gene locus_tag LOCUS_10020 37032 38024 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223398.1 protein_id gnl|my_center|LOCUS_10020 38400 38014 gene locus_tag LOCUS_10030 38400 38014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 38568 38667 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39425 38679 gene locus_tag LOCUS_10040 39425 38679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 39642 41033 gene locus_tag LOCUS_10050 39642 41033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 41030 41944 gene locus_tag LOCUS_10060 41030 41944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 >Feature sequence027 1129 689 gene locus_tag LOCUS_10070 1129 689 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081070.1 protein_id gnl|my_center|LOCUS_10070 1374 2750 gene locus_tag LOCUS_10080 1374 2750 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_10080 3071 4210 gene locus_tag LOCUS_10090 gene corA 3071 4210 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141025.1 protein_id gnl|my_center|LOCUS_10090 4230 4946 gene locus_tag LOCUS_10100 4230 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 5933 4977 gene locus_tag LOCUS_10110 5933 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 6912 5953 gene locus_tag LOCUS_10120 6912 5953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 7142 8059 gene locus_tag LOCUS_10130 gene rbsK 7142 8059 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257591.1 protein_id gnl|my_center|LOCUS_10130 8066 8749 gene locus_tag LOCUS_10140 gene rpe 8066 8749 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_10140 8880 10214 gene locus_tag LOCUS_10150 8880 10214 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_10150 10513 10304 gene locus_tag LOCUS_10160 10513 10304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 10493 12388 gene locus_tag LOCUS_10170 10493 12388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 13795 12425 gene locus_tag LOCUS_10180 13795 12425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 15203 13803 gene locus_tag LOCUS_10190 15203 13803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 16280 15249 gene locus_tag LOCUS_10200 gene gutB 16280 15249 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 protein_id gnl|my_center|LOCUS_10200 17062 16493 gene locus_tag LOCUS_10210 17062 16493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 17442 19049 gene locus_tag LOCUS_10220 17442 19049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 19046 20470 gene locus_tag LOCUS_10230 19046 20470 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_10230 20756 21460 gene locus_tag LOCUS_10240 20756 21460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 22045 22755 gene locus_tag LOCUS_10250 22045 22755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 23191 23811 gene locus_tag LOCUS_10260 23191 23811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 23808 26414 gene locus_tag LOCUS_10270 23808 26414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 28358 26523 gene locus_tag LOCUS_10280 28358 26523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 28554 30368 gene locus_tag LOCUS_10290 28554 30368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 31924 30446 gene locus_tag LOCUS_10300 31924 30446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 32322 31921 gene locus_tag LOCUS_10310 32322 31921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 32788 32408 gene locus_tag LOCUS_10320 32788 32408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 33071 34660 gene locus_tag LOCUS_10330 33071 34660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 36962 34698 gene locus_tag LOCUS_10340 36962 34698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 39797 37032 gene locus_tag LOCUS_10350 39797 37032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 40051 41490 gene locus_tag LOCUS_10360 40051 41490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 >Feature sequence028 1690 83 gene locus_tag LOCUS_10370 gene murJ 1690 83 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_10370 3278 1716 gene locus_tag LOCUS_10380 gene lnt 3278 1716 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939146.1 protein_id gnl|my_center|LOCUS_10380 4509 3430 gene locus_tag LOCUS_10390 4509 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 5744 4509 gene locus_tag LOCUS_10400 5744 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 6726 5752 gene locus_tag LOCUS_10410 6726 5752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 7270 6845 gene locus_tag LOCUS_10420 7270 6845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 7500 7288 gene locus_tag LOCUS_10430 7500 7288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 7843 10446 gene locus_tag LOCUS_10440 7843 10446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 10607 11113 gene locus_tag LOCUS_10450 gene def 10607 11113 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461416.1 protein_id gnl|my_center|LOCUS_10450 11164 11763 gene locus_tag LOCUS_10460 gene recR 11164 11763 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359478.1 protein_id gnl|my_center|LOCUS_10460 12750 11788 gene locus_tag LOCUS_10470 12750 11788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 13972 12914 gene locus_tag LOCUS_10480 13972 12914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 15398 14133 gene locus_tag LOCUS_10490 gene glgC 15398 14133 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329623.1 protein_id gnl|my_center|LOCUS_10490 16056 15391 gene locus_tag LOCUS_10500 16056 15391 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943961.1 protein_id gnl|my_center|LOCUS_10500 16559 17515 gene locus_tag LOCUS_10510 16559 17515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 18470 17610 gene locus_tag LOCUS_10520 18470 17610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 19566 18613 gene locus_tag LOCUS_10530 19566 18613 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939546.1 protein_id gnl|my_center|LOCUS_10530 19959 20267 gene locus_tag LOCUS_10540 19959 20267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 20383 21201 gene locus_tag LOCUS_10550 20383 21201 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809725.1 protein_id gnl|my_center|LOCUS_10550 21245 22633 gene locus_tag LOCUS_10560 21245 22633 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921496.1 protein_id gnl|my_center|LOCUS_10560 22660 24063 gene locus_tag LOCUS_10570 22660 24063 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120094.1 protein_id gnl|my_center|LOCUS_10570 24281 25660 gene locus_tag LOCUS_10580 24281 25660 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_10580 25710 26585 gene locus_tag LOCUS_10590 25710 26585 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124073.1 protein_id gnl|my_center|LOCUS_10590 26582 27949 gene locus_tag LOCUS_10600 26582 27949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 30837 28222 gene locus_tag LOCUS_10610 gene valS 30837 28222 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804592.1 protein_id gnl|my_center|LOCUS_10610 31118 32461 gene locus_tag LOCUS_10620 31118 32461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 32631 33530 gene locus_tag LOCUS_10630 32631 33530 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_10630 34076 33726 gene locus_tag LOCUS_10640 34076 33726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 34569 34117 gene locus_tag LOCUS_10650 34569 34117 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_10650 34885 35268 gene locus_tag LOCUS_10660 34885 35268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 35306 35539 gene locus_tag LOCUS_10670 35306 35539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 35536 36387 gene locus_tag LOCUS_10680 35536 36387 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869527.1 protein_id gnl|my_center|LOCUS_10680 36402 37475 gene locus_tag LOCUS_10690 gene recF 36402 37475 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470750.1 protein_id gnl|my_center|LOCUS_10690 37510 37845 gene locus_tag LOCUS_10700 37510 37845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 37965 40370 gene locus_tag LOCUS_10710 gene gyrB 37965 40370 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940681.1 protein_id gnl|my_center|LOCUS_10710 >Feature sequence029 1352 39 gene locus_tag LOCUS_10720 1352 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 2586 1363 gene locus_tag LOCUS_10730 2586 1363 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226897.1 protein_id gnl|my_center|LOCUS_10730 3585 2590 gene locus_tag LOCUS_10740 3585 2590 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529475.1 protein_id gnl|my_center|LOCUS_10740 4587 5834 gene locus_tag LOCUS_10750 4587 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 5831 6505 gene locus_tag LOCUS_10760 5831 6505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 6502 7077 gene locus_tag LOCUS_10770 6502 7077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 7074 7736 gene locus_tag LOCUS_10780 7074 7736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 7741 9909 gene locus_tag LOCUS_10790 7741 9909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 13103 10032 gene locus_tag LOCUS_10800 13103 10032 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583743.1 protein_id gnl|my_center|LOCUS_10800 14727 13525 gene locus_tag LOCUS_10810 gene dinB 14727 13525 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937382.1 protein_id gnl|my_center|LOCUS_10810 15770 14868 gene locus_tag LOCUS_10820 15770 14868 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081450.1 protein_id gnl|my_center|LOCUS_10820 16297 15863 gene locus_tag LOCUS_10830 16297 15863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 17282 16350 gene locus_tag LOCUS_10840 17282 16350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 18200 17415 gene locus_tag LOCUS_10850 gene nagB 18200 17415 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030128.1 protein_id gnl|my_center|LOCUS_10850 18870 18298 gene locus_tag LOCUS_10860 18870 18298 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940170.1 protein_id gnl|my_center|LOCUS_10860 20022 18898 gene locus_tag LOCUS_10870 20022 18898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 20689 20168 gene locus_tag LOCUS_10880 20689 20168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 20767 20866 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21779 21099 gene locus_tag LOCUS_10890 21779 21099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 22454 22254 gene locus_tag LOCUS_10900 22454 22254 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812516.1 protein_id gnl|my_center|LOCUS_10900 23891 22875 gene locus_tag LOCUS_10910 23891 22875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 24769 23891 gene locus_tag LOCUS_10920 24769 23891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 27810 24844 gene locus_tag LOCUS_10930 27810 24844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 27989 28846 gene locus_tag LOCUS_10940 27989 28846 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582729.1 protein_id gnl|my_center|LOCUS_10940 31365 28870 gene locus_tag LOCUS_10950 31365 28870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 33267 31426 gene locus_tag LOCUS_10960 33267 31426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 34151 33312 gene locus_tag LOCUS_10970 34151 33312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 34682 34161 gene locus_tag LOCUS_10980 34682 34161 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256182.1 protein_id gnl|my_center|LOCUS_10980 35684 34806 gene locus_tag LOCUS_10990 35684 34806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 36230 35868 gene locus_tag LOCUS_11000 36230 35868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 36126 36563 gene locus_tag LOCUS_11010 36126 36563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 36753 37514 gene locus_tag LOCUS_11020 36753 37514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 37543 39153 gene locus_tag LOCUS_11030 37543 39153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 39153 39941 gene locus_tag LOCUS_11040 gene srlD 39153 39941 CDS product sorbitol-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582810.1 protein_id gnl|my_center|LOCUS_11040 40135 40320 gene locus_tag LOCUS_11050 40135 40320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 >Feature sequence030 4945 2621 gene locus_tag LOCUS_11060 4945 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 7768 5135 gene locus_tag LOCUS_11070 7768 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 8124 7930 gene locus_tag LOCUS_11080 8124 7930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 8545 8237 gene locus_tag LOCUS_11090 8545 8237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 10074 8806 gene locus_tag LOCUS_11100 10074 8806 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_11100 10790 10074 gene locus_tag LOCUS_11110 10790 10074 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387053.1 protein_id gnl|my_center|LOCUS_11110 12592 10787 gene locus_tag LOCUS_11120 12592 10787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 13409 12714 gene locus_tag LOCUS_11130 13409 12714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 14253 14543 gene locus_tag LOCUS_11140 14253 14543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 14721 15413 gene locus_tag LOCUS_11150 gene aqpZ 14721 15413 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705214.1 protein_id gnl|my_center|LOCUS_11150 15757 17241 gene locus_tag LOCUS_11160 15757 17241 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070812.1 protein_id gnl|my_center|LOCUS_11160 18707 17355 gene locus_tag LOCUS_11170 18707 17355 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921626.1 protein_id gnl|my_center|LOCUS_11170 20026 18881 gene locus_tag LOCUS_11180 20026 18881 CDS product bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229810.1 protein_id gnl|my_center|LOCUS_11180 21279 20338 gene locus_tag LOCUS_11190 21279 20338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 24259 21437 gene locus_tag LOCUS_11200 24259 21437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 24455 25123 gene locus_tag LOCUS_11210 24455 25123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 26446 25151 gene locus_tag LOCUS_11220 26446 25151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 28819 26504 gene locus_tag LOCUS_11230 28819 26504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 29807 28812 gene locus_tag LOCUS_11240 29807 28812 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501884.1 protein_id gnl|my_center|LOCUS_11240 31396 29804 gene locus_tag LOCUS_11250 31396 29804 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972980.1 protein_id gnl|my_center|LOCUS_11250 33692 31533 gene locus_tag LOCUS_11260 33692 31533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 33994 38649 gene locus_tag LOCUS_11270 33994 38649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 38725 39873 gene locus_tag LOCUS_11280 38725 39873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 >Feature sequence031 91 1194 gene locus_tag LOCUS_11290 91 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1231 2127 gene locus_tag LOCUS_11300 1231 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 2183 3043 gene locus_tag LOCUS_11310 2183 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 3142 3936 gene locus_tag LOCUS_11320 3142 3936 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223919.1 protein_id gnl|my_center|LOCUS_11320 3954 4736 gene locus_tag LOCUS_11330 3954 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 6980 4785 gene locus_tag LOCUS_11340 6980 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 7179 7763 gene locus_tag LOCUS_11350 7179 7763 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721539.1 protein_id gnl|my_center|LOCUS_11350 7798 8715 gene locus_tag LOCUS_11360 gene xerD 7798 8715 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390080.1 protein_id gnl|my_center|LOCUS_11360 9938 8742 gene locus_tag LOCUS_11370 9938 8742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 10050 10823 gene locus_tag LOCUS_11380 10050 10823 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445444.1 protein_id gnl|my_center|LOCUS_11380 10830 13202 gene locus_tag LOCUS_11390 10830 13202 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272774.1 protein_id gnl|my_center|LOCUS_11390 13214 14560 gene locus_tag LOCUS_11400 13214 14560 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967587.1 protein_id gnl|my_center|LOCUS_11400 14611 17448 gene locus_tag LOCUS_11410 14611 17448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 17952 19412 gene locus_tag LOCUS_11420 17952 19412 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938513.1 protein_id gnl|my_center|LOCUS_11420 19661 20416 gene locus_tag LOCUS_11430 gene rpsB 19661 20416 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460417.1 protein_id gnl|my_center|LOCUS_11430 20480 21109 gene locus_tag LOCUS_11440 gene tsf 20480 21109 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942565.1 protein_id gnl|my_center|LOCUS_11440 21115 21834 gene locus_tag LOCUS_11450 gene pyrH 21115 21834 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056115.1 protein_id gnl|my_center|LOCUS_11450 21838 22395 gene locus_tag LOCUS_11460 gene frr 21838 22395 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545660.1 protein_id gnl|my_center|LOCUS_11460 22521 23240 gene locus_tag LOCUS_11470 22521 23240 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_11470 23243 24079 gene locus_tag LOCUS_11480 23243 24079 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392553.1 protein_id gnl|my_center|LOCUS_11480 24120 25232 gene locus_tag LOCUS_11490 gene prfB 24120 25232 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096948712.1 protein_id gnl|my_center|LOCUS_11490 25255 26820 gene locus_tag LOCUS_11500 gene lysS 25255 26820 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_11500 26876 28147 gene locus_tag LOCUS_11510 26876 28147 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_11510 28140 28835 gene locus_tag LOCUS_11520 28140 28835 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_11520 28859 30292 gene locus_tag LOCUS_11530 28859 30292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 31681 30341 gene locus_tag LOCUS_11540 31681 30341 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_11540 33203 31947 gene locus_tag LOCUS_11550 33203 31947 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801343.1 protein_id gnl|my_center|LOCUS_11550 34644 33262 gene locus_tag LOCUS_11560 gene xylE 34644 33262 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097267.1 protein_id gnl|my_center|LOCUS_11560 35474 34641 gene locus_tag LOCUS_11570 35474 34641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 37911 35662 gene locus_tag LOCUS_11580 37911 35662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 37910 38116 gene locus_tag LOCUS_11590 37910 38116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 >Feature sequence032 1668 487 gene locus_tag LOCUS_11600 1668 487 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169978569.1 protein_id gnl|my_center|LOCUS_11600 3855 1690 gene locus_tag LOCUS_11610 3855 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 4122 6929 gene locus_tag LOCUS_11620 4122 6929 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369316.1 protein_id gnl|my_center|LOCUS_11620 6983 7951 gene locus_tag LOCUS_11630 6983 7951 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360266.1 protein_id gnl|my_center|LOCUS_11630 9152 8007 gene locus_tag LOCUS_11640 9152 8007 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803908.1 protein_id gnl|my_center|LOCUS_11640 9501 12476 gene locus_tag LOCUS_11650 9501 12476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 13853 12663 gene locus_tag LOCUS_11660 13853 12663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 15805 14300 gene locus_tag LOCUS_11670 15805 14300 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357216.1 protein_id gnl|my_center|LOCUS_11670 16120 17082 gene locus_tag LOCUS_11680 gene guaA 16120 17082 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877764.1 protein_id gnl|my_center|LOCUS_11680 17191 18705 gene locus_tag LOCUS_11690 17191 18705 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_11690 20081 18726 gene locus_tag LOCUS_11700 20081 18726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121480.1 protein_id gnl|my_center|LOCUS_11700 20316 21866 gene locus_tag LOCUS_11710 20316 21866 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107897.1 protein_id gnl|my_center|LOCUS_11710 25149 21880 gene locus_tag LOCUS_11720 25149 21880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 25501 27606 gene locus_tag LOCUS_11730 25501 27606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 27865 28713 gene locus_tag LOCUS_11740 27865 28713 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117757.1 protein_id gnl|my_center|LOCUS_11740 29485 28856 gene locus_tag LOCUS_11750 29485 28856 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065304.1 protein_id gnl|my_center|LOCUS_11750 31152 29545 gene locus_tag LOCUS_11760 31152 29545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 33176 31314 gene locus_tag LOCUS_11770 33176 31314 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013192.1 protein_id gnl|my_center|LOCUS_11770 34617 33259 gene locus_tag LOCUS_11780 34617 33259 CDS product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932503.1 protein_id gnl|my_center|LOCUS_11780 36742 34814 gene locus_tag LOCUS_11790 36742 34814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 37646 36768 gene locus_tag LOCUS_11800 37646 36768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 38443 37733 gene locus_tag LOCUS_11810 gene hisF 38443 37733 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878322.1 protein_id gnl|my_center|LOCUS_11810 >Feature sequence033 1294 2724 gene locus_tag LOCUS_11820 1294 2724 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198931.1 protein_id gnl|my_center|LOCUS_11820 2958 6521 gene locus_tag LOCUS_11830 2958 6521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 6715 7599 gene locus_tag LOCUS_11840 6715 7599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 8963 7614 gene locus_tag LOCUS_11850 8963 7614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 9183 10184 gene locus_tag LOCUS_11860 9183 10184 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255513.1 protein_id gnl|my_center|LOCUS_11860 10246 14643 gene locus_tag LOCUS_11870 10246 14643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 14695 17967 gene locus_tag LOCUS_11880 14695 17967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 18022 18339 gene locus_tag LOCUS_11890 18022 18339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 18392 18712 gene locus_tag LOCUS_11900 18392 18712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 18762 19763 gene locus_tag LOCUS_11910 gene dhaK 18762 19763 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259135.1 protein_id gnl|my_center|LOCUS_11910 19783 20418 gene locus_tag LOCUS_11920 gene dhaL 19783 20418 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229494.1 protein_id gnl|my_center|LOCUS_11920 20411 21304 gene locus_tag LOCUS_11930 gene lsrF 20411 21304 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209188.1 protein_id gnl|my_center|LOCUS_11930 21468 22034 gene locus_tag LOCUS_11940 gene lyxE 21468 22034 CDS product D-lyxose ketol-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234400.1 protein_id gnl|my_center|LOCUS_11940 22166 26236 gene locus_tag LOCUS_11950 22166 26236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 26515 28356 gene locus_tag LOCUS_11960 26515 28356 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764577.1 protein_id gnl|my_center|LOCUS_11960 28468 29589 gene locus_tag LOCUS_11970 28468 29589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 29647 30546 gene locus_tag LOCUS_11980 29647 30546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 31581 30556 gene locus_tag LOCUS_11990 gene cydB 31581 30556 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_11990 33040 31586 gene locus_tag LOCUS_12000 33040 31586 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_12000 33636 33370 gene locus_tag LOCUS_12010 33636 33370 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141324.1 protein_id gnl|my_center|LOCUS_12010 33884 33660 gene locus_tag LOCUS_12020 33884 33660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876121.1 protein_id gnl|my_center|LOCUS_12020 35027 33954 gene locus_tag LOCUS_12030 gene nadA 35027 33954 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404647.1 protein_id gnl|my_center|LOCUS_12030 35774 35319 gene locus_tag LOCUS_12040 35774 35319 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_12040 37042 35774 gene locus_tag LOCUS_12050 37042 35774 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_12050 38183 37068 gene locus_tag LOCUS_12060 gene sufD 38183 37068 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928762.1 protein_id gnl|my_center|LOCUS_12060 >Feature sequence034 386 2281 gene locus_tag LOCUS_12070 386 2281 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929297.1 protein_id gnl|my_center|LOCUS_12070 2391 2909 gene locus_tag LOCUS_12080 2391 2909 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926900.1 protein_id gnl|my_center|LOCUS_12080 3102 5180 gene locus_tag LOCUS_12090 3102 5180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 5529 6395 gene locus_tag LOCUS_12100 5529 6395 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942704.1 protein_id gnl|my_center|LOCUS_12100 6903 6538 gene locus_tag LOCUS_12110 6903 6538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 7648 7055 gene locus_tag LOCUS_12120 7648 7055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 7869 9275 gene locus_tag LOCUS_12130 7869 9275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 10940 9294 gene locus_tag LOCUS_12140 10940 9294 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108495.1 protein_id gnl|my_center|LOCUS_12140 11190 12377 gene locus_tag LOCUS_12150 11190 12377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 13359 12400 gene locus_tag LOCUS_12160 13359 12400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 15681 13501 gene locus_tag LOCUS_12170 15681 13501 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_12170 16178 17623 gene locus_tag LOCUS_12180 16178 17623 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939860.1 protein_id gnl|my_center|LOCUS_12180 18053 17649 gene locus_tag LOCUS_12190 18053 17649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 18405 19301 gene locus_tag LOCUS_12200 18405 19301 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257972.1 protein_id gnl|my_center|LOCUS_12200 19320 20654 gene locus_tag LOCUS_12210 19320 20654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 20654 21070 gene locus_tag LOCUS_12220 gene nikR 20654 21070 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868557.1 protein_id gnl|my_center|LOCUS_12220 21137 23104 gene locus_tag LOCUS_12230 21137 23104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 25625 23136 gene locus_tag LOCUS_12240 25625 23136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 26406 25669 gene locus_tag LOCUS_12250 26406 25669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333116.1 protein_id gnl|my_center|LOCUS_12250 28057 26729 gene locus_tag LOCUS_12260 28057 26729 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243878.1 protein_id gnl|my_center|LOCUS_12260 29439 28120 gene locus_tag LOCUS_12270 29439 28120 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615779.1 protein_id gnl|my_center|LOCUS_12270 29716 30717 gene locus_tag LOCUS_12280 29716 30717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 30836 32203 gene locus_tag LOCUS_12290 30836 32203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 32200 33186 gene locus_tag LOCUS_12300 32200 33186 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061699.1 protein_id gnl|my_center|LOCUS_12300 33251 35167 gene locus_tag LOCUS_12310 33251 35167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 36579 35197 gene locus_tag LOCUS_12320 36579 35197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 >Feature sequence035 6397 3296 gene locus_tag LOCUS_12330 6397 3296 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_12330 7445 6423 gene locus_tag LOCUS_12340 gene queA 7445 6423 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880543.1 protein_id gnl|my_center|LOCUS_12340 8370 7462 gene locus_tag LOCUS_12350 8370 7462 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256476.1 protein_id gnl|my_center|LOCUS_12350 8554 9492 gene locus_tag LOCUS_12360 8554 9492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 9509 9964 gene locus_tag LOCUS_12370 9509 9964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 10514 9909 gene locus_tag LOCUS_12380 10514 9909 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404532.1 protein_id gnl|my_center|LOCUS_12380 12745 10772 gene locus_tag LOCUS_12390 12745 10772 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030755.1 protein_id gnl|my_center|LOCUS_12390 12933 16295 gene locus_tag LOCUS_12400 12933 16295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 19277 16395 gene locus_tag LOCUS_12410 19277 16395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 19996 19370 gene locus_tag LOCUS_12420 19996 19370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 20916 19993 gene locus_tag LOCUS_12430 gene xrt 20916 19993 CDS product exosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176633.1 protein_id gnl|my_center|LOCUS_12430 24150 20920 gene locus_tag LOCUS_12440 24150 20920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 25022 24204 gene locus_tag LOCUS_12450 25022 24204 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965614.1 protein_id gnl|my_center|LOCUS_12450 25651 25028 gene locus_tag LOCUS_12460 25651 25028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 27980 25659 gene locus_tag LOCUS_12470 27980 25659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 29258 27990 gene locus_tag LOCUS_12480 29258 27990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 30407 29298 gene locus_tag LOCUS_12490 30407 29298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 32304 30838 gene locus_tag LOCUS_12500 gene rho 32304 30838 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_12500 35096 32385 gene locus_tag LOCUS_12510 gene polA 35096 32385 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941209.1 protein_id gnl|my_center|LOCUS_12510 <36154 35071 gene locus_tag LOCUS_12520 <36154 35071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942901.1:lipid-A-disaccharide synthase >Feature sequence036 3430 1742 gene locus_tag LOCUS_12530 3430 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 5200 3512 gene locus_tag LOCUS_12540 5200 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 6464 5685 gene locus_tag LOCUS_12550 6464 5685 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931160.1 protein_id gnl|my_center|LOCUS_12550 6767 6468 gene locus_tag LOCUS_12560 6767 6468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 7716 6778 gene locus_tag LOCUS_12570 gene pdhA 7716 6778 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_12570 8734 7727 gene locus_tag LOCUS_12580 8734 7727 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104786.1 protein_id gnl|my_center|LOCUS_12580 9543 8746 gene locus_tag LOCUS_12590 9543 8746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 10360 9563 gene locus_tag LOCUS_12600 10360 9563 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922304.1 protein_id gnl|my_center|LOCUS_12600 11345 10389 gene locus_tag LOCUS_12610 11345 10389 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030183075.1 protein_id gnl|my_center|LOCUS_12610 12409 11342 gene locus_tag LOCUS_12620 gene allD 12409 11342 CDS product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244926.1 protein_id gnl|my_center|LOCUS_12620 13640 12423 gene locus_tag LOCUS_12630 13640 12423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 14257 13592 gene locus_tag LOCUS_12640 14257 13592 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359835.1 protein_id gnl|my_center|LOCUS_12640 15301 14273 gene locus_tag LOCUS_12650 15301 14273 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_12650 16500 15334 gene locus_tag LOCUS_12660 16500 15334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 17926 16544 gene locus_tag LOCUS_12670 gene araE 17926 16544 CDS product arabinose-proton symporter AraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243899.1 protein_id gnl|my_center|LOCUS_12670 18837 17992 gene locus_tag LOCUS_12680 gene fabG 18837 17992 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 protein_id gnl|my_center|LOCUS_12680 19920 18910 gene locus_tag LOCUS_12690 19920 18910 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_12690 20935 19901 gene locus_tag LOCUS_12700 20935 19901 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075126.1 protein_id gnl|my_center|LOCUS_12700 23411 20952 gene locus_tag LOCUS_12710 23411 20952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 24236 23772 gene locus_tag LOCUS_12720 24236 23772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 24900 24409 gene locus_tag LOCUS_12730 24900 24409 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_12730 25533 24904 gene locus_tag LOCUS_12740 25533 24904 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876584.1 protein_id gnl|my_center|LOCUS_12740 26950 25535 gene locus_tag LOCUS_12750 26950 25535 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_12750 28694 26925 gene locus_tag LOCUS_12760 28694 26925 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250553.1 protein_id gnl|my_center|LOCUS_12760 29337 28687 gene locus_tag LOCUS_12770 29337 28687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 29606 29334 gene locus_tag LOCUS_12780 29606 29334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 29997 29641 gene locus_tag LOCUS_12790 29997 29641 CDS product ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869272.1 protein_id gnl|my_center|LOCUS_12790 31998 30010 gene locus_tag LOCUS_12800 31998 30010 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_12800 33042 32002 gene locus_tag LOCUS_12810 33042 32002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 33356 33042 gene locus_tag LOCUS_12820 33356 33042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 >Feature sequence037 114 929 gene locus_tag LOCUS_12830 114 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 926 2092 gene locus_tag LOCUS_12840 926 2092 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202512.1 protein_id gnl|my_center|LOCUS_12840 2236 3417 gene locus_tag LOCUS_12850 2236 3417 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122559.1 protein_id gnl|my_center|LOCUS_12850 4138 3512 gene locus_tag LOCUS_12860 4138 3512 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_12860 4598 8191 gene locus_tag LOCUS_12870 4598 8191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 8261 10141 gene locus_tag LOCUS_12880 8261 10141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 11209 10184 gene locus_tag LOCUS_12890 11209 10184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 15050 11292 gene locus_tag LOCUS_12900 15050 11292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 15622 18084 gene locus_tag LOCUS_12910 15622 18084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 18227 21193 gene locus_tag LOCUS_12920 18227 21193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 21347 23359 gene locus_tag LOCUS_12930 21347 23359 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_12930 23486 24937 gene locus_tag LOCUS_12940 23486 24937 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_12940 25754 26830 gene locus_tag LOCUS_12950 25754 26830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 27044 28171 gene locus_tag LOCUS_12960 27044 28171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 29299 28334 gene locus_tag LOCUS_12970 29299 28334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 29695 31977 gene locus_tag LOCUS_12980 29695 31977 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210266672.1 protein_id gnl|my_center|LOCUS_12980 32319 31978 gene locus_tag LOCUS_12990 32319 31978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211291926.1 protein_id gnl|my_center|LOCUS_12990 34115 32316 gene locus_tag LOCUS_13000 34115 32316 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928981.1 protein_id gnl|my_center|LOCUS_13000 34700 34624 gene locus_tag LOCUS_t00100 34700 34624 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 35198 34857 gene locus_tag LOCUS_13010 35198 34857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 >Feature sequence038 1302 343 gene locus_tag LOCUS_13020 1302 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 2268 1324 gene locus_tag LOCUS_13030 2268 1324 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_13030 3260 2265 gene locus_tag LOCUS_13040 gene gmd 3260 2265 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_13040 3419 4117 gene locus_tag LOCUS_13050 gene queC 3419 4117 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877949.1 protein_id gnl|my_center|LOCUS_13050 4140 4445 gene locus_tag LOCUS_13060 4140 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 4487 5449 gene locus_tag LOCUS_13070 4487 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 5479 6555 gene locus_tag LOCUS_13080 gene mutY 5479 6555 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056920.1 protein_id gnl|my_center|LOCUS_13080 8418 7420 gene locus_tag LOCUS_13090 8418 7420 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393601.1 protein_id gnl|my_center|LOCUS_13090 8643 10361 gene locus_tag LOCUS_13100 8643 10361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 11097 10387 gene locus_tag LOCUS_13110 11097 10387 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173565.1 protein_id gnl|my_center|LOCUS_13110 11550 11272 gene locus_tag LOCUS_13120 11550 11272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 12714 11872 gene locus_tag LOCUS_13130 gene larE 12714 11872 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_13130 14038 12707 gene locus_tag LOCUS_13140 gene mtaB 14038 12707 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_13140 15538 14045 gene locus_tag LOCUS_13150 15538 14045 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_13150 16861 15578 gene locus_tag LOCUS_13160 gene miaB 16861 15578 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037471.1 protein_id gnl|my_center|LOCUS_13160 20147 17220 gene locus_tag LOCUS_13170 20147 17220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 20695 20144 gene locus_tag LOCUS_13180 20695 20144 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 protein_id gnl|my_center|LOCUS_13180 20880 22676 gene locus_tag LOCUS_13190 20880 22676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 22652 24310 gene locus_tag LOCUS_13200 22652 24310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 24387 25100 gene locus_tag LOCUS_13210 24387 25100 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838449.1 protein_id gnl|my_center|LOCUS_13210 25128 26414 gene locus_tag LOCUS_13220 25128 26414 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_13220 26479 26973 gene locus_tag LOCUS_13230 26479 26973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 28072 26996 gene locus_tag LOCUS_13240 28072 26996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 29939 28884 gene locus_tag LOCUS_13250 29939 28884 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459735.1 protein_id gnl|my_center|LOCUS_13250 30701 29979 gene locus_tag LOCUS_13260 30701 29979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 32094 30769 gene locus_tag LOCUS_13270 32094 30769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 34270 32192 gene locus_tag LOCUS_13280 34270 32192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895537.1 protein_id gnl|my_center|LOCUS_13280 <35773 34322 gene locus_tag LOCUS_13290 <35773 34322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027423.1:FAD-dependent oxidoreductase 35023 34949 gene locus_tag LOCUS_t00110 35023 34949 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence039 228 1499 gene locus_tag LOCUS_13300 228 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 2016 1579 gene locus_tag LOCUS_13310 2016 1579 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942381.1 protein_id gnl|my_center|LOCUS_13310 3392 2061 gene locus_tag LOCUS_13320 3392 2061 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162490120.1 protein_id gnl|my_center|LOCUS_13320 3978 3454 gene locus_tag LOCUS_13330 3978 3454 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942383.1 protein_id gnl|my_center|LOCUS_13330 5576 3966 gene locus_tag LOCUS_13340 gene iorA 5576 3966 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942384.1 protein_id gnl|my_center|LOCUS_13340 5995 5834 gene locus_tag LOCUS_13350 5995 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 6196 7209 gene locus_tag LOCUS_13360 6196 7209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 8020 7235 gene locus_tag LOCUS_13370 8020 7235 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788045.1 protein_id gnl|my_center|LOCUS_13370 8778 8017 gene locus_tag LOCUS_13380 gene thiF 8778 8017 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056327.1 protein_id gnl|my_center|LOCUS_13380 10578 8884 gene locus_tag LOCUS_13390 10578 8884 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144228.1 protein_id gnl|my_center|LOCUS_13390 10806 11090 gene locus_tag LOCUS_13400 10806 11090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 11152 12231 gene locus_tag LOCUS_13410 gene hemW 11152 12231 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038356.1 protein_id gnl|my_center|LOCUS_13410 12396 14135 gene locus_tag LOCUS_13420 12396 14135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 14117 14419 gene locus_tag LOCUS_13430 14117 14419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 14416 14913 gene locus_tag LOCUS_13440 14416 14913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 14994 16004 gene locus_tag LOCUS_13450 gene floA 14994 16004 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230026.1 protein_id gnl|my_center|LOCUS_13450 16092 16727 gene locus_tag LOCUS_13460 16092 16727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 16970 18649 gene locus_tag LOCUS_13470 16970 18649 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393418.1 protein_id gnl|my_center|LOCUS_13470 18652 21792 gene locus_tag LOCUS_13480 gene addB 18652 21792 CDS product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083576.1 protein_id gnl|my_center|LOCUS_13480 21789 25181 gene locus_tag LOCUS_13490 21789 25181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 25178 26140 gene locus_tag LOCUS_13500 25178 26140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 26193 28241 gene locus_tag LOCUS_13510 gene glgX 26193 28241 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122228.1 protein_id gnl|my_center|LOCUS_13510 29209 28238 gene locus_tag LOCUS_13520 29209 28238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 30191 29337 gene locus_tag LOCUS_13530 30191 29337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 31292 30384 gene locus_tag LOCUS_13540 31292 30384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 31807 32259 gene locus_tag LOCUS_13550 gene mscL 31807 32259 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932912.1 protein_id gnl|my_center|LOCUS_13550 32694 35105 gene locus_tag LOCUS_13560 32694 35105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 >Feature sequence040 754 665 gene locus_tag LOCUS_t00120 754 665 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2305 917 gene locus_tag LOCUS_13570 2305 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 3585 2431 gene locus_tag LOCUS_13580 3585 2431 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143816.1 protein_id gnl|my_center|LOCUS_13580 4025 3840 gene locus_tag LOCUS_13590 4025 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 4361 4140 gene locus_tag LOCUS_13600 4361 4140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 4663 4493 gene locus_tag LOCUS_13610 4663 4493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 6434 4836 gene locus_tag LOCUS_13620 6434 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 7042 6431 gene locus_tag LOCUS_13630 7042 6431 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325344.1 protein_id gnl|my_center|LOCUS_13630 8156 7449 gene locus_tag LOCUS_13640 8156 7449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 8278 8700 gene locus_tag LOCUS_13650 8278 8700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 8693 9190 gene locus_tag LOCUS_13660 8693 9190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 10158 9202 gene locus_tag LOCUS_13670 10158 9202 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140222.1 protein_id gnl|my_center|LOCUS_13670 10635 10348 gene locus_tag LOCUS_13680 10635 10348 CDS product DUF4491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812401.1 protein_id gnl|my_center|LOCUS_13680 13150 10979 gene locus_tag LOCUS_13690 gene feoB 13150 10979 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939841.1 protein_id gnl|my_center|LOCUS_13690 13391 13152 gene locus_tag LOCUS_13700 13391 13152 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023401.1 protein_id gnl|my_center|LOCUS_13700 13751 13500 gene locus_tag LOCUS_13710 13751 13500 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053694.1 protein_id gnl|my_center|LOCUS_13710 14227 13772 gene locus_tag LOCUS_13720 14227 13772 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044348005.1 protein_id gnl|my_center|LOCUS_13720 15694 14462 gene locus_tag LOCUS_13730 15694 14462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 16038 16460 gene locus_tag LOCUS_13740 16038 16460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 16853 17836 gene locus_tag LOCUS_13750 16853 17836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 18610 19590 gene locus_tag LOCUS_13760 18610 19590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 19871 19970 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20046 20252 gene locus_tag LOCUS_13770 20046 20252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 20413 21951 gene locus_tag LOCUS_13780 gene htrA 20413 21951 CDS product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872209.1 protein_id gnl|my_center|LOCUS_13780 22059 22592 gene locus_tag LOCUS_13790 22059 22592 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 protein_id gnl|my_center|LOCUS_13790 22753 23943 gene locus_tag LOCUS_13800 gene aspC 22753 23943 CDS product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462648.1 protein_id gnl|my_center|LOCUS_13800 24402 25745 gene locus_tag LOCUS_13810 24402 25745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 25784 26182 gene locus_tag LOCUS_13820 25784 26182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 26768 26199 gene locus_tag LOCUS_13830 26768 26199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 27015 27935 gene locus_tag LOCUS_13840 gene ispH 27015 27935 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470638.1 protein_id gnl|my_center|LOCUS_13840 28183 29520 gene locus_tag LOCUS_13850 gene ffh 28183 29520 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_13850 29637 29978 gene locus_tag LOCUS_13860 29637 29978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 30043 30273 gene locus_tag LOCUS_13870 30043 30273 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_13870 30292 30819 gene locus_tag LOCUS_13880 30292 30819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 30809 31561 gene locus_tag LOCUS_13890 gene trmD 30809 31561 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_13890 31558 31944 gene locus_tag LOCUS_13900 gene rplS 31558 31944 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_13900 32291 32890 gene locus_tag LOCUS_13910 32291 32890 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941310.1 protein_id gnl|my_center|LOCUS_13910 32878 34557 gene locus_tag LOCUS_13920 32878 34557 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942079.1 protein_id gnl|my_center|LOCUS_13920 >Feature sequence041 1247 192 gene locus_tag LOCUS_13930 1247 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 3814 1382 gene locus_tag LOCUS_13940 3814 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 5280 3949 gene locus_tag LOCUS_13950 5280 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 6626 5352 gene locus_tag LOCUS_13960 gene aroA 6626 5352 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024417.1 protein_id gnl|my_center|LOCUS_13960 8747 6744 gene locus_tag LOCUS_13970 8747 6744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 11105 8814 gene locus_tag LOCUS_13980 11105 8814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 13149 11239 gene locus_tag LOCUS_13990 13149 11239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 13570 14853 gene locus_tag LOCUS_14000 13570 14853 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921627.1 protein_id gnl|my_center|LOCUS_14000 15014 16705 gene locus_tag LOCUS_14010 15014 16705 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102223.1 protein_id gnl|my_center|LOCUS_14010 16944 17705 gene locus_tag LOCUS_14020 16944 17705 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776310.1 protein_id gnl|my_center|LOCUS_14020 17705 19396 gene locus_tag LOCUS_14030 17705 19396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 20557 19406 gene locus_tag LOCUS_14040 20557 19406 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880720.1 protein_id gnl|my_center|LOCUS_14040 21026 20541 gene locus_tag LOCUS_14050 21026 20541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 21558 22310 gene locus_tag LOCUS_14060 21558 22310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 22307 23062 gene locus_tag LOCUS_14070 22307 23062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 23090 24289 gene locus_tag LOCUS_14080 23090 24289 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901949.1 protein_id gnl|my_center|LOCUS_14080 25272 24304 gene locus_tag LOCUS_14090 25272 24304 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_14090 26779 25250 gene locus_tag LOCUS_14100 gene xylB 26779 25250 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_14100 27084 26893 gene locus_tag LOCUS_14110 gene rpsU 27084 26893 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421025.1 protein_id gnl|my_center|LOCUS_14110 31208 27330 gene locus_tag LOCUS_14120 31208 27330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 31089 31730 gene locus_tag LOCUS_14130 31089 31730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 >Feature sequence042 2582 4015 gene locus_tag LOCUS_14140 2582 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_14140 6612 4039 gene locus_tag LOCUS_14150 6612 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 7424 6711 gene locus_tag LOCUS_14160 7424 6711 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975840.1 protein_id gnl|my_center|LOCUS_14160 9080 7476 gene locus_tag LOCUS_14170 9080 7476 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_14170 12860 9207 gene locus_tag LOCUS_14180 12860 9207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 14059 12965 gene locus_tag LOCUS_14190 14059 12965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 14205 15491 gene locus_tag LOCUS_14200 14205 15491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 15535 16167 gene locus_tag LOCUS_14210 15535 16167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879725.1 protein_id gnl|my_center|LOCUS_14210 17645 16197 gene locus_tag LOCUS_14220 17645 16197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 17893 19956 gene locus_tag LOCUS_14230 17893 19956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 20214 19978 gene locus_tag LOCUS_14240 20214 19978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 20495 20205 gene locus_tag LOCUS_14250 20495 20205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 22061 20496 gene locus_tag LOCUS_14260 22061 20496 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975674.1 protein_id gnl|my_center|LOCUS_14260 23680 22319 gene locus_tag LOCUS_14270 23680 22319 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_14270 23970 26858 gene locus_tag LOCUS_14280 23970 26858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 29373 26845 gene locus_tag LOCUS_14290 29373 26845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 29689 32502 gene locus_tag LOCUS_14300 29689 32502 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054625.1 protein_id gnl|my_center|LOCUS_14300 33995 32565 gene locus_tag LOCUS_14310 33995 32565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_14310 >Feature sequence043 298 1245 gene locus_tag LOCUS_14320 298 1245 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210024.1 protein_id gnl|my_center|LOCUS_14320 1348 3171 gene locus_tag LOCUS_14330 1348 3171 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325003.1 protein_id gnl|my_center|LOCUS_14330 3447 3650 gene locus_tag LOCUS_14340 3447 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 4017 5537 gene locus_tag LOCUS_14350 4017 5537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 5571 6902 gene locus_tag LOCUS_14360 5571 6902 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_14360 10172 6909 gene locus_tag LOCUS_14370 10172 6909 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922034.1 protein_id gnl|my_center|LOCUS_14370 10864 10169 gene locus_tag LOCUS_14380 gene lolD 10864 10169 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091168.1 protein_id gnl|my_center|LOCUS_14380 12124 10889 gene locus_tag LOCUS_14390 12124 10889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 13413 12121 gene locus_tag LOCUS_14400 13413 12121 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_14400 14897 13410 gene locus_tag LOCUS_14410 14897 13410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 17289 14902 gene locus_tag LOCUS_14420 gene nuoF 17289 14902 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 protein_id gnl|my_center|LOCUS_14420 19015 17276 gene locus_tag LOCUS_14430 19015 17276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 20306 19020 gene locus_tag LOCUS_14440 20306 19020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 20866 20303 gene locus_tag LOCUS_14450 20866 20303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 21066 20863 gene locus_tag LOCUS_14460 21066 20863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 22057 21068 gene locus_tag LOCUS_14470 22057 21068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145385480.1 protein_id gnl|my_center|LOCUS_14470 23535 22078 gene locus_tag LOCUS_14480 23535 22078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 24840 23575 gene locus_tag LOCUS_14490 24840 23575 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_14490 25137 26366 gene locus_tag LOCUS_14500 25137 26366 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_14500 26341 27354 gene locus_tag LOCUS_14510 26341 27354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 29799 27442 gene locus_tag LOCUS_14520 29799 27442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 31150 29819 gene locus_tag LOCUS_14530 31150 29819 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_14530 32871 31171 gene locus_tag LOCUS_14540 32871 31171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 33055 34020 gene locus_tag LOCUS_14550 gene akrN 33055 34020 CDS product aldo/keto reductase AkrN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245422.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence044 1350 565 gene locus_tag LOCUS_14560 1350 565 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919165.1 protein_id gnl|my_center|LOCUS_14560 2159 1347 gene locus_tag LOCUS_14570 2159 1347 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926031.1 protein_id gnl|my_center|LOCUS_14570 3158 2196 gene locus_tag LOCUS_14580 3158 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 4607 3180 gene locus_tag LOCUS_14590 4607 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 4974 6056 gene locus_tag LOCUS_14600 gene aroB 4974 6056 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231846185.1 protein_id gnl|my_center|LOCUS_14600 6096 6917 gene locus_tag LOCUS_14610 6096 6917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 6964 7623 gene locus_tag LOCUS_14620 6964 7623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 9611 7674 gene locus_tag LOCUS_14630 9611 7674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 10423 9611 gene locus_tag LOCUS_14640 10423 9611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 11458 10436 gene locus_tag LOCUS_14650 11458 10436 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867543.1 protein_id gnl|my_center|LOCUS_14650 12165 11455 gene locus_tag LOCUS_14660 12165 11455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 12791 12162 gene locus_tag LOCUS_14670 12791 12162 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948772.1 protein_id gnl|my_center|LOCUS_14670 13370 12795 gene locus_tag LOCUS_14680 13370 12795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 13885 13745 gene locus_tag LOCUS_14690 13885 13745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 15630 14164 gene locus_tag LOCUS_14700 15630 14164 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931634.1 protein_id gnl|my_center|LOCUS_14700 20262 15724 gene locus_tag LOCUS_14710 20262 15724 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196742.1 protein_id gnl|my_center|LOCUS_14710 20719 21837 gene locus_tag LOCUS_14720 20719 21837 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616105.1 protein_id gnl|my_center|LOCUS_14720 21834 22994 gene locus_tag LOCUS_14730 21834 22994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 23169 24983 gene locus_tag LOCUS_14740 gene fucI 23169 24983 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779363.1 protein_id gnl|my_center|LOCUS_14740 25144 26172 gene locus_tag LOCUS_14750 25144 26172 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391963.1 protein_id gnl|my_center|LOCUS_14750 26225 26515 gene locus_tag LOCUS_14760 26225 26515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 26493 27146 gene locus_tag LOCUS_14770 gene hypB 26493 27146 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545559.1 protein_id gnl|my_center|LOCUS_14770 28201 27200 gene locus_tag LOCUS_14780 gene hypE 28201 27200 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893646.1 protein_id gnl|my_center|LOCUS_14780 29377 28319 gene locus_tag LOCUS_14790 gene hypD 29377 28319 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810717.1 protein_id gnl|my_center|LOCUS_14790 29600 29364 gene locus_tag LOCUS_14800 29600 29364 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545287.1 protein_id gnl|my_center|LOCUS_14800 32067 29563 gene locus_tag LOCUS_14810 gene hypF 32067 29563 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_14810 33636 32149 gene locus_tag LOCUS_14820 33636 32149 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117733.1 protein_id gnl|my_center|LOCUS_14820 >Feature sequence045 1810 914 gene locus_tag LOCUS_14830 1810 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 1951 3474 gene locus_tag LOCUS_14840 1951 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144206.1 protein_id gnl|my_center|LOCUS_14840 3679 3536 gene locus_tag LOCUS_14850 3679 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 3882 5447 gene locus_tag LOCUS_14860 3882 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 5509 6567 gene locus_tag LOCUS_14870 5509 6567 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459735.1 protein_id gnl|my_center|LOCUS_14870 6666 7145 gene locus_tag LOCUS_14880 6666 7145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021936.1 protein_id gnl|my_center|LOCUS_14880 7674 8870 gene locus_tag LOCUS_14890 7674 8870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 10687 8861 gene locus_tag LOCUS_14900 10687 8861 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143441.1 protein_id gnl|my_center|LOCUS_14900 11766 10738 gene locus_tag LOCUS_14910 11766 10738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 13125 11959 gene locus_tag LOCUS_14920 13125 11959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 13412 13140 gene locus_tag LOCUS_14930 13412 13140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 14495 13482 gene locus_tag LOCUS_14940 14495 13482 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 protein_id gnl|my_center|LOCUS_14940 16492 14969 gene locus_tag LOCUS_14950 16492 14969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 16629 16471 gene locus_tag LOCUS_14960 16629 16471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 16692 16766 gene locus_tag LOCUS_t00130 16692 16766 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 16796 16871 gene locus_tag LOCUS_t00140 16796 16871 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 17363 17632 gene locus_tag LOCUS_14970 17363 17632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 20771 17724 gene locus_tag LOCUS_14980 20771 17724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 21391 21146 gene locus_tag LOCUS_14990 21391 21146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 22268 21510 gene locus_tag LOCUS_15000 22268 21510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 24151 22343 gene locus_tag LOCUS_15010 24151 22343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 22355 22454 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24373 25356 gene locus_tag LOCUS_15020 24373 25356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 27194 25383 gene locus_tag LOCUS_15030 27194 25383 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976323.1 protein_id gnl|my_center|LOCUS_15030 28685 27213 gene locus_tag LOCUS_15040 28685 27213 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_15040 31561 28844 gene locus_tag LOCUS_15050 31561 28844 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109093.1 protein_id gnl|my_center|LOCUS_15050 31767 33065 gene locus_tag LOCUS_15060 31767 33065 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence046 39 518 gene locus_tag LOCUS_15070 39 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 733 2664 gene locus_tag LOCUS_15080 733 2664 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783169.1 protein_id gnl|my_center|LOCUS_15080 3143 2676 gene locus_tag LOCUS_15090 3143 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 4690 3260 gene locus_tag LOCUS_15100 4690 3260 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123116.1 protein_id gnl|my_center|LOCUS_15100 5174 4719 gene locus_tag LOCUS_15110 5174 4719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 5385 6188 gene locus_tag LOCUS_15120 5385 6188 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257316.1 protein_id gnl|my_center|LOCUS_15120 6482 6207 gene locus_tag LOCUS_15130 6482 6207 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250981.1 protein_id gnl|my_center|LOCUS_15130 7861 6482 gene locus_tag LOCUS_15140 7861 6482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 9187 7940 gene locus_tag LOCUS_15150 9187 7940 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089165.1 protein_id gnl|my_center|LOCUS_15150 9951 9205 gene locus_tag LOCUS_15160 9951 9205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 10435 10534 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11447 10860 gene locus_tag LOCUS_15170 gene pyrE 11447 10860 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460653.1 protein_id gnl|my_center|LOCUS_15170 12136 11444 gene locus_tag LOCUS_15180 gene pyrF 12136 11444 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942107.1 protein_id gnl|my_center|LOCUS_15180 13023 12133 gene locus_tag LOCUS_15190 13023 12133 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_15190 13870 13061 gene locus_tag LOCUS_15200 13870 13061 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_15200 14957 13872 gene locus_tag LOCUS_15210 gene disA 14957 13872 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392168.1 protein_id gnl|my_center|LOCUS_15210 16373 15012 gene locus_tag LOCUS_15220 gene radA 16373 15012 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_15220 18039 16681 gene locus_tag LOCUS_15230 18039 16681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 18247 19503 gene locus_tag LOCUS_15240 18247 19503 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190627.1 protein_id gnl|my_center|LOCUS_15240 21537 19495 gene locus_tag LOCUS_15250 21537 19495 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861272.1 protein_id gnl|my_center|LOCUS_15250 22283 21534 gene locus_tag LOCUS_15260 22283 21534 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896767.1 protein_id gnl|my_center|LOCUS_15260 23285 22401 gene locus_tag LOCUS_15270 23285 22401 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107584.1 protein_id gnl|my_center|LOCUS_15270 23502 24290 gene locus_tag LOCUS_15280 23502 24290 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242402.1 protein_id gnl|my_center|LOCUS_15280 24508 27552 gene locus_tag LOCUS_15290 24508 27552 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725349.1 protein_id gnl|my_center|LOCUS_15290 27549 28316 gene locus_tag LOCUS_15300 27549 28316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 28313 29365 gene locus_tag LOCUS_15310 gene rsgA 28313 29365 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815419.1 protein_id gnl|my_center|LOCUS_15310 30009 29524 gene locus_tag LOCUS_15320 30009 29524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 >Feature sequence047 559 2382 gene locus_tag LOCUS_15330 559 2382 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332193.1 protein_id gnl|my_center|LOCUS_15330 2436 3542 gene locus_tag LOCUS_15340 2436 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 3893 4354 gene locus_tag LOCUS_15350 3893 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 4359 4751 gene locus_tag LOCUS_15360 4359 4751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 5095 5646 gene locus_tag LOCUS_15370 gene pgsA 5095 5646 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090204.1 protein_id gnl|my_center|LOCUS_15370 5646 6986 gene locus_tag LOCUS_15380 gene der 5646 6986 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460200.1 protein_id gnl|my_center|LOCUS_15380 6983 7606 gene locus_tag LOCUS_15390 gene plsY 6983 7606 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231560.1 protein_id gnl|my_center|LOCUS_15390 8030 7632 gene locus_tag LOCUS_15400 8030 7632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 8225 9367 gene locus_tag LOCUS_15410 8225 9367 CDS product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199169830.1 protein_id gnl|my_center|LOCUS_15410 9487 10212 gene locus_tag LOCUS_15420 9487 10212 CDS product DUF2161 domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966295.1 protein_id gnl|my_center|LOCUS_15420 10378 11922 gene locus_tag LOCUS_15430 10378 11922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 14211 11968 gene locus_tag LOCUS_15440 14211 11968 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121109.1 protein_id gnl|my_center|LOCUS_15440 14415 15530 gene locus_tag LOCUS_15450 14415 15530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 16333 15524 gene locus_tag LOCUS_15460 16333 15524 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107159.1 protein_id gnl|my_center|LOCUS_15460 17108 16356 gene locus_tag LOCUS_15470 17108 16356 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838205.1 protein_id gnl|my_center|LOCUS_15470 17601 17338 gene locus_tag LOCUS_15480 17601 17338 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028883.1 protein_id gnl|my_center|LOCUS_15480 17856 19403 gene locus_tag LOCUS_15490 17856 19403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 19542 20525 gene locus_tag LOCUS_15500 19542 20525 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_15500 20527 21075 gene locus_tag LOCUS_15510 20527 21075 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103118.1 protein_id gnl|my_center|LOCUS_15510 21094 21798 gene locus_tag LOCUS_15520 21094 21798 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888106.1 protein_id gnl|my_center|LOCUS_15520 22901 21855 gene locus_tag LOCUS_15530 22901 21855 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060741.1 protein_id gnl|my_center|LOCUS_15530 24161 23031 gene locus_tag LOCUS_15540 24161 23031 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742100.1 protein_id gnl|my_center|LOCUS_15540 24353 25006 gene locus_tag LOCUS_15550 24353 25006 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977711.1 protein_id gnl|my_center|LOCUS_15550 25053 27848 gene locus_tag LOCUS_15560 25053 27848 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921413.1 protein_id gnl|my_center|LOCUS_15560 28396 28956 gene locus_tag LOCUS_15570 28396 28956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 29039 30010 gene locus_tag LOCUS_15580 29039 30010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 31336 30041 gene locus_tag LOCUS_15590 31336 30041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 31659 32123 gene locus_tag LOCUS_15600 31659 32123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 32131 32853 gene locus_tag LOCUS_15610 gene rlmB 32131 32853 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887393.1 protein_id gnl|my_center|LOCUS_15610 >Feature sequence048 1315 1414 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1552 2544 gene locus_tag LOCUS_15620 1552 2544 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943449.1 protein_id gnl|my_center|LOCUS_15620 2544 3494 gene locus_tag LOCUS_15630 2544 3494 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943450.1 protein_id gnl|my_center|LOCUS_15630 3478 4449 gene locus_tag LOCUS_15640 3478 4449 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943451.1 protein_id gnl|my_center|LOCUS_15640 4446 5579 gene locus_tag LOCUS_15650 4446 5579 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943452.1 protein_id gnl|my_center|LOCUS_15650 5605 6732 gene locus_tag LOCUS_15660 5605 6732 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943453.1 protein_id gnl|my_center|LOCUS_15660 6850 9141 gene locus_tag LOCUS_15670 6850 9141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 10275 9181 gene locus_tag LOCUS_15680 10275 9181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 12453 10402 gene locus_tag LOCUS_15690 gene cyaD2 12453 10402 CDS product adenylate cyclase CyaD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969598.1 protein_id gnl|my_center|LOCUS_15690 13080 12478 gene locus_tag LOCUS_15700 13080 12478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 13562 13077 gene locus_tag LOCUS_15710 13562 13077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 13925 15073 gene locus_tag LOCUS_15720 gene cfa 13925 15073 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933625.1 protein_id gnl|my_center|LOCUS_15720 16289 15075 gene locus_tag LOCUS_15730 16289 15075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 16328 17815 gene locus_tag LOCUS_15740 16328 17815 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_15740 18927 17851 gene locus_tag LOCUS_15750 18927 17851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 19094 22591 gene locus_tag LOCUS_15760 19094 22591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 22605 26078 gene locus_tag LOCUS_15770 22605 26078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 26672 26214 gene locus_tag LOCUS_15780 26672 26214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 27248 26766 gene locus_tag LOCUS_15790 27248 26766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 27347 27832 gene locus_tag LOCUS_15800 27347 27832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 27971 29254 gene locus_tag LOCUS_15810 27971 29254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 29342 30007 gene locus_tag LOCUS_15820 29342 30007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 30004 31158 gene locus_tag LOCUS_15830 30004 31158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 31169 31846 gene locus_tag LOCUS_15840 31169 31846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 32792 31968 gene locus_tag LOCUS_15850 32792 31968 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931881.1 protein_id gnl|my_center|LOCUS_15850 <33458 32842 gene locus_tag LOCUS_15860 <33458 32842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064853.1:class I SAM-dependent methyltransferase >Feature sequence049 960 781 gene locus_tag LOCUS_15870 960 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 4247 1131 gene locus_tag LOCUS_15880 4247 1131 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037292.1 protein_id gnl|my_center|LOCUS_15880 4489 4863 gene locus_tag LOCUS_15890 4489 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 4866 5675 gene locus_tag LOCUS_15900 4866 5675 CDS product family 1 encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388729.1 protein_id gnl|my_center|LOCUS_15900 6074 6883 gene locus_tag LOCUS_15910 6074 6883 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_15910 7732 6935 gene locus_tag LOCUS_15920 7732 6935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 11198 7776 gene locus_tag LOCUS_15930 11198 7776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 11401 12306 gene locus_tag LOCUS_15940 11401 12306 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932575.1 protein_id gnl|my_center|LOCUS_15940 12290 13474 gene locus_tag LOCUS_15950 12290 13474 CDS product PstC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926951.1 protein_id gnl|my_center|LOCUS_15950 13479 14825 gene locus_tag LOCUS_15960 gene pstA 13479 14825 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932578.1 protein_id gnl|my_center|LOCUS_15960 14831 15658 gene locus_tag LOCUS_15970 gene pstB 14831 15658 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932579.1 protein_id gnl|my_center|LOCUS_15970 15673 16377 gene locus_tag LOCUS_15980 gene phoU 15673 16377 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326666.1 protein_id gnl|my_center|LOCUS_15980 16381 17067 gene locus_tag LOCUS_15990 16381 17067 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_15990 17078 18847 gene locus_tag LOCUS_16000 gene phoR 17078 18847 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_16000 18974 19705 gene locus_tag LOCUS_16010 gene coxK1 18974 19705 CDS product Dot/Icm T4SS effector protein kinase CoxK1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957418.1 protein_id gnl|my_center|LOCUS_16010 21268 19721 gene locus_tag LOCUS_16020 gene guaA 21268 19721 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_16020 22742 21273 gene locus_tag LOCUS_16030 gene guaB 22742 21273 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881325.1 protein_id gnl|my_center|LOCUS_16030 23032 24525 gene locus_tag LOCUS_16040 23032 24525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 26256 24598 gene locus_tag LOCUS_16050 26256 24598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 27694 26408 gene locus_tag LOCUS_16060 27694 26408 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028108.1 protein_id gnl|my_center|LOCUS_16060 28063 29742 gene locus_tag LOCUS_16070 28063 29742 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777117.1 protein_id gnl|my_center|LOCUS_16070 29785 30954 gene locus_tag LOCUS_16080 29785 30954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 31079 31279 gene locus_tag LOCUS_16090 31079 31279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 31369 31551 gene locus_tag LOCUS_16100 31369 31551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 31621 32136 gene locus_tag LOCUS_16110 31621 32136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 32798 32223 gene locus_tag LOCUS_16120 32798 32223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 >Feature sequence050 901 290 gene locus_tag LOCUS_16130 901 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 1698 1033 gene locus_tag LOCUS_16140 1698 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 3286 1685 gene locus_tag LOCUS_16150 3286 1685 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141015.1 protein_id gnl|my_center|LOCUS_16150 4305 3286 gene locus_tag LOCUS_16160 4305 3286 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117960.1 protein_id gnl|my_center|LOCUS_16160 6036 4324 gene locus_tag LOCUS_16170 6036 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 7775 6036 gene locus_tag LOCUS_16180 7775 6036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 9663 7801 gene locus_tag LOCUS_16190 9663 7801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 11431 9725 gene locus_tag LOCUS_16200 11431 9725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 12364 11435 gene locus_tag LOCUS_16210 12364 11435 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330018.1 protein_id gnl|my_center|LOCUS_16210 14964 12355 gene locus_tag LOCUS_16220 14964 12355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 16904 14961 gene locus_tag LOCUS_16230 16904 14961 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615739.1 protein_id gnl|my_center|LOCUS_16230 17803 16901 gene locus_tag LOCUS_16240 17803 16901 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427744.1 protein_id gnl|my_center|LOCUS_16240 18806 17808 gene locus_tag LOCUS_16250 18806 17808 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922072.1 protein_id gnl|my_center|LOCUS_16250 21721 18803 gene locus_tag LOCUS_16260 21721 18803 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922518.1 protein_id gnl|my_center|LOCUS_16260 22466 21789 gene locus_tag LOCUS_16270 22466 21789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 24337 22733 gene locus_tag LOCUS_16280 24337 22733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259251.1 protein_id gnl|my_center|LOCUS_16280 25373 24579 gene locus_tag LOCUS_16290 25373 24579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 26123 25377 gene locus_tag LOCUS_16300 26123 25377 CDS product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813264.1 protein_id gnl|my_center|LOCUS_16300 27244 27393 gene locus_tag LOCUS_16310 27244 27393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 27689 27829 gene locus_tag LOCUS_16320 27689 27829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 27855 28016 gene locus_tag LOCUS_16330 27855 28016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 29042 28209 gene locus_tag LOCUS_16340 29042 28209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 29445 29059 gene locus_tag LOCUS_16350 gene rsfS 29445 29059 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721994.1 protein_id gnl|my_center|LOCUS_16350 30894 29464 gene locus_tag LOCUS_16360 gene gatB 30894 29464 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393504.1 protein_id gnl|my_center|LOCUS_16360 32401 30932 gene locus_tag LOCUS_16370 gene gatA 32401 30932 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence051 3 440 gene locus_tag LOCUS_16380 3 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 1584 445 gene locus_tag LOCUS_16390 1584 445 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811039.1 protein_id gnl|my_center|LOCUS_16390 4490 1662 gene locus_tag LOCUS_16400 4490 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 4957 4505 gene locus_tag LOCUS_16410 gene rnhA 4957 4505 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921194.1 protein_id gnl|my_center|LOCUS_16410 5623 5033 gene locus_tag LOCUS_16420 5623 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 6573 5596 gene locus_tag LOCUS_16430 6573 5596 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061257.1 protein_id gnl|my_center|LOCUS_16430 7607 6633 gene locus_tag LOCUS_16440 gene rbsC 7607 6633 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001891150.1 protein_id gnl|my_center|LOCUS_16440 8075 9001 gene locus_tag LOCUS_16450 gene cysK 8075 9001 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034403.1 protein_id gnl|my_center|LOCUS_16450 9044 10342 gene locus_tag LOCUS_16460 9044 10342 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941843.1 protein_id gnl|my_center|LOCUS_16460 10429 12249 gene locus_tag LOCUS_16470 10429 12249 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922133.1 protein_id gnl|my_center|LOCUS_16470 13153 12344 gene locus_tag LOCUS_16480 13153 12344 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_16480 13301 14656 gene locus_tag LOCUS_16490 13301 14656 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_16490 14837 15763 gene locus_tag LOCUS_16500 14837 15763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 16482 15793 gene locus_tag LOCUS_16510 16482 15793 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766123.1 protein_id gnl|my_center|LOCUS_16510 17567 16566 gene locus_tag LOCUS_16520 gene dusB 17567 16566 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927287.1 protein_id gnl|my_center|LOCUS_16520 19425 17611 gene locus_tag LOCUS_16530 gene thiC 19425 17611 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095696.1 protein_id gnl|my_center|LOCUS_16530 21038 19656 gene locus_tag LOCUS_16540 gene hemG 21038 19656 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940690.1 protein_id gnl|my_center|LOCUS_16540 22408 21035 gene locus_tag LOCUS_16550 gene hemN 22408 21035 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256540.1 protein_id gnl|my_center|LOCUS_16550 22820 22512 gene locus_tag LOCUS_16560 22820 22512 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256599.1 protein_id gnl|my_center|LOCUS_16560 22987 23601 gene locus_tag LOCUS_16570 22987 23601 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339235.1 protein_id gnl|my_center|LOCUS_16570 26165 23631 gene locus_tag LOCUS_16580 26165 23631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 28263 26518 gene locus_tag LOCUS_16590 gene proS 28263 26518 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231918.1 protein_id gnl|my_center|LOCUS_16590 28805 28395 gene locus_tag LOCUS_16600 28805 28395 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116199.1 protein_id gnl|my_center|LOCUS_16600 29597 28851 gene locus_tag LOCUS_16610 29597 28851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 30775 29789 gene locus_tag LOCUS_16620 30775 29789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 31640 30894 gene locus_tag LOCUS_16630 31640 30894 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462636.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence052 1954 1631 gene locus_tag LOCUS_16640 1954 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 2462 2028 gene locus_tag LOCUS_16650 gene flgC 2462 2028 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_16650 2870 2475 gene locus_tag LOCUS_16660 gene flgB 2870 2475 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811894.1 protein_id gnl|my_center|LOCUS_16660 5347 3971 gene locus_tag LOCUS_16670 5347 3971 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_16670 6577 5414 gene locus_tag LOCUS_16680 6577 5414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 7017 6574 gene locus_tag LOCUS_16690 7017 6574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 9560 7014 gene locus_tag LOCUS_16700 9560 7014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 9552 9974 gene locus_tag LOCUS_16710 9552 9974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 10450 10800 gene locus_tag LOCUS_16720 10450 10800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 11043 12371 gene locus_tag LOCUS_16730 11043 12371 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275358.1 protein_id gnl|my_center|LOCUS_16730 12465 16025 gene locus_tag LOCUS_16740 12465 16025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 16022 19225 gene locus_tag LOCUS_16750 16022 19225 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461050.1 protein_id gnl|my_center|LOCUS_16750 19413 20135 gene locus_tag LOCUS_16760 gene tpiA 19413 20135 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942272.1 protein_id gnl|my_center|LOCUS_16760 20225 20770 gene locus_tag LOCUS_16770 20225 20770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 20885 22138 gene locus_tag LOCUS_16780 gene murA 20885 22138 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037922.1 protein_id gnl|my_center|LOCUS_16780 22243 23550 gene locus_tag LOCUS_16790 gene hisD 22243 23550 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461463.1 protein_id gnl|my_center|LOCUS_16790 23547 24596 gene locus_tag LOCUS_16800 gene hisC 23547 24596 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121508.1 protein_id gnl|my_center|LOCUS_16800 24608 25453 gene locus_tag LOCUS_16810 24608 25453 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942084.1 protein_id gnl|my_center|LOCUS_16810 25516 25872 gene locus_tag LOCUS_16820 25516 25872 CDS product phosphoribosylaminoimidazole carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404391.1 protein_id gnl|my_center|LOCUS_16820 26016 26777 gene locus_tag LOCUS_16830 26016 26777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 29669 26895 gene locus_tag LOCUS_16840 gene ppdK 29669 26895 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_16840 30146 30222 gene locus_tag LOCUS_t00150 30146 30222 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence053 2849 3391 gene locus_tag LOCUS_16850 2849 3391 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466608.1 protein_id gnl|my_center|LOCUS_16850 3378 3797 gene locus_tag LOCUS_16860 3378 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 4312 3818 gene locus_tag LOCUS_16870 4312 3818 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941779.1 protein_id gnl|my_center|LOCUS_16870 5648 4344 gene locus_tag LOCUS_16880 5648 4344 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942699.1 protein_id gnl|my_center|LOCUS_16880 6154 5645 gene locus_tag LOCUS_16890 6154 5645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 7237 6182 gene locus_tag LOCUS_16900 7237 6182 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942697.1 protein_id gnl|my_center|LOCUS_16900 7440 7192 gene locus_tag LOCUS_16910 7440 7192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 7685 7954 gene locus_tag LOCUS_16920 7685 7954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 8076 8282 gene locus_tag LOCUS_16930 8076 8282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 8279 8512 gene locus_tag LOCUS_16940 8279 8512 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250461.1 protein_id gnl|my_center|LOCUS_16940 8406 8654 gene locus_tag LOCUS_16950 8406 8654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 10303 8831 gene locus_tag LOCUS_16960 10303 8831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 10205 10708 gene locus_tag LOCUS_16970 10205 10708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 10910 12043 gene locus_tag LOCUS_16980 10910 12043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 12229 13131 gene locus_tag LOCUS_16990 12229 13131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 13286 14752 gene locus_tag LOCUS_17000 13286 14752 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173402000.1 protein_id gnl|my_center|LOCUS_17000 14843 16570 gene locus_tag LOCUS_17010 14843 16570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 16692 18449 gene locus_tag LOCUS_17020 16692 18449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 18639 19814 gene locus_tag LOCUS_17030 18639 19814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 19909 21249 gene locus_tag LOCUS_17040 19909 21249 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727454.1 protein_id gnl|my_center|LOCUS_17040 21246 22511 gene locus_tag LOCUS_17050 21246 22511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 22890 22501 gene locus_tag LOCUS_17060 22890 22501 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626340.1 protein_id gnl|my_center|LOCUS_17060 24885 22990 gene locus_tag LOCUS_17070 gene typA 24885 22990 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925120.1 protein_id gnl|my_center|LOCUS_17070 26230 25010 gene locus_tag LOCUS_17080 26230 25010 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142321.1 protein_id gnl|my_center|LOCUS_17080 29200 26849 gene locus_tag LOCUS_17090 29200 26849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 29460 29559 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31545 29608 gene locus_tag LOCUS_17100 31545 29608 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024232.1 protein_id gnl|my_center|LOCUS_17100 31940 31656 gene locus_tag LOCUS_17110 31940 31656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 >Feature sequence054 84 8 gene locus_tag LOCUS_t00160 84 8 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1744 290 gene locus_tag LOCUS_17120 gene menE 1744 290 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404107.1 protein_id gnl|my_center|LOCUS_17120 2838 1741 gene locus_tag LOCUS_17130 gene menC 2838 1741 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838743.1 protein_id gnl|my_center|LOCUS_17130 3728 2835 gene locus_tag LOCUS_17140 3728 2835 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404105.1 protein_id gnl|my_center|LOCUS_17140 4583 3762 gene locus_tag LOCUS_17150 gene menB 4583 3762 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098093.1 protein_id gnl|my_center|LOCUS_17150 5431 4583 gene locus_tag LOCUS_17160 gene menH 5431 4583 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933504.1 protein_id gnl|my_center|LOCUS_17160 7222 5453 gene locus_tag LOCUS_17170 gene menD 7222 5453 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927100.1 protein_id gnl|my_center|LOCUS_17170 8621 7215 gene locus_tag LOCUS_17180 8621 7215 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838739.1 protein_id gnl|my_center|LOCUS_17180 9356 8628 gene locus_tag LOCUS_17190 gene ubiE 9356 8628 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403588.1 protein_id gnl|my_center|LOCUS_17190 9684 10511 gene locus_tag LOCUS_17200 9684 10511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 10903 10544 gene locus_tag LOCUS_17210 10903 10544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 14689 11069 gene locus_tag LOCUS_17220 gene metH 14689 11069 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259744.1 protein_id gnl|my_center|LOCUS_17220 15619 14894 gene locus_tag LOCUS_17230 15619 14894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 15724 16671 gene locus_tag LOCUS_17240 15724 16671 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405412.1 protein_id gnl|my_center|LOCUS_17240 17407 16721 gene locus_tag LOCUS_17250 17407 16721 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922660.1 protein_id gnl|my_center|LOCUS_17250 19624 18278 gene locus_tag LOCUS_17260 19624 18278 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_17260 21277 19676 gene locus_tag LOCUS_17270 21277 19676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 22344 21274 gene locus_tag LOCUS_17280 22344 21274 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_17280 24147 22447 gene locus_tag LOCUS_17290 gene pilB 24147 22447 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_17290 25608 24274 gene locus_tag LOCUS_17300 25608 24274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 26620 25586 gene locus_tag LOCUS_17310 26620 25586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 25627 25726 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27844 26885 gene locus_tag LOCUS_17320 27844 26885 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_17320 30142 28208 gene locus_tag LOCUS_17330 30142 28208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 31278 30139 gene locus_tag LOCUS_17340 31278 30139 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942716.1 protein_id gnl|my_center|LOCUS_17340 31622 31275 gene locus_tag LOCUS_17350 31622 31275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 <32233 31682 gene locus_tag LOCUS_17360 <32233 31682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810321.1:carbamoyl-phosphate synthase large subunit >Feature sequence055 152 2332 gene locus_tag LOCUS_17370 152 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 2484 3590 gene locus_tag LOCUS_17380 2484 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 5108 3606 gene locus_tag LOCUS_17390 5108 3606 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_17390 8356 5195 gene locus_tag LOCUS_17400 8356 5195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 9471 8359 gene locus_tag LOCUS_17410 9471 8359 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392016.1 protein_id gnl|my_center|LOCUS_17410 10689 9739 gene locus_tag LOCUS_17420 10689 9739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 10960 13326 gene locus_tag LOCUS_17430 10960 13326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 13463 14455 gene locus_tag LOCUS_17440 13463 14455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 15867 14476 gene locus_tag LOCUS_17450 gene fumC 15867 14476 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958006.1 protein_id gnl|my_center|LOCUS_17450 16853 15999 gene locus_tag LOCUS_17460 16853 15999 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_17460 17122 19881 gene locus_tag LOCUS_17470 17122 19881 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615720.1 protein_id gnl|my_center|LOCUS_17470 21381 19918 gene locus_tag LOCUS_17480 gene dnaB 21381 19918 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286244.1 protein_id gnl|my_center|LOCUS_17480 21966 21388 gene locus_tag LOCUS_17490 21966 21388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 23002 22016 gene locus_tag LOCUS_17500 23002 22016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 23279 23016 gene locus_tag LOCUS_17510 gene rpsR 23279 23016 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869404.1 protein_id gnl|my_center|LOCUS_17510 23738 23313 gene locus_tag LOCUS_17520 gene ssb 23738 23313 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806953.1 protein_id gnl|my_center|LOCUS_17520 24278 23766 gene locus_tag LOCUS_17530 24278 23766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 27080 24591 gene locus_tag LOCUS_17540 27080 24591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 27997 27107 gene locus_tag LOCUS_17550 27997 27107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 28199 30379 gene locus_tag LOCUS_17560 28199 30379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 30917 31876 gene locus_tag LOCUS_17570 30917 31876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 >Feature sequence056 43 1272 gene locus_tag LOCUS_17580 43 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 1582 1301 gene locus_tag LOCUS_17590 1582 1301 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256760.1 protein_id gnl|my_center|LOCUS_17590 1883 3145 gene locus_tag LOCUS_17600 1883 3145 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921601.1 protein_id gnl|my_center|LOCUS_17600 5503 3152 gene locus_tag LOCUS_17610 5503 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 6653 5568 gene locus_tag LOCUS_17620 6653 5568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 7876 6962 gene locus_tag LOCUS_17630 7876 6962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 9692 8118 gene locus_tag LOCUS_17640 9692 8118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 9810 10742 gene locus_tag LOCUS_17650 gene miaA 9810 10742 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679096.1 protein_id gnl|my_center|LOCUS_17650 11043 11318 gene locus_tag LOCUS_17660 11043 11318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 11341 11754 gene locus_tag LOCUS_17670 11341 11754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 11834 13933 gene locus_tag LOCUS_17680 11834 13933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 14015 15349 gene locus_tag LOCUS_17690 14015 15349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 16738 15398 gene locus_tag LOCUS_17700 16738 15398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 17724 16909 gene locus_tag LOCUS_17710 17724 16909 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_17710 19266 18448 gene locus_tag LOCUS_17720 19266 18448 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_17720 20835 19435 gene locus_tag LOCUS_17730 20835 19435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 21179 20838 gene locus_tag LOCUS_17740 21179 20838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 22545 21409 gene locus_tag LOCUS_17750 22545 21409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 23129 22545 gene locus_tag LOCUS_17760 gene rpoE 23129 22545 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457274.1 protein_id gnl|my_center|LOCUS_17760 23517 23942 gene locus_tag LOCUS_17770 23517 23942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 24742 24017 gene locus_tag LOCUS_17780 24742 24017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 27178 25337 gene locus_tag LOCUS_17790 27178 25337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 27316 29055 gene locus_tag LOCUS_17800 27316 29055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 29526 29071 gene locus_tag LOCUS_17810 29526 29071 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096590.1 protein_id gnl|my_center|LOCUS_17810 30375 29644 gene locus_tag LOCUS_17820 30375 29644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 31600 30536 gene locus_tag LOCUS_17830 31600 30536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 >Feature sequence057 1531 101 gene locus_tag LOCUS_17840 1531 101 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121664.1 protein_id gnl|my_center|LOCUS_17840 1649 3592 gene locus_tag LOCUS_17850 1649 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 3714 4979 gene locus_tag LOCUS_17860 3714 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 7015 6173 gene locus_tag LOCUS_17870 7015 6173 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975126.1 protein_id gnl|my_center|LOCUS_17870 7984 7019 gene locus_tag LOCUS_17880 7984 7019 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582771.1 protein_id gnl|my_center|LOCUS_17880 9551 7962 gene locus_tag LOCUS_17890 9551 7962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 11670 9748 gene locus_tag LOCUS_17900 11670 9748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 12275 11859 gene locus_tag LOCUS_17910 12275 11859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 12732 12598 gene locus_tag LOCUS_17920 12732 12598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 15218 12717 gene locus_tag LOCUS_17930 15218 12717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 12774 12873 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15568 16029 gene locus_tag LOCUS_17940 15568 16029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 16688 15972 gene locus_tag LOCUS_17950 16688 15972 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869727.1 protein_id gnl|my_center|LOCUS_17950 16883 17497 gene locus_tag LOCUS_17960 16883 17497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 17554 18822 gene locus_tag LOCUS_17970 17554 18822 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870020.1 protein_id gnl|my_center|LOCUS_17970 19014 19113 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20430 19663 gene locus_tag LOCUS_17980 gene cobB 20430 19663 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762545.1 protein_id gnl|my_center|LOCUS_17980 21735 20461 gene locus_tag LOCUS_17990 gene serS 21735 20461 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940715.1 protein_id gnl|my_center|LOCUS_17990 22691 21807 gene locus_tag LOCUS_18000 22691 21807 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476457.1 protein_id gnl|my_center|LOCUS_18000 23442 22684 gene locus_tag LOCUS_18010 23442 22684 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_18010 24188 23751 gene locus_tag LOCUS_18020 24188 23751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 25301 24264 gene locus_tag LOCUS_18030 gene holA 25301 24264 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320835.1 protein_id gnl|my_center|LOCUS_18030 25868 25305 gene locus_tag LOCUS_18040 25868 25305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 26815 25865 gene locus_tag LOCUS_18050 26815 25865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 27226 27633 gene locus_tag LOCUS_18060 27226 27633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 27995 29380 gene locus_tag LOCUS_18070 gene dnaA 27995 29380 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727573.1 protein_id gnl|my_center|LOCUS_18070 29542 30657 gene locus_tag LOCUS_18080 29542 30657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062194302.1 protein_id gnl|my_center|LOCUS_18080 <31894 30654 gene locus_tag LOCUS_18090 <31894 30654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928735.1:family 10 glycosylhydrolase >Feature sequence058 84 347 gene locus_tag LOCUS_18100 84 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 380 1948 gene locus_tag LOCUS_18110 380 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 1878 2474 gene locus_tag LOCUS_18120 1878 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 2548 3393 gene locus_tag LOCUS_18130 2548 3393 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038545.1 protein_id gnl|my_center|LOCUS_18130 4731 3436 gene locus_tag LOCUS_18140 4731 3436 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_18140 4907 7690 gene locus_tag LOCUS_18150 4907 7690 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285985.1 protein_id gnl|my_center|LOCUS_18150 7707 8822 gene locus_tag LOCUS_18160 7707 8822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_18160 8822 9481 gene locus_tag LOCUS_18170 gene gmhA 8822 9481 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194315.1 protein_id gnl|my_center|LOCUS_18170 11389 9494 gene locus_tag LOCUS_18180 11389 9494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 12584 11634 gene locus_tag LOCUS_18190 12584 11634 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257625.1 protein_id gnl|my_center|LOCUS_18190 14060 12633 gene locus_tag LOCUS_18200 14060 12633 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940757.1 protein_id gnl|my_center|LOCUS_18200 16750 14057 gene locus_tag LOCUS_18210 gene glnD 16750 14057 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_18210 17529 16747 gene locus_tag LOCUS_18220 17529 16747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 19325 17529 gene locus_tag LOCUS_18230 19325 17529 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405278.1 protein_id gnl|my_center|LOCUS_18230 20194 19325 gene locus_tag LOCUS_18240 20194 19325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 21356 20256 gene locus_tag LOCUS_18250 21356 20256 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839879.1 protein_id gnl|my_center|LOCUS_18250 22409 21366 gene locus_tag LOCUS_18260 22409 21366 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_18260 23335 22406 gene locus_tag LOCUS_18270 23335 22406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 24636 23332 gene locus_tag LOCUS_18280 24636 23332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 25506 24646 gene locus_tag LOCUS_18290 25506 24646 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_18290 26531 25545 gene locus_tag LOCUS_18300 26531 25545 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_18300 27398 26553 gene locus_tag LOCUS_18310 27398 26553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 28601 27630 gene locus_tag LOCUS_18320 28601 27630 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584156.1 protein_id gnl|my_center|LOCUS_18320 31192 28601 gene locus_tag LOCUS_18330 31192 28601 CDS product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119311.1 protein_id gnl|my_center|LOCUS_18330 31398 31571 gene locus_tag LOCUS_18340 31398 31571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 >Feature sequence059 447 1265 gene locus_tag LOCUS_18350 447 1265 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928572.1 protein_id gnl|my_center|LOCUS_18350 1967 1290 gene locus_tag LOCUS_18360 1967 1290 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037937.1 protein_id gnl|my_center|LOCUS_18360 4071 2146 gene locus_tag LOCUS_18370 4071 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 4326 5210 gene locus_tag LOCUS_18380 4326 5210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 5277 6713 gene locus_tag LOCUS_18390 5277 6713 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155594933.1 protein_id gnl|my_center|LOCUS_18390 9504 6799 gene locus_tag LOCUS_18400 9504 6799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 10835 9537 gene locus_tag LOCUS_18410 10835 9537 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_18410 11062 12801 gene locus_tag LOCUS_18420 gene metG 11062 12801 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404304.1 protein_id gnl|my_center|LOCUS_18420 12921 15386 gene locus_tag LOCUS_18430 12921 15386 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111257634.1 protein_id gnl|my_center|LOCUS_18430 15431 16213 gene locus_tag LOCUS_18440 15431 16213 CDS product AAC(3) family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976892.1 protein_id gnl|my_center|LOCUS_18440 16306 17475 gene locus_tag LOCUS_18450 16306 17475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 17960 17511 gene locus_tag LOCUS_18460 17960 17511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 18286 19293 gene locus_tag LOCUS_18470 18286 19293 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465709.1 protein_id gnl|my_center|LOCUS_18470 19346 20254 gene locus_tag LOCUS_18480 19346 20254 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791099.1 protein_id gnl|my_center|LOCUS_18480 20285 20713 gene locus_tag LOCUS_18490 20285 20713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 20710 21162 gene locus_tag LOCUS_18500 20710 21162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 22104 21172 gene locus_tag LOCUS_18510 22104 21172 CDS product phosphatidylinositol-specific phospholipase C1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038314.1 protein_id gnl|my_center|LOCUS_18510 22039 22263 gene locus_tag LOCUS_18520 22039 22263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 24009 22435 gene locus_tag LOCUS_18530 24009 22435 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881359.1 protein_id gnl|my_center|LOCUS_18530 24313 25149 gene locus_tag LOCUS_18540 24313 25149 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335559.1 protein_id gnl|my_center|LOCUS_18540 25155 25991 gene locus_tag LOCUS_18550 25155 25991 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082267.1 protein_id gnl|my_center|LOCUS_18550 27851 26016 gene locus_tag LOCUS_18560 gene ilvB 27851 26016 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149674780.1 protein_id gnl|my_center|LOCUS_18560 30005 28089 gene locus_tag LOCUS_18570 30005 28089 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_18570 >Feature sequence060 3352 17 gene locus_tag LOCUS_18580 3352 17 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202204.1 protein_id gnl|my_center|LOCUS_18580 5015 3399 gene locus_tag LOCUS_18590 5015 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 5441 5055 gene locus_tag LOCUS_18600 5441 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 5982 6599 gene locus_tag LOCUS_18610 gene lexA 5982 6599 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_18610 7060 6668 gene locus_tag LOCUS_18620 gene rplL 7060 6668 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393946.1 protein_id gnl|my_center|LOCUS_18620 7632 7099 gene locus_tag LOCUS_18630 gene rplJ 7632 7099 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810195.1 protein_id gnl|my_center|LOCUS_18630 8098 9255 gene locus_tag LOCUS_18640 8098 9255 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942379.1 protein_id gnl|my_center|LOCUS_18640 9351 10244 gene locus_tag LOCUS_18650 9351 10244 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810750.1 protein_id gnl|my_center|LOCUS_18650 10246 11334 gene locus_tag LOCUS_18660 10246 11334 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942377.1 protein_id gnl|my_center|LOCUS_18660 11321 12109 gene locus_tag LOCUS_18670 11321 12109 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064072.1 protein_id gnl|my_center|LOCUS_18670 12084 12803 gene locus_tag LOCUS_18680 12084 12803 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_18680 12800 13984 gene locus_tag LOCUS_18690 12800 13984 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942374.1 protein_id gnl|my_center|LOCUS_18690 14122 15402 gene locus_tag LOCUS_18700 14122 15402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 16811 15435 gene locus_tag LOCUS_18710 16811 15435 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_18710 18169 16808 gene locus_tag LOCUS_18720 18169 16808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 19010 18177 gene locus_tag LOCUS_18730 19010 18177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 21445 19130 gene locus_tag LOCUS_18740 21445 19130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 22842 21619 gene locus_tag LOCUS_18750 22842 21619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 25019 22890 gene locus_tag LOCUS_18760 25019 22890 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229021.1 protein_id gnl|my_center|LOCUS_18760 25676 26551 gene locus_tag LOCUS_18770 25676 26551 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391812.1 protein_id gnl|my_center|LOCUS_18770 26685 27572 gene locus_tag LOCUS_18780 26685 27572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 27679 29655 gene locus_tag LOCUS_18790 27679 29655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 >Feature sequence061 2011 221 gene locus_tag LOCUS_18800 2011 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 2231 4831 gene locus_tag LOCUS_18810 2231 4831 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762897.1 protein_id gnl|my_center|LOCUS_18810 5615 7501 gene locus_tag LOCUS_18820 5615 7501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 8044 7598 gene locus_tag LOCUS_18830 8044 7598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 10521 8086 gene locus_tag LOCUS_18840 10521 8086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 11326 10589 gene locus_tag LOCUS_18850 11326 10589 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930893.1 protein_id gnl|my_center|LOCUS_18850 12264 11326 gene locus_tag LOCUS_18860 12264 11326 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922076.1 protein_id gnl|my_center|LOCUS_18860 12671 14275 gene locus_tag LOCUS_18870 12671 14275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 14350 16995 gene locus_tag LOCUS_18880 14350 16995 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256996.1 protein_id gnl|my_center|LOCUS_18880 17223 18791 gene locus_tag LOCUS_18890 17223 18791 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933195.1 protein_id gnl|my_center|LOCUS_18890 19038 19214 gene locus_tag LOCUS_18900 19038 19214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 19710 20579 gene locus_tag LOCUS_18910 19710 20579 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788160.1 protein_id gnl|my_center|LOCUS_18910 20751 25733 gene locus_tag LOCUS_18920 20751 25733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 25833 27176 gene locus_tag LOCUS_18930 gene rsxC 25833 27176 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_18930 27173 28243 gene locus_tag LOCUS_18940 27173 28243 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428487.1 protein_id gnl|my_center|LOCUS_18940 28240 28956 gene locus_tag LOCUS_18950 28240 28956 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020708.1 protein_id gnl|my_center|LOCUS_18950 >Feature sequence062 2967 604 gene locus_tag LOCUS_18960 gene lon 2967 604 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_18960 3341 2964 gene locus_tag LOCUS_18970 3341 2964 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880818.1 protein_id gnl|my_center|LOCUS_18970 3504 4202 gene locus_tag LOCUS_18980 3504 4202 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895306.1 protein_id gnl|my_center|LOCUS_18980 4574 4873 gene locus_tag LOCUS_18990 4574 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 4981 5835 gene locus_tag LOCUS_19000 4981 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 6146 7618 gene locus_tag LOCUS_19010 6146 7618 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_19010 7625 8335 gene locus_tag LOCUS_19020 gene rph 7625 8335 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632808.1 protein_id gnl|my_center|LOCUS_19020 8328 8954 gene locus_tag LOCUS_19030 8328 8954 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545768.1 protein_id gnl|my_center|LOCUS_19030 8920 9516 gene locus_tag LOCUS_19040 8920 9516 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769752.1 protein_id gnl|my_center|LOCUS_19040 9599 10759 gene locus_tag LOCUS_19050 9599 10759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 10807 11199 gene locus_tag LOCUS_19060 gene rpiB 10807 11199 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_19060 11218 12609 gene locus_tag LOCUS_19070 gene hslU 11218 12609 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_19070 12606 13304 gene locus_tag LOCUS_19080 gene pgeF 12606 13304 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_19080 13566 14021 gene locus_tag LOCUS_19090 13566 14021 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392560.1 protein_id gnl|my_center|LOCUS_19090 14045 15256 gene locus_tag LOCUS_19100 gene nusA 14045 15256 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_19100 15314 18112 gene locus_tag LOCUS_19110 15314 18112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 18150 18431 gene locus_tag LOCUS_19120 18150 18431 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393381.1 protein_id gnl|my_center|LOCUS_19120 18435 18806 gene locus_tag LOCUS_19130 gene rbfA 18435 18806 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460392.1 protein_id gnl|my_center|LOCUS_19130 18793 19773 gene locus_tag LOCUS_19140 18793 19773 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_19140 19770 20663 gene locus_tag LOCUS_19150 gene truB 19770 20663 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392567.1 protein_id gnl|my_center|LOCUS_19150 20656 21636 gene locus_tag LOCUS_19160 gene ribF 20656 21636 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073366.1 protein_id gnl|my_center|LOCUS_19160 21744 23618 gene locus_tag LOCUS_19170 21744 23618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 23635 25419 gene locus_tag LOCUS_19180 23635 25419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 25425 26117 gene locus_tag LOCUS_19190 25425 26117 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121188.1 protein_id gnl|my_center|LOCUS_19190 26101 27450 gene locus_tag LOCUS_19200 26101 27450 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_19200 27533 28741 gene locus_tag LOCUS_19210 27533 28741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 28813 28899 gene locus_tag LOCUS_t00170 28813 28899 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence063 148 11 gene locus_tag LOCUS_19220 148 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19220 343 1305 gene locus_tag LOCUS_19230 343 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 1784 1518 gene locus_tag LOCUS_19240 1784 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 2069 1797 gene locus_tag LOCUS_19250 2069 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 2160 3182 gene locus_tag LOCUS_19260 2160 3182 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_19260 3714 3628 gene locus_tag LOCUS_t00180 3714 3628 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4733 3849 gene locus_tag LOCUS_19270 4733 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 5898 4705 gene locus_tag LOCUS_19280 5898 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 6578 5901 gene locus_tag LOCUS_19290 6578 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 7673 7083 gene locus_tag LOCUS_19300 gene yihA 7673 7083 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229621.1 protein_id gnl|my_center|LOCUS_19300 10015 7670 gene locus_tag LOCUS_19310 gene lon 10015 7670 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460911.1 protein_id gnl|my_center|LOCUS_19310 11428 10217 gene locus_tag LOCUS_19320 gene clpX 11428 10217 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532190.1 protein_id gnl|my_center|LOCUS_19320 12347 11724 gene locus_tag LOCUS_19330 gene clpP 12347 11724 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880859.1 protein_id gnl|my_center|LOCUS_19330 13812 12337 gene locus_tag LOCUS_19340 gene tig 13812 12337 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971784.1 protein_id gnl|my_center|LOCUS_19340 13959 13875 gene locus_tag LOCUS_t00190 13959 13875 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14362 15651 gene locus_tag LOCUS_19350 14362 15651 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938271.1 protein_id gnl|my_center|LOCUS_19350 17843 15717 gene locus_tag LOCUS_19360 17843 15717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 18390 17944 gene locus_tag LOCUS_19370 18390 17944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 21576 20119 gene locus_tag LOCUS_19380 21576 20119 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_19380 21775 22509 gene locus_tag LOCUS_19390 21775 22509 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202917.1 protein_id gnl|my_center|LOCUS_19390 23864 22737 gene locus_tag LOCUS_19400 23864 22737 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_19400 24212 25408 gene locus_tag LOCUS_19410 24212 25408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 25662 26771 gene locus_tag LOCUS_19420 25662 26771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 26812 28704 gene locus_tag LOCUS_19430 gene asnB 26812 28704 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027075.1 protein_id gnl|my_center|LOCUS_19430 >Feature sequence064 719 1609 gene locus_tag LOCUS_19440 719 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 3078 1684 gene locus_tag LOCUS_19450 3078 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 4574 3075 gene locus_tag LOCUS_19460 4574 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 5365 4571 gene locus_tag LOCUS_19470 5365 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 6261 5362 gene locus_tag LOCUS_19480 6261 5362 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259448.1 protein_id gnl|my_center|LOCUS_19480 8022 6295 gene locus_tag LOCUS_19490 gene recJ 8022 6295 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_19490 8696 8019 gene locus_tag LOCUS_19500 gene cmk 8696 8019 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565355.1 protein_id gnl|my_center|LOCUS_19500 10832 8811 gene locus_tag LOCUS_19510 10832 8811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 11904 10843 gene locus_tag LOCUS_19520 gene mtnA 11904 10843 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392224.1 protein_id gnl|my_center|LOCUS_19520 12368 13291 gene locus_tag LOCUS_19530 12368 13291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 13446 14663 gene locus_tag LOCUS_19540 13446 14663 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_19540 14880 15878 gene locus_tag LOCUS_19550 14880 15878 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530151.1 protein_id gnl|my_center|LOCUS_19550 15951 17435 gene locus_tag LOCUS_19560 gene crtI 15951 17435 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066789316.1 protein_id gnl|my_center|LOCUS_19560 17425 18726 gene locus_tag LOCUS_19570 17425 18726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 18129 18228 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18723 20189 gene locus_tag LOCUS_19580 gene crtI 18723 20189 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066789316.1 protein_id gnl|my_center|LOCUS_19580 20200 20955 gene locus_tag LOCUS_19590 20200 20955 CDS product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256123.1 protein_id gnl|my_center|LOCUS_19590 22198 21002 gene locus_tag LOCUS_19600 22198 21002 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816110.1 protein_id gnl|my_center|LOCUS_19600 23397 22237 gene locus_tag LOCUS_19610 23397 22237 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921852.1 protein_id gnl|my_center|LOCUS_19610 24602 23550 gene locus_tag LOCUS_19620 24602 23550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 25000 24656 gene locus_tag LOCUS_19630 25000 24656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 26388 24997 gene locus_tag LOCUS_19640 26388 24997 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257227.1 protein_id gnl|my_center|LOCUS_19640 27542 26385 gene locus_tag LOCUS_19650 gene sat 27542 26385 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141086.1 protein_id gnl|my_center|LOCUS_19650 >Feature sequence065 1784 198 gene locus_tag LOCUS_19660 1784 198 CDS product IS1182-like element ISMac1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020521.1 protein_id gnl|my_center|LOCUS_19660 2344 2123 gene locus_tag LOCUS_19670 2344 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 2821 2624 gene locus_tag LOCUS_19680 2821 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 3933 2827 gene locus_tag LOCUS_19690 3933 2827 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246830.1 protein_id gnl|my_center|LOCUS_19690 5239 4010 gene locus_tag LOCUS_19700 gene nqrF 5239 4010 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337386.1 protein_id gnl|my_center|LOCUS_19700 5907 5284 gene locus_tag LOCUS_19710 gene nqrE 5907 5284 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091182.1 protein_id gnl|my_center|LOCUS_19710 6546 5911 gene locus_tag LOCUS_19720 6546 5911 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002889716.1 protein_id gnl|my_center|LOCUS_19720 7358 6546 gene locus_tag LOCUS_19730 7358 6546 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816934.1 protein_id gnl|my_center|LOCUS_19730 8589 7348 gene locus_tag LOCUS_19740 8589 7348 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109478.1 protein_id gnl|my_center|LOCUS_19740 9968 8589 gene locus_tag LOCUS_19750 9968 8589 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225561.1 protein_id gnl|my_center|LOCUS_19750 12577 10337 gene locus_tag LOCUS_19760 12577 10337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227787.1 protein_id gnl|my_center|LOCUS_19760 13758 12829 gene locus_tag LOCUS_19770 13758 12829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 16009 13772 gene locus_tag LOCUS_19780 16009 13772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 16707 16072 gene locus_tag LOCUS_19790 16707 16072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 17305 16718 gene locus_tag LOCUS_19800 17305 16718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 18217 17534 gene locus_tag LOCUS_19810 18217 17534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937351.1 protein_id gnl|my_center|LOCUS_19810 20370 18214 gene locus_tag LOCUS_19820 20370 18214 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140386.1 protein_id gnl|my_center|LOCUS_19820 21977 20670 gene locus_tag LOCUS_19830 21977 20670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 22591 21977 gene locus_tag LOCUS_19840 22591 21977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 22855 23886 gene locus_tag LOCUS_19850 22855 23886 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_19850 25110 23890 gene locus_tag LOCUS_19860 25110 23890 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584016.1 protein_id gnl|my_center|LOCUS_19860 26606 25185 gene locus_tag LOCUS_19870 26606 25185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 26638 27000 gene locus_tag LOCUS_19880 26638 27000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 >Feature sequence066 1122 433 gene locus_tag LOCUS_19890 1122 433 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813120.1 protein_id gnl|my_center|LOCUS_19890 2420 1146 gene locus_tag LOCUS_19900 2420 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 2672 3892 gene locus_tag LOCUS_19910 2672 3892 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391154.1 protein_id gnl|my_center|LOCUS_19910 5188 3998 gene locus_tag LOCUS_19920 5188 3998 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_19920 6787 5276 gene locus_tag LOCUS_19930 6787 5276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 7315 6830 gene locus_tag LOCUS_19940 7315 6830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 7811 8233 gene locus_tag LOCUS_19950 7811 8233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 8316 8936 gene locus_tag LOCUS_19960 gene mtrR 8316 8936 CDS product multidrug efflux system transcriptional repressor MtrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693763.1 protein_id gnl|my_center|LOCUS_19960 8948 10252 gene locus_tag LOCUS_19970 8948 10252 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967877.1 protein_id gnl|my_center|LOCUS_19970 10257 13403 gene locus_tag LOCUS_19980 10257 13403 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967876.1 protein_id gnl|my_center|LOCUS_19980 13400 15013 gene locus_tag LOCUS_19990 13400 15013 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149366214.1 protein_id gnl|my_center|LOCUS_19990 15115 15324 gene locus_tag LOCUS_20000 15115 15324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 15639 15442 gene locus_tag LOCUS_20010 15639 15442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 17570 15912 gene locus_tag LOCUS_20020 gene groL 17570 15912 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_20020 18545 17916 gene locus_tag LOCUS_20030 18545 17916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 19183 18566 gene locus_tag LOCUS_20040 19183 18566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 19700 19272 gene locus_tag LOCUS_20050 gene queF 19700 19272 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_20050 20388 19690 gene locus_tag LOCUS_20060 20388 19690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 21174 20389 gene locus_tag LOCUS_20070 gene queE 21174 20389 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038131.1 protein_id gnl|my_center|LOCUS_20070 21334 23904 gene locus_tag LOCUS_20080 21334 23904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 24109 25026 gene locus_tag LOCUS_20090 24109 25026 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529475.1 protein_id gnl|my_center|LOCUS_20090 >Feature sequence067 675 43 gene locus_tag LOCUS_20100 675 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 586 867 gene locus_tag LOCUS_20110 586 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 873 1649 gene locus_tag LOCUS_20120 873 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 1767 2102 gene locus_tag LOCUS_20130 1767 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 2285 3595 gene locus_tag LOCUS_20140 2285 3595 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615422.1 protein_id gnl|my_center|LOCUS_20140 3798 4607 gene locus_tag LOCUS_20150 3798 4607 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_20150 5484 4756 gene locus_tag LOCUS_20160 gene pdxJ 5484 4756 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420709.1 protein_id gnl|my_center|LOCUS_20160 6844 5501 gene locus_tag LOCUS_20170 gene glmM 6844 5501 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_20170 7716 6841 gene locus_tag LOCUS_20180 gene folP 7716 6841 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545277.1 protein_id gnl|my_center|LOCUS_20180 9711 7744 gene locus_tag LOCUS_20190 gene ftsH 9711 7744 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_20190 9971 11089 gene locus_tag LOCUS_20200 9971 11089 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_20200 11128 12102 gene locus_tag LOCUS_20210 11128 12102 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140702.1 protein_id gnl|my_center|LOCUS_20210 13116 12181 gene locus_tag LOCUS_20220 13116 12181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 13280 15409 gene locus_tag LOCUS_20230 gene pcrA 13280 15409 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542538.1 protein_id gnl|my_center|LOCUS_20230 15406 16476 gene locus_tag LOCUS_20240 gene pheA 15406 16476 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880586.1 protein_id gnl|my_center|LOCUS_20240 16568 17344 gene locus_tag LOCUS_20250 16568 17344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 17468 18484 gene locus_tag LOCUS_20260 17468 18484 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974270.1 protein_id gnl|my_center|LOCUS_20260 18868 18500 gene locus_tag LOCUS_20270 18868 18500 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679605.1 protein_id gnl|my_center|LOCUS_20270 19237 20232 gene locus_tag LOCUS_20280 19237 20232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 20401 22026 gene locus_tag LOCUS_20290 gene gpmI 20401 22026 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_20290 23583 22078 gene locus_tag LOCUS_20300 gene gguA 23583 22078 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992366.1 protein_id gnl|my_center|LOCUS_20300 23795 25843 gene locus_tag LOCUS_20310 23795 25843 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941556.1 protein_id gnl|my_center|LOCUS_20310 <26530 25801 gene locus_tag LOCUS_20320 <26530 25801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261837.1:iron ABC transporter permease >Feature sequence068 335 1597 gene locus_tag LOCUS_20330 335 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 1866 2492 gene locus_tag LOCUS_20340 1866 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 2494 3090 gene locus_tag LOCUS_20350 2494 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 4196 3336 gene locus_tag LOCUS_20360 gene sucD 4196 3336 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025451.1 protein_id gnl|my_center|LOCUS_20360 5338 4193 gene locus_tag LOCUS_20370 gene sucC 5338 4193 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257007.1 protein_id gnl|my_center|LOCUS_20370 5768 6400 gene locus_tag LOCUS_20380 5768 6400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 6400 6930 gene locus_tag LOCUS_20390 6400 6930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 6930 7487 gene locus_tag LOCUS_20400 6930 7487 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_20400 7609 8442 gene locus_tag LOCUS_20410 7609 8442 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_20410 9482 8538 gene locus_tag LOCUS_20420 9482 8538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 9940 10095 gene locus_tag LOCUS_20430 9940 10095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 10172 13051 gene locus_tag LOCUS_20440 10172 13051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 13280 14389 gene locus_tag LOCUS_20450 gene dgoD 13280 14389 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_20450 14452 16890 gene locus_tag LOCUS_20460 14452 16890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 15766 15865 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18214 16925 gene locus_tag LOCUS_20470 18214 16925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 18206 18859 gene locus_tag LOCUS_20480 18206 18859 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 protein_id gnl|my_center|LOCUS_20480 18939 20684 gene locus_tag LOCUS_20490 18939 20684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 22016 20688 gene locus_tag LOCUS_20500 22016 20688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 23383 22106 gene locus_tag LOCUS_20510 23383 22106 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258147.1 protein_id gnl|my_center|LOCUS_20510 23601 24305 gene locus_tag LOCUS_20520 23601 24305 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867690.1 protein_id gnl|my_center|LOCUS_20520 24306 25379 gene locus_tag LOCUS_20530 24306 25379 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218916593.1 protein_id gnl|my_center|LOCUS_20530 25376 26116 gene locus_tag LOCUS_20540 25376 26116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 >Feature sequence069 458 1561 gene locus_tag LOCUS_20550 458 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 1569 3995 gene locus_tag LOCUS_20560 1569 3995 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294690.1 protein_id gnl|my_center|LOCUS_20560 5917 4985 gene locus_tag LOCUS_20570 5917 4985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 6229 7854 gene locus_tag LOCUS_20580 6229 7854 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143151.1 protein_id gnl|my_center|LOCUS_20580 8373 7891 gene locus_tag LOCUS_20590 8373 7891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 8483 10837 gene locus_tag LOCUS_20600 8483 10837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 12310 10838 gene locus_tag LOCUS_20610 12310 10838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 12450 13286 gene locus_tag LOCUS_20620 12450 13286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 13283 13882 gene locus_tag LOCUS_20630 13283 13882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 15302 14385 gene locus_tag LOCUS_20640 15302 14385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 15421 15299 gene locus_tag LOCUS_20650 15421 15299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 15831 15418 gene locus_tag LOCUS_20660 15831 15418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 16106 15843 gene locus_tag LOCUS_20670 16106 15843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 18052 16103 gene locus_tag LOCUS_20680 18052 16103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 19055 18114 gene locus_tag LOCUS_20690 19055 18114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 19487 19074 gene locus_tag LOCUS_20700 19487 19074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 19930 19505 gene locus_tag LOCUS_20710 19930 19505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 20469 19927 gene locus_tag LOCUS_20720 20469 19927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 21216 22004 gene locus_tag LOCUS_20730 21216 22004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 23917 22154 gene locus_tag LOCUS_20740 23917 22154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 >Feature sequence070 854 1009 gene locus_tag LOCUS_20750 854 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 1499 2833 gene locus_tag LOCUS_20760 1499 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 4499 2997 gene locus_tag LOCUS_20770 4499 2997 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085833.1 protein_id gnl|my_center|LOCUS_20770 5838 4501 gene locus_tag LOCUS_20780 5838 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 6682 7968 gene locus_tag LOCUS_20790 6682 7968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 6722 6821 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9193 8174 gene locus_tag LOCUS_20800 9193 8174 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767200.1 protein_id gnl|my_center|LOCUS_20800 10155 9295 gene locus_tag LOCUS_20810 10155 9295 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_20810 10517 10170 gene locus_tag LOCUS_20820 10517 10170 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552785.1 protein_id gnl|my_center|LOCUS_20820 11395 10667 gene locus_tag LOCUS_20830 11395 10667 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038010.1 protein_id gnl|my_center|LOCUS_20830 11630 12457 gene locus_tag LOCUS_20840 11630 12457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 12535 14757 gene locus_tag LOCUS_20850 12535 14757 CDS product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421589.1 protein_id gnl|my_center|LOCUS_20850 14754 15782 gene locus_tag LOCUS_20860 14754 15782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 15842 16915 gene locus_tag LOCUS_20870 15842 16915 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144046.1 protein_id gnl|my_center|LOCUS_20870 17768 16965 gene locus_tag LOCUS_20880 gene thiD 17768 16965 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392386.1 protein_id gnl|my_center|LOCUS_20880 18960 17761 gene locus_tag LOCUS_20890 18960 17761 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356704.1 protein_id gnl|my_center|LOCUS_20890 19294 19109 gene locus_tag LOCUS_20900 19294 19109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 19424 20326 gene locus_tag LOCUS_20910 19424 20326 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225423.1 protein_id gnl|my_center|LOCUS_20910 21323 20424 gene locus_tag LOCUS_20920 21323 20424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 21519 25046 gene locus_tag LOCUS_20930 21519 25046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 >Feature sequence071 <1 557 gene locus_tag LOCUS_20940 <1 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011102223.1:sodium:solute symporter 591 1700 gene locus_tag LOCUS_20950 591 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 1905 2216 gene locus_tag LOCUS_20960 1905 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 2219 4270 gene locus_tag LOCUS_20970 2219 4270 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583858.1 protein_id gnl|my_center|LOCUS_20970 4382 4885 gene locus_tag LOCUS_20980 4382 4885 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583857.1 protein_id gnl|my_center|LOCUS_20980 4936 5550 gene locus_tag LOCUS_20990 4936 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 5547 6539 gene locus_tag LOCUS_21000 5547 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 6532 6852 gene locus_tag LOCUS_21010 6532 6852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 6903 8660 gene locus_tag LOCUS_21020 6903 8660 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033047490.1 protein_id gnl|my_center|LOCUS_21020 8710 10086 gene locus_tag LOCUS_21030 8710 10086 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869607.1 protein_id gnl|my_center|LOCUS_21030 10130 10759 gene locus_tag LOCUS_21040 10130 10759 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015799.1 protein_id gnl|my_center|LOCUS_21040 12855 10999 gene locus_tag LOCUS_21050 12855 10999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 14775 13048 gene locus_tag LOCUS_21060 14775 13048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 15045 14791 gene locus_tag LOCUS_21070 15045 14791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 15872 15123 gene locus_tag LOCUS_21080 15872 15123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 17965 15869 gene locus_tag LOCUS_21090 17965 15869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 20825 18240 gene locus_tag LOCUS_21100 20825 18240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 22076 21039 gene locus_tag LOCUS_21110 22076 21039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 23303 22128 gene locus_tag LOCUS_21120 23303 22128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 <25091 23358 gene locus_tag LOCUS_21130 <25091 23358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929927.1:alpha-L-fucosidase >Feature sequence072 507 3350 gene locus_tag LOCUS_21140 507 3350 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338417.1 protein_id gnl|my_center|LOCUS_21140 3413 4621 gene locus_tag LOCUS_21150 gene odhB 3413 4621 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227835.1 protein_id gnl|my_center|LOCUS_21150 4685 6073 gene locus_tag LOCUS_21160 gene lpdA 4685 6073 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227834.1 protein_id gnl|my_center|LOCUS_21160 7745 6129 gene locus_tag LOCUS_21170 7745 6129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 9963 7765 gene locus_tag LOCUS_21180 9963 7765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 12124 9998 gene locus_tag LOCUS_21190 12124 9998 CDS product DUF5696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390300.1 protein_id gnl|my_center|LOCUS_21190 12352 14163 gene locus_tag LOCUS_21200 gene pepF 12352 14163 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122658.1 protein_id gnl|my_center|LOCUS_21200 15795 14371 gene locus_tag LOCUS_21210 15795 14371 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764741.1 protein_id gnl|my_center|LOCUS_21210 16916 15942 gene locus_tag LOCUS_21220 16916 15942 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584156.1 protein_id gnl|my_center|LOCUS_21220 18442 17102 gene locus_tag LOCUS_21230 18442 17102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 18765 19931 gene locus_tag LOCUS_21240 18765 19931 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173181.1 protein_id gnl|my_center|LOCUS_21240 19928 21016 gene locus_tag LOCUS_21250 gene lptG 19928 21016 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870030.1 protein_id gnl|my_center|LOCUS_21250 22462 21053 gene locus_tag LOCUS_21260 22462 21053 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921601.1 protein_id gnl|my_center|LOCUS_21260 22698 24206 gene locus_tag LOCUS_21270 22698 24206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 24850 24254 gene locus_tag LOCUS_21280 24850 24254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 >Feature sequence073 461 1693 gene locus_tag LOCUS_21290 461 1693 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_21290 1717 3321 gene locus_tag LOCUS_21300 gene cimA 1717 3321 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583555.1 protein_id gnl|my_center|LOCUS_21300 3496 4398 gene locus_tag LOCUS_21310 3496 4398 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119250.1 protein_id gnl|my_center|LOCUS_21310 4450 5742 gene locus_tag LOCUS_21320 4450 5742 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921601.1 protein_id gnl|my_center|LOCUS_21320 6826 5771 gene locus_tag LOCUS_21330 6826 5771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 7322 6867 gene locus_tag LOCUS_21340 7322 6867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 7610 8416 gene locus_tag LOCUS_21350 gene cysE 7610 8416 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704210.1 protein_id gnl|my_center|LOCUS_21350 8532 10076 gene locus_tag LOCUS_21360 8532 10076 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121087.1 protein_id gnl|my_center|LOCUS_21360 10650 9979 gene locus_tag LOCUS_21370 10650 9979 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941823.1 protein_id gnl|my_center|LOCUS_21370 11849 10665 gene locus_tag LOCUS_21380 11849 10665 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816839.1 protein_id gnl|my_center|LOCUS_21380 12889 11846 gene locus_tag LOCUS_21390 12889 11846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 13563 12886 gene locus_tag LOCUS_21400 13563 12886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 14019 13567 gene locus_tag LOCUS_21410 14019 13567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 14590 14027 gene locus_tag LOCUS_21420 14590 14027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 14562 14906 gene locus_tag LOCUS_21430 14562 14906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 15012 16424 gene locus_tag LOCUS_21440 15012 16424 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958607.1 protein_id gnl|my_center|LOCUS_21440 15056 15155 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16430 17050 gene locus_tag LOCUS_21450 16430 17050 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142953.1 protein_id gnl|my_center|LOCUS_21450 17210 17135 gene locus_tag LOCUS_t00200 17210 17135 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 17492 18457 gene locus_tag LOCUS_21460 17492 18457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 18496 19299 gene locus_tag LOCUS_21470 18496 19299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 19454 20293 gene locus_tag LOCUS_21480 19454 20293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 20335 20496 gene locus_tag LOCUS_21490 20335 20496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 20681 22702 gene locus_tag LOCUS_21500 gene ppiD 20681 22702 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482527.1 protein_id gnl|my_center|LOCUS_21500 22777 23910 gene locus_tag LOCUS_21510 22777 23910 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942893.1 protein_id gnl|my_center|LOCUS_21510 24042 24794 gene locus_tag LOCUS_21520 24042 24794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 >Feature sequence074 80 3 gene locus_tag LOCUS_t00210 80 3 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 269 2554 gene locus_tag LOCUS_21530 269 2554 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681492.1 protein_id gnl|my_center|LOCUS_21530 3998 2583 gene locus_tag LOCUS_21540 3998 2583 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_21540 4308 6992 gene locus_tag LOCUS_21550 4308 6992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 7292 8311 gene locus_tag LOCUS_21560 7292 8311 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046800989.1 protein_id gnl|my_center|LOCUS_21560 9677 8319 gene locus_tag LOCUS_21570 9677 8319 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118279.1 protein_id gnl|my_center|LOCUS_21570 9918 10763 gene locus_tag LOCUS_21580 9918 10763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 12804 10918 gene locus_tag LOCUS_21590 12804 10918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 11115 11214 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12900 13943 gene locus_tag LOCUS_21600 12900 13943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 13991 14602 gene locus_tag LOCUS_21610 gene ruvA 13991 14602 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707372.1 protein_id gnl|my_center|LOCUS_21610 14661 15686 gene locus_tag LOCUS_21620 gene ruvB 14661 15686 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_21620 16096 16443 gene locus_tag LOCUS_21630 16096 16443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 16609 17979 gene locus_tag LOCUS_21640 gene zraR 16609 17979 CDS product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368806.1 protein_id gnl|my_center|LOCUS_21640 19597 17999 gene locus_tag LOCUS_21650 19597 17999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 21233 19641 gene locus_tag LOCUS_21660 21233 19641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 21885 22202 gene locus_tag LOCUS_21670 21885 22202 CDS product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641840.1 protein_id gnl|my_center|LOCUS_21670 22195 23088 gene locus_tag LOCUS_21680 22195 23088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 23992 23093 gene locus_tag LOCUS_21690 23992 23093 CDS product WG repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358861.1 protein_id gnl|my_center|LOCUS_21690 >Feature sequence075 267 1022 gene locus_tag LOCUS_21700 267 1022 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_21700 1019 3499 gene locus_tag LOCUS_21710 1019 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259586.1 protein_id gnl|my_center|LOCUS_21710 4079 3492 gene locus_tag LOCUS_21720 4079 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 5117 4092 gene locus_tag LOCUS_21730 5117 4092 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908976.1 protein_id gnl|my_center|LOCUS_21730 5969 5121 gene locus_tag LOCUS_21740 5969 5121 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390659.1 protein_id gnl|my_center|LOCUS_21740 6766 5966 gene locus_tag LOCUS_21750 6766 5966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 7079 6780 gene locus_tag LOCUS_21760 7079 6780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 7612 7106 gene locus_tag LOCUS_21770 7612 7106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 9327 7639 gene locus_tag LOCUS_21780 9327 7639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 10555 9527 gene locus_tag LOCUS_21790 10555 9527 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031011.1 protein_id gnl|my_center|LOCUS_21790 12827 10731 gene locus_tag LOCUS_21800 12827 10731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 14116 12839 gene locus_tag LOCUS_21810 14116 12839 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_21810 14576 14250 gene locus_tag LOCUS_21820 14576 14250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 14488 15240 gene locus_tag LOCUS_21830 14488 15240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 15299 16051 gene locus_tag LOCUS_21840 15299 16051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 16197 17306 gene locus_tag LOCUS_21850 gene ugpC 16197 17306 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_21850 17491 18474 gene locus_tag LOCUS_21860 gene galE 17491 18474 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706835.1 protein_id gnl|my_center|LOCUS_21860 19605 18556 gene locus_tag LOCUS_21870 19605 18556 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902145.1 protein_id gnl|my_center|LOCUS_21870 19797 20630 gene locus_tag LOCUS_21880 gene nadC 19797 20630 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067615902.1 protein_id gnl|my_center|LOCUS_21880 20641 21378 gene locus_tag LOCUS_21890 20641 21378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 21366 22142 gene locus_tag LOCUS_21900 21366 22142 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_21900 22139 22720 gene locus_tag LOCUS_21910 22139 22720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 22717 23598 gene locus_tag LOCUS_21920 22717 23598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 >Feature sequence076 1598 423 gene locus_tag LOCUS_21930 1598 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 1881 1705 gene locus_tag LOCUS_21940 1881 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 1950 2999 gene locus_tag LOCUS_21950 1950 2999 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392195.1 protein_id gnl|my_center|LOCUS_21950 2996 4105 gene locus_tag LOCUS_21960 gene wecB 2996 4105 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211986.1 protein_id gnl|my_center|LOCUS_21960 4159 5379 gene locus_tag LOCUS_21970 4159 5379 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259615.1 protein_id gnl|my_center|LOCUS_21970 5376 6434 gene locus_tag LOCUS_21980 5376 6434 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378318.1 protein_id gnl|my_center|LOCUS_21980 6463 7377 gene locus_tag LOCUS_21990 6463 7377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256034.1 protein_id gnl|my_center|LOCUS_21990 7814 9397 gene locus_tag LOCUS_22000 7814 9397 CDS product PhoPQ-activated protein PqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817293.1 protein_id gnl|my_center|LOCUS_22000 10055 9525 gene locus_tag LOCUS_22010 10055 9525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 10330 11265 gene locus_tag LOCUS_22020 10330 11265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 11502 12863 gene locus_tag LOCUS_22030 11502 12863 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144234.1 protein_id gnl|my_center|LOCUS_22030 12999 14591 gene locus_tag LOCUS_22040 12999 14591 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098467.1 protein_id gnl|my_center|LOCUS_22040 14651 16273 gene locus_tag LOCUS_22050 14651 16273 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258554.1 protein_id gnl|my_center|LOCUS_22050 16874 16284 gene locus_tag LOCUS_22060 16874 16284 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404046.1 protein_id gnl|my_center|LOCUS_22060 17649 16885 gene locus_tag LOCUS_22070 17649 16885 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679455.1 protein_id gnl|my_center|LOCUS_22070 17837 18472 gene locus_tag LOCUS_22080 17837 18472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 18519 19340 gene locus_tag LOCUS_22090 gene amrB 18519 19340 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 protein_id gnl|my_center|LOCUS_22090 19791 19345 gene locus_tag LOCUS_22100 19791 19345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 20188 21288 gene locus_tag LOCUS_22110 20188 21288 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392163.1 protein_id gnl|my_center|LOCUS_22110 21285 22766 gene locus_tag LOCUS_22120 gene glgA 21285 22766 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393434.1 protein_id gnl|my_center|LOCUS_22120 22763 23242 gene locus_tag LOCUS_22130 gene tsaE 22763 23242 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044854.1 protein_id gnl|my_center|LOCUS_22130 <23892 23263 gene locus_tag LOCUS_22140 <23892 23263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003891355.1:Stk1 family PASTA domain-containing Ser/Thr kinase >Feature sequence077 2228 132 gene locus_tag LOCUS_22150 gene fusA 2228 132 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_22150 2994 2521 gene locus_tag LOCUS_22160 gene rpsG 2994 2521 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306266.1 protein_id gnl|my_center|LOCUS_22160 3521 3099 gene locus_tag LOCUS_22170 gene rpsL 3521 3099 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081846.1 protein_id gnl|my_center|LOCUS_22170 7828 3698 gene locus_tag LOCUS_22180 gene rpoC 7828 3698 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_22180 11695 7832 gene locus_tag LOCUS_22190 gene rpoB 11695 7832 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882731.1 protein_id gnl|my_center|LOCUS_22190 12555 12355 gene locus_tag LOCUS_22200 12555 12355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 12467 13339 gene locus_tag LOCUS_22210 12467 13339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 14492 13404 gene locus_tag LOCUS_22220 14492 13404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 15956 14517 gene locus_tag LOCUS_22230 gene lpdA 15956 14517 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118277.1 protein_id gnl|my_center|LOCUS_22230 17483 16002 gene locus_tag LOCUS_22240 17483 16002 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974440.1 protein_id gnl|my_center|LOCUS_22240 18119 17562 gene locus_tag LOCUS_22250 18119 17562 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_22250 19512 18124 gene locus_tag LOCUS_22260 19512 18124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 22270 19589 gene locus_tag LOCUS_22270 gene aceE 22270 19589 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119356.1 protein_id gnl|my_center|LOCUS_22270 22592 23545 gene locus_tag LOCUS_22280 22592 23545 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461587.1 protein_id gnl|my_center|LOCUS_22280 >Feature sequence078 525 1172 gene locus_tag LOCUS_22290 525 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 1277 2581 gene locus_tag LOCUS_22300 1277 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 2609 3811 gene locus_tag LOCUS_22310 2609 3811 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462130.1 protein_id gnl|my_center|LOCUS_22310 3979 4656 gene locus_tag LOCUS_22320 3979 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 4666 5760 gene locus_tag LOCUS_22330 4666 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 5757 8939 gene locus_tag LOCUS_22340 gene vmeK 5757 8939 CDS product multidrug efflux RND transporter permease subunit VmeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479069.1 protein_id gnl|my_center|LOCUS_22340 8941 10428 gene locus_tag LOCUS_22350 8941 10428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 10522 12930 gene locus_tag LOCUS_22360 10522 12930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 15342 12982 gene locus_tag LOCUS_22370 15342 12982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 16414 15389 gene locus_tag LOCUS_22380 16414 15389 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833582.1 protein_id gnl|my_center|LOCUS_22380 17284 16742 gene locus_tag LOCUS_22390 17284 16742 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937895.1 protein_id gnl|my_center|LOCUS_22390 19586 17766 gene locus_tag LOCUS_22400 19586 17766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 20320 19676 gene locus_tag LOCUS_22410 20320 19676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 20583 21014 gene locus_tag LOCUS_22420 20583 21014 CDS product BLUF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055933.1 protein_id gnl|my_center|LOCUS_22420 23189 21087 gene locus_tag LOCUS_22430 23189 21087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 >Feature sequence079 1214 2554 gene locus_tag LOCUS_22440 1214 2554 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_22440 3460 2645 gene locus_tag LOCUS_22450 3460 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 4784 3942 gene locus_tag LOCUS_22460 4784 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 4976 5215 gene locus_tag LOCUS_22470 4976 5215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 7914 5269 gene locus_tag LOCUS_22480 7914 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 9253 8072 gene locus_tag LOCUS_22490 9253 8072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 12117 9277 gene locus_tag LOCUS_22500 12117 9277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 12928 12188 gene locus_tag LOCUS_22510 12928 12188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 14443 13208 gene locus_tag LOCUS_22520 14443 13208 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_22520 14519 14749 gene locus_tag LOCUS_22530 14519 14749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 18510 15346 gene locus_tag LOCUS_22540 18510 15346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 19663 18524 gene locus_tag LOCUS_22550 19663 18524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 20123 21529 gene locus_tag LOCUS_22560 20123 21529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 21830 22891 gene locus_tag LOCUS_22570 21830 22891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 >Feature sequence080 2486 855 gene locus_tag LOCUS_22580 2486 855 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108495.1 protein_id gnl|my_center|LOCUS_22580 3181 4218 gene locus_tag LOCUS_22590 3181 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 4356 6764 gene locus_tag LOCUS_22600 4356 6764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 6884 9673 gene locus_tag LOCUS_22610 6884 9673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 9837 12989 gene locus_tag LOCUS_22620 9837 12989 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027462.1 protein_id gnl|my_center|LOCUS_22620 13052 15487 gene locus_tag LOCUS_22630 13052 15487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 15778 15581 gene locus_tag LOCUS_22640 15778 15581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 15717 16988 gene locus_tag LOCUS_22650 15717 16988 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_22650 17181 18221 gene locus_tag LOCUS_22660 17181 18221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 20893 18632 gene locus_tag LOCUS_22670 20893 18632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 22828 21257 gene locus_tag LOCUS_22680 22828 21257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 23075 23000 gene locus_tag LOCUS_t00220 23075 23000 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence081 2 157 gene locus_tag LOCUS_22690 2 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 281 1204 gene locus_tag LOCUS_22700 281 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 2486 1218 gene locus_tag LOCUS_22710 gene mrfB 2486 1218 CDS product metal-dependent exonucleaseMrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398813.1 protein_id gnl|my_center|LOCUS_22710 4799 2490 gene locus_tag LOCUS_22720 gene mrfA 4799 2490 CDS product ATP-dependent helicase MrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246149.1 protein_id gnl|my_center|LOCUS_22720 6890 5382 gene locus_tag LOCUS_22730 6890 5382 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_22730 8236 6887 gene locus_tag LOCUS_22740 gene trkA 8236 6887 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878341.1 protein_id gnl|my_center|LOCUS_22740 9458 8358 gene locus_tag LOCUS_22750 9458 8358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 10702 9455 gene locus_tag LOCUS_22760 10702 9455 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868912.1 protein_id gnl|my_center|LOCUS_22760 11060 11137 gene locus_tag LOCUS_t00230 11060 11137 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 11541 12143 gene locus_tag LOCUS_22770 gene sigR 11541 12143 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_22770 12312 13754 gene locus_tag LOCUS_22780 12312 13754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 13745 14248 gene locus_tag LOCUS_22790 13745 14248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 14262 14546 gene locus_tag LOCUS_22800 14262 14546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 14670 16043 gene locus_tag LOCUS_22810 14670 16043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 16040 18070 gene locus_tag LOCUS_22820 16040 18070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 19557 18079 gene locus_tag LOCUS_22830 19557 18079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 21178 19547 gene locus_tag LOCUS_22840 21178 19547 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942540.1 protein_id gnl|my_center|LOCUS_22840 21950 21171 gene locus_tag LOCUS_22850 gene kdsB 21950 21171 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_22850 >Feature sequence082 546 1772 gene locus_tag LOCUS_22860 546 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 1802 2959 gene locus_tag LOCUS_22870 1802 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 3007 4470 gene locus_tag LOCUS_22880 3007 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 4639 4548 gene locus_tag LOCUS_t00240 4639 4548 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8191 4811 gene locus_tag LOCUS_22890 8191 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 8768 10549 gene locus_tag LOCUS_22900 gene aspS 8768 10549 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932992.1 protein_id gnl|my_center|LOCUS_22900 10915 11625 gene locus_tag LOCUS_22910 10915 11625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 11628 11915 gene locus_tag LOCUS_22920 11628 11915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 11897 14203 gene locus_tag LOCUS_22930 11897 14203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 14432 14785 gene locus_tag LOCUS_22940 14432 14785 CDS product peptide chain release factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039645979.1 protein_id gnl|my_center|LOCUS_22940 14805 15533 gene locus_tag LOCUS_22950 gene rlmB 14805 15533 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174056.1 protein_id gnl|my_center|LOCUS_22950 15976 15545 gene locus_tag LOCUS_22960 15976 15545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 18190 16118 gene locus_tag LOCUS_22970 18190 16118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 18496 19719 gene locus_tag LOCUS_22980 18496 19719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 21982 19748 gene locus_tag LOCUS_22990 21982 19748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 >Feature sequence083 511 98 gene locus_tag LOCUS_23000 511 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 1917 952 gene locus_tag LOCUS_23010 1917 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 3609 2623 gene locus_tag LOCUS_23020 3609 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 4065 5144 gene locus_tag LOCUS_23030 gene ccpA 4065 5144 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103297.1 protein_id gnl|my_center|LOCUS_23030 5563 6612 gene locus_tag LOCUS_23040 5563 6612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 7658 6807 gene locus_tag LOCUS_23050 7658 6807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 9184 7793 gene locus_tag LOCUS_23060 9184 7793 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_23060 9397 11571 gene locus_tag LOCUS_23070 9397 11571 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211634420.1 protein_id gnl|my_center|LOCUS_23070 13746 11668 gene locus_tag LOCUS_23080 13746 11668 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_23080 14587 13856 gene locus_tag LOCUS_23090 gene rnc 14587 13856 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973423.1 protein_id gnl|my_center|LOCUS_23090 15803 14580 gene locus_tag LOCUS_23100 gene fabF 15803 14580 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706107.1 protein_id gnl|my_center|LOCUS_23100 16157 15912 gene locus_tag LOCUS_23110 16157 15912 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004615098.1 protein_id gnl|my_center|LOCUS_23110 17576 16341 gene locus_tag LOCUS_23120 17576 16341 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583303.1 protein_id gnl|my_center|LOCUS_23120 19240 17684 gene locus_tag LOCUS_23130 19240 17684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 21580 19277 gene locus_tag LOCUS_23140 21580 19277 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037536.1 protein_id gnl|my_center|LOCUS_23140 >Feature sequence084 1007 396 gene locus_tag LOCUS_23150 1007 396 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765411.1 protein_id gnl|my_center|LOCUS_23150 3867 1114 gene locus_tag LOCUS_23160 3867 1114 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928482.1 protein_id gnl|my_center|LOCUS_23160 4841 4065 gene locus_tag LOCUS_23170 4841 4065 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943172.1 protein_id gnl|my_center|LOCUS_23170 5153 7795 gene locus_tag LOCUS_23180 5153 7795 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223297.1 protein_id gnl|my_center|LOCUS_23180 7825 8718 gene locus_tag LOCUS_23190 7825 8718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 8995 11679 gene locus_tag LOCUS_23200 8995 11679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 12093 15251 gene locus_tag LOCUS_23210 12093 15251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 16822 15269 gene locus_tag LOCUS_23220 16822 15269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 18565 16832 gene locus_tag LOCUS_23230 18565 16832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 18453 18755 gene locus_tag LOCUS_23240 18453 18755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 18945 19529 gene locus_tag LOCUS_23250 gene sodB 18945 19529 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357051.1 protein_id gnl|my_center|LOCUS_23250 19658 20419 gene locus_tag LOCUS_23260 19658 20419 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202330.1 protein_id gnl|my_center|LOCUS_23260 >Feature sequence085 1400 459 gene locus_tag LOCUS_23270 1400 459 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582840.1 protein_id gnl|my_center|LOCUS_23270 4671 1564 gene locus_tag LOCUS_23280 4671 1564 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868786.1 protein_id gnl|my_center|LOCUS_23280 5986 4823 gene locus_tag LOCUS_23290 5986 4823 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868787.1 protein_id gnl|my_center|LOCUS_23290 7370 5988 gene locus_tag LOCUS_23300 7370 5988 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626657.1 protein_id gnl|my_center|LOCUS_23300 7804 7385 gene locus_tag LOCUS_23310 7804 7385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 8049 10163 gene locus_tag LOCUS_23320 8049 10163 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206290416.1 protein_id gnl|my_center|LOCUS_23320 10947 10450 gene locus_tag LOCUS_23330 10947 10450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 11309 11905 gene locus_tag LOCUS_23340 11309 11905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 12042 13004 gene locus_tag LOCUS_23350 gene rfaD 12042 13004 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546025.1 protein_id gnl|my_center|LOCUS_23350 13015 13857 gene locus_tag LOCUS_23360 gene kdsA 13015 13857 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_23360 13871 14323 gene locus_tag LOCUS_23370 13871 14323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 14326 14847 gene locus_tag LOCUS_23380 14326 14847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 14913 15656 gene locus_tag LOCUS_23390 gene lptB 14913 15656 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077984407.1 protein_id gnl|my_center|LOCUS_23390 15707 16045 gene locus_tag LOCUS_23400 15707 16045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 16108 17061 gene locus_tag LOCUS_23410 gene hprK 16108 17061 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062490.1 protein_id gnl|my_center|LOCUS_23410 17065 17370 gene locus_tag LOCUS_23420 17065 17370 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668605.1 protein_id gnl|my_center|LOCUS_23420 17385 19154 gene locus_tag LOCUS_23430 gene ptsP 17385 19154 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152804487.1 protein_id gnl|my_center|LOCUS_23430 19206 20399 gene locus_tag LOCUS_23440 gene metK 19206 20399 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_23440 >Feature sequence086 4592 924 gene locus_tag LOCUS_23450 4592 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 5198 4614 gene locus_tag LOCUS_23460 5198 4614 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328727.1 protein_id gnl|my_center|LOCUS_23460 7000 5396 gene locus_tag LOCUS_23470 7000 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 8364 6997 gene locus_tag LOCUS_23480 8364 6997 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_23480 10919 8361 gene locus_tag LOCUS_23490 10919 8361 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941031.1 protein_id gnl|my_center|LOCUS_23490 11904 11134 gene locus_tag LOCUS_23500 11904 11134 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980652.1 protein_id gnl|my_center|LOCUS_23500 13691 11934 gene locus_tag LOCUS_23510 gene sir 13691 11934 CDS product sulfite reductase, ferredoxin dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920675.1 protein_id gnl|my_center|LOCUS_23510 14452 13874 gene locus_tag LOCUS_23520 gene folE 14452 13874 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216616.1 protein_id gnl|my_center|LOCUS_23520 14966 14445 gene locus_tag LOCUS_23530 gene folK 14966 14445 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771454.1 protein_id gnl|my_center|LOCUS_23530 15341 14973 gene locus_tag LOCUS_23540 gene folX 15341 14973 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091897.1 protein_id gnl|my_center|LOCUS_23540 16083 15334 gene locus_tag LOCUS_23550 16083 15334 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379796.1 protein_id gnl|my_center|LOCUS_23550 17567 16182 gene locus_tag LOCUS_23560 17567 16182 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263817.1 protein_id gnl|my_center|LOCUS_23560 18489 17572 gene locus_tag LOCUS_23570 18489 17572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 20620 18566 gene locus_tag LOCUS_23580 20620 18566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 >Feature sequence087 228 1208 gene locus_tag LOCUS_23590 228 1208 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583128.1 protein_id gnl|my_center|LOCUS_23590 1440 4421 gene locus_tag LOCUS_23600 gene glnE 1440 4421 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943989.1 protein_id gnl|my_center|LOCUS_23600 4450 5751 gene locus_tag LOCUS_23610 4450 5751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 5822 7228 gene locus_tag LOCUS_23620 gene hydG 5822 7228 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939053.1 protein_id gnl|my_center|LOCUS_23620 7388 7648 gene locus_tag LOCUS_23630 7388 7648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986424.1 protein_id gnl|my_center|LOCUS_23630 8778 7669 gene locus_tag LOCUS_23640 gene rhaT 8778 7669 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762702.1 protein_id gnl|my_center|LOCUS_23640 10099 8822 gene locus_tag LOCUS_23650 10099 8822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 10468 11295 gene locus_tag LOCUS_23660 10468 11295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 11984 11322 gene locus_tag LOCUS_23670 11984 11322 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021775.1 protein_id gnl|my_center|LOCUS_23670 12808 12131 gene locus_tag LOCUS_23680 12808 12131 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615797.1 protein_id gnl|my_center|LOCUS_23680 13929 12844 gene locus_tag LOCUS_23690 gene hydE 13929 12844 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393236.1 protein_id gnl|my_center|LOCUS_23690 15240 13951 gene locus_tag LOCUS_23700 gene hydF 15240 13951 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939056.1 protein_id gnl|my_center|LOCUS_23700 15684 15400 gene locus_tag LOCUS_23710 15684 15400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 15835 15972 gene locus_tag LOCUS_23720 15835 15972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 17487 16045 gene locus_tag LOCUS_23730 17487 16045 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261223.1 protein_id gnl|my_center|LOCUS_23730 18177 17596 gene locus_tag LOCUS_23740 18177 17596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 19178 18177 gene locus_tag LOCUS_23750 19178 18177 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947761.1 protein_id gnl|my_center|LOCUS_23750 19978 19190 gene locus_tag LOCUS_23760 19978 19190 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390659.1 protein_id gnl|my_center|LOCUS_23760 21053 19968 gene locus_tag LOCUS_23770 21053 19968 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003620.1 protein_id gnl|my_center|LOCUS_23770 >Feature sequence088 198 3416 gene locus_tag LOCUS_23780 198 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 3919 3494 gene locus_tag LOCUS_23790 3919 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 5476 3947 gene locus_tag LOCUS_23800 gene lcfB 5476 3947 CDS product long-chain-fatty-acid--CoA ligase LcfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244686.1 protein_id gnl|my_center|LOCUS_23800 6906 5629 gene locus_tag LOCUS_23810 6906 5629 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035901.1 protein_id gnl|my_center|LOCUS_23810 7948 6938 gene locus_tag LOCUS_23820 7948 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 8582 7959 gene locus_tag LOCUS_23830 8582 7959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 9205 8582 gene locus_tag LOCUS_23840 9205 8582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 9502 10719 gene locus_tag LOCUS_23850 9502 10719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 11845 10784 gene locus_tag LOCUS_23860 11845 10784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 12130 12861 gene locus_tag LOCUS_23870 12130 12861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 13110 13619 gene locus_tag LOCUS_23880 13110 13619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 13849 14127 gene locus_tag LOCUS_23890 13849 14127 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263488.1 protein_id gnl|my_center|LOCUS_23890 14094 14408 gene locus_tag LOCUS_23900 14094 14408 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263487.1 protein_id gnl|my_center|LOCUS_23900 15584 14508 gene locus_tag LOCUS_23910 15584 14508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 16640 15717 gene locus_tag LOCUS_23920 16640 15717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 17047 18627 gene locus_tag LOCUS_23930 17047 18627 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257227.1 protein_id gnl|my_center|LOCUS_23930 18666 19751 gene locus_tag LOCUS_23940 18666 19751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 >Feature sequence089 90 500 gene locus_tag LOCUS_23950 90 500 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705754.1 protein_id gnl|my_center|LOCUS_23950 589 4239 gene locus_tag LOCUS_23960 589 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 6110 4350 gene locus_tag LOCUS_23970 6110 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 6874 6236 gene locus_tag LOCUS_23980 6874 6236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 7142 9175 gene locus_tag LOCUS_23990 7142 9175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 9179 11176 gene locus_tag LOCUS_24000 gene uvrB 9179 11176 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_24000 11436 11654 gene locus_tag LOCUS_24010 gene infA 11436 11654 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942395.1 protein_id gnl|my_center|LOCUS_24010 12547 11792 gene locus_tag LOCUS_24020 12547 11792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 14084 12636 gene locus_tag LOCUS_24030 14084 12636 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615932.1 protein_id gnl|my_center|LOCUS_24030 14334 15068 gene locus_tag LOCUS_24040 14334 15068 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_24040 15405 15088 gene locus_tag LOCUS_24050 15405 15088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 15764 16624 gene locus_tag LOCUS_24060 15764 16624 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142292.1 protein_id gnl|my_center|LOCUS_24060 18261 16735 gene locus_tag LOCUS_24070 18261 16735 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256530.1 protein_id gnl|my_center|LOCUS_24070 18906 18310 gene locus_tag LOCUS_24080 gene leuD 18906 18310 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091398.1 protein_id gnl|my_center|LOCUS_24080 19250 18951 gene locus_tag LOCUS_24090 19250 18951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 20702 19290 gene locus_tag LOCUS_24100 gene leuC 20702 19290 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340234.1 protein_id gnl|my_center|LOCUS_24100 >Feature sequence090 2115 2813 gene locus_tag LOCUS_24110 2115 2813 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020206.1 protein_id gnl|my_center|LOCUS_24110 7385 2826 gene locus_tag LOCUS_24120 7385 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 7665 10046 gene locus_tag LOCUS_24130 7665 10046 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055503.1 protein_id gnl|my_center|LOCUS_24130 11255 10113 gene locus_tag LOCUS_24140 11255 10113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 11881 12900 gene locus_tag LOCUS_24150 11881 12900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 14365 12992 gene locus_tag LOCUS_24160 14365 12992 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021695.1 protein_id gnl|my_center|LOCUS_24160 15576 14362 gene locus_tag LOCUS_24170 15576 14362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 16187 15624 gene locus_tag LOCUS_24180 16187 15624 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944067.1 protein_id gnl|my_center|LOCUS_24180 17034 16222 gene locus_tag LOCUS_24190 17034 16222 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905410.1 protein_id gnl|my_center|LOCUS_24190 17411 18577 gene locus_tag LOCUS_24200 17411 18577 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031011.1 protein_id gnl|my_center|LOCUS_24200 18837 19799 gene locus_tag LOCUS_24210 18837 19799 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690405.1 protein_id gnl|my_center|LOCUS_24210 >Feature sequence091 <1 1241 gene locus_tag LOCUS_24220 <1 1241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970220.1:aspartate aminotransferase family protein 1248 2009 gene locus_tag LOCUS_24230 1248 2009 CDS product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705542.1 protein_id gnl|my_center|LOCUS_24230 1993 3477 gene locus_tag LOCUS_24240 1993 3477 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537559.1 protein_id gnl|my_center|LOCUS_24240 3443 4882 gene locus_tag LOCUS_24250 gene araA 3443 4882 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964651.1 protein_id gnl|my_center|LOCUS_24250 4932 5942 gene locus_tag LOCUS_24260 4932 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 5958 8228 gene locus_tag LOCUS_24270 5958 8228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 8696 8406 gene locus_tag LOCUS_24280 8696 8406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 10801 8939 gene locus_tag LOCUS_24290 10801 8939 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121854.1 protein_id gnl|my_center|LOCUS_24290 10981 11973 gene locus_tag LOCUS_24300 10981 11973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 13194 11998 gene locus_tag LOCUS_24310 13194 11998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 13304 15775 gene locus_tag LOCUS_24320 13304 15775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 16101 17189 gene locus_tag LOCUS_24330 gene ribD 16101 17189 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_24330 17194 17817 gene locus_tag LOCUS_24340 17194 17817 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143593.1 protein_id gnl|my_center|LOCUS_24340 17836 19029 gene locus_tag LOCUS_24350 17836 19029 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_24350 19043 19507 gene locus_tag LOCUS_24360 gene ribE 19043 19507 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358088.1 protein_id gnl|my_center|LOCUS_24360 19504 19941 gene locus_tag LOCUS_24370 gene nusB 19504 19941 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942335.1 protein_id gnl|my_center|LOCUS_24370 >Feature sequence092 8 886 gene locus_tag LOCUS_24380 8 886 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031015.1 protein_id gnl|my_center|LOCUS_24380 1819 905 gene locus_tag LOCUS_24390 1819 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 3477 1966 gene locus_tag LOCUS_24400 3477 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 5941 3695 gene locus_tag LOCUS_24410 5941 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 6177 6043 gene locus_tag LOCUS_24420 6177 6043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 6437 7183 gene locus_tag LOCUS_24430 6437 7183 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943078.1 protein_id gnl|my_center|LOCUS_24430 7393 7317 gene locus_tag LOCUS_t00250 7393 7317 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 10704 7432 gene locus_tag LOCUS_24440 10704 7432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 12494 10944 gene locus_tag LOCUS_24450 12494 10944 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767660.1 protein_id gnl|my_center|LOCUS_24450 13520 12504 gene locus_tag LOCUS_24460 13520 12504 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119510.1 protein_id gnl|my_center|LOCUS_24460 14248 14943 gene locus_tag LOCUS_24470 gene deoC 14248 14943 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 protein_id gnl|my_center|LOCUS_24470 15938 14958 gene locus_tag LOCUS_24480 15938 14958 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792769.1 protein_id gnl|my_center|LOCUS_24480 17631 16168 gene locus_tag LOCUS_24490 gene rfaE1 17631 16168 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942727.1 protein_id gnl|my_center|LOCUS_24490 20016 17758 gene locus_tag LOCUS_24500 20016 17758 CDS product DUF4838 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107588.1 protein_id gnl|my_center|LOCUS_24500 >Feature sequence093 <1 1447 gene locus_tag LOCUS_24510 <1 1447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766599.1:glycoside hydrolase family 38 C-terminal domain-containing protein 1468 2694 gene locus_tag LOCUS_24520 1468 2694 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801343.1 protein_id gnl|my_center|LOCUS_24520 2735 4483 gene locus_tag LOCUS_24530 2735 4483 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_24530 5544 5194 gene locus_tag LOCUS_24540 5544 5194 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121435.1 protein_id gnl|my_center|LOCUS_24540 6121 5555 gene locus_tag LOCUS_24550 gene rfbC 6121 5555 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403366.1 protein_id gnl|my_center|LOCUS_24550 6399 7130 gene locus_tag LOCUS_24560 6399 7130 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461598.1 protein_id gnl|my_center|LOCUS_24560 8824 7223 gene locus_tag LOCUS_24570 8824 7223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 10219 8969 gene locus_tag LOCUS_24580 10219 8969 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040635.1 protein_id gnl|my_center|LOCUS_24580 10451 10858 gene locus_tag LOCUS_24590 10451 10858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 10917 11873 gene locus_tag LOCUS_24600 10917 11873 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894906.1 protein_id gnl|my_center|LOCUS_24600 12966 11890 gene locus_tag LOCUS_24610 12966 11890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 14372 13026 gene locus_tag LOCUS_24620 14372 13026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 15184 14441 gene locus_tag LOCUS_24630 15184 14441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444495.1 protein_id gnl|my_center|LOCUS_24630 16438 15203 gene locus_tag LOCUS_24640 16438 15203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 18371 16467 gene locus_tag LOCUS_24650 18371 16467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 17295 17394 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence094 172 2007 gene locus_tag LOCUS_24660 172 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 3165 2071 gene locus_tag LOCUS_24670 3165 2071 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_24670 4337 3165 gene locus_tag LOCUS_24680 4337 3165 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925698.1 protein_id gnl|my_center|LOCUS_24680 5894 4365 gene locus_tag LOCUS_24690 5894 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 7234 5891 gene locus_tag LOCUS_24700 7234 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 8627 7245 gene locus_tag LOCUS_24710 8627 7245 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_24710 9932 8973 gene locus_tag LOCUS_24720 9932 8973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 10852 9929 gene locus_tag LOCUS_24730 10852 9929 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243523.1 protein_id gnl|my_center|LOCUS_24730 12425 10845 gene locus_tag LOCUS_24740 12425 10845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 13119 12658 gene locus_tag LOCUS_24750 13119 12658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 14610 13294 gene locus_tag LOCUS_24760 14610 13294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 15350 14619 gene locus_tag LOCUS_24770 15350 14619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 15300 15587 gene locus_tag LOCUS_24780 15300 15587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 18255 16924 gene locus_tag LOCUS_24790 18255 16924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 >Feature sequence095 3897 2860 gene locus_tag LOCUS_24800 3897 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 4624 4723 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5065 5517 gene locus_tag LOCUS_24810 gene ndk 5065 5517 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_24810 5794 6264 gene locus_tag LOCUS_24820 5794 6264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 6299 7621 gene locus_tag LOCUS_24830 6299 7621 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393792.1 protein_id gnl|my_center|LOCUS_24830 7644 8936 gene locus_tag LOCUS_24840 7644 8936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 9214 10983 gene locus_tag LOCUS_24850 9214 10983 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942254.1 protein_id gnl|my_center|LOCUS_24850 11381 12838 gene locus_tag LOCUS_24860 11381 12838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 13124 13200 gene locus_tag LOCUS_t00260 13124 13200 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 13229 14617 gene locus_tag LOCUS_24870 gene tilS 13229 14617 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942455.1 protein_id gnl|my_center|LOCUS_24870 14604 15125 gene locus_tag LOCUS_24880 gene hpt 14604 15125 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019295.1 protein_id gnl|my_center|LOCUS_24880 16107 15127 gene locus_tag LOCUS_24890 16107 15127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 16229 16328 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16393 18678 gene locus_tag LOCUS_24900 16393 18678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 >Feature sequence096 1109 2215 gene locus_tag LOCUS_24910 1109 2215 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941517.1 protein_id gnl|my_center|LOCUS_24910 3511 2243 gene locus_tag LOCUS_24920 3511 2243 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229640.1 protein_id gnl|my_center|LOCUS_24920 4359 3508 gene locus_tag LOCUS_24930 gene accD 4359 3508 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966832.1 protein_id gnl|my_center|LOCUS_24930 5211 4480 gene locus_tag LOCUS_24940 5211 4480 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938748.1 protein_id gnl|my_center|LOCUS_24940 6325 5330 gene locus_tag LOCUS_24950 gene ilvC 6325 5330 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938673.1 protein_id gnl|my_center|LOCUS_24950 6829 6329 gene locus_tag LOCUS_24960 gene ilvN 6829 6329 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545180.1 protein_id gnl|my_center|LOCUS_24960 7421 6864 gene locus_tag LOCUS_24970 gene pth 7421 6864 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941324.1 protein_id gnl|my_center|LOCUS_24970 8189 7515 gene locus_tag LOCUS_24980 8189 7515 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768871.1 protein_id gnl|my_center|LOCUS_24980 9164 8214 gene locus_tag LOCUS_24990 9164 8214 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546354.1 protein_id gnl|my_center|LOCUS_24990 9404 9330 gene locus_tag LOCUS_t00270 9404 9330 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 9657 10619 gene locus_tag LOCUS_25000 9657 10619 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403393.1 protein_id gnl|my_center|LOCUS_25000 10834 10910 gene locus_tag LOCUS_t00280 10834 10910 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11062 11949 gene locus_tag LOCUS_25010 11062 11949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 12198 13259 gene locus_tag LOCUS_25020 gene trpS 12198 13259 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016366.1 protein_id gnl|my_center|LOCUS_25020 13287 14228 gene locus_tag LOCUS_25030 13287 14228 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125025.1 protein_id gnl|my_center|LOCUS_25030 14304 16406 gene locus_tag LOCUS_25040 14304 16406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 16447 16854 gene locus_tag LOCUS_25050 16447 16854 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020323.1 protein_id gnl|my_center|LOCUS_25050 16876 18324 gene locus_tag LOCUS_25060 16876 18324 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053651.1 protein_id gnl|my_center|LOCUS_25060 >Feature sequence097 551 1657 gene locus_tag LOCUS_25070 gene dnaN 551 1657 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895312.1 protein_id gnl|my_center|LOCUS_25070 2237 3175 gene locus_tag LOCUS_25080 2237 3175 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049979583.1 protein_id gnl|my_center|LOCUS_25080 3300 4301 gene locus_tag LOCUS_25090 3300 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 4580 6289 gene locus_tag LOCUS_25100 4580 6289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 7391 6303 gene locus_tag LOCUS_25110 7391 6303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 9216 7393 gene locus_tag LOCUS_25120 9216 7393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 10258 9236 gene locus_tag LOCUS_25130 10258 9236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 10469 11116 gene locus_tag LOCUS_25140 10469 11116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 11206 11958 gene locus_tag LOCUS_25150 11206 11958 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462636.1 protein_id gnl|my_center|LOCUS_25150 12011 13540 gene locus_tag LOCUS_25160 12011 13540 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_25160 13606 15066 gene locus_tag LOCUS_25170 13606 15066 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921988.1 protein_id gnl|my_center|LOCUS_25170 15280 17172 gene locus_tag LOCUS_25180 15280 17172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 17620 18669 gene locus_tag LOCUS_25190 17620 18669 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128929876.1 protein_id gnl|my_center|LOCUS_25190 >Feature sequence098 165 476 gene locus_tag LOCUS_25200 gene rpsJ 165 476 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 protein_id gnl|my_center|LOCUS_25200 541 1176 gene locus_tag LOCUS_25210 gene rplC 541 1176 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_25210 1179 1805 gene locus_tag LOCUS_25220 gene rplD 1179 1805 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674916.1 protein_id gnl|my_center|LOCUS_25220 1802 2086 gene locus_tag LOCUS_25230 gene rplW 1802 2086 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393935.1 protein_id gnl|my_center|LOCUS_25230 2147 2929 gene locus_tag LOCUS_25240 gene rplB 2147 2929 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511583.1 protein_id gnl|my_center|LOCUS_25240 2957 3238 gene locus_tag LOCUS_25250 gene rpsS 2957 3238 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938602.1 protein_id gnl|my_center|LOCUS_25250 3238 3588 gene locus_tag LOCUS_25260 gene rplV 3238 3588 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829734.1 protein_id gnl|my_center|LOCUS_25260 3630 4346 gene locus_tag LOCUS_25270 gene rpsC 3630 4346 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_25270 4382 4789 gene locus_tag LOCUS_25280 gene rplP 4382 4789 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943479.1 protein_id gnl|my_center|LOCUS_25280 4824 5042 gene locus_tag LOCUS_25290 gene rpmC 4824 5042 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403594.1 protein_id gnl|my_center|LOCUS_25290 5045 5302 gene locus_tag LOCUS_25300 gene rpsQ 5045 5302 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421156.1 protein_id gnl|my_center|LOCUS_25300 5322 5690 gene locus_tag LOCUS_25310 gene rplN 5322 5690 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603030.1 protein_id gnl|my_center|LOCUS_25310 5737 6051 gene locus_tag LOCUS_25320 gene rplX 5737 6051 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187422288.1 protein_id gnl|my_center|LOCUS_25320 6104 6649 gene locus_tag LOCUS_25330 gene rplE 6104 6649 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741297.1 protein_id gnl|my_center|LOCUS_25330 6699 6884 gene locus_tag LOCUS_25340 6699 6884 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583358.1 protein_id gnl|my_center|LOCUS_25340 6908 7300 gene locus_tag LOCUS_25350 gene rpsH 6908 7300 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549038.1 protein_id gnl|my_center|LOCUS_25350 7388 7909 gene locus_tag LOCUS_25360 gene rplF 7388 7909 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357306.1 protein_id gnl|my_center|LOCUS_25360 7937 8290 gene locus_tag LOCUS_25370 gene rplR 7937 8290 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055951.1 protein_id gnl|my_center|LOCUS_25370 8302 8838 gene locus_tag LOCUS_25380 gene rpsE 8302 8838 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_25380 8906 9421 gene locus_tag LOCUS_25390 gene rplO 8906 9421 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723680.1 protein_id gnl|my_center|LOCUS_25390 9425 10753 gene locus_tag LOCUS_25400 gene secY 9425 10753 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545307.1 protein_id gnl|my_center|LOCUS_25400 10784 11455 gene locus_tag LOCUS_25410 10784 11455 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869908.1 protein_id gnl|my_center|LOCUS_25410 11459 12229 gene locus_tag LOCUS_25420 gene map 11459 12229 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421130.1 protein_id gnl|my_center|LOCUS_25420 12251 12469 gene locus_tag LOCUS_25430 gene infA 12251 12469 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393913.1 protein_id gnl|my_center|LOCUS_25430 12666 13031 gene locus_tag LOCUS_25440 gene rpsM 12666 13031 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888756.1 protein_id gnl|my_center|LOCUS_25440 13044 13442 gene locus_tag LOCUS_25450 gene rpsK 13044 13442 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966385.1 protein_id gnl|my_center|LOCUS_25450 13530 14534 gene locus_tag LOCUS_25460 13530 14534 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_25460 14687 14992 gene locus_tag LOCUS_25470 14687 14992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 15136 17775 gene locus_tag LOCUS_25480 gene mutS 15136 17775 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_25480 18387 18746 gene locus_tag LOCUS_25490 18387 18746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 >Feature sequence099 2470 761 gene locus_tag LOCUS_25500 gene ptsP 2470 761 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942526.1 protein_id gnl|my_center|LOCUS_25500 2804 2532 gene locus_tag LOCUS_25510 2804 2532 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 protein_id gnl|my_center|LOCUS_25510 3994 3125 gene locus_tag LOCUS_25520 gene rapZ 3994 3125 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462179.1 protein_id gnl|my_center|LOCUS_25520 4955 3987 gene locus_tag LOCUS_25530 gene hprK 4955 3987 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228097.1 protein_id gnl|my_center|LOCUS_25530 5560 4991 gene locus_tag LOCUS_25540 gene raiA 5560 4991 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942531.1 protein_id gnl|my_center|LOCUS_25540 8983 5714 gene locus_tag LOCUS_25550 8983 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 9593 9081 gene locus_tag LOCUS_25560 9593 9081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 9712 10584 gene locus_tag LOCUS_25570 9712 10584 CDS product ARMT1-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582978.1 protein_id gnl|my_center|LOCUS_25570 11581 10664 gene locus_tag LOCUS_25580 11581 10664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 13014 11689 gene locus_tag LOCUS_25590 13014 11689 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246120.1 protein_id gnl|my_center|LOCUS_25590 14938 13016 gene locus_tag LOCUS_25600 gene uvrC 14938 13016 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943890.1 protein_id gnl|my_center|LOCUS_25600 15072 15830 gene locus_tag LOCUS_25610 15072 15830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 17186 15849 gene locus_tag LOCUS_25620 17186 15849 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858523.1 protein_id gnl|my_center|LOCUS_25620 >Feature sequence100 242 697 gene locus_tag LOCUS_25630 242 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 789 2315 gene locus_tag LOCUS_25640 789 2315 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113317.1 protein_id gnl|my_center|LOCUS_25640 2305 3636 gene locus_tag LOCUS_25650 2305 3636 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269235.1 protein_id gnl|my_center|LOCUS_25650 3672 6788 gene locus_tag LOCUS_25660 3672 6788 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941497.1 protein_id gnl|my_center|LOCUS_25660 8109 7000 gene locus_tag LOCUS_25670 8109 7000 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_25670 8682 8227 gene locus_tag LOCUS_25680 gene dut 8682 8227 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970813.1 protein_id gnl|my_center|LOCUS_25680 9941 8679 gene locus_tag LOCUS_25690 9941 8679 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392573.1 protein_id gnl|my_center|LOCUS_25690 12320 10020 gene locus_tag LOCUS_25700 gene pnp 12320 10020 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_25700 12715 12446 gene locus_tag LOCUS_25710 gene rpsO 12715 12446 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409373.1 protein_id gnl|my_center|LOCUS_25710 14068 12836 gene locus_tag LOCUS_25720 14068 12836 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036339.1 protein_id gnl|my_center|LOCUS_25720 15136 14141 gene locus_tag LOCUS_25730 gene gap 15136 14141 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_25730 16418 15477 gene locus_tag LOCUS_25740 16418 15477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 17598 16591 gene locus_tag LOCUS_25750 17598 16591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 <18603 17950 gene locus_tag LOCUS_25760 <18603 17950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037399640.1:1-acyl-sn-glycerol-3-phosphate acyltransferase >Feature sequence101 128 1237 gene locus_tag LOCUS_25770 128 1237 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922132.1 protein_id gnl|my_center|LOCUS_25770 1402 2562 gene locus_tag LOCUS_25780 1402 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 3591 2593 gene locus_tag LOCUS_25790 3591 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 3802 4992 gene locus_tag LOCUS_25800 3802 4992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 5209 6255 gene locus_tag LOCUS_25810 5209 6255 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957539.1 protein_id gnl|my_center|LOCUS_25810 6400 7044 gene locus_tag LOCUS_25820 gene rpoE 6400 7044 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_25820 7041 7484 gene locus_tag LOCUS_25830 7041 7484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 7481 8026 gene locus_tag LOCUS_25840 7481 8026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 8911 8036 gene locus_tag LOCUS_25850 8911 8036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 10724 9057 gene locus_tag LOCUS_25860 10724 9057 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206221.1 protein_id gnl|my_center|LOCUS_25860 11795 10920 gene locus_tag LOCUS_25870 gene lgt 11795 10920 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545160.1 protein_id gnl|my_center|LOCUS_25870 12327 11776 gene locus_tag LOCUS_25880 gene lspA 12327 11776 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256792.1 protein_id gnl|my_center|LOCUS_25880 12692 12324 gene locus_tag LOCUS_25890 12692 12324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 13071 13313 gene locus_tag LOCUS_25900 13071 13313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 15787 13331 gene locus_tag LOCUS_25910 15787 13331 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922751.1 protein_id gnl|my_center|LOCUS_25910 18044 15888 gene locus_tag LOCUS_25920 18044 15888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201942.1 protein_id gnl|my_center|LOCUS_25920 >Feature sequence102 <1 1186 gene locus_tag LOCUS_25930 <1 1186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546350.1:transglutaminase-like domain-containing protein 1264 4173 gene locus_tag LOCUS_25940 1264 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 4220 4921 gene locus_tag LOCUS_25950 4220 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 4980 6239 gene locus_tag LOCUS_25960 4980 6239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 6475 9192 gene locus_tag LOCUS_25970 6475 9192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 10338 9208 gene locus_tag LOCUS_25980 10338 9208 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405142.1 protein_id gnl|my_center|LOCUS_25980 10680 10829 gene locus_tag LOCUS_25990 10680 10829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 11267 11554 gene locus_tag LOCUS_26000 gene groES 11267 11554 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583322.1 protein_id gnl|my_center|LOCUS_26000 11613 13244 gene locus_tag LOCUS_26010 gene groL 11613 13244 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545192.1 protein_id gnl|my_center|LOCUS_26010 15841 13358 gene locus_tag LOCUS_26020 15841 13358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 14010 14100 gene locus_tag LOCUS_t00290 14010 14100 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence103 126 1094 gene locus_tag LOCUS_26030 126 1094 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994093.1 protein_id gnl|my_center|LOCUS_26030 1374 1141 gene locus_tag LOCUS_26040 1374 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 1752 1411 gene locus_tag LOCUS_26050 1752 1411 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582838.1 protein_id gnl|my_center|LOCUS_26050 2192 1746 gene locus_tag LOCUS_26060 2192 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 2845 2237 gene locus_tag LOCUS_26070 gene rpoE 2845 2237 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_26070 3053 4129 gene locus_tag LOCUS_26080 3053 4129 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169978569.1 protein_id gnl|my_center|LOCUS_26080 4379 6076 gene locus_tag LOCUS_26090 4379 6076 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925143.1 protein_id gnl|my_center|LOCUS_26090 6173 7060 gene locus_tag LOCUS_26100 gene folD 6173 7060 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_26100 8001 7132 gene locus_tag LOCUS_26110 8001 7132 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943679.1 protein_id gnl|my_center|LOCUS_26110 9322 7967 gene locus_tag LOCUS_26120 gene flhF 9322 7967 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870056.1 protein_id gnl|my_center|LOCUS_26120 11462 9381 gene locus_tag LOCUS_26130 gene flhA 11462 9381 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231947.1 protein_id gnl|my_center|LOCUS_26130 12607 11483 gene locus_tag LOCUS_26140 gene flhB 12607 11483 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_26140 13385 12615 gene locus_tag LOCUS_26150 gene fliR 13385 12615 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063736.1 protein_id gnl|my_center|LOCUS_26150 13700 13389 gene locus_tag LOCUS_26160 gene fliQ 13700 13389 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816214.1 protein_id gnl|my_center|LOCUS_26160 >Feature sequence104 936 655 gene locus_tag LOCUS_26170 936 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 850 2730 gene locus_tag LOCUS_26180 gene mnmG 850 2730 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546402.1 protein_id gnl|my_center|LOCUS_26180 2740 3861 gene locus_tag LOCUS_26190 2740 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 3921 5240 gene locus_tag LOCUS_26200 3921 5240 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922239.1 protein_id gnl|my_center|LOCUS_26200 5415 5951 gene locus_tag LOCUS_26210 5415 5951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 6111 7232 gene locus_tag LOCUS_26220 6111 7232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 8386 7256 gene locus_tag LOCUS_26230 8386 7256 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_26230 9598 8441 gene locus_tag LOCUS_26240 9598 8441 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_26240 10397 9636 gene locus_tag LOCUS_26250 10397 9636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 11950 10520 gene locus_tag LOCUS_26260 11950 10520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 12136 13416 gene locus_tag LOCUS_26270 12136 13416 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803854.1 protein_id gnl|my_center|LOCUS_26270 13413 14630 gene locus_tag LOCUS_26280 13413 14630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 14024 14123 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14669 16501 gene locus_tag LOCUS_26290 14669 16501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 17488 16517 gene locus_tag LOCUS_26300 17488 16517 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256941.1 protein_id gnl|my_center|LOCUS_26300 >Feature sequence105 805 1806 gene locus_tag LOCUS_26310 gene fliG 805 1806 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870078.1 protein_id gnl|my_center|LOCUS_26310 1844 2494 gene locus_tag LOCUS_26320 gene cdsL 1844 2494 CDS product SctL family type III secretion system stator protein CdsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873901.1 protein_id gnl|my_center|LOCUS_26320 2504 3814 gene locus_tag LOCUS_26330 gene fliI 2504 3814 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_26330 3821 4282 gene locus_tag LOCUS_26340 3821 4282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 4279 4842 gene locus_tag LOCUS_26350 4279 4842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 5074 6630 gene locus_tag LOCUS_26360 5074 6630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 6690 7226 gene locus_tag LOCUS_26370 6690 7226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 7223 7624 gene locus_tag LOCUS_26380 7223 7624 CDS product TIGR02530 family flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941086.1 protein_id gnl|my_center|LOCUS_26380 7715 9034 gene locus_tag LOCUS_26390 gene flgE 7715 9034 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680830.1 protein_id gnl|my_center|LOCUS_26390 9244 10011 gene locus_tag LOCUS_26400 9244 10011 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870068.1 protein_id gnl|my_center|LOCUS_26400 10013 10795 gene locus_tag LOCUS_26410 10013 10795 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870067.1 protein_id gnl|my_center|LOCUS_26410 10811 11347 gene locus_tag LOCUS_26420 10811 11347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 11353 11712 gene locus_tag LOCUS_26430 11353 11712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 11690 12532 gene locus_tag LOCUS_26440 11690 12532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 12537 13298 gene locus_tag LOCUS_26450 gene fliP 12537 13298 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_26450 13313 13786 gene locus_tag LOCUS_26460 13313 13786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 14780 13797 gene locus_tag LOCUS_26470 14780 13797 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329644.1 protein_id gnl|my_center|LOCUS_26470 17372 14859 gene locus_tag LOCUS_26480 17372 14859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 17533 17369 gene locus_tag LOCUS_26490 17533 17369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 >Feature sequence106 1371 553 gene locus_tag LOCUS_26500 1371 553 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_26500 3171 1393 gene locus_tag LOCUS_26510 3171 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 4149 3271 gene locus_tag LOCUS_26520 4149 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 5512 4181 gene locus_tag LOCUS_26530 gene arnB 5512 4181 CDS product UDP-4-amino-4-deoxy-L-arabinose aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704927.1 protein_id gnl|my_center|LOCUS_26530 6410 6039 gene locus_tag LOCUS_26540 6410 6039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 7483 6497 gene locus_tag LOCUS_26550 7483 6497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 8069 9472 gene locus_tag LOCUS_26560 8069 9472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 10913 9513 gene locus_tag LOCUS_26570 10913 9513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_26570 11198 12355 gene locus_tag LOCUS_26580 11198 12355 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_26580 12512 13396 gene locus_tag LOCUS_26590 12512 13396 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615678.1 protein_id gnl|my_center|LOCUS_26590 13917 13432 gene locus_tag LOCUS_26600 gene ispF 13917 13432 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098560.1 protein_id gnl|my_center|LOCUS_26600 14606 13917 gene locus_tag LOCUS_26610 gene ispD 14606 13917 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421617.1 protein_id gnl|my_center|LOCUS_26610 15673 14603 gene locus_tag LOCUS_26620 15673 14603 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860623.1 protein_id gnl|my_center|LOCUS_26620 16615 15788 gene locus_tag LOCUS_26630 16615 15788 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933475.1 protein_id gnl|my_center|LOCUS_26630 16954 16658 gene locus_tag LOCUS_26640 16954 16658 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914001.1 protein_id gnl|my_center|LOCUS_26640 <17623 16957 gene locus_tag LOCUS_26650 <17623 16957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942051.1:acetyl-CoA carboxylase carboxyltransferase subunit alpha >Feature sequence107 630 1325 gene locus_tag LOCUS_26660 630 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 2049 4709 gene locus_tag LOCUS_26670 2049 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 4960 6123 gene locus_tag LOCUS_26680 4960 6123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 6240 7634 gene locus_tag LOCUS_26690 6240 7634 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_26690 7719 9125 gene locus_tag LOCUS_26700 7719 9125 CDS product glycoside hydrolase family 140 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 protein_id gnl|my_center|LOCUS_26700 9532 10272 gene locus_tag LOCUS_26710 9532 10272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 10587 11504 gene locus_tag LOCUS_26720 10587 11504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 11573 12730 gene locus_tag LOCUS_26730 11573 12730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 12736 13404 gene locus_tag LOCUS_26740 12736 13404 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117262.1 protein_id gnl|my_center|LOCUS_26740 13630 16530 gene locus_tag LOCUS_26750 13630 16530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 <17316 16562 gene locus_tag LOCUS_26760 <17316 16562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767711.1:alpha-L-fucosidase >Feature sequence108 <1 6118 gene locus_tag LOCUS_26770 <1 6118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010890750.1:M6 family metalloprotease domain-containing protein 6273 8603 gene locus_tag LOCUS_26780 6273 8603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 8739 11561 gene locus_tag LOCUS_26790 8739 11561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 12440 11595 gene locus_tag LOCUS_26800 12440 11595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 13508 12480 gene locus_tag LOCUS_26810 13508 12480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 13709 14719 gene locus_tag LOCUS_26820 13709 14719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 15473 14739 gene locus_tag LOCUS_26830 15473 14739 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263747.1 protein_id gnl|my_center|LOCUS_26830 >Feature sequence109 127 645 gene locus_tag LOCUS_26840 127 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 1109 1855 gene locus_tag LOCUS_26850 1109 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 2036 2434 gene locus_tag LOCUS_26860 2036 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 2698 2943 gene locus_tag LOCUS_26870 2698 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 3090 4160 gene locus_tag LOCUS_26880 3090 4160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 4168 4461 gene locus_tag LOCUS_26890 4168 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 5529 4804 gene locus_tag LOCUS_26900 5529 4804 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259229.1 protein_id gnl|my_center|LOCUS_26900 6731 5571 gene locus_tag LOCUS_26910 6731 5571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 7383 7000 gene locus_tag LOCUS_26920 7383 7000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 7895 8038 gene locus_tag LOCUS_26930 7895 8038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 8586 10331 gene locus_tag LOCUS_26940 8586 10331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 10368 10856 gene locus_tag LOCUS_26950 10368 10856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 10863 12365 gene locus_tag LOCUS_26960 10863 12365 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_26960 13137 12376 gene locus_tag LOCUS_26970 13137 12376 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941404.1 protein_id gnl|my_center|LOCUS_26970 14677 13154 gene locus_tag LOCUS_26980 14677 13154 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941403.1 protein_id gnl|my_center|LOCUS_26980 16161 14674 gene locus_tag LOCUS_26990 16161 14674 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816730.1 protein_id gnl|my_center|LOCUS_26990 16807 16163 gene locus_tag LOCUS_27000 16807 16163 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941401.1 protein_id gnl|my_center|LOCUS_27000 >Feature sequence110 2336 21 gene locus_tag LOCUS_27010 2336 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 3303 2683 gene locus_tag LOCUS_27020 3303 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 5672 3357 gene locus_tag LOCUS_27030 5672 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 5907 8849 gene locus_tag LOCUS_27040 5907 8849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 9016 11349 gene locus_tag LOCUS_27050 9016 11349 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_27050 11563 12147 gene locus_tag LOCUS_27060 11563 12147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 12153 13265 gene locus_tag LOCUS_27070 12153 13265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 13358 14029 gene locus_tag LOCUS_27080 gene lepB 13358 14029 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392487.1 protein_id gnl|my_center|LOCUS_27080 14026 14826 gene locus_tag LOCUS_27090 14026 14826 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_27090 15675 14755 gene locus_tag LOCUS_27100 gene prpC 15675 14755 CDS product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 protein_id gnl|my_center|LOCUS_27100 16859 15843 gene locus_tag LOCUS_27110 16859 15843 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086852489.1 protein_id gnl|my_center|LOCUS_27110 >Feature sequence111 1856 558 gene locus_tag LOCUS_27120 gene tolB 1856 558 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_27120 2802 1867 gene locus_tag LOCUS_27130 2802 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 3024 4415 gene locus_tag LOCUS_27140 3024 4415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 4423 5163 gene locus_tag LOCUS_27150 4423 5163 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868310.1 protein_id gnl|my_center|LOCUS_27150 5160 6065 gene locus_tag LOCUS_27160 5160 6065 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257037.1 protein_id gnl|my_center|LOCUS_27160 7614 6103 gene locus_tag LOCUS_27170 7614 6103 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257549.1 protein_id gnl|my_center|LOCUS_27170 9077 7692 gene locus_tag LOCUS_27180 gene argH 9077 7692 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940832.1 protein_id gnl|my_center|LOCUS_27180 10316 9102 gene locus_tag LOCUS_27190 10316 9102 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227831.1 protein_id gnl|my_center|LOCUS_27190 11310 10351 gene locus_tag LOCUS_27200 gene argF 11310 10351 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_27200 12497 11310 gene locus_tag LOCUS_27210 12497 11310 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940827.1 protein_id gnl|my_center|LOCUS_27210 13006 12680 gene locus_tag LOCUS_27220 13006 12680 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325406.1 protein_id gnl|my_center|LOCUS_27220 14323 13223 gene locus_tag LOCUS_27230 14323 13223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 15212 14346 gene locus_tag LOCUS_27240 gene rsmA 15212 14346 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651552.1 protein_id gnl|my_center|LOCUS_27240 15332 16972 gene locus_tag LOCUS_27250 15332 16972 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257013.1 protein_id gnl|my_center|LOCUS_27250 >Feature sequence112 1905 541 gene locus_tag LOCUS_27260 1905 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 2311 1937 gene locus_tag LOCUS_27270 2311 1937 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105017.1 protein_id gnl|my_center|LOCUS_27270 2658 2362 gene locus_tag LOCUS_27280 2658 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 3238 4359 gene locus_tag LOCUS_27290 3238 4359 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120966.1 protein_id gnl|my_center|LOCUS_27290 6165 4441 gene locus_tag LOCUS_27300 6165 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 6371 6550 gene locus_tag LOCUS_27310 6371 6550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 6642 7901 gene locus_tag LOCUS_27320 6642 7901 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_27320 7997 9334 gene locus_tag LOCUS_27330 7997 9334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 9344 9937 gene locus_tag LOCUS_27340 9344 9937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 9998 11008 gene locus_tag LOCUS_27350 9998 11008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 11156 12913 gene locus_tag LOCUS_27360 11156 12913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 13952 12924 gene locus_tag LOCUS_27370 13952 12924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 14327 15574 gene locus_tag LOCUS_27380 gene fabF 14327 15574 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_27380 15576 16643 gene locus_tag LOCUS_27390 15576 16643 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582795.1 protein_id gnl|my_center|LOCUS_27390 >Feature sequence113 1157 825 gene locus_tag LOCUS_27400 1157 825 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403747.1 protein_id gnl|my_center|LOCUS_27400 3480 1189 gene locus_tag LOCUS_27410 3480 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 4187 3507 gene locus_tag LOCUS_27420 4187 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 5004 4198 gene locus_tag LOCUS_27430 5004 4198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 5797 5306 gene locus_tag LOCUS_27440 5797 5306 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582742.1 protein_id gnl|my_center|LOCUS_27440 6000 7997 gene locus_tag LOCUS_27450 gene msbA 6000 7997 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_27450 7994 8677 gene locus_tag LOCUS_27460 7994 8677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 9847 8741 gene locus_tag LOCUS_27470 9847 8741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 10059 11870 gene locus_tag LOCUS_27480 10059 11870 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_27480 11887 12459 gene locus_tag LOCUS_27490 11887 12459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 12616 15147 gene locus_tag LOCUS_27500 12616 15147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 15164 16240 gene locus_tag LOCUS_27510 15164 16240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 16263 16619 gene locus_tag LOCUS_27520 16263 16619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 >Feature sequence114 61 240 gene locus_tag LOCUS_27530 61 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 258 1643 gene locus_tag LOCUS_27540 gene zraS 258 1643 CDS product two-component system sensor histidine kinase ZraS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211892.1 protein_id gnl|my_center|LOCUS_27540 1648 2955 gene locus_tag LOCUS_27550 1648 2955 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146518596.1 protein_id gnl|my_center|LOCUS_27550 3445 3248 gene locus_tag LOCUS_27560 3445 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 3368 3598 gene locus_tag LOCUS_27570 3368 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 3755 6964 gene locus_tag LOCUS_27580 3755 6964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 8362 6989 gene locus_tag LOCUS_27590 8362 6989 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_27590 8934 8566 gene locus_tag LOCUS_27600 8934 8566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 9160 9417 gene locus_tag LOCUS_27610 9160 9417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 9490 11472 gene locus_tag LOCUS_27620 9490 11472 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921322.1 protein_id gnl|my_center|LOCUS_27620 11675 12955 gene locus_tag LOCUS_27630 11675 12955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 15618 12976 gene locus_tag LOCUS_27640 15618 12976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 >Feature sequence115 5975 3525 gene locus_tag LOCUS_27650 5975 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 6643 5972 gene locus_tag LOCUS_27660 6643 5972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 9334 6680 gene locus_tag LOCUS_27670 9334 6680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 9813 9331 gene locus_tag LOCUS_27680 gene pssD 9813 9331 CDS product PssD/Cps14F family polysaccharide biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065325.1 protein_id gnl|my_center|LOCUS_27680 10770 10606 gene locus_tag LOCUS_27690 10770 10606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 10724 12061 gene locus_tag LOCUS_27700 10724 12061 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_27700 12193 14241 gene locus_tag LOCUS_27710 12193 14241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 15227 14316 gene locus_tag LOCUS_27720 15227 14316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 <16913 15490 gene locus_tag LOCUS_27730 <16913 15490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010865120.1:exopolygalacturonase PelB >Feature sequence116 349 1245 gene locus_tag LOCUS_27740 349 1245 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119121.1 protein_id gnl|my_center|LOCUS_27740 1684 1262 gene locus_tag LOCUS_27750 1684 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 2583 3638 gene locus_tag LOCUS_27760 2583 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 3846 6377 gene locus_tag LOCUS_27770 3846 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 6634 8583 gene locus_tag LOCUS_27780 6634 8583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 9876 10658 gene locus_tag LOCUS_27790 9876 10658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 10763 11692 gene locus_tag LOCUS_27800 gene ftsY 10763 11692 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941793.1 protein_id gnl|my_center|LOCUS_27800 14365 11738 gene locus_tag LOCUS_27810 14365 11738 CDS product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119311.1 protein_id gnl|my_center|LOCUS_27810 15130 14420 gene locus_tag LOCUS_27820 15130 14420 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_27820 16259 15276 gene locus_tag LOCUS_27830 16259 15276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 >Feature sequence117 1280 543 gene locus_tag LOCUS_27840 gene fabG 1280 543 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918744.1 protein_id gnl|my_center|LOCUS_27840 2170 1277 gene locus_tag LOCUS_27850 gene fabD 2170 1277 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245314.1 protein_id gnl|my_center|LOCUS_27850 3198 2167 gene locus_tag LOCUS_27860 gene plsX 3198 2167 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774380.1 protein_id gnl|my_center|LOCUS_27860 4111 3527 gene locus_tag LOCUS_27870 4111 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 4393 4578 gene locus_tag LOCUS_27880 4393 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 5940 4666 gene locus_tag LOCUS_27890 5940 4666 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852462.1 protein_id gnl|my_center|LOCUS_27890 7580 6261 gene locus_tag LOCUS_27900 7580 6261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 8854 7832 gene locus_tag LOCUS_27910 8854 7832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 8970 9560 gene locus_tag LOCUS_27920 8970 9560 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920592.1 protein_id gnl|my_center|LOCUS_27920 9532 10137 gene locus_tag LOCUS_27930 9532 10137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 10118 11155 gene locus_tag LOCUS_27940 10118 11155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 11324 13060 gene locus_tag LOCUS_27950 gene ilvD 11324 13060 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502719.1 protein_id gnl|my_center|LOCUS_27950 15707 13077 gene locus_tag LOCUS_27960 15707 13077 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272644.1 protein_id gnl|my_center|LOCUS_27960 16447 15704 gene locus_tag LOCUS_27970 16447 15704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 >Feature sequence118 <1 2065 gene locus_tag LOCUS_27980 <1 2065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943442.1:PAS domain S-box protein 2736 2080 gene locus_tag LOCUS_27990 gene thiE 2736 2080 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939368.1 protein_id gnl|my_center|LOCUS_27990 2936 2736 gene locus_tag LOCUS_28000 gene thiS 2936 2736 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919747.1 protein_id gnl|my_center|LOCUS_28000 4124 2991 gene locus_tag LOCUS_28010 gene thiH 4124 2991 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939370.1 protein_id gnl|my_center|LOCUS_28010 8026 4148 gene locus_tag LOCUS_28020 8026 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 8341 10764 gene locus_tag LOCUS_28030 8341 10764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 10761 11429 gene locus_tag LOCUS_28040 10761 11429 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_28040 11641 12207 gene locus_tag LOCUS_28050 11641 12207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 12388 13653 gene locus_tag LOCUS_28060 12388 13653 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_28060 16107 13669 gene locus_tag LOCUS_28070 16107 13669 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926008.1 protein_id gnl|my_center|LOCUS_28070 >Feature sequence119 114 812 gene locus_tag LOCUS_28080 gene tsaB 114 812 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_28080 809 1315 gene locus_tag LOCUS_28090 gene rimI 809 1315 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393645.1 protein_id gnl|my_center|LOCUS_28090 1333 3906 gene locus_tag LOCUS_28100 1333 3906 CDS product GH116 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156015680.1 protein_id gnl|my_center|LOCUS_28100 3942 4484 gene locus_tag LOCUS_28110 3942 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 4659 5282 gene locus_tag LOCUS_28120 gene coaE 4659 5282 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398928.1 protein_id gnl|my_center|LOCUS_28120 5272 5790 gene locus_tag LOCUS_28130 5272 5790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 5858 7039 gene locus_tag LOCUS_28140 5858 7039 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 protein_id gnl|my_center|LOCUS_28140 7229 8077 gene locus_tag LOCUS_28150 7229 8077 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111464.1 protein_id gnl|my_center|LOCUS_28150 8106 9434 gene locus_tag LOCUS_28160 8106 9434 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202787.1 protein_id gnl|my_center|LOCUS_28160 9682 10176 gene locus_tag LOCUS_28170 9682 10176 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875797.1 protein_id gnl|my_center|LOCUS_28170 11493 10327 gene locus_tag LOCUS_28180 11493 10327 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228926.1 protein_id gnl|my_center|LOCUS_28180 12595 11495 gene locus_tag LOCUS_28190 gene ald 12595 11495 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227783.1 protein_id gnl|my_center|LOCUS_28190 14349 12658 gene locus_tag LOCUS_28200 14349 12658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 15583 14618 gene locus_tag LOCUS_28210 15583 14618 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521614.1 protein_id gnl|my_center|LOCUS_28210 <16448 15631 gene locus_tag LOCUS_28220 <16448 15631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615550.1:sugar ABC transporter substrate-binding protein >Feature sequence120 128 2317 gene locus_tag LOCUS_28230 128 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 2555 3235 gene locus_tag LOCUS_28240 2555 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_28240 3238 5151 gene locus_tag LOCUS_28250 3238 5151 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_28250 5179 5943 gene locus_tag LOCUS_28260 5179 5943 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_28260 7075 5924 gene locus_tag LOCUS_28270 7075 5924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 7844 7101 gene locus_tag LOCUS_28280 7844 7101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 8144 7935 gene locus_tag LOCUS_28290 8144 7935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 8988 8170 gene locus_tag LOCUS_28300 8988 8170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 10441 9143 gene locus_tag LOCUS_28310 gene larA 10441 9143 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943907.1 protein_id gnl|my_center|LOCUS_28310 11215 10460 gene locus_tag LOCUS_28320 11215 10460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 12278 11193 gene locus_tag LOCUS_28330 12278 11193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 14752 12488 gene locus_tag LOCUS_28340 14752 12488 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_28340 16114 14807 gene locus_tag LOCUS_28350 16114 14807 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_28350 16327 16402 gene locus_tag LOCUS_t00300 16327 16402 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence121 <1 899 gene locus_tag LOCUS_28360 <1 899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119132.1:glycosyltransferase family 4 protein 949 2715 gene locus_tag LOCUS_28370 949 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 2932 3360 gene locus_tag LOCUS_28380 gene rplM 2932 3360 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016252.1 protein_id gnl|my_center|LOCUS_28380 3398 3802 gene locus_tag LOCUS_28390 gene rpsI 3398 3802 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546072.1 protein_id gnl|my_center|LOCUS_28390 4971 3955 gene locus_tag LOCUS_28400 4971 3955 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761737.1 protein_id gnl|my_center|LOCUS_28400 5255 6544 gene locus_tag LOCUS_28410 gene hflX 5255 6544 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804682.1 protein_id gnl|my_center|LOCUS_28410 6541 7011 gene locus_tag LOCUS_28420 6541 7011 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082285506.1 protein_id gnl|my_center|LOCUS_28420 7240 7878 gene locus_tag LOCUS_28430 7240 7878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 7903 8292 gene locus_tag LOCUS_28440 7903 8292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 8372 9916 gene locus_tag LOCUS_28450 8372 9916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 11120 9987 gene locus_tag LOCUS_28460 11120 9987 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787054.1 protein_id gnl|my_center|LOCUS_28460 11238 12833 gene locus_tag LOCUS_28470 11238 12833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 13094 14092 gene locus_tag LOCUS_28480 gene pta 13094 14092 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023515.1 protein_id gnl|my_center|LOCUS_28480 14154 15413 gene locus_tag LOCUS_28490 14154 15413 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986808.1 protein_id gnl|my_center|LOCUS_28490 15460 16053 gene locus_tag LOCUS_28500 gene pdxH 15460 16053 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918802.1 protein_id gnl|my_center|LOCUS_28500 >Feature sequence122 398 1615 gene locus_tag LOCUS_28510 gene gspF 398 1615 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718700.1 protein_id gnl|my_center|LOCUS_28510 1629 2075 gene locus_tag LOCUS_28520 gene gspG 1629 2075 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_28520 2087 2947 gene locus_tag LOCUS_28530 2087 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 2944 3468 gene locus_tag LOCUS_28540 2944 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 3475 4386 gene locus_tag LOCUS_28550 3475 4386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 4383 5459 gene locus_tag LOCUS_28560 4383 5459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 5456 7039 gene locus_tag LOCUS_28570 5456 7039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 7057 7590 gene locus_tag LOCUS_28580 7057 7590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 8127 9947 gene locus_tag LOCUS_28590 8127 9947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 9973 11097 gene locus_tag LOCUS_28600 9973 11097 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329383.1 protein_id gnl|my_center|LOCUS_28600 11126 12865 gene locus_tag LOCUS_28610 11126 12865 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 protein_id gnl|my_center|LOCUS_28610 12882 14120 gene locus_tag LOCUS_28620 12882 14120 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_28620 14166 15005 gene locus_tag LOCUS_28630 14166 15005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 15087 15938 gene locus_tag LOCUS_28640 15087 15938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 >Feature sequence123 1732 1989 gene locus_tag LOCUS_28650 1732 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 2000 2947 gene locus_tag LOCUS_28660 2000 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 3394 3687 gene locus_tag LOCUS_28670 3394 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 3671 4048 gene locus_tag LOCUS_28680 3671 4048 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393092.1 protein_id gnl|my_center|LOCUS_28680 4225 5256 gene locus_tag LOCUS_28690 4225 5256 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142473.1 protein_id gnl|my_center|LOCUS_28690 5400 8453 gene locus_tag LOCUS_28700 5400 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 10984 8450 gene locus_tag LOCUS_28710 10984 8450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 13225 11198 gene locus_tag LOCUS_28720 13225 11198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 15921 13222 gene locus_tag LOCUS_28730 15921 13222 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615720.1 protein_id gnl|my_center|LOCUS_28730 >Feature sequence124 69 488 gene locus_tag LOCUS_28740 69 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 1119 505 gene locus_tag LOCUS_28750 1119 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 2158 1505 gene locus_tag LOCUS_28760 2158 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 2691 2149 gene locus_tag LOCUS_28770 2691 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 3616 3215 gene locus_tag LOCUS_28780 3616 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 5263 3626 gene locus_tag LOCUS_28790 5263 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 6006 5260 gene locus_tag LOCUS_28800 6006 5260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 6687 6025 gene locus_tag LOCUS_28810 6687 6025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 7234 6704 gene locus_tag LOCUS_28820 7234 6704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 7815 7231 gene locus_tag LOCUS_28830 7815 7231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 8237 7812 gene locus_tag LOCUS_28840 8237 7812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 8716 8303 gene locus_tag LOCUS_28850 8716 8303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 9448 8735 gene locus_tag LOCUS_28860 9448 8735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 10427 9504 gene locus_tag LOCUS_28870 10427 9504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 11460 10450 gene locus_tag LOCUS_28880 11460 10450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 12005 11565 gene locus_tag LOCUS_28890 12005 11565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 12421 12002 gene locus_tag LOCUS_28900 12421 12002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 13287 12418 gene locus_tag LOCUS_28910 13287 12418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 14347 13493 gene locus_tag LOCUS_28920 14347 13493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 14995 14648 gene locus_tag LOCUS_28930 14995 14648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 >Feature sequence125 1166 192 gene locus_tag LOCUS_28940 1166 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 1719 1414 gene locus_tag LOCUS_28950 1719 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 2191 2712 gene locus_tag LOCUS_28960 2191 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 2806 4020 gene locus_tag LOCUS_28970 2806 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 4083 5210 gene locus_tag LOCUS_28980 4083 5210 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943264.1 protein_id gnl|my_center|LOCUS_28980 6203 5223 gene locus_tag LOCUS_28990 6203 5223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 6487 7203 gene locus_tag LOCUS_29000 6487 7203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 7259 8575 gene locus_tag LOCUS_29010 7259 8575 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_29010 9563 8622 gene locus_tag LOCUS_29020 9563 8622 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263776.1 protein_id gnl|my_center|LOCUS_29020 10316 9585 gene locus_tag LOCUS_29030 10316 9585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 10431 13871 gene locus_tag LOCUS_29040 10431 13871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 14260 13880 gene locus_tag LOCUS_29050 14260 13880 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_29050 15102 14257 gene locus_tag LOCUS_29060 15102 14257 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_29060 >Feature sequence126 301 3297 gene locus_tag LOCUS_29070 301 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 3597 4910 gene locus_tag LOCUS_29080 gene xylA 3597 4910 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118969.1 protein_id gnl|my_center|LOCUS_29080 5051 7366 gene locus_tag LOCUS_29090 5051 7366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 8762 7719 gene locus_tag LOCUS_29100 8762 7719 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665981.1 protein_id gnl|my_center|LOCUS_29100 8992 11346 gene locus_tag LOCUS_29110 8992 11346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 12403 12502 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12664 13140 gene locus_tag LOCUS_29120 12664 13140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 13140 13406 gene locus_tag LOCUS_29130 13140 13406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 13445 13756 gene locus_tag LOCUS_29140 13445 13756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 13756 14253 gene locus_tag LOCUS_29150 13756 14253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 15701 14280 gene locus_tag LOCUS_29160 15701 14280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 >Feature sequence127 946 365 gene locus_tag LOCUS_29170 946 365 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943415.1 protein_id gnl|my_center|LOCUS_29170 1410 2828 gene locus_tag LOCUS_29180 1410 2828 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943931.1 protein_id gnl|my_center|LOCUS_29180 4781 2877 gene locus_tag LOCUS_29190 4781 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 5061 5744 gene locus_tag LOCUS_29200 5061 5744 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762936.1 protein_id gnl|my_center|LOCUS_29200 5973 6386 gene locus_tag LOCUS_29210 5973 6386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 6487 8520 gene locus_tag LOCUS_29220 6487 8520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 9523 8630 gene locus_tag LOCUS_29230 gene dapA 9523 8630 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392582.1 protein_id gnl|my_center|LOCUS_29230 10940 9555 gene locus_tag LOCUS_29240 10940 9555 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877197.1 protein_id gnl|my_center|LOCUS_29240 11032 12450 gene locus_tag LOCUS_29250 11032 12450 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080611.1 protein_id gnl|my_center|LOCUS_29250 12447 13346 gene locus_tag LOCUS_29260 12447 13346 CDS product tagatose-bisphosphate aldolase subunit GatY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861804.1 protein_id gnl|my_center|LOCUS_29260 13386 14891 gene locus_tag LOCUS_29270 gene xylB 13386 14891 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270490.1 protein_id gnl|my_center|LOCUS_29270 >Feature sequence128 1941 1135 gene locus_tag LOCUS_29280 1941 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 6400 2018 gene locus_tag LOCUS_29290 6400 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 6897 7748 gene locus_tag LOCUS_29300 6897 7748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 7942 9246 gene locus_tag LOCUS_29310 7942 9246 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_29310 9249 10133 gene locus_tag LOCUS_29320 9249 10133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 12480 10165 gene locus_tag LOCUS_29330 12480 10165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 12675 13892 gene locus_tag LOCUS_29340 12675 13892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 15322 13997 gene locus_tag LOCUS_29350 15322 13997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 >Feature sequence129 <1 689 gene locus_tag LOCUS_29360 <1 689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679811.1:ISNCY-like element ISTde1 family transposase 1042 1992 gene locus_tag LOCUS_29370 1042 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 2291 4057 gene locus_tag LOCUS_29380 2291 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 5181 4885 gene locus_tag LOCUS_29390 5181 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 5074 5541 gene locus_tag LOCUS_29400 5074 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 5535 6314 gene locus_tag LOCUS_29410 gene hisF 5535 6314 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937595.1 protein_id gnl|my_center|LOCUS_29410 6535 10407 gene locus_tag LOCUS_29420 6535 10407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 10475 11380 gene locus_tag LOCUS_29430 10475 11380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 11531 11980 gene locus_tag LOCUS_29440 gene dtd 11531 11980 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080996.1 protein_id gnl|my_center|LOCUS_29440 12006 12950 gene locus_tag LOCUS_29450 gene fmt 12006 12950 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114642.1 protein_id gnl|my_center|LOCUS_29450 12952 14013 gene locus_tag LOCUS_29460 12952 14013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 14047 14649 gene locus_tag LOCUS_29470 14047 14649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 >Feature sequence130 1101 97 gene locus_tag LOCUS_29480 1101 97 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_29480 1596 1276 gene locus_tag LOCUS_29490 gene trxA 1596 1276 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020199.1 protein_id gnl|my_center|LOCUS_29490 1884 1976 gene locus_tag LOCUS_t00310 1884 1976 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2077 3123 gene locus_tag LOCUS_29500 gene waaC 2077 3123 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942882.1 protein_id gnl|my_center|LOCUS_29500 3248 4153 gene locus_tag LOCUS_29510 3248 4153 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582497.1 protein_id gnl|my_center|LOCUS_29510 4157 5239 gene locus_tag LOCUS_29520 4157 5239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 6115 5330 gene locus_tag LOCUS_29530 6115 5330 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389482.1 protein_id gnl|my_center|LOCUS_29530 7448 6087 gene locus_tag LOCUS_29540 7448 6087 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_29540 8938 7445 gene locus_tag LOCUS_29550 8938 7445 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228155.1 protein_id gnl|my_center|LOCUS_29550 9450 8944 gene locus_tag LOCUS_29560 9450 8944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 11975 9447 gene locus_tag LOCUS_29570 11975 9447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 12895 11972 gene locus_tag LOCUS_29580 12895 11972 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392130.1 protein_id gnl|my_center|LOCUS_29580 13320 13018 gene locus_tag LOCUS_29590 13320 13018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 14725 13424 gene locus_tag LOCUS_29600 gene eno 14725 13424 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_29600 >Feature sequence131 <1 836 gene locus_tag LOCUS_29610 <1 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226064.1:glycoside hydrolase family 28 protein 926 1249 gene locus_tag LOCUS_29620 926 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 1321 2628 gene locus_tag LOCUS_29630 1321 2628 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057723.1 protein_id gnl|my_center|LOCUS_29630 2647 2880 gene locus_tag LOCUS_29640 2647 2880 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868932.1 protein_id gnl|my_center|LOCUS_29640 2880 3608 gene locus_tag LOCUS_29650 2880 3608 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870595.1 protein_id gnl|my_center|LOCUS_29650 3666 4997 gene locus_tag LOCUS_29660 3666 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 5029 5727 gene locus_tag LOCUS_29670 5029 5727 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943589.1 protein_id gnl|my_center|LOCUS_29670 5796 6176 gene locus_tag LOCUS_29680 5796 6176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 6193 6525 gene locus_tag LOCUS_29690 6193 6525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392788.1 protein_id gnl|my_center|LOCUS_29690 6589 6978 gene locus_tag LOCUS_29700 6589 6978 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938935.1 protein_id gnl|my_center|LOCUS_29700 6975 7829 gene locus_tag LOCUS_29710 6975 7829 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289730.1 protein_id gnl|my_center|LOCUS_29710 7830 9068 gene locus_tag LOCUS_29720 gene arsB 7830 9068 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118066.1 protein_id gnl|my_center|LOCUS_29720 9205 10116 gene locus_tag LOCUS_29730 9205 10116 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141082.1 protein_id gnl|my_center|LOCUS_29730 12328 10181 gene locus_tag LOCUS_29740 12328 10181 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_29740 12564 14003 gene locus_tag LOCUS_29750 gene atpD 12564 14003 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065404.1 protein_id gnl|my_center|LOCUS_29750 14007 14399 gene locus_tag LOCUS_29760 14007 14399 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120166.1 protein_id gnl|my_center|LOCUS_29760 14386 14700 gene locus_tag LOCUS_29770 14386 14700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 14734 15054 gene locus_tag LOCUS_29780 14734 15054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 >Feature sequence132 762 367 gene locus_tag LOCUS_29790 762 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 2611 875 gene locus_tag LOCUS_29800 2611 875 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776870.1 protein_id gnl|my_center|LOCUS_29800 3023 4711 gene locus_tag LOCUS_29810 3023 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 4719 5963 gene locus_tag LOCUS_29820 gene fabF 4719 5963 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_29820 5960 8470 gene locus_tag LOCUS_29830 5960 8470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 8474 10408 gene locus_tag LOCUS_29840 8474 10408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 10386 11765 gene locus_tag LOCUS_29850 10386 11765 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_29850 11892 12800 gene locus_tag LOCUS_29860 11892 12800 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174155.1 protein_id gnl|my_center|LOCUS_29860 13221 12850 gene locus_tag LOCUS_29870 13221 12850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 13441 14808 gene locus_tag LOCUS_29880 13441 14808 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937988.1 protein_id gnl|my_center|LOCUS_29880 >Feature sequence133 474 1733 gene locus_tag LOCUS_29890 474 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 1933 3951 gene locus_tag LOCUS_29900 1933 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 4120 5715 gene locus_tag LOCUS_29910 4120 5715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 5804 9259 gene locus_tag LOCUS_29920 5804 9259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 9559 9906 gene locus_tag LOCUS_29930 9559 9906 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720289.1 protein_id gnl|my_center|LOCUS_29930 10013 11437 gene locus_tag LOCUS_29940 gene glnA 10013 11437 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_29940 12163 11591 gene locus_tag LOCUS_29950 12163 11591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 12873 13847 gene locus_tag LOCUS_29960 12873 13847 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530262.1 protein_id gnl|my_center|LOCUS_29960 13882 14847 gene locus_tag LOCUS_29970 gene thpA 13882 14847 CDS product sugar ABC transporter xylitol/D-threitol-binding protein ThpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729193.1 protein_id gnl|my_center|LOCUS_29970 >Feature sequence134 319 1932 gene locus_tag LOCUS_29980 319 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 3911 1968 gene locus_tag LOCUS_29990 3911 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 4951 4001 gene locus_tag LOCUS_30000 4951 4001 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_30000 5115 6119 gene locus_tag LOCUS_30010 5115 6119 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972764.1 protein_id gnl|my_center|LOCUS_30010 6173 8692 gene locus_tag LOCUS_30020 6173 8692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 8933 10486 gene locus_tag LOCUS_30030 8933 10486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 10639 12774 gene locus_tag LOCUS_30040 10639 12774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 12818 13558 gene locus_tag LOCUS_30050 12818 13558 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334461.1 protein_id gnl|my_center|LOCUS_30050 14423 13569 gene locus_tag LOCUS_30060 14423 13569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 >Feature sequence135 2555 132 gene locus_tag LOCUS_30070 2555 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 5466 2824 gene locus_tag LOCUS_30080 5466 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 7156 5648 gene locus_tag LOCUS_30090 7156 5648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 8013 7216 gene locus_tag LOCUS_30100 8013 7216 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867222.1 protein_id gnl|my_center|LOCUS_30100 8759 8010 gene locus_tag LOCUS_30110 8759 8010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 10977 8746 gene locus_tag LOCUS_30120 10977 8746 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545662.1 protein_id gnl|my_center|LOCUS_30120 11475 11083 gene locus_tag LOCUS_30130 11475 11083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 13108 11522 gene locus_tag LOCUS_30140 13108 11522 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195899535.1 protein_id gnl|my_center|LOCUS_30140 13258 14289 gene locus_tag LOCUS_30150 13258 14289 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615657.1 protein_id gnl|my_center|LOCUS_30150 >Feature sequence136 2420 1404 gene locus_tag LOCUS_30160 gene pheS 2420 1404 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_30160 3119 2442 gene locus_tag LOCUS_30170 3119 2442 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_30170 5016 3220 gene locus_tag LOCUS_30180 5016 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 5922 5023 gene locus_tag LOCUS_30190 5922 5023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 6882 5923 gene locus_tag LOCUS_30200 6882 5923 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325468.1 protein_id gnl|my_center|LOCUS_30200 8379 7270 gene locus_tag LOCUS_30210 8379 7270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 8487 9737 gene locus_tag LOCUS_30220 8487 9737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 10543 9665 gene locus_tag LOCUS_30230 gene pssA 10543 9665 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546557.1 protein_id gnl|my_center|LOCUS_30230 11187 10540 gene locus_tag LOCUS_30240 11187 10540 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196436.1 protein_id gnl|my_center|LOCUS_30240 11882 11187 gene locus_tag LOCUS_30250 gene radC 11882 11187 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392073.1 protein_id gnl|my_center|LOCUS_30250 12727 11879 gene locus_tag LOCUS_30260 gene prmC 12727 11879 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_30260 13803 12727 gene locus_tag LOCUS_30270 gene prfA 13803 12727 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545879.1 protein_id gnl|my_center|LOCUS_30270 14016 13813 gene locus_tag LOCUS_30280 gene rpmE 14016 13813 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_30280 >Feature sequence137 2606 615 gene locus_tag LOCUS_30290 2606 615 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941395.1 protein_id gnl|my_center|LOCUS_30290 3317 2622 gene locus_tag LOCUS_30300 3317 2622 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941396.1 protein_id gnl|my_center|LOCUS_30300 4317 3484 gene locus_tag LOCUS_30310 4317 3484 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_30310 5370 4393 gene locus_tag LOCUS_30320 5370 4393 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314820.1 protein_id gnl|my_center|LOCUS_30320 5369 5746 gene locus_tag LOCUS_30330 5369 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 5743 7065 gene locus_tag LOCUS_30340 5743 7065 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_30340 9418 7106 gene locus_tag LOCUS_30350 9418 7106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227787.1 protein_id gnl|my_center|LOCUS_30350 11045 9471 gene locus_tag LOCUS_30360 11045 9471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 12290 11151 gene locus_tag LOCUS_30370 12290 11151 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_30370 13366 13459 gene locus_tag LOCUS_t00320 13366 13459 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence138 1549 2577 gene locus_tag LOCUS_30380 1549 2577 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008192388.1 protein_id gnl|my_center|LOCUS_30380 2579 3532 gene locus_tag LOCUS_30390 2579 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 3546 4529 gene locus_tag LOCUS_30400 3546 4529 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615404.1 protein_id gnl|my_center|LOCUS_30400 5034 6203 gene locus_tag LOCUS_30410 gene yghO 5034 6203 CDS product protein YghO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305975.1 protein_id gnl|my_center|LOCUS_30410 7245 6247 gene locus_tag LOCUS_30420 7245 6247 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524032.1 protein_id gnl|my_center|LOCUS_30420 8267 7296 gene locus_tag LOCUS_30430 gene pfkA 8267 7296 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173968.1 protein_id gnl|my_center|LOCUS_30430 10192 8282 gene locus_tag LOCUS_30440 10192 8282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 10810 10196 gene locus_tag LOCUS_30450 10810 10196 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_30450 11166 12206 gene locus_tag LOCUS_30460 11166 12206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 12327 14069 gene locus_tag LOCUS_30470 12327 14069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 >Feature sequence139 1327 377 gene locus_tag LOCUS_30480 1327 377 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242543.1 protein_id gnl|my_center|LOCUS_30480 1514 1894 gene locus_tag LOCUS_30490 1514 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 1840 2727 gene locus_tag LOCUS_30500 gene murB 1840 2727 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460695.1 protein_id gnl|my_center|LOCUS_30500 3065 2736 gene locus_tag LOCUS_30510 3065 2736 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_30510 3263 4696 gene locus_tag LOCUS_30520 gene hisS 3263 4696 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921342.1 protein_id gnl|my_center|LOCUS_30520 4758 5774 gene locus_tag LOCUS_30530 4758 5774 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986252.1 protein_id gnl|my_center|LOCUS_30530 8340 5884 gene locus_tag LOCUS_30540 gene priA 8340 5884 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405449.1 protein_id gnl|my_center|LOCUS_30540 8959 8363 gene locus_tag LOCUS_30550 8959 8363 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 protein_id gnl|my_center|LOCUS_30550 10719 9037 gene locus_tag LOCUS_30560 10719 9037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 >Feature sequence140 182 1159 gene locus_tag LOCUS_30570 gene pdxA 182 1159 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392248.1 protein_id gnl|my_center|LOCUS_30570 1152 2420 gene locus_tag LOCUS_30580 1152 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 4638 2446 gene locus_tag LOCUS_30590 4638 2446 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942341.1 protein_id gnl|my_center|LOCUS_30590 5704 4631 gene locus_tag LOCUS_30600 5704 4631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 6723 5710 gene locus_tag LOCUS_30610 6723 5710 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_30610 7952 6987 gene locus_tag LOCUS_30620 7952 6987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 8207 9313 gene locus_tag LOCUS_30630 8207 9313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 9350 11839 gene locus_tag LOCUS_30640 9350 11839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 13706 11901 gene locus_tag LOCUS_30650 13706 11901 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939685.1 protein_id gnl|my_center|LOCUS_30650 >Feature sequence141 1486 2388 gene locus_tag LOCUS_30660 1486 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 2592 3701 gene locus_tag LOCUS_30670 2592 3701 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461032.1 protein_id gnl|my_center|LOCUS_30670 5344 3683 gene locus_tag LOCUS_30680 5344 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 7151 5394 gene locus_tag LOCUS_30690 7151 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 9529 7184 gene locus_tag LOCUS_30700 9529 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 9954 9526 gene locus_tag LOCUS_30710 9954 9526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 10703 9951 gene locus_tag LOCUS_30720 10703 9951 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021216.1 protein_id gnl|my_center|LOCUS_30720 12703 10823 gene locus_tag LOCUS_30730 12703 10823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 <13886 12817 gene locus_tag LOCUS_30740 <13886 12817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804705.1:cell division protein FtsZ >Feature sequence142 74 1381 gene locus_tag LOCUS_30750 74 1381 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837901.1 protein_id gnl|my_center|LOCUS_30750 1378 4434 gene locus_tag LOCUS_30760 1378 4434 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402871.1 protein_id gnl|my_center|LOCUS_30760 4440 5156 gene locus_tag LOCUS_30770 4440 5156 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122349.1 protein_id gnl|my_center|LOCUS_30770 7033 5168 gene locus_tag LOCUS_30780 7033 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 8384 7164 gene locus_tag LOCUS_30790 8384 7164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328450.1 protein_id gnl|my_center|LOCUS_30790 9548 8406 gene locus_tag LOCUS_30800 9548 8406 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_30800 10563 9667 gene locus_tag LOCUS_30810 10563 9667 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331327.1 protein_id gnl|my_center|LOCUS_30810 <13850 10774 gene locus_tag LOCUS_30820 <13850 10774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065773.1:PKD domain-containing protein >Feature sequence143 566 228 gene locus_tag LOCUS_30830 566 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 1548 613 gene locus_tag LOCUS_30840 1548 613 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140504.1 protein_id gnl|my_center|LOCUS_30840 1857 2618 gene locus_tag LOCUS_30850 1857 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 2723 3964 gene locus_tag LOCUS_30860 2723 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 4090 4476 gene locus_tag LOCUS_30870 4090 4476 CDS product Rid family detoxifying hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705513.1 protein_id gnl|my_center|LOCUS_30870 4486 5766 gene locus_tag LOCUS_30880 4486 5766 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942406.1 protein_id gnl|my_center|LOCUS_30880 5842 7872 gene locus_tag LOCUS_30890 5842 7872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 7869 9710 gene locus_tag LOCUS_30900 7869 9710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 10069 9803 gene locus_tag LOCUS_30910 gene rpsT 10069 9803 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094744.1 protein_id gnl|my_center|LOCUS_30910 10294 11229 gene locus_tag LOCUS_30920 10294 11229 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082403.1 protein_id gnl|my_center|LOCUS_30920 11229 12173 gene locus_tag LOCUS_30930 11229 12173 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022353.1 protein_id gnl|my_center|LOCUS_30930 12980 12288 gene locus_tag LOCUS_30940 12980 12288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 >Feature sequence144 1444 290 gene locus_tag LOCUS_30950 1444 290 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022270.1 protein_id gnl|my_center|LOCUS_30950 4312 1703 gene locus_tag LOCUS_30960 gene leuS 4312 1703 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403694.1 protein_id gnl|my_center|LOCUS_30960 4502 6049 gene locus_tag LOCUS_30970 4502 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140647.1 protein_id gnl|my_center|LOCUS_30970 6105 9230 gene locus_tag LOCUS_30980 6105 9230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 9354 9689 gene locus_tag LOCUS_30990 9354 9689 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815036.1 protein_id gnl|my_center|LOCUS_30990 9690 10622 gene locus_tag LOCUS_31000 gene fmt 9690 10622 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392417.1 protein_id gnl|my_center|LOCUS_31000 10626 11948 gene locus_tag LOCUS_31010 gene rsmB 10626 11948 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_31010 11858 13018 gene locus_tag LOCUS_31020 11858 13018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 >Feature sequence145 288 1163 gene locus_tag LOCUS_31030 288 1163 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 protein_id gnl|my_center|LOCUS_31030 1222 1449 gene locus_tag LOCUS_31040 1222 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 1592 4333 gene locus_tag LOCUS_31050 1592 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 4330 5484 gene locus_tag LOCUS_31060 4330 5484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 5465 6550 gene locus_tag LOCUS_31070 5465 6550 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600562.1 protein_id gnl|my_center|LOCUS_31070 6763 8658 gene locus_tag LOCUS_31080 6763 8658 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244150.1 protein_id gnl|my_center|LOCUS_31080 8713 10713 gene locus_tag LOCUS_31090 8713 10713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 >Feature sequence146 400 1359 gene locus_tag LOCUS_31100 400 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 2889 1390 gene locus_tag LOCUS_31110 2889 1390 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080375.1 protein_id gnl|my_center|LOCUS_31110 3570 2911 gene locus_tag LOCUS_31120 3570 2911 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067924.1 protein_id gnl|my_center|LOCUS_31120 4012 3587 gene locus_tag LOCUS_31130 4012 3587 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392860.1 protein_id gnl|my_center|LOCUS_31130 4705 4022 gene locus_tag LOCUS_31140 4705 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 6537 4702 gene locus_tag LOCUS_31150 6537 4702 CDS product KinB sensor domain-containing domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114120.1 protein_id gnl|my_center|LOCUS_31150 6756 8714 gene locus_tag LOCUS_31160 6756 8714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 8951 9838 gene locus_tag LOCUS_31170 8951 9838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 9955 10491 gene locus_tag LOCUS_31180 9955 10491 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090500.1 protein_id gnl|my_center|LOCUS_31180 11710 10607 gene locus_tag LOCUS_31190 11710 10607 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_31190 12369 11722 gene locus_tag LOCUS_31200 12369 11722 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530499.1 protein_id gnl|my_center|LOCUS_31200 13063 12458 gene locus_tag LOCUS_31210 13063 12458 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921582.1 protein_id gnl|my_center|LOCUS_31210 >Feature sequence147 30 1442 gene locus_tag LOCUS_31220 30 1442 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391508.1 protein_id gnl|my_center|LOCUS_31220 1467 2453 gene locus_tag LOCUS_31230 1467 2453 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942316.1 protein_id gnl|my_center|LOCUS_31230 2608 2748 gene locus_tag LOCUS_31240 2608 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 2909 4510 gene locus_tag LOCUS_31250 2909 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 7004 4527 gene locus_tag LOCUS_31260 7004 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 7460 7858 gene locus_tag LOCUS_31270 7460 7858 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256808.1 protein_id gnl|my_center|LOCUS_31270 7900 11391 gene locus_tag LOCUS_31280 7900 11391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 11675 11421 gene locus_tag LOCUS_31290 11675 11421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 13120 12266 gene locus_tag LOCUS_31300 13120 12266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 >Feature sequence148 <1 768 gene locus_tag LOCUS_31310 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943898.1:TatD family hydrolase 769 1485 gene locus_tag LOCUS_31320 769 1485 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184121.1 protein_id gnl|my_center|LOCUS_31320 1821 1510 gene locus_tag LOCUS_31330 1821 1510 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256312.1 protein_id gnl|my_center|LOCUS_31330 3575 1818 gene locus_tag LOCUS_31340 3575 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 3723 4688 gene locus_tag LOCUS_31350 3723 4688 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767200.1 protein_id gnl|my_center|LOCUS_31350 6447 4726 gene locus_tag LOCUS_31360 6447 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 8742 6502 gene locus_tag LOCUS_31370 8742 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 9696 8971 gene locus_tag LOCUS_31380 9696 8971 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899455.1 protein_id gnl|my_center|LOCUS_31380 10835 9693 gene locus_tag LOCUS_31390 10835 9693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 >Feature sequence149 2013 3761 gene locus_tag LOCUS_31400 2013 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 3898 4713 gene locus_tag LOCUS_31410 3898 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 4802 6097 gene locus_tag LOCUS_31420 4802 6097 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_31420 6110 8176 gene locus_tag LOCUS_31430 6110 8176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 8362 11298 gene locus_tag LOCUS_31440 8362 11298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 <13060 11393 gene locus_tag LOCUS_31450 <13060 11393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226869.1:alpha-galactosidase >Feature sequence150 376 451 gene locus_tag LOCUS_t00330 376 451 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 986 1252 gene locus_tag LOCUS_31460 986 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 1174 1956 gene locus_tag LOCUS_31470 1174 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 4684 2234 gene locus_tag LOCUS_31480 4684 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 5780 4968 gene locus_tag LOCUS_31490 5780 4968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 5908 9243 gene locus_tag LOCUS_31500 5908 9243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 9261 11579 gene locus_tag LOCUS_31510 9261 11579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 <12950 11634 gene locus_tag LOCUS_31520 <12950 11634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036949.1:sodium/sugar symporter >Feature sequence151 <1 596 gene locus_tag LOCUS_31530 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928465.1:IPT/TIG domain-containing protein 713 2200 gene locus_tag LOCUS_31540 713 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 2230 2667 gene locus_tag LOCUS_31550 2230 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 2815 3111 gene locus_tag LOCUS_31560 2815 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 4472 4056 gene locus_tag LOCUS_31570 4472 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 4559 4804 gene locus_tag LOCUS_31580 4559 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 4788 7787 gene locus_tag LOCUS_31590 4788 7787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 7806 8918 gene locus_tag LOCUS_31600 gene xerD 7806 8918 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_31600 9574 9981 gene locus_tag LOCUS_31610 9574 9981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 9989 10303 gene locus_tag LOCUS_31620 9989 10303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 10506 11936 gene locus_tag LOCUS_31630 10506 11936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 12371 12586 gene locus_tag LOCUS_31640 12371 12586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 >Feature sequence152 1190 231 gene locus_tag LOCUS_31650 1190 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 2847 1192 gene locus_tag LOCUS_31660 2847 1192 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174683.1 protein_id gnl|my_center|LOCUS_31660 2982 3081 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3462 3094 gene locus_tag LOCUS_31670 3462 3094 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769565.1 protein_id gnl|my_center|LOCUS_31670 4203 3778 gene locus_tag LOCUS_31680 4203 3778 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119424.1 protein_id gnl|my_center|LOCUS_31680 5195 4599 gene locus_tag LOCUS_31690 5195 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 7144 5231 gene locus_tag LOCUS_31700 7144 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 7756 9498 gene locus_tag LOCUS_31710 gene dnaX 7756 9498 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963452.1 protein_id gnl|my_center|LOCUS_31710 9720 10151 gene locus_tag LOCUS_31720 9720 10151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 10233 10796 gene locus_tag LOCUS_31730 10233 10796 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_31730 10867 12387 gene locus_tag LOCUS_31740 10867 12387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 >Feature sequence153 3164 4294 gene locus_tag LOCUS_31750 3164 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 4989 4351 gene locus_tag LOCUS_31760 4989 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 4918 5100 gene locus_tag LOCUS_31770 4918 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 5321 5734 gene locus_tag LOCUS_31780 5321 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 5879 7675 gene locus_tag LOCUS_31790 5879 7675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 8095 8397 gene locus_tag LOCUS_31800 8095 8397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 8381 8821 gene locus_tag LOCUS_31810 8381 8821 CDS product lasso peptide biosynthesis B2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337565.1 protein_id gnl|my_center|LOCUS_31810 9106 10071 gene locus_tag LOCUS_31820 9106 10071 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626495.1 protein_id gnl|my_center|LOCUS_31820 10076 11107 gene locus_tag LOCUS_31830 10076 11107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 11112 12161 gene locus_tag LOCUS_31840 11112 12161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 >Feature sequence154 <1 650 gene locus_tag LOCUS_31850 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931819.1:1-deoxy-D-xylulose-5-phosphate reductoisomerase 782 3259 gene locus_tag LOCUS_31860 782 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 4906 3551 gene locus_tag LOCUS_31870 4906 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 5382 7076 gene locus_tag LOCUS_31880 5382 7076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 7285 8598 gene locus_tag LOCUS_31890 7285 8598 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_31890 8606 10054 gene locus_tag LOCUS_31900 gene pyk 8606 10054 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258979.1 protein_id gnl|my_center|LOCUS_31900 10058 10813 gene locus_tag LOCUS_31910 10058 10813 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582685.1 protein_id gnl|my_center|LOCUS_31910 >Feature sequence155 2767 194 gene locus_tag LOCUS_31920 2767 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 3099 2863 gene locus_tag LOCUS_31930 3099 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 3316 4047 gene locus_tag LOCUS_31940 3316 4047 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391918.1 protein_id gnl|my_center|LOCUS_31940 4060 4920 gene locus_tag LOCUS_31950 4060 4920 CDS product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072774223.1 protein_id gnl|my_center|LOCUS_31950 4924 5985 gene locus_tag LOCUS_31960 4924 5985 CDS product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072774223.1 protein_id gnl|my_center|LOCUS_31960 6957 6058 gene locus_tag LOCUS_31970 6957 6058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 7549 7184 gene locus_tag LOCUS_31980 7549 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 9135 7954 gene locus_tag LOCUS_31990 9135 7954 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541328.1 protein_id gnl|my_center|LOCUS_31990 9665 11422 gene locus_tag LOCUS_32000 gene dnaG 9665 11422 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392160.1 protein_id gnl|my_center|LOCUS_32000 >Feature sequence156 89 1264 gene locus_tag LOCUS_32010 89 1264 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048382.1 protein_id gnl|my_center|LOCUS_32010 1351 2619 gene locus_tag LOCUS_32020 1351 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 2689 5223 gene locus_tag LOCUS_32030 2689 5223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 6341 5244 gene locus_tag LOCUS_32040 6341 5244 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880449.1 protein_id gnl|my_center|LOCUS_32040 7987 6770 gene locus_tag LOCUS_32050 gene rifK 7987 6770 CDS product 3-amino-5-hydroxybenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222557.1 protein_id gnl|my_center|LOCUS_32050 8342 8476 gene locus_tag LOCUS_32060 8342 8476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 8937 9857 gene locus_tag LOCUS_32070 8937 9857 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257319.1 protein_id gnl|my_center|LOCUS_32070 9893 10558 gene locus_tag LOCUS_32080 9893 10558 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256490.1 protein_id gnl|my_center|LOCUS_32080 10830 11900 gene locus_tag LOCUS_32090 10830 11900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 >Feature sequence157 2077 560 gene locus_tag LOCUS_32100 2077 560 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462181.1 protein_id gnl|my_center|LOCUS_32100 3979 2096 gene locus_tag LOCUS_32110 3979 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 6477 4075 gene locus_tag LOCUS_32120 6477 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 6918 8186 gene locus_tag LOCUS_32130 6918 8186 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878099.1 protein_id gnl|my_center|LOCUS_32130 8235 9803 gene locus_tag LOCUS_32140 8235 9803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 9995 10879 gene locus_tag LOCUS_32150 9995 10879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 >Feature sequence158 2612 585 gene locus_tag LOCUS_32160 2612 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 3243 2617 gene locus_tag LOCUS_32170 3243 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 3401 3240 gene locus_tag LOCUS_32180 3401 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 4813 3434 gene locus_tag LOCUS_32190 4813 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 5672 8212 gene locus_tag LOCUS_32200 5672 8212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 8212 8889 gene locus_tag LOCUS_32210 8212 8889 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943846.1 protein_id gnl|my_center|LOCUS_32210 9180 11057 gene locus_tag LOCUS_32220 9180 11057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 >Feature sequence159 248 1549 gene locus_tag LOCUS_32230 248 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 3266 1638 gene locus_tag LOCUS_32240 3266 1638 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021660.1 protein_id gnl|my_center|LOCUS_32240 4113 3352 gene locus_tag LOCUS_32250 4113 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 7103 4266 gene locus_tag LOCUS_32260 7103 4266 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_32260 7304 8308 gene locus_tag LOCUS_32270 7304 8308 CDS product 3'(2'),5'-bisphosphate nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404078.1 protein_id gnl|my_center|LOCUS_32270 9371 8415 gene locus_tag LOCUS_32280 9371 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 10363 9566 gene locus_tag LOCUS_32290 10363 9566 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455757.1 protein_id gnl|my_center|LOCUS_32290 >Feature sequence160 60 1211 gene locus_tag LOCUS_32300 gene purD 60 1211 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_32300 2171 1242 gene locus_tag LOCUS_32310 2171 1242 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943987.1 protein_id gnl|my_center|LOCUS_32310 2427 2843 gene locus_tag LOCUS_32320 2427 2843 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_32320 3691 2897 gene locus_tag LOCUS_32330 3691 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 4135 5025 gene locus_tag LOCUS_32340 4135 5025 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_32340 5027 6553 gene locus_tag LOCUS_32350 gene purF 5027 6553 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_32350 8523 6604 gene locus_tag LOCUS_32360 gene dxs 8523 6604 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393020.1 protein_id gnl|my_center|LOCUS_32360 10192 8645 gene locus_tag LOCUS_32370 10192 8645 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481647.1 protein_id gnl|my_center|LOCUS_32370 >Feature sequence161 469 383 gene locus_tag LOCUS_t00340 469 383 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 746 1465 gene locus_tag LOCUS_32380 gene recO 746 1465 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119985.1 protein_id gnl|my_center|LOCUS_32380 1505 3319 gene locus_tag LOCUS_32390 gene lepA 1505 3319 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392118.1 protein_id gnl|my_center|LOCUS_32390 3325 4632 gene locus_tag LOCUS_32400 3325 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 4742 6001 gene locus_tag LOCUS_32410 4742 6001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 6034 6561 gene locus_tag LOCUS_32420 6034 6561 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_32420 6856 9150 gene locus_tag LOCUS_32430 6856 9150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 10096 9089 gene locus_tag LOCUS_32440 10096 9089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 11254 10157 gene locus_tag LOCUS_32450 gene leuB 11254 10157 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081326.1 protein_id gnl|my_center|LOCUS_32450 >Feature sequence162 663 947 gene locus_tag LOCUS_32460 663 947 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545507.1 protein_id gnl|my_center|LOCUS_32460 1500 988 gene locus_tag LOCUS_32470 1500 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 3464 1647 gene locus_tag LOCUS_32480 3464 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 5514 3847 gene locus_tag LOCUS_32490 5514 3847 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_32490 6374 5649 gene locus_tag LOCUS_32500 6374 5649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 7293 6514 gene locus_tag LOCUS_32510 7293 6514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 7415 8170 gene locus_tag LOCUS_32520 7415 8170 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991831.1 protein_id gnl|my_center|LOCUS_32520 8195 9349 gene locus_tag LOCUS_32530 8195 9349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 9382 10056 gene locus_tag LOCUS_32540 9382 10056 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393606.1 protein_id gnl|my_center|LOCUS_32540 >Feature sequence163 277 987 gene locus_tag LOCUS_32550 277 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 1058 3316 gene locus_tag LOCUS_32560 1058 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 5581 3326 gene locus_tag LOCUS_32570 5581 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 7130 5574 gene locus_tag LOCUS_32580 7130 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 8835 7399 gene locus_tag LOCUS_32590 8835 7399 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082946.1 protein_id gnl|my_center|LOCUS_32590 9562 8858 gene locus_tag LOCUS_32600 9562 8858 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121737.1 protein_id gnl|my_center|LOCUS_32600 9752 9827 gene locus_tag LOCUS_t00350 9752 9827 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 9835 9910 gene locus_tag LOCUS_t00360 9835 9910 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 10382 11146 gene locus_tag LOCUS_32610 10382 11146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 >Feature sequence164 762 568 gene locus_tag LOCUS_32620 762 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 731 2602 gene locus_tag LOCUS_32630 731 2602 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941439.1 protein_id gnl|my_center|LOCUS_32630 5626 2729 gene locus_tag LOCUS_32640 5626 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063800.1 protein_id gnl|my_center|LOCUS_32640 6041 6229 gene locus_tag LOCUS_32650 6041 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 7051 6263 gene locus_tag LOCUS_32660 7051 6263 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_32660 10215 7048 gene locus_tag LOCUS_32670 10215 7048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 10310 10693 gene locus_tag LOCUS_32680 10310 10693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 >Feature sequence165 1380 652 gene locus_tag LOCUS_32690 1380 652 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974589.1 protein_id gnl|my_center|LOCUS_32690 3770 1419 gene locus_tag LOCUS_32700 3770 1419 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584148.1 protein_id gnl|my_center|LOCUS_32700 3936 4496 gene locus_tag LOCUS_32710 3936 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 4646 5509 gene locus_tag LOCUS_32720 4646 5509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 5790 6938 gene locus_tag LOCUS_32730 gene amrB 5790 6938 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093005130.1 protein_id gnl|my_center|LOCUS_32730 7657 6959 gene locus_tag LOCUS_32740 7657 6959 CDS product purine nucleoside phosphorylase I, inosine and guanosine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082038.1 protein_id gnl|my_center|LOCUS_32740 8679 7654 gene locus_tag LOCUS_32750 8679 7654 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_32750 9421 8690 gene locus_tag LOCUS_32760 9421 8690 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_32760 10462 9467 gene locus_tag LOCUS_32770 10462 9467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 >Feature sequence166 407 1189 gene locus_tag LOCUS_32780 gene trpC 407 1189 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392852.1 protein_id gnl|my_center|LOCUS_32780 1176 1805 gene locus_tag LOCUS_32790 1176 1805 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_32790 1750 2991 gene locus_tag LOCUS_32800 gene trpB 1750 2991 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546381.1 protein_id gnl|my_center|LOCUS_32800 2988 3788 gene locus_tag LOCUS_32810 gene trpA 2988 3788 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_32810 3800 5137 gene locus_tag LOCUS_32820 3800 5137 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942701.1 protein_id gnl|my_center|LOCUS_32820 5138 6040 gene locus_tag LOCUS_32830 5138 6040 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_32830 6059 7243 gene locus_tag LOCUS_32840 gene aroC 6059 7243 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_32840 7270 8193 gene locus_tag LOCUS_32850 7270 8193 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398688.1 protein_id gnl|my_center|LOCUS_32850 8231 9253 gene locus_tag LOCUS_32860 8231 9253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 9433 9654 gene locus_tag LOCUS_32870 9433 9654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 <10963 9864 gene locus_tag LOCUS_32880 <10963 9864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065389.1:polyphosphate:AMP phosphotransferase >Feature sequence167 <1 550 gene locus_tag LOCUS_32890 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902504.1:2-dehydropantoate 2-reductase 547 1248 gene locus_tag LOCUS_32900 547 1248 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918193.1 protein_id gnl|my_center|LOCUS_32900 2288 1245 gene locus_tag LOCUS_32910 gene rlmN 2288 1245 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392423.1 protein_id gnl|my_center|LOCUS_32910 3067 2285 gene locus_tag LOCUS_32920 3067 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 3343 3603 gene locus_tag LOCUS_32930 3343 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 4756 3659 gene locus_tag LOCUS_32940 4756 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 5624 4929 gene locus_tag LOCUS_32950 5624 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 6585 5650 gene locus_tag LOCUS_32960 6585 5650 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678981.1 protein_id gnl|my_center|LOCUS_32960 6916 7794 gene locus_tag LOCUS_32970 gene lipA 6916 7794 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393263.1 protein_id gnl|my_center|LOCUS_32970 7830 8066 gene locus_tag LOCUS_32980 7830 8066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 8378 9331 gene locus_tag LOCUS_32990 8378 9331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 >Feature sequence168 173 1450 gene locus_tag LOCUS_33000 173 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122044.1 protein_id gnl|my_center|LOCUS_33000 1560 3230 gene locus_tag LOCUS_33010 1560 3230 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_33010 3247 4125 gene locus_tag LOCUS_33020 gene ispE 3247 4125 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391620.1 protein_id gnl|my_center|LOCUS_33020 4250 6127 gene locus_tag LOCUS_33030 4250 6127 CDS product GxGYxYP family putative glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764130.1 protein_id gnl|my_center|LOCUS_33030 7349 6771 gene locus_tag LOCUS_33040 7349 6771 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_33040 8401 7529 gene locus_tag LOCUS_33050 8401 7529 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919889.1 protein_id gnl|my_center|LOCUS_33050 9373 8519 gene locus_tag LOCUS_33060 9373 8519 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942704.1 protein_id gnl|my_center|LOCUS_33060 10575 9538 gene locus_tag LOCUS_33070 10575 9538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 >Feature sequence169 1789 650 gene locus_tag LOCUS_33080 1789 650 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037227959.1 protein_id gnl|my_center|LOCUS_33080 2973 1786 gene locus_tag LOCUS_33090 2973 1786 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337623.1 protein_id gnl|my_center|LOCUS_33090 3458 2970 gene locus_tag LOCUS_33100 3458 2970 CDS product RimK/LysX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459284.1 protein_id gnl|my_center|LOCUS_33100 4773 3466 gene locus_tag LOCUS_33110 4773 3466 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928696.1 protein_id gnl|my_center|LOCUS_33110 6441 4936 gene locus_tag LOCUS_33120 6441 4936 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_33120 6799 8271 gene locus_tag LOCUS_33130 6799 8271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 9873 8311 gene locus_tag LOCUS_33140 9873 8311 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363938.1 protein_id gnl|my_center|LOCUS_33140 10050 10619 gene locus_tag LOCUS_33150 10050 10619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 >Feature sequence170 <1 749 gene locus_tag LOCUS_33160 <1 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392654.1:D-alanine--D-alanine ligase 822 1664 gene locus_tag LOCUS_33170 gene dapF 822 1664 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768322.1 protein_id gnl|my_center|LOCUS_33170 1728 2351 gene locus_tag LOCUS_33180 gene purN 1728 2351 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942403.1 protein_id gnl|my_center|LOCUS_33180 3898 2918 gene locus_tag LOCUS_33190 3898 2918 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_33190 4264 5214 gene locus_tag LOCUS_33200 4264 5214 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943320.1 protein_id gnl|my_center|LOCUS_33200 5259 6923 gene locus_tag LOCUS_33210 5259 6923 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943319.1 protein_id gnl|my_center|LOCUS_33210 7738 6926 gene locus_tag LOCUS_33220 7738 6926 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545351.1 protein_id gnl|my_center|LOCUS_33220 8127 7735 gene locus_tag LOCUS_33230 8127 7735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 9637 8357 gene locus_tag LOCUS_33240 9637 8357 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_33240 10274 9783 gene locus_tag LOCUS_33250 gene coaD 10274 9783 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393371.1 protein_id gnl|my_center|LOCUS_33250 >Feature sequence171 471 67 gene locus_tag LOCUS_33260 471 67 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384381.1 protein_id gnl|my_center|LOCUS_33260 1342 809 gene locus_tag LOCUS_33270 gene hslV 1342 809 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392543.1 protein_id gnl|my_center|LOCUS_33270 2304 1372 gene locus_tag LOCUS_33280 gene xerC 2304 1372 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941160.1 protein_id gnl|my_center|LOCUS_33280 4647 2332 gene locus_tag LOCUS_33290 gene topA 4647 2332 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259747.1 protein_id gnl|my_center|LOCUS_33290 5152 4694 gene locus_tag LOCUS_33300 5152 4694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 6450 5287 gene locus_tag LOCUS_33310 6450 5287 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974188.1 protein_id gnl|my_center|LOCUS_33310 6595 7374 gene locus_tag LOCUS_33320 gene rfbF 6595 7374 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257101.1 protein_id gnl|my_center|LOCUS_33320 7426 8559 gene locus_tag LOCUS_33330 gene rfbG 7426 8559 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 protein_id gnl|my_center|LOCUS_33330 8572 9567 gene locus_tag LOCUS_33340 8572 9567 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174325.1 protein_id gnl|my_center|LOCUS_33340 9722 9880 gene locus_tag LOCUS_33350 9722 9880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 10518 9952 gene locus_tag LOCUS_33360 10518 9952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 >Feature sequence172 4488 1672 gene locus_tag LOCUS_33370 4488 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 5482 4610 gene locus_tag LOCUS_33380 5482 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 9267 5779 gene locus_tag LOCUS_33390 9267 5779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 9551 10369 gene locus_tag LOCUS_33400 9551 10369 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987089.1 protein_id gnl|my_center|LOCUS_33400 >Feature sequence173 964 38 gene locus_tag LOCUS_33410 964 38 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943987.1 protein_id gnl|my_center|LOCUS_33410 2793 982 gene locus_tag LOCUS_33420 2793 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 4433 3078 gene locus_tag LOCUS_33430 4433 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 5830 4529 gene locus_tag LOCUS_33440 5830 4529 CDS product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_33440 6612 6830 gene locus_tag LOCUS_33450 6612 6830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 6857 7255 gene locus_tag LOCUS_33460 6857 7255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 7248 8276 gene locus_tag LOCUS_33470 gene waaF 7248 8276 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_33470 9188 8316 gene locus_tag LOCUS_33480 gene rfbA 9188 8316 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706707.1 protein_id gnl|my_center|LOCUS_33480 10069 9224 gene locus_tag LOCUS_33490 10069 9224 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256676.1 protein_id gnl|my_center|LOCUS_33490 >Feature sequence174 983 336 gene locus_tag LOCUS_33500 983 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 1258 2688 gene locus_tag LOCUS_33510 1258 2688 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385749.1 protein_id gnl|my_center|LOCUS_33510 3638 4420 gene locus_tag LOCUS_33520 3638 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 6163 4448 gene locus_tag LOCUS_33530 6163 4448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 8953 6560 gene locus_tag LOCUS_33540 8953 6560 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085445.1 protein_id gnl|my_center|LOCUS_33540 9886 9029 gene locus_tag LOCUS_33550 9886 9029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973986.1 protein_id gnl|my_center|LOCUS_33550 >Feature sequence175 3631 890 gene locus_tag LOCUS_33560 gene secDF 3631 890 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531306.1 protein_id gnl|my_center|LOCUS_33560 4060 3686 gene locus_tag LOCUS_33570 gene yajC 4060 3686 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931759.1 protein_id gnl|my_center|LOCUS_33570 5223 4099 gene locus_tag LOCUS_33580 gene tgt 5223 4099 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_33580 6379 5246 gene locus_tag LOCUS_33590 6379 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 7262 6420 gene locus_tag LOCUS_33600 7262 6420 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_33600 8295 7408 gene locus_tag LOCUS_33610 8295 7408 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121747.1 protein_id gnl|my_center|LOCUS_33610 9629 8331 gene locus_tag LOCUS_33620 9629 8331 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921627.1 protein_id gnl|my_center|LOCUS_33620 >Feature sequence176 194 1426 gene locus_tag LOCUS_33630 194 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 1654 2499 gene locus_tag LOCUS_33640 1654 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 4010 2634 gene locus_tag LOCUS_33650 4010 2634 CDS product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295245.1 protein_id gnl|my_center|LOCUS_33650 5099 4080 gene locus_tag LOCUS_33660 gene mnmA 5099 4080 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_33660 5631 5209 gene locus_tag LOCUS_33670 5631 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 6620 5634 gene locus_tag LOCUS_33680 6620 5634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 8275 6965 gene locus_tag LOCUS_33690 8275 6965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 8724 8272 gene locus_tag LOCUS_33700 8724 8272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 10011 9115 gene locus_tag LOCUS_33710 10011 9115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 >Feature sequence177 132 554 gene locus_tag LOCUS_33720 132 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 814 1761 gene locus_tag LOCUS_33730 814 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 3234 1855 gene locus_tag LOCUS_33740 3234 1855 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_33740 3425 5242 gene locus_tag LOCUS_33750 3425 5242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 6791 5271 gene locus_tag LOCUS_33760 6791 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 9803 6816 gene locus_tag LOCUS_33770 9803 6816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 >Feature sequence178 797 549 gene locus_tag LOCUS_33780 797 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 933 1643 gene locus_tag LOCUS_33790 933 1643 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922324.1 protein_id gnl|my_center|LOCUS_33790 2866 1640 gene locus_tag LOCUS_33800 gene rlmD 2866 1640 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021134739.1 protein_id gnl|my_center|LOCUS_33800 3466 4353 gene locus_tag LOCUS_33810 3466 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 4350 5339 gene locus_tag LOCUS_33820 gene thiL 4350 5339 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392671.1 protein_id gnl|my_center|LOCUS_33820 5930 5355 gene locus_tag LOCUS_33830 5930 5355 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_33830 7106 6180 gene locus_tag LOCUS_33840 7106 6180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 9469 7121 gene locus_tag LOCUS_33850 9469 7121 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943164.1 protein_id gnl|my_center|LOCUS_33850 >Feature sequence179 4227 2926 gene locus_tag LOCUS_33860 4227 2926 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_33860 5396 4275 gene locus_tag LOCUS_33870 5396 4275 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146468.1 protein_id gnl|my_center|LOCUS_33870 5600 6526 gene locus_tag LOCUS_33880 5600 6526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 6766 7491 gene locus_tag LOCUS_33890 6766 7491 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870390.1 protein_id gnl|my_center|LOCUS_33890 >Feature sequence180 413 1057 gene locus_tag LOCUS_33900 413 1057 CDS product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456820.1 protein_id gnl|my_center|LOCUS_33900 1172 3814 gene locus_tag LOCUS_33910 1172 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 3913 4833 gene locus_tag LOCUS_33920 3913 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 4935 6326 gene locus_tag LOCUS_33930 gene rimO 4935 6326 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_33930 6458 7483 gene locus_tag LOCUS_33940 6458 7483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 7483 7962 gene locus_tag LOCUS_33950 7483 7962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 7966 9366 gene locus_tag LOCUS_33960 7966 9366 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764153.1 protein_id gnl|my_center|LOCUS_33960 >Feature sequence181 2213 162 gene locus_tag LOCUS_33970 2213 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 5059 2303 gene locus_tag LOCUS_33980 5059 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 6397 5123 gene locus_tag LOCUS_33990 6397 5123 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_33990 8124 6607 gene locus_tag LOCUS_34000 8124 6607 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332236.1 protein_id gnl|my_center|LOCUS_34000 >Feature sequence182 1190 360 gene locus_tag LOCUS_34010 1190 360 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172583.1 protein_id gnl|my_center|LOCUS_34010 1557 1180 gene locus_tag LOCUS_34020 1557 1180 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_34020 2782 1589 gene locus_tag LOCUS_34030 2782 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 3616 3374 gene locus_tag LOCUS_34040 3616 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 3796 4014 gene locus_tag LOCUS_34050 3796 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 4634 4158 gene locus_tag LOCUS_34060 4634 4158 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090684.1 protein_id gnl|my_center|LOCUS_34060 5102 4707 gene locus_tag LOCUS_34070 5102 4707 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535286.1 protein_id gnl|my_center|LOCUS_34070 5615 5151 gene locus_tag LOCUS_34080 5615 5151 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083188.1 protein_id gnl|my_center|LOCUS_34080 5834 5619 gene locus_tag LOCUS_34090 5834 5619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 5978 9517 gene locus_tag LOCUS_34100 5978 9517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 >Feature sequence183 782 189 gene locus_tag LOCUS_34110 782 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 1426 851 gene locus_tag LOCUS_34120 1426 851 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328727.1 protein_id gnl|my_center|LOCUS_34120 1929 3005 gene locus_tag LOCUS_34130 1929 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 3091 5781 gene locus_tag LOCUS_34140 3091 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 5889 7328 gene locus_tag LOCUS_34150 5889 7328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 8115 7387 gene locus_tag LOCUS_34160 8115 7387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 8537 8109 gene locus_tag LOCUS_34170 8537 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 9130 8537 gene locus_tag LOCUS_34180 9130 8537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 9581 9132 gene locus_tag LOCUS_34190 9581 9132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 >Feature sequence184 62 901 gene locus_tag LOCUS_34200 62 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 2282 930 gene locus_tag LOCUS_34210 2282 930 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803818.1 protein_id gnl|my_center|LOCUS_34210 2581 2279 gene locus_tag LOCUS_34220 2581 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 2469 4595 gene locus_tag LOCUS_34230 2469 4595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 5209 4769 gene locus_tag LOCUS_34240 5209 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 5434 6804 gene locus_tag LOCUS_34250 5434 6804 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_34250 6858 8282 gene locus_tag LOCUS_34260 6858 8282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 8540 8349 gene locus_tag LOCUS_34270 8540 8349 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943808.1 protein_id gnl|my_center|LOCUS_34270 >Feature sequence185 373 170 gene locus_tag LOCUS_34280 373 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 1835 741 gene locus_tag LOCUS_34290 1835 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 2649 1939 gene locus_tag LOCUS_34300 2649 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 4436 2811 gene locus_tag LOCUS_34310 4436 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 4770 4567 gene locus_tag LOCUS_34320 4770 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 6974 5112 gene locus_tag LOCUS_34330 6974 5112 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325003.1 protein_id gnl|my_center|LOCUS_34330 <9556 6961 gene locus_tag LOCUS_34340 <9556 6961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein >Feature sequence186 2133 1486 gene locus_tag LOCUS_34350 2133 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 2349 2137 gene locus_tag LOCUS_34360 2349 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 2794 2360 gene locus_tag LOCUS_34370 2794 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 3393 2806 gene locus_tag LOCUS_34380 3393 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 4093 3521 gene locus_tag LOCUS_34390 4093 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 5071 4115 gene locus_tag LOCUS_34400 5071 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 6260 5118 gene locus_tag LOCUS_34410 6260 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 6612 6280 gene locus_tag LOCUS_34420 6612 6280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 8852 6609 gene locus_tag LOCUS_34430 8852 6609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 9348 9112 gene locus_tag LOCUS_34440 9348 9112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 >Feature sequence187 2 355 gene locus_tag LOCUS_34450 2 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 676 467 gene locus_tag LOCUS_34460 676 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 578 1408 gene locus_tag LOCUS_34470 578 1408 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927080.1 protein_id gnl|my_center|LOCUS_34470 1405 2643 gene locus_tag LOCUS_34480 1405 2643 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392956.1 protein_id gnl|my_center|LOCUS_34480 2640 3494 gene locus_tag LOCUS_34490 2640 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 3491 4891 gene locus_tag LOCUS_34500 3491 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 4872 5672 gene locus_tag LOCUS_34510 4872 5672 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_34510 5805 7847 gene locus_tag LOCUS_34520 5805 7847 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109364.1 protein_id gnl|my_center|LOCUS_34520 9376 8045 gene locus_tag LOCUS_34530 9376 8045 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_34530 >Feature sequence188 1388 486 gene locus_tag LOCUS_34540 gene cysK 1388 486 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832242.1 protein_id gnl|my_center|LOCUS_34540 2349 1522 gene locus_tag LOCUS_34550 2349 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 3136 2354 gene locus_tag LOCUS_34560 3136 2354 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226756.1 protein_id gnl|my_center|LOCUS_34560 4107 3136 gene locus_tag LOCUS_34570 4107 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 5184 4132 gene locus_tag LOCUS_34580 5184 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 5843 5217 gene locus_tag LOCUS_34590 gene tmk 5843 5217 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942869.1 protein_id gnl|my_center|LOCUS_34590 6697 5840 gene locus_tag LOCUS_34600 6697 5840 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813366.1 protein_id gnl|my_center|LOCUS_34600 7422 6694 gene locus_tag LOCUS_34610 gene hisA 7422 6694 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943717.1 protein_id gnl|my_center|LOCUS_34610 7790 7434 gene locus_tag LOCUS_34620 gene rplT 7790 7434 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138360.1 protein_id gnl|my_center|LOCUS_34620 8050 7853 gene locus_tag LOCUS_34630 gene rpmI 8050 7853 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_34630 8839 8264 gene locus_tag LOCUS_34640 gene infC 8839 8264 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227848.1 protein_id gnl|my_center|LOCUS_34640 >Feature sequence189 1734 304 gene locus_tag LOCUS_34650 1734 304 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093087.1 protein_id gnl|my_center|LOCUS_34650 2604 1951 gene locus_tag LOCUS_34660 2604 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 2497 2697 gene locus_tag LOCUS_34670 2497 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 2851 3843 gene locus_tag LOCUS_34680 2851 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 4714 3875 gene locus_tag LOCUS_34690 4714 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 6858 4726 gene locus_tag LOCUS_34700 6858 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 7615 6977 gene locus_tag LOCUS_34710 7615 6977 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462636.1 protein_id gnl|my_center|LOCUS_34710 >Feature sequence190 2107 311 gene locus_tag LOCUS_34720 2107 311 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_34720 2958 2233 gene locus_tag LOCUS_34730 2958 2233 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707448.1 protein_id gnl|my_center|LOCUS_34730 4381 2975 gene locus_tag LOCUS_34740 4381 2975 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_34740 5048 5674 gene locus_tag LOCUS_34750 5048 5674 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088397.1 protein_id gnl|my_center|LOCUS_34750 5671 6789 gene locus_tag LOCUS_34760 5671 6789 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390879.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34760 6786 7724 gene locus_tag LOCUS_34770 6786 7724 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943450.1 protein_id gnl|my_center|LOCUS_34770 7726 8841 gene locus_tag LOCUS_34780 7726 8841 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393399.1 protein_id gnl|my_center|LOCUS_34780 >Feature sequence191 204 746 gene locus_tag LOCUS_34790 204 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 983 2263 gene locus_tag LOCUS_34800 983 2263 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_34800 2267 3370 gene locus_tag LOCUS_34810 gene thrC 2267 3370 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546273.1 protein_id gnl|my_center|LOCUS_34810 3376 4038 gene locus_tag LOCUS_34820 3376 4038 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963951.1 protein_id gnl|my_center|LOCUS_34820 4051 4719 gene locus_tag LOCUS_34830 gene lipB 4051 4719 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258689.1 protein_id gnl|my_center|LOCUS_34830 5784 4744 gene locus_tag LOCUS_34840 5784 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 7151 5784 gene locus_tag LOCUS_34850 gene hflX 7151 5784 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545622.1 protein_id gnl|my_center|LOCUS_34850 7032 7388 gene locus_tag LOCUS_34860 7032 7388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 8596 7619 gene locus_tag LOCUS_34870 8596 7619 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529215.1 protein_id gnl|my_center|LOCUS_34870 >Feature sequence192 1429 341 gene locus_tag LOCUS_34880 1429 341 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_34880 1745 4720 gene locus_tag LOCUS_34890 1745 4720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 5813 4764 gene locus_tag LOCUS_34900 gene hemE 5813 4764 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258456.1 protein_id gnl|my_center|LOCUS_34900 >Feature sequence193 923 105 gene locus_tag LOCUS_34910 923 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022686.1 protein_id gnl|my_center|LOCUS_34910 2361 1216 gene locus_tag LOCUS_34920 2361 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 3377 2358 gene locus_tag LOCUS_34930 3377 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 4867 3521 gene locus_tag LOCUS_34940 4867 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 6147 4951 gene locus_tag LOCUS_34950 6147 4951 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_34950 7145 6333 gene locus_tag LOCUS_34960 7145 6333 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083333.1 protein_id gnl|my_center|LOCUS_34960 7937 7149 gene locus_tag LOCUS_34970 7937 7149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 <9102 7968 gene locus_tag LOCUS_34980 <9102 7968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948635.1:nucleotidyltransferase family protein >Feature sequence194 230 1564 gene locus_tag LOCUS_34990 230 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 1611 2903 gene locus_tag LOCUS_35000 1611 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 2981 4423 gene locus_tag LOCUS_35010 2981 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 5248 4457 gene locus_tag LOCUS_35020 5248 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 7674 5254 gene locus_tag LOCUS_35030 7674 5254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 7946 8905 gene locus_tag LOCUS_35040 7946 8905 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_35040 >Feature sequence195 700 1956 gene locus_tag LOCUS_35050 700 1956 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_35050 2022 3986 gene locus_tag LOCUS_35060 2022 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 4065 7322 gene locus_tag LOCUS_35070 4065 7322 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202068.1 protein_id gnl|my_center|LOCUS_35070 8021 7683 gene locus_tag LOCUS_35080 8021 7683 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533029.1 protein_id gnl|my_center|LOCUS_35080 <9007 8034 gene locus_tag LOCUS_35090 <9007 8034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393601.1:uroporphyrinogen decarboxylase family protein >Feature sequence196 632 6 gene locus_tag LOCUS_35100 632 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 840 655 gene locus_tag LOCUS_35110 840 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 1330 857 gene locus_tag LOCUS_35120 1330 857 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037198267.1 protein_id gnl|my_center|LOCUS_35120 5093 1632 gene locus_tag LOCUS_35130 gene dnaE 5093 1632 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_35130 5572 5090 gene locus_tag LOCUS_35140 5572 5090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 5808 6833 gene locus_tag LOCUS_35150 5808 6833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 7075 8109 gene locus_tag LOCUS_35160 7075 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 >Feature sequence197 996 334 gene locus_tag LOCUS_35170 996 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 1680 2216 gene locus_tag LOCUS_35180 1680 2216 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546022.1 protein_id gnl|my_center|LOCUS_35180 2203 3012 gene locus_tag LOCUS_35190 gene proC 2203 3012 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943177.1 protein_id gnl|my_center|LOCUS_35190 3013 3804 gene locus_tag LOCUS_35200 3013 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 3804 4556 gene locus_tag LOCUS_35210 3804 4556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 4553 5161 gene locus_tag LOCUS_35220 4553 5161 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_35220 5286 6653 gene locus_tag LOCUS_35230 5286 6653 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404676.1 protein_id gnl|my_center|LOCUS_35230 6657 7607 gene locus_tag LOCUS_35240 6657 7607 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938962.1 protein_id gnl|my_center|LOCUS_35240 8695 7643 gene locus_tag LOCUS_35250 8695 7643 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_35250 >Feature sequence198 350 769 gene locus_tag LOCUS_35260 350 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 1705 785 gene locus_tag LOCUS_35270 1705 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 1922 3211 gene locus_tag LOCUS_35280 1922 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223273.1 protein_id gnl|my_center|LOCUS_35280 5251 3326 gene locus_tag LOCUS_35290 5251 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 7263 5269 gene locus_tag LOCUS_35300 7263 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 7879 7352 gene locus_tag LOCUS_35310 7879 7352 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941194.1 protein_id gnl|my_center|LOCUS_35310 8327 8426 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence199 235 1245 gene locus_tag LOCUS_35320 gene argC 235 1245 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546077.1 protein_id gnl|my_center|LOCUS_35320 1242 2447 gene locus_tag LOCUS_35330 gene argJ 1242 2447 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_35330 2472 3347 gene locus_tag LOCUS_35340 gene argB 2472 3347 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057248.1 protein_id gnl|my_center|LOCUS_35340 3392 4036 gene locus_tag LOCUS_35350 3392 4036 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021216.1 protein_id gnl|my_center|LOCUS_35350 4069 4524 gene locus_tag LOCUS_35360 4069 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 4535 5374 gene locus_tag LOCUS_35370 4535 5374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 5371 5733 gene locus_tag LOCUS_35380 5371 5733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 6358 5759 gene locus_tag LOCUS_35390 6358 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 6542 8146 gene locus_tag LOCUS_35400 6542 8146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 >Feature sequence200 3538 149 gene locus_tag LOCUS_35410 gene ileS 3538 149 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434976.1 protein_id gnl|my_center|LOCUS_35410 3844 6315 gene locus_tag LOCUS_35420 3844 6315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 6355 8094 gene locus_tag LOCUS_35430 6355 8094 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403056.1 protein_id gnl|my_center|LOCUS_35430 8470 8201 gene locus_tag LOCUS_35440 8470 8201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 >Feature sequence201 <1 1351 gene locus_tag LOCUS_35450 <1 1351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256506.1:DNA repair protein RecN 3049 1355 gene locus_tag LOCUS_35460 3049 1355 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943652.1 protein_id gnl|my_center|LOCUS_35460 4814 3054 gene locus_tag LOCUS_35470 4814 3054 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044916.1 protein_id gnl|my_center|LOCUS_35470 8227 4889 gene locus_tag LOCUS_35480 8227 4889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 >Feature sequence202 1626 169 gene locus_tag LOCUS_35490 1626 169 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209873.1 protein_id gnl|my_center|LOCUS_35490 1796 2383 gene locus_tag LOCUS_35500 1796 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 3616 2792 gene locus_tag LOCUS_35510 3616 2792 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067536.1 protein_id gnl|my_center|LOCUS_35510 4777 3629 gene locus_tag LOCUS_35520 4777 3629 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393241.1 protein_id gnl|my_center|LOCUS_35520 6243 4879 gene locus_tag LOCUS_35530 6243 4879 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107138.1 protein_id gnl|my_center|LOCUS_35530 6559 7197 gene locus_tag LOCUS_35540 6559 7197 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_35540 7194 8048 gene locus_tag LOCUS_35550 7194 8048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 >Feature sequence203 1030 1473 gene locus_tag LOCUS_35560 1030 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 1470 2948 gene locus_tag LOCUS_35570 1470 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 3276 4256 gene locus_tag LOCUS_35580 3276 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 4437 5309 gene locus_tag LOCUS_35590 4437 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 5311 6267 gene locus_tag LOCUS_35600 5311 6267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 6359 7633 gene locus_tag LOCUS_35610 6359 7633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 >Feature sequence204 2435 129 gene locus_tag LOCUS_35620 gene pbpC 2435 129 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992445.1 protein_id gnl|my_center|LOCUS_35620 <8188 2465 gene locus_tag LOCUS_35630 <8188 2465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037391582.1:alpha-2-macroglobulin family protein >Feature sequence205 469 894 gene locus_tag LOCUS_35640 469 894 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838707.1 protein_id gnl|my_center|LOCUS_35640 1134 2279 gene locus_tag LOCUS_35650 1134 2279 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545010.1 protein_id gnl|my_center|LOCUS_35650 3557 2289 gene locus_tag LOCUS_35660 3557 2289 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404404.1 protein_id gnl|my_center|LOCUS_35660 4572 3688 gene locus_tag LOCUS_35670 4572 3688 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340302.1 protein_id gnl|my_center|LOCUS_35670 6121 4547 gene locus_tag LOCUS_35680 6121 4547 CDS product alternate F1F0 ATPase, F1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022405.1 protein_id gnl|my_center|LOCUS_35680 7057 6131 gene locus_tag LOCUS_35690 7057 6131 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022406.1 protein_id gnl|my_center|LOCUS_35690 7383 7117 gene locus_tag LOCUS_35700 7383 7117 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328511.1 protein_id gnl|my_center|LOCUS_35700 8116 7400 gene locus_tag LOCUS_35710 8116 7400 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328512.1 protein_id gnl|my_center|LOCUS_35710 >Feature sequence206 <1 1479 gene locus_tag LOCUS_35720 <1 1479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011366119.1:selenide, water dikinase SelD 1487 3484 gene locus_tag LOCUS_35730 gene selB 1487 3484 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_35730 3481 3747 gene locus_tag LOCUS_35740 3481 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 3846 4724 gene locus_tag LOCUS_35750 3846 4724 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582857.1 protein_id gnl|my_center|LOCUS_35750 4784 5986 gene locus_tag LOCUS_35760 4784 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 6020 6901 gene locus_tag LOCUS_35770 6020 6901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 >Feature sequence207 1803 982 gene locus_tag LOCUS_35780 1803 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 2748 1864 gene locus_tag LOCUS_35790 2748 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 3072 4226 gene locus_tag LOCUS_35800 3072 4226 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_35800 5850 4309 gene locus_tag LOCUS_35810 5850 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 >Feature sequence208 230 769 gene locus_tag LOCUS_35820 230 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 982 2295 gene locus_tag LOCUS_35830 982 2295 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048700.1 protein_id gnl|my_center|LOCUS_35830 2375 3208 gene locus_tag LOCUS_35840 2375 3208 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064011.1 protein_id gnl|my_center|LOCUS_35840 3464 4459 gene locus_tag LOCUS_35850 gene fliM 3464 4459 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870065.1 protein_id gnl|my_center|LOCUS_35850 4472 5389 gene locus_tag LOCUS_35860 4472 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 5386 6204 gene locus_tag LOCUS_35870 gene whiG 5386 6204 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973389.1 protein_id gnl|my_center|LOCUS_35870 6152 6484 gene locus_tag LOCUS_35880 6152 6484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 6556 7413 gene locus_tag LOCUS_35890 6556 7413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 >Feature sequence209 34 255 gene locus_tag LOCUS_35900 34 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 3109 308 gene locus_tag LOCUS_35910 3109 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 5121 3256 gene locus_tag LOCUS_35920 5121 3256 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460547.1 protein_id gnl|my_center|LOCUS_35920 6089 5154 gene locus_tag LOCUS_35930 6089 5154 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933107.1 protein_id gnl|my_center|LOCUS_35930 6468 7367 gene locus_tag LOCUS_35940 6468 7367 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170031.1 protein_id gnl|my_center|LOCUS_35940 7557 7886 gene locus_tag LOCUS_35950 7557 7886 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454504.1 protein_id gnl|my_center|LOCUS_35950 >Feature sequence210 1965 1510 gene locus_tag LOCUS_35960 1965 1510 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943436.1 protein_id gnl|my_center|LOCUS_35960 5973 2059 gene locus_tag LOCUS_35970 5973 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 7301 6093 gene locus_tag LOCUS_35980 7301 6093 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390206.1 protein_id gnl|my_center|LOCUS_35980 >Feature sequence211 2770 245 gene locus_tag LOCUS_35990 2770 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 3729 2767 gene locus_tag LOCUS_36000 3729 2767 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_36000 4345 4151 gene locus_tag LOCUS_36010 4345 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 4454 4553 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6573 5194 gene locus_tag LOCUS_36020 6573 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 6750 7517 gene locus_tag LOCUS_36030 6750 7517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 >Feature sequence212 1381 7656 gene locus_tag LOCUS_36040 1381 7656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 >Feature sequence213 1244 51 gene locus_tag LOCUS_36050 gene larC 1244 51 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393989.1 protein_id gnl|my_center|LOCUS_36050 2048 1284 gene locus_tag LOCUS_36060 gene larB 2048 1284 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812203.1 protein_id gnl|my_center|LOCUS_36060 3431 2157 gene locus_tag LOCUS_36070 3431 2157 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222986.1 protein_id gnl|my_center|LOCUS_36070 5064 3562 gene locus_tag LOCUS_36080 5064 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 5015 5572 gene locus_tag LOCUS_36090 5015 5572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 6228 5569 gene locus_tag LOCUS_36100 6228 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 <7640 6615 gene locus_tag LOCUS_36110 <7640 6615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941871.1:methyltransferase >Feature sequence214 79 3813 gene locus_tag LOCUS_36120 79 3813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 3881 5062 gene locus_tag LOCUS_36130 3881 5062 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861090.1 protein_id gnl|my_center|LOCUS_36130 <7611 5076 gene locus_tag LOCUS_36140 <7611 5076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_019639497.1:alpha-galactosidase >Feature sequence215 341 1723 gene locus_tag LOCUS_36150 341 1723 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943221.1 protein_id gnl|my_center|LOCUS_36150 1827 3641 gene locus_tag LOCUS_36160 1827 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 4264 5019 gene locus_tag LOCUS_36170 gene surE 4264 5019 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942170.1 protein_id gnl|my_center|LOCUS_36170 5016 5528 gene locus_tag LOCUS_36180 5016 5528 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064945.1 protein_id gnl|my_center|LOCUS_36180 5603 7438 gene locus_tag LOCUS_36190 gene glmS 5603 7438 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228994.1 protein_id gnl|my_center|LOCUS_36190 >Feature sequence216 544 95 gene locus_tag LOCUS_36200 544 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 2104 752 gene locus_tag LOCUS_36210 2104 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 2482 4176 gene locus_tag LOCUS_36220 gene argS 2482 4176 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877057.1 protein_id gnl|my_center|LOCUS_36220 6498 4252 gene locus_tag LOCUS_36230 6498 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 >Feature sequence217 3197 801 gene locus_tag LOCUS_36240 3197 801 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942746.1 protein_id gnl|my_center|LOCUS_36240 4235 3396 gene locus_tag LOCUS_36250 4235 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 6246 4345 gene locus_tag LOCUS_36260 6246 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 <7419 6349 gene locus_tag LOCUS_36270 <7419 6349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392957.1:uroporphyrinogen decarboxylase family protein >Feature sequence218 <1 915 gene locus_tag LOCUS_36280 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255965.1:serine/threonine-protein kinase 1880 912 gene locus_tag LOCUS_36290 1880 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 2433 2176 gene locus_tag LOCUS_36300 2433 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 2766 3302 gene locus_tag LOCUS_36310 gene pal 2766 3302 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932322.1 protein_id gnl|my_center|LOCUS_36310 3315 4235 gene locus_tag LOCUS_36320 3315 4235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 4335 5345 gene locus_tag LOCUS_36330 4335 5345 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584023.1 protein_id gnl|my_center|LOCUS_36330 5349 6479 gene locus_tag LOCUS_36340 5349 6479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 >Feature sequence219 968 312 gene locus_tag LOCUS_36350 968 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 2253 985 gene locus_tag LOCUS_36360 2253 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 3370 2234 gene locus_tag LOCUS_36370 3370 2234 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922072.1 protein_id gnl|my_center|LOCUS_36370 3708 3367 gene locus_tag LOCUS_36380 3708 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 5741 4158 gene locus_tag LOCUS_36390 5741 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 5816 7135 gene locus_tag LOCUS_36400 5816 7135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 >Feature sequence220 99 3074 gene locus_tag LOCUS_36410 99 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 3103 6492 gene locus_tag LOCUS_36420 3103 6492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 >Feature sequence221 154 1125 gene locus_tag LOCUS_36430 154 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 1265 2056 gene locus_tag LOCUS_36440 1265 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 2077 3351 gene locus_tag LOCUS_36450 2077 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 3053 3152 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3622 5892 gene locus_tag LOCUS_36460 3622 5892 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_36460 5885 6094 gene locus_tag LOCUS_36470 5885 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 6867 5995 gene locus_tag LOCUS_36480 6867 5995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 >Feature sequence222 3275 2283 gene locus_tag LOCUS_36490 3275 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 3880 3272 gene locus_tag LOCUS_36500 3880 3272 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393343.1 protein_id gnl|my_center|LOCUS_36500 4100 6691 gene locus_tag LOCUS_36510 4100 6691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 >Feature sequence223 1138 62 gene locus_tag LOCUS_36520 1138 62 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932661.1 protein_id gnl|my_center|LOCUS_36520 2046 1216 gene locus_tag LOCUS_36530 2046 1216 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839268.1 protein_id gnl|my_center|LOCUS_36530 3384 2050 gene locus_tag LOCUS_36540 3384 2050 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_36540 5866 3377 gene locus_tag LOCUS_36550 5866 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 >Feature sequence224 1702 1103 gene locus_tag LOCUS_36560 1702 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 3462 1810 gene locus_tag LOCUS_36570 3462 1810 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390860.1 protein_id gnl|my_center|LOCUS_36570 3969 3526 gene locus_tag LOCUS_36580 3969 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 5227 4235 gene locus_tag LOCUS_36590 5227 4235 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615578.1 protein_id gnl|my_center|LOCUS_36590 6139 5273 gene locus_tag LOCUS_36600 6139 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 >Feature sequence225 227 303 gene locus_tag LOCUS_t00370 227 303 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 354 581 gene locus_tag LOCUS_36610 354 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 594 1544 gene locus_tag LOCUS_36620 594 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 1575 2015 gene locus_tag LOCUS_36630 gene rplK 1575 2015 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356424.1 protein_id gnl|my_center|LOCUS_36630 2102 2812 gene locus_tag LOCUS_36640 gene rplA 2102 2812 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_36640 2968 4137 gene locus_tag LOCUS_36650 gene metK 2968 4137 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331112.1 protein_id gnl|my_center|LOCUS_36650 4409 4050 gene locus_tag LOCUS_36660 4409 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 4372 5016 gene locus_tag LOCUS_36670 4372 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 6465 5032 gene locus_tag LOCUS_36680 6465 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 6535 6729 gene locus_tag LOCUS_36690 6535 6729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 >Feature sequence226 <1 540 gene locus_tag LOCUS_36700 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392107.1:ComEA family DNA-binding protein 677 3103 gene locus_tag LOCUS_36710 677 3103 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_36710 3143 5368 gene locus_tag LOCUS_36720 3143 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 5387 6628 gene locus_tag LOCUS_36730 5387 6628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 >Feature sequence227 1262 885 gene locus_tag LOCUS_36740 1262 885 CDS product DUF5320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546690.1 protein_id gnl|my_center|LOCUS_36740 1547 1323 gene locus_tag LOCUS_36750 1547 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 2014 1634 gene locus_tag LOCUS_36760 2014 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 2197 3564 gene locus_tag LOCUS_36770 gene orpR 2197 3564 CDS product sigma 54-interacting transcriptional regulator OrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 protein_id gnl|my_center|LOCUS_36770 3586 3685 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3902 4264 gene locus_tag LOCUS_36780 3902 4264 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939385.1 protein_id gnl|my_center|LOCUS_36780 4337 4675 gene locus_tag LOCUS_36790 4337 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 4978 6639 gene locus_tag LOCUS_36800 4978 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 >Feature sequence228 <1 1034 gene locus_tag LOCUS_36810 <1 1034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_179943936.1:PKD domain-containing protein 3037 1001 gene locus_tag LOCUS_36820 3037 1001 CDS product NPCBM/NEW2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767105.1 protein_id gnl|my_center|LOCUS_36820 4727 3162 gene locus_tag LOCUS_36830 4727 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 6116 4848 gene locus_tag LOCUS_36840 6116 4848 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393761.1 protein_id gnl|my_center|LOCUS_36840 >Feature sequence229 503 706 gene locus_tag LOCUS_36850 503 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 716 1498 gene locus_tag LOCUS_36860 716 1498 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121747.1 protein_id gnl|my_center|LOCUS_36860 1870 1502 gene locus_tag LOCUS_36870 1870 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 4845 3196 gene locus_tag LOCUS_36880 4845 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 5117 6268 gene locus_tag LOCUS_36890 5117 6268 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209537.1 protein_id gnl|my_center|LOCUS_36890 >Feature sequence230 604 1398 gene locus_tag LOCUS_36900 gene fabI 604 1398 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719509.1 protein_id gnl|my_center|LOCUS_36900 1453 2409 gene locus_tag LOCUS_36910 1453 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 2923 4413 gene locus_tag LOCUS_36920 2923 4413 CDS product lipase maturation factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401279.1 protein_id gnl|my_center|LOCUS_36920 <6498 4453 gene locus_tag LOCUS_36930 <6498 4453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203190.1:TlpA disulfide reductase family protein >Feature sequence231 1735 422 gene locus_tag LOCUS_36940 gene hemL 1735 422 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460175.1 protein_id gnl|my_center|LOCUS_36940 1912 1769 gene locus_tag LOCUS_36950 1912 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 2969 1962 gene locus_tag LOCUS_36960 gene hemB 2969 1962 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546067.1 protein_id gnl|my_center|LOCUS_36960 4498 2972 gene locus_tag LOCUS_36970 gene cobA 4498 2972 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_36970 5415 4495 gene locus_tag LOCUS_36980 gene hemC 5415 4495 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460181.1 protein_id gnl|my_center|LOCUS_36980 <6490 5415 gene locus_tag LOCUS_36990 <6490 5415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943895.1:glutamyl-tRNA reductase >Feature sequence232 1884 1342 gene locus_tag LOCUS_37000 1884 1342 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 protein_id gnl|my_center|LOCUS_37000 2622 1909 gene locus_tag LOCUS_37010 gene hoxU 2622 1909 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257072.1 protein_id gnl|my_center|LOCUS_37010 4406 2628 gene locus_tag LOCUS_37020 gene nuoF 4406 2628 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_37020 6400 4973 gene locus_tag LOCUS_37030 6400 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_37030 >Feature sequence233 1574 774 gene locus_tag LOCUS_37040 1574 774 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876244.1 protein_id gnl|my_center|LOCUS_37040 2512 1571 gene locus_tag LOCUS_37050 2512 1571 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938638.1 protein_id gnl|my_center|LOCUS_37050 2795 2502 gene locus_tag LOCUS_37060 2795 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 3170 3772 gene locus_tag LOCUS_37070 3170 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 3850 5943 gene locus_tag LOCUS_37080 gene recG 3850 5943 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941980.1 protein_id gnl|my_center|LOCUS_37080 >Feature sequence234 806 1099 gene locus_tag LOCUS_37090 806 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 2249 1170 gene locus_tag LOCUS_37100 gene recA 2249 1170 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546028.1 protein_id gnl|my_center|LOCUS_37100 3194 3269 gene locus_tag LOCUS_t00380 3194 3269 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4582 4265 gene locus_tag LOCUS_37110 4582 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 4875 4579 gene locus_tag LOCUS_37120 4875 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 <6171 4872 gene locus_tag LOCUS_37130 <6171 4872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393251.1:phenylalanine--tRNA ligase subunit beta >Feature sequence235 1363 557 gene locus_tag LOCUS_37140 1363 557 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937951.1 protein_id gnl|my_center|LOCUS_37140 2165 1347 gene locus_tag LOCUS_37150 2165 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 3269 2421 gene locus_tag LOCUS_37160 3269 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 4784 3387 gene locus_tag LOCUS_37170 4784 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 >Feature sequence236 3518 717 gene locus_tag LOCUS_37180 3518 717 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671005.1 protein_id gnl|my_center|LOCUS_37180 5329 3584 gene locus_tag LOCUS_37190 5329 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 <6140 5413 gene locus_tag LOCUS_37200 <6140 5413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002228687.1:alpha/beta fold hydrolase >Feature sequence237 2502 961 gene locus_tag LOCUS_37210 2502 961 CDS product glycine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680713.1 protein_id gnl|my_center|LOCUS_37210 3003 4862 gene locus_tag LOCUS_37220 3003 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 4962 5813 gene locus_tag LOCUS_37230 4962 5813 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_37230 >Feature sequence238 2088 829 gene locus_tag LOCUS_37240 gene aroA 2088 829 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457254.1 protein_id gnl|my_center|LOCUS_37240 2813 2085 gene locus_tag LOCUS_37250 2813 2085 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142916.1 protein_id gnl|my_center|LOCUS_37250 2992 3318 gene locus_tag LOCUS_37260 2992 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 4064 3366 gene locus_tag LOCUS_37270 4064 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 4745 4068 gene locus_tag LOCUS_37280 gene nth 4745 4068 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_37280 <6041 4727 gene locus_tag LOCUS_37290 <6041 4727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000867515.1:DNA polymerase/3'-5' exonuclease PolX >Feature sequence239 1820 2191 gene locus_tag LOCUS_37300 1820 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 3247 2243 gene locus_tag LOCUS_37310 3247 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 5735 3501 gene locus_tag LOCUS_37320 5735 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 5691 5930 gene locus_tag LOCUS_37330 5691 5930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 >Feature sequence240 3 1331 gene locus_tag LOCUS_37340 3 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 1391 2188 gene locus_tag LOCUS_37350 1391 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 2300 2824 gene locus_tag LOCUS_37360 2300 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 2877 3308 gene locus_tag LOCUS_37370 2877 3308 CDS product peptide chain release factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941214.1 protein_id gnl|my_center|LOCUS_37370 5600 3363 gene locus_tag LOCUS_37380 5600 3363 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208599863.1 protein_id gnl|my_center|LOCUS_37380 >Feature sequence241 1088 2803 gene locus_tag LOCUS_37390 1088 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 3917 2934 gene locus_tag LOCUS_37400 3917 2934 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_37400 4888 3914 gene locus_tag LOCUS_37410 4888 3914 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144109.1 protein_id gnl|my_center|LOCUS_37410 <5651 4890 gene locus_tag LOCUS_37420 <5651 4890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388348.1:ABC transporter permease subunit >Feature sequence242 1958 687 gene locus_tag LOCUS_37430 1958 687 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_37430 3037 2090 gene locus_tag LOCUS_37440 3037 2090 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_37440 4483 3053 gene locus_tag LOCUS_37450 gene purB 4483 3053 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_37450 5322 4480 gene locus_tag LOCUS_37460 5322 4480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 >Feature sequence243 475 1020 gene locus_tag LOCUS_37470 475 1020 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142702.1 protein_id gnl|my_center|LOCUS_37470 1069 1527 gene locus_tag LOCUS_37480 1069 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 1643 2863 gene locus_tag LOCUS_37490 1643 2863 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947252.1 protein_id gnl|my_center|LOCUS_37490 2884 4194 gene locus_tag LOCUS_37500 2884 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 >Feature sequence244 <1 1688 gene locus_tag LOCUS_37510 <1 1688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081484.1:acyl-CoA dehydratase activase 2196 1714 gene locus_tag LOCUS_37520 2196 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 2697 4133 gene locus_tag LOCUS_37530 gene murC 2697 4133 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_37530 4130 4921 gene locus_tag LOCUS_37540 4130 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 >Feature sequence245 1965 7 gene locus_tag LOCUS_37550 1965 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 3943 2291 gene locus_tag LOCUS_37560 3943 2291 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144112.1 protein_id gnl|my_center|LOCUS_37560 4784 4002 gene locus_tag LOCUS_37570 4784 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 >Feature sequence246 3 341 gene locus_tag LOCUS_37580 3 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 408 842 gene locus_tag LOCUS_37590 gene ruvX 408 842 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440635.1 protein_id gnl|my_center|LOCUS_37590 851 1984 gene locus_tag LOCUS_37600 gene mltG 851 1984 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438164.1 protein_id gnl|my_center|LOCUS_37600 1971 2777 gene locus_tag LOCUS_37610 1971 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 2952 4988 gene locus_tag LOCUS_37620 gene fusA 2952 4988 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583197.1 protein_id gnl|my_center|LOCUS_37620 >Feature sequence247 1700 1625 gene locus_tag LOCUS_t00390 1700 1625 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2163 1789 gene locus_tag LOCUS_37630 2163 1789 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404162.1 protein_id gnl|my_center|LOCUS_37630 3019 2168 gene locus_tag LOCUS_37640 gene panC 3019 2168 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_37640 3813 3016 gene locus_tag LOCUS_37650 gene panB 3813 3016 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942349.1 protein_id gnl|my_center|LOCUS_37650 4374 3883 gene locus_tag LOCUS_37660 gene folK 4374 3883 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 protein_id gnl|my_center|LOCUS_37660 4894 4589 gene locus_tag LOCUS_37670 4894 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 5019 5252 gene locus_tag LOCUS_37680 5019 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 >Feature sequence248 248 3703 gene locus_tag LOCUS_37690 248 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 3714 4877 gene locus_tag LOCUS_37700 3714 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 >Feature sequence249 309 1790 gene locus_tag LOCUS_37710 309 1790 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148183489.1 protein_id gnl|my_center|LOCUS_37710 2061 2160 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2196 2534 gene locus_tag LOCUS_37720 2196 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 2628 4007 gene locus_tag LOCUS_37730 2628 4007 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941561.1 protein_id gnl|my_center|LOCUS_37730 4855 4037 gene locus_tag LOCUS_37740 4855 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 >Feature sequence250 2721 2197 gene locus_tag LOCUS_37750 2721 2197 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925223.1 protein_id gnl|my_center|LOCUS_37750 3512 2718 gene locus_tag LOCUS_37760 3512 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 4033 3512 gene locus_tag LOCUS_37770 4033 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 4323 4030 gene locus_tag LOCUS_37780 4323 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 <5171 4327 gene locus_tag LOCUS_37790 <5171 4327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458834.1:amidoligase family protein >Feature sequence251 847 1902 gene locus_tag LOCUS_37800 847 1902 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173990.1 protein_id gnl|my_center|LOCUS_37800 2037 2747 gene locus_tag LOCUS_37810 2037 2747 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_37810 2777 3448 gene locus_tag LOCUS_37820 2777 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 >Feature sequence252 2116 812 gene locus_tag LOCUS_37830 2116 812 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_37830 2349 3659 gene locus_tag LOCUS_37840 gene hcp 2349 3659 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391685.1 protein_id gnl|my_center|LOCUS_37840 3805 4311 gene locus_tag LOCUS_37850 3805 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 >Feature sequence253 1830 268 gene locus_tag LOCUS_37860 1830 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_37860 2711 1881 gene locus_tag LOCUS_37870 2711 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 4296 2776 gene locus_tag LOCUS_37880 4296 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_37880 <5091 4409 gene locus_tag LOCUS_37890 <5091 4409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008192388.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence254 480 716 gene locus_tag LOCUS_37900 480 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 1959 1117 gene locus_tag LOCUS_37910 1959 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 2294 3892 gene locus_tag LOCUS_37920 2294 3892 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132123697.1 protein_id gnl|my_center|LOCUS_37920 >Feature sequence255 <1 684 gene locus_tag LOCUS_37930 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937910.1:adenosylhomocysteinase 747 2024 gene locus_tag LOCUS_37940 gene larA 747 2024 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484568.1 protein_id gnl|my_center|LOCUS_37940 2168 3712 gene locus_tag LOCUS_37950 gene sufB 2168 3712 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772922.1 protein_id gnl|my_center|LOCUS_37950 3713 4480 gene locus_tag LOCUS_37960 gene sufC 3713 4480 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_37960 >Feature sequence256 136 756 gene locus_tag LOCUS_37970 gene udk 136 756 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403303.1 protein_id gnl|my_center|LOCUS_37970 2282 759 gene locus_tag LOCUS_37980 2282 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 <4956 2533 gene locus_tag LOCUS_37990 <4956 2533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942590.1:Ig-like domain-containing protein >Feature sequence257 332 1627 gene locus_tag LOCUS_38000 332 1627 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_38000 1659 4589 gene locus_tag LOCUS_38010 1659 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 4726 4802 gene locus_tag LOCUS_t00400 4726 4802 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence258 135 2009 gene locus_tag LOCUS_38020 135 2009 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 protein_id gnl|my_center|LOCUS_38020 2006 2584 gene locus_tag LOCUS_38030 2006 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 2753 3838 gene locus_tag LOCUS_38040 2753 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 >Feature sequence259 518 1237 gene locus_tag LOCUS_38050 gene bshB1 518 1237 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403695.1 protein_id gnl|my_center|LOCUS_38050 1237 2370 gene locus_tag LOCUS_38060 gene bshA 1237 2370 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768305.1 protein_id gnl|my_center|LOCUS_38060 2428 2595 gene locus_tag LOCUS_38070 2428 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 2582 2782 gene locus_tag LOCUS_38080 2582 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38080 2713 3024 gene locus_tag LOCUS_38090 2713 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38090 3171 4598 gene locus_tag LOCUS_38100 3171 4598 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110815093.1 protein_id gnl|my_center|LOCUS_38100 >Feature sequence260 409 206 gene locus_tag LOCUS_38110 409 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 1382 477 gene locus_tag LOCUS_38120 gene speB 1382 477 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771798.1 protein_id gnl|my_center|LOCUS_38120 2479 1388 gene locus_tag LOCUS_38130 2479 1388 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879789.1 protein_id gnl|my_center|LOCUS_38130 2882 2457 gene locus_tag LOCUS_38140 2882 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 >Feature sequence261 3249 1300 gene locus_tag LOCUS_38150 3249 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 4383 3292 gene locus_tag LOCUS_38160 4383 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 >Feature sequence262 <1 839 gene locus_tag LOCUS_38170 <1 839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861606.1:PASTA domain-containing Ser/Thr kinase PrkC 1372 2568 gene locus_tag LOCUS_38180 1372 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 4565 2664 gene locus_tag LOCUS_38190 4565 2664 CDS product DUF4914 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583124.1 protein_id gnl|my_center|LOCUS_38190 >Feature sequence263 2227 2952 gene locus_tag LOCUS_38200 2227 2952 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_38200 2977 3567 gene locus_tag LOCUS_38210 gene hisB 2977 3567 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_38210 3564 4397 gene locus_tag LOCUS_38220 3564 4397 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227875.1 protein_id gnl|my_center|LOCUS_38220 >Feature sequence264 536 2461 gene locus_tag LOCUS_38230 gene dnaK 536 2461 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_38230 2574 3713 gene locus_tag LOCUS_38240 gene dnaJ 2574 3713 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_38240 >Feature sequence265 940 2352 gene locus_tag LOCUS_38250 940 2352 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_38250 2345 3745 gene locus_tag LOCUS_38260 2345 3745 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_38260 3749 4351 gene locus_tag LOCUS_38270 3749 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 >Feature sequence266 <1 959 gene locus_tag LOCUS_38280 <1 959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073016.1:Gfo/Idh/MocA family oxidoreductase 1802 1095 gene locus_tag LOCUS_38290 gene aat 1802 1095 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 protein_id gnl|my_center|LOCUS_38290 4102 1823 gene locus_tag LOCUS_38300 gene clpA 4102 1823 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546336.1 protein_id gnl|my_center|LOCUS_38300 4425 4111 gene locus_tag LOCUS_38310 gene clpS 4425 4111 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440419.1 protein_id gnl|my_center|LOCUS_38310 >Feature sequence267 <1 1624 gene locus_tag LOCUS_38320 <1 1624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021593.1:DNA gyrase subunit A 1872 3350 gene locus_tag LOCUS_38330 1872 3350 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143698.1 protein_id gnl|my_center|LOCUS_38330 >Feature sequence268 3202 1070 gene locus_tag LOCUS_38340 3202 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 <4341 3192 gene locus_tag LOCUS_38350 <4341 3192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706440.1:DEAD/DEAH box helicase >Feature sequence269 >Feature sequence270 572 1441 gene locus_tag LOCUS_38360 572 1441 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_38360 1625 2920 gene locus_tag LOCUS_38370 1625 2920 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_38370 >Feature sequence271 1037 66 gene locus_tag LOCUS_38380 1037 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 1557 1081 gene locus_tag LOCUS_38390 1557 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 2048 1554 gene locus_tag LOCUS_38400 2048 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 3163 2279 gene locus_tag LOCUS_38410 3163 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 >Feature sequence272 586 2304 gene locus_tag LOCUS_38420 gene fliD 586 2304 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080294.1 protein_id gnl|my_center|LOCUS_38420 2342 2794 gene locus_tag LOCUS_38430 gene fliS 2342 2794 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392287.1 protein_id gnl|my_center|LOCUS_38430 >Feature sequence273 292 1119 gene locus_tag LOCUS_38440 292 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 <4168 1196 gene locus_tag LOCUS_38450 <4168 1196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391799.1:excinuclease ABC subunit UvrA >Feature sequence274 1568 138 gene locus_tag LOCUS_38460 gene rpoN 1568 138 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_38460 1681 2487 gene locus_tag LOCUS_38470 1681 2487 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_38470 2484 3731 gene locus_tag LOCUS_38480 2484 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 3728 3886 gene locus_tag LOCUS_38490 3728 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 >Feature sequence275 1208 51 gene locus_tag LOCUS_38500 1208 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 2861 1218 gene locus_tag LOCUS_38510 2861 1218 CDS product TIGR03663 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023977.1 protein_id gnl|my_center|LOCUS_38510 3707 3036 gene locus_tag LOCUS_38520 3707 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 >Feature sequence276 1625 609 gene locus_tag LOCUS_38530 1625 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 2635 1622 gene locus_tag LOCUS_38540 2635 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 3752 2709 gene locus_tag LOCUS_38550 3752 2709 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986252.1 protein_id gnl|my_center|LOCUS_38550 >Feature sequence277 1321 1088 gene locus_tag LOCUS_38560 1321 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 2167 1442 gene locus_tag LOCUS_38570 2167 1442 CDS product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964914.1 protein_id gnl|my_center|LOCUS_38570 2937 2224 gene locus_tag LOCUS_38580 2937 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 >Feature sequence278 1711 44 gene locus_tag LOCUS_38590 1711 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 1990 3303 gene locus_tag LOCUS_38600 1990 3303 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615621.1 protein_id gnl|my_center|LOCUS_38600 >Feature sequence279 1307 153 gene locus_tag LOCUS_38610 1307 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 2118 1354 gene locus_tag LOCUS_38620 2118 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 2879 2115 gene locus_tag LOCUS_38630 2879 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 >Feature sequence280 733 1380 gene locus_tag LOCUS_38640 733 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 <3830 2770 gene locus_tag LOCUS_38650 <3830 2770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030935.1:glycoside hydrolase family 2 TIM barrel-domain containing protein >Feature sequence281 <1 2038 gene locus_tag LOCUS_38660 <1 2038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921322.1:alpha/beta hydrolase family protein 2133 2960 gene locus_tag LOCUS_38670 2133 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 3594 3067 gene locus_tag LOCUS_38680 3594 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 >Feature sequence282 2 832 gene locus_tag LOCUS_38690 2 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 3277 851 gene locus_tag LOCUS_38700 3277 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 3791 3717 gene locus_tag LOCUS_t00410 3791 3717 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence283 629 51 gene locus_tag LOCUS_38710 629 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 2224 809 gene locus_tag LOCUS_38720 2224 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 2825 3763 gene locus_tag LOCUS_38730 2825 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 >Feature sequence284 2427 109 gene locus_tag LOCUS_38740 2427 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 >Feature sequence285 3466 710 gene locus_tag LOCUS_38750 3466 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 >Feature sequence286 1565 120 gene locus_tag LOCUS_38760 1565 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 3319 1712 gene locus_tag LOCUS_38770 3319 1712 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261398.1 protein_id gnl|my_center|LOCUS_38770 >Feature sequence287 2774 2586 gene locus_tag LOCUS_38780 2774 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 3354 2776 gene locus_tag LOCUS_38790 gene rsxA 3354 2776 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082952.1 protein_id gnl|my_center|LOCUS_38790 >Feature sequence288 229 432 gene locus_tag LOCUS_38800 229 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 420 1712 gene locus_tag LOCUS_38810 420 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 1792 2862 gene locus_tag LOCUS_38820 1792 2862 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_38820 3017 3244 gene locus_tag LOCUS_38830 3017 3244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 >Feature sequence289 1055 474 gene locus_tag LOCUS_38840 1055 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 1189 1803 gene locus_tag LOCUS_38850 1189 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 >Feature sequence290 2046 3194 gene locus_tag LOCUS_38860 2046 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 >Feature sequence291 347 1597 gene locus_tag LOCUS_38870 347 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 1637 2542 gene locus_tag LOCUS_38880 1637 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 >Feature sequence292 1394 1846 gene locus_tag LOCUS_38890 1394 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 1843 3270 gene locus_tag LOCUS_38900 1843 3270 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626412.1 protein_id gnl|my_center|LOCUS_38900 >Feature sequence293 <3448 495 gene locus_tag LOCUS_38910 <3448 495 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256147.1:PAS domain-containing hybrid sensor histidine kinase/response regulator >Feature sequence294 158 1720 gene locus_tag LOCUS_38920 158 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 2187 2882 gene locus_tag LOCUS_38930 2187 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 >Feature sequence295 648 851 gene locus_tag LOCUS_38940 648 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 992 1144 gene locus_tag LOCUS_38950 992 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 1514 2092 gene locus_tag LOCUS_38960 1514 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 >Feature sequence296 350 2443 gene locus_tag LOCUS_38970 350 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 >Feature sequence297 657 55 gene locus_tag LOCUS_38980 657 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 1458 754 gene locus_tag LOCUS_38990 1458 754 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818985.1 protein_id gnl|my_center|LOCUS_38990 2303 1455 gene locus_tag LOCUS_39000 2303 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 3186 2416 gene locus_tag LOCUS_39010 3186 2416 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532951.1 protein_id gnl|my_center|LOCUS_39010 >Feature sequence298 1092 328 gene locus_tag LOCUS_39020 1092 328 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975956.1 protein_id gnl|my_center|LOCUS_39020 1954 1247 gene locus_tag LOCUS_39030 1954 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 >Feature sequence299 187 372 gene locus_tag LOCUS_39040 187 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 >Feature sequence300 313 1287 gene locus_tag LOCUS_39050 313 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 2781 1456 gene locus_tag LOCUS_39060 2781 1456 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225764.1 protein_id gnl|my_center|LOCUS_39060 >Feature sequence301 730 2193 gene locus_tag LOCUS_39070 730 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 2200 2874 gene locus_tag LOCUS_39080 2200 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 >Feature sequence302 1559 318 gene locus_tag LOCUS_39090 1559 318 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399796.1 protein_id gnl|my_center|LOCUS_39090 >Feature sequence303 338 667 gene locus_tag LOCUS_39100 338 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 725 1018 gene locus_tag LOCUS_39110 725 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 1773 1000 gene locus_tag LOCUS_39120 1773 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 2409 1957 gene locus_tag LOCUS_39130 2409 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 2660 2406 gene locus_tag LOCUS_39140 2660 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 >Feature sequence304 1562 600 gene locus_tag LOCUS_39150 1562 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 2133 1546 gene locus_tag LOCUS_39160 2133 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 >Feature sequence305 1401 2699 gene locus_tag LOCUS_39170 1401 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 >Feature sequence306 59 316 gene locus_tag LOCUS_39180 59 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 705 427 gene locus_tag LOCUS_39190 705 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 726 1862 gene locus_tag LOCUS_39200 726 1862 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879220.1 protein_id gnl|my_center|LOCUS_39200 >Feature sequence307 >Feature sequence308 1026 580 gene locus_tag LOCUS_39210 gene tnpA 1026 580 CDS product IS200/IS605-like element ISAzo20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011236150.1 protein_id gnl|my_center|LOCUS_39210 1191 1433 gene locus_tag LOCUS_39220 1191 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 1891 1448 gene locus_tag LOCUS_39230 1891 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 <2770 1951 gene locus_tag LOCUS_39240 <2770 1951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012166094.1:aminomethyl-transferring glycine dehydrogenase >Feature sequence309 1291 365 gene locus_tag LOCUS_39250 1291 365 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057738.1 protein_id gnl|my_center|LOCUS_39250 2603 1380 gene locus_tag LOCUS_39260 2603 1380 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940837.1 protein_id gnl|my_center|LOCUS_39260 >Feature sequence310 734 1522 gene locus_tag LOCUS_39270 734 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 >Feature sequence311 1853 1065 gene locus_tag LOCUS_39280 1853 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 >Feature sequence312 28 351 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttcaatggggccaccgattttcatcggtggaaat 848 558 gene locus_tag LOCUS_39290 848 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 <2582 852 gene locus_tag LOCUS_39300 <2582 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940735.1:CRISPR-associated endonuclease Cas1 >Feature sequence313 1137 667 gene locus_tag LOCUS_39310 gene phnB 1137 667 CDS product Dot/Icm type IV secretion system effector PhnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957793.1 protein_id gnl|my_center|LOCUS_39310 >Feature sequence314 2159 735 gene locus_tag LOCUS_39320 2159 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320