>Feature sequence001 453 1739 gene locus_tag LOCUS_00010 453 1739 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022104.1 protein_id gnl|my_center|LOCUS_00010 2904 1762 gene locus_tag LOCUS_00020 2904 1762 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957954.1 protein_id gnl|my_center|LOCUS_00020 3769 3029 gene locus_tag LOCUS_00030 gene dapB 3769 3029 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071373.1 protein_id gnl|my_center|LOCUS_00030 4790 3750 gene locus_tag LOCUS_00040 4790 3750 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_00040 4981 5247 gene locus_tag LOCUS_00050 4981 5247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5251 5646 gene locus_tag LOCUS_00060 5251 5646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5733 6089 gene locus_tag LOCUS_00070 5733 6089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6126 7817 gene locus_tag LOCUS_00080 6126 7817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 7928 9235 gene locus_tag LOCUS_00090 gene miaB 7928 9235 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942838.1 protein_id gnl|my_center|LOCUS_00090 9310 10080 gene locus_tag LOCUS_00100 gene pssA 9310 10080 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892285.1 protein_id gnl|my_center|LOCUS_00100 10086 11402 gene locus_tag LOCUS_00110 10086 11402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11399 11809 gene locus_tag LOCUS_00120 11399 11809 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458951.1 protein_id gnl|my_center|LOCUS_00120 11806 12087 gene locus_tag LOCUS_00130 11806 12087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 12071 14113 gene locus_tag LOCUS_00140 12071 14113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 14129 15184 gene locus_tag LOCUS_00150 14129 15184 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931922.1 protein_id gnl|my_center|LOCUS_00150 15323 17626 gene locus_tag LOCUS_00160 15323 17626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 17656 18174 gene locus_tag LOCUS_00170 17656 18174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 18338 18634 gene locus_tag LOCUS_00180 18338 18634 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257967.1 protein_id gnl|my_center|LOCUS_00180 18624 18983 gene locus_tag LOCUS_00190 18624 18983 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546363.1 protein_id gnl|my_center|LOCUS_00190 19034 19133 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20037 21287 gene locus_tag LOCUS_00200 20037 21287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 21314 22951 gene locus_tag LOCUS_00210 21314 22951 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_00210 24235 22958 gene locus_tag LOCUS_00220 24235 22958 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108740.1 protein_id gnl|my_center|LOCUS_00220 24379 25257 gene locus_tag LOCUS_00230 24379 25257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 25266 26549 gene locus_tag LOCUS_00240 25266 26549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 26553 28241 gene locus_tag LOCUS_00250 gene mutL 26553 28241 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957996.1 protein_id gnl|my_center|LOCUS_00250 28241 29173 gene locus_tag LOCUS_00260 gene miaA 28241 29173 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965140.1 protein_id gnl|my_center|LOCUS_00260 29272 29760 gene locus_tag LOCUS_00270 29272 29760 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938863.1 protein_id gnl|my_center|LOCUS_00270 29767 30135 gene locus_tag LOCUS_00280 29767 30135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 30205 30855 gene locus_tag LOCUS_00290 30205 30855 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048126054.1 protein_id gnl|my_center|LOCUS_00290 31801 30857 gene locus_tag LOCUS_00300 31801 30857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 31974 32831 gene locus_tag LOCUS_00310 31974 32831 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933364.1 protein_id gnl|my_center|LOCUS_00310 32845 33189 gene locus_tag LOCUS_00320 32845 33189 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023100.1 protein_id gnl|my_center|LOCUS_00320 33301 33900 gene locus_tag LOCUS_00330 33301 33900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 33897 35000 gene locus_tag LOCUS_00340 33897 35000 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072998.1 protein_id gnl|my_center|LOCUS_00340 34997 38095 gene locus_tag LOCUS_00350 34997 38095 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461050.1 protein_id gnl|my_center|LOCUS_00350 38092 39504 gene locus_tag LOCUS_00360 38092 39504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 39598 41259 gene locus_tag LOCUS_00370 gene hcp 39598 41259 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939296.1 protein_id gnl|my_center|LOCUS_00370 41284 41703 gene locus_tag LOCUS_00380 41284 41703 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419409.1 protein_id gnl|my_center|LOCUS_00380 42736 41693 gene locus_tag LOCUS_00390 42736 41693 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986544.1 protein_id gnl|my_center|LOCUS_00390 >Feature sequence002 2820 298 gene locus_tag LOCUS_00400 2820 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 5190 2836 gene locus_tag LOCUS_00410 5190 2836 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015682.1 protein_id gnl|my_center|LOCUS_00410 5701 5183 gene locus_tag LOCUS_00420 5701 5183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 7539 5698 gene locus_tag LOCUS_00430 7539 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 8806 7547 gene locus_tag LOCUS_00440 8806 7547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 9003 8917 gene locus_tag LOCUS_t00010 9003 8917 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9127 10011 gene locus_tag LOCUS_00450 9127 10011 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897998.1 protein_id gnl|my_center|LOCUS_00450 10073 13207 gene locus_tag LOCUS_00460 10073 13207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 14020 13208 gene locus_tag LOCUS_00470 14020 13208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 14561 14013 gene locus_tag LOCUS_00480 14561 14013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 15787 14657 gene locus_tag LOCUS_00490 15787 14657 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858082.1 protein_id gnl|my_center|LOCUS_00490 16132 16974 gene locus_tag LOCUS_00500 gene ybgF 16132 16974 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940701.1 protein_id gnl|my_center|LOCUS_00500 16971 18152 gene locus_tag LOCUS_00510 16971 18152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 18152 20104 gene locus_tag LOCUS_00520 18152 20104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 20118 20771 gene locus_tag LOCUS_00530 20118 20771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 20782 23709 gene locus_tag LOCUS_00540 20782 23709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 23706 25061 gene locus_tag LOCUS_00550 23706 25061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 25251 27701 gene locus_tag LOCUS_00560 gene gyrB 25251 27701 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003041967.1 protein_id gnl|my_center|LOCUS_00560 27716 30217 gene locus_tag LOCUS_00570 gene gyrA 27716 30217 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_00570 30355 30594 gene locus_tag LOCUS_00580 30355 30594 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_00580 30669 32252 gene locus_tag LOCUS_00590 30669 32252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 32249 33481 gene locus_tag LOCUS_00600 32249 33481 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_00600 33585 35933 gene locus_tag LOCUS_00610 33585 35933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 35902 37440 gene locus_tag LOCUS_00620 35902 37440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 37458 38618 gene locus_tag LOCUS_00630 37458 38618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 38626 40398 gene locus_tag LOCUS_00640 38626 40398 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049207.1 protein_id gnl|my_center|LOCUS_00640 >Feature sequence003 2913 2413 gene locus_tag LOCUS_00650 2913 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 3767 2997 gene locus_tag LOCUS_00660 3767 2997 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879697.1 protein_id gnl|my_center|LOCUS_00660 6180 3760 gene locus_tag LOCUS_00670 6180 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 7720 6200 gene locus_tag LOCUS_00680 gene rng 7720 6200 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_00680 8504 7734 gene locus_tag LOCUS_00690 8504 7734 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_00690 8712 10619 gene locus_tag LOCUS_00700 8712 10619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 10663 12534 gene locus_tag LOCUS_00710 10663 12534 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986940.1 protein_id gnl|my_center|LOCUS_00710 12637 12562 gene locus_tag LOCUS_t00020 12637 12562 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 13151 12882 gene locus_tag LOCUS_00720 13151 12882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 15090 13246 gene locus_tag LOCUS_00730 15090 13246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 15458 15090 gene locus_tag LOCUS_00740 15458 15090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 16068 15445 gene locus_tag LOCUS_00750 16068 15445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 16783 16094 gene locus_tag LOCUS_00760 16783 16094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 17464 16784 gene locus_tag LOCUS_00770 17464 16784 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964353.1 protein_id gnl|my_center|LOCUS_00770 18392 17451 gene locus_tag LOCUS_00780 18392 17451 CDS product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964354.1 protein_id gnl|my_center|LOCUS_00780 19602 18394 gene locus_tag LOCUS_00790 19602 18394 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179058.1 protein_id gnl|my_center|LOCUS_00790 22495 19604 gene locus_tag LOCUS_00800 22495 19604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 23181 22534 gene locus_tag LOCUS_00810 23181 22534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 24023 23178 gene locus_tag LOCUS_00820 24023 23178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 25321 24020 gene locus_tag LOCUS_00830 25321 24020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 26370 25318 gene locus_tag LOCUS_00840 26370 25318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 27806 26370 gene locus_tag LOCUS_00850 27806 26370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 28003 27803 gene locus_tag LOCUS_00860 28003 27803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 28437 28000 gene locus_tag LOCUS_00870 28437 28000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 29986 28469 gene locus_tag LOCUS_00880 29986 28469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 30846 29983 gene locus_tag LOCUS_00890 30846 29983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 33650 30930 gene locus_tag LOCUS_00900 33650 30930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 34774 33776 gene locus_tag LOCUS_00910 34774 33776 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932752.1 protein_id gnl|my_center|LOCUS_00910 36089 34728 gene locus_tag LOCUS_00920 36089 34728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 39241 36149 gene locus_tag LOCUS_00930 39241 36149 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839353.1 protein_id gnl|my_center|LOCUS_00930 40386 39238 gene locus_tag LOCUS_00940 40386 39238 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393847.1 protein_id gnl|my_center|LOCUS_00940 >Feature sequence004 1057 17 gene locus_tag LOCUS_00950 gene queA 1057 17 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627822.1 protein_id gnl|my_center|LOCUS_00950 2124 1057 gene locus_tag LOCUS_00960 2124 1057 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943259.1 protein_id gnl|my_center|LOCUS_00960 2824 2162 gene locus_tag LOCUS_00970 2824 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 4976 2835 gene locus_tag LOCUS_00980 4976 2835 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006742214.1 protein_id gnl|my_center|LOCUS_00980 5563 4976 gene locus_tag LOCUS_00990 gene uppC 5563 4976 CDS product polysaccharide export protein UppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971492.1 protein_id gnl|my_center|LOCUS_00990 6517 5618 gene locus_tag LOCUS_01000 6517 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 6640 6739 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7591 6869 gene locus_tag LOCUS_01010 7591 6869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 8987 7608 gene locus_tag LOCUS_01020 8987 7608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 9648 9073 gene locus_tag LOCUS_01030 9648 9073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 10209 9658 gene locus_tag LOCUS_01040 10209 9658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 10880 10242 gene locus_tag LOCUS_01050 10880 10242 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_01050 11240 10908 gene locus_tag LOCUS_01060 11240 10908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 12822 11224 gene locus_tag LOCUS_01070 12822 11224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 16124 12819 gene locus_tag LOCUS_01080 16124 12819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 18406 16121 gene locus_tag LOCUS_01090 18406 16121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 19163 18423 gene locus_tag LOCUS_01100 19163 18423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 20039 19224 gene locus_tag LOCUS_01110 gene murI 20039 19224 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545640.1 protein_id gnl|my_center|LOCUS_01110 20693 20046 gene locus_tag LOCUS_01120 20693 20046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 22112 20703 gene locus_tag LOCUS_01130 22112 20703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 22421 22155 gene locus_tag LOCUS_01140 22421 22155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 23651 22497 gene locus_tag LOCUS_01150 23651 22497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 27218 23655 gene locus_tag LOCUS_01160 27218 23655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 28913 27291 gene locus_tag LOCUS_01170 28913 27291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 29790 28927 gene locus_tag LOCUS_01180 29790 28927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 32547 29983 gene locus_tag LOCUS_01190 32547 29983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 >Feature sequence005 683 183 gene locus_tag LOCUS_01200 683 183 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870109.1 protein_id gnl|my_center|LOCUS_01200 1952 699 gene locus_tag LOCUS_01210 1952 699 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870108.1 protein_id gnl|my_center|LOCUS_01210 2161 2235 gene locus_tag LOCUS_t00030 2161 2235 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2270 4183 gene locus_tag LOCUS_01220 gene thrS 2270 4183 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_01220 4180 4737 gene locus_tag LOCUS_01230 gene infC 4180 4737 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939807.1 protein_id gnl|my_center|LOCUS_01230 4751 4948 gene locus_tag LOCUS_01240 gene rpmI 4751 4948 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_01240 4966 5316 gene locus_tag LOCUS_01250 gene rplT 4966 5316 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942165.1 protein_id gnl|my_center|LOCUS_01250 5333 5620 gene locus_tag LOCUS_01260 5333 5620 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_01260 5670 5747 gene locus_tag LOCUS_t00040 5670 5747 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5761 6540 gene locus_tag LOCUS_01270 gene surE 5761 6540 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942170.1 protein_id gnl|my_center|LOCUS_01270 6558 7538 gene locus_tag LOCUS_01280 6558 7538 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057642364.1 protein_id gnl|my_center|LOCUS_01280 8327 7542 gene locus_tag LOCUS_01290 8327 7542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 9765 8338 gene locus_tag LOCUS_01300 9765 8338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 9941 10675 gene locus_tag LOCUS_01310 gene fkpA 9941 10675 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071319.1 protein_id gnl|my_center|LOCUS_01310 10849 11073 gene locus_tag LOCUS_01320 10849 11073 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_01320 11103 12185 gene locus_tag LOCUS_01330 11103 12185 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786497.1 protein_id gnl|my_center|LOCUS_01330 12197 12961 gene locus_tag LOCUS_01340 12197 12961 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760623.1 protein_id gnl|my_center|LOCUS_01340 12978 13514 gene locus_tag LOCUS_01350 12978 13514 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760622.1 protein_id gnl|my_center|LOCUS_01350 13590 14060 gene locus_tag LOCUS_01360 13590 14060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 14115 15641 gene locus_tag LOCUS_01370 gene hutH 14115 15641 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925153.1 protein_id gnl|my_center|LOCUS_01370 16271 15654 gene locus_tag LOCUS_01380 16271 15654 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990008.1 protein_id gnl|my_center|LOCUS_01380 16555 16268 gene locus_tag LOCUS_01390 16555 16268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 18939 16561 gene locus_tag LOCUS_01400 18939 16561 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_01400 19953 18967 gene locus_tag LOCUS_01410 19953 18967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 21727 19955 gene locus_tag LOCUS_01420 21727 19955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 21906 24116 gene locus_tag LOCUS_01430 21906 24116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 24113 24634 gene locus_tag LOCUS_01440 24113 24634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 24724 25338 gene locus_tag LOCUS_01450 24724 25338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 26298 25357 gene locus_tag LOCUS_01460 26298 25357 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 protein_id gnl|my_center|LOCUS_01460 26621 26295 gene locus_tag LOCUS_01470 26621 26295 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_01470 26833 26618 gene locus_tag LOCUS_01480 26833 26618 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_01480 27059 27388 gene locus_tag LOCUS_01490 27059 27388 CDS product CGGC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018214298.1 protein_id gnl|my_center|LOCUS_01490 27569 28162 gene locus_tag LOCUS_01500 27569 28162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 28169 28315 gene locus_tag LOCUS_01510 28169 28315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 28481 29047 gene locus_tag LOCUS_01520 28481 29047 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948585.1 protein_id gnl|my_center|LOCUS_01520 29044 29700 gene locus_tag LOCUS_01530 29044 29700 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288827.1 protein_id gnl|my_center|LOCUS_01530 29697 30080 gene locus_tag LOCUS_01540 gene mscL 29697 30080 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104883.1 protein_id gnl|my_center|LOCUS_01540 30574 30089 gene locus_tag LOCUS_01550 30574 30089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 30860 30588 gene locus_tag LOCUS_01560 30860 30588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 31386 30862 gene locus_tag LOCUS_01570 31386 30862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 31508 32308 gene locus_tag LOCUS_01580 31508 32308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 >Feature sequence006 870 310 gene locus_tag LOCUS_01590 870 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 1672 1175 gene locus_tag LOCUS_01600 1672 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 3126 1813 gene locus_tag LOCUS_01610 3126 1813 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_01610 3476 3153 gene locus_tag LOCUS_01620 3476 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 3977 3660 gene locus_tag LOCUS_01630 3977 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 4262 4361 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4423 5664 gene locus_tag LOCUS_01640 4423 5664 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963345.1 protein_id gnl|my_center|LOCUS_01640 5740 5883 gene locus_tag LOCUS_01650 5740 5883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 6118 6597 gene locus_tag LOCUS_01660 6118 6597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 7621 6605 gene locus_tag LOCUS_01670 gene rlmN 7621 6605 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_01670 8240 7623 gene locus_tag LOCUS_01680 8240 7623 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_01680 9757 8255 gene locus_tag LOCUS_01690 gene malQ 9757 8255 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941842.1 protein_id gnl|my_center|LOCUS_01690 10279 9770 gene locus_tag LOCUS_01700 10279 9770 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870107.1 protein_id gnl|my_center|LOCUS_01700 12228 10276 gene locus_tag LOCUS_01710 12228 10276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 12728 12240 gene locus_tag LOCUS_01720 gene pgpA 12728 12240 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704563.1 protein_id gnl|my_center|LOCUS_01720 14789 12729 gene locus_tag LOCUS_01730 gene fusA 14789 12729 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_01730 15605 14805 gene locus_tag LOCUS_01740 15605 14805 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 protein_id gnl|my_center|LOCUS_01740 15870 15589 gene locus_tag LOCUS_01750 15870 15589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 16062 15889 gene locus_tag LOCUS_01760 16062 15889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 17582 16086 gene locus_tag LOCUS_01770 17582 16086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 17746 18720 gene locus_tag LOCUS_01780 17746 18720 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010255239.1 protein_id gnl|my_center|LOCUS_01780 18717 19886 gene locus_tag LOCUS_01790 18717 19886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 19879 20346 gene locus_tag LOCUS_01800 gene ruvX 19879 20346 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597453.1 protein_id gnl|my_center|LOCUS_01800 20349 20579 gene locus_tag LOCUS_01810 20349 20579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 22168 20576 gene locus_tag LOCUS_01820 22168 20576 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966231.1 protein_id gnl|my_center|LOCUS_01820 23608 22196 gene locus_tag LOCUS_01830 23608 22196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 23721 25640 gene locus_tag LOCUS_01840 23721 25640 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678989.1 protein_id gnl|my_center|LOCUS_01840 27836 25653 gene locus_tag LOCUS_01850 27836 25653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 27978 29963 gene locus_tag LOCUS_01860 27978 29963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 30155 32011 gene locus_tag LOCUS_01870 30155 32011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 >Feature sequence007 1609 338 gene locus_tag LOCUS_01880 1609 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 1629 1964 gene locus_tag LOCUS_01890 1629 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 3689 2307 gene locus_tag LOCUS_01900 3689 2307 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941440.1 protein_id gnl|my_center|LOCUS_01900 4369 3686 gene locus_tag LOCUS_01910 4369 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 5190 4366 gene locus_tag LOCUS_01920 5190 4366 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_01920 5951 5187 gene locus_tag LOCUS_01930 5951 5187 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_01930 6491 5964 gene locus_tag LOCUS_01940 6491 5964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 7059 6493 gene locus_tag LOCUS_01950 gene yihA 7059 6493 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933808.1 protein_id gnl|my_center|LOCUS_01950 8330 7059 gene locus_tag LOCUS_01960 gene purD 8330 7059 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_01960 9226 8411 gene locus_tag LOCUS_01970 9226 8411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 9590 10156 gene locus_tag LOCUS_01980 9590 10156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 10161 12242 gene locus_tag LOCUS_01990 10161 12242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 12250 13140 gene locus_tag LOCUS_02000 12250 13140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 13876 13229 gene locus_tag LOCUS_02010 13876 13229 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_02010 15156 13987 gene locus_tag LOCUS_02020 15156 13987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 19817 15159 gene locus_tag LOCUS_02030 19817 15159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 19981 20724 gene locus_tag LOCUS_02040 19981 20724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 20734 21480 gene locus_tag LOCUS_02050 20734 21480 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657484.1 protein_id gnl|my_center|LOCUS_02050 21674 24661 gene locus_tag LOCUS_02060 21674 24661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 26395 24662 gene locus_tag LOCUS_02070 gene recJ 26395 24662 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_02070 27517 26396 gene locus_tag LOCUS_02080 27517 26396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 29266 27533 gene locus_tag LOCUS_02090 gene secD 29266 27533 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546364.1 protein_id gnl|my_center|LOCUS_02090 29645 29289 gene locus_tag LOCUS_02100 29645 29289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 >Feature sequence008 2260 497 gene locus_tag LOCUS_02110 2260 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 2420 3901 gene locus_tag LOCUS_02120 2420 3901 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237994.1 protein_id gnl|my_center|LOCUS_02120 5599 3908 gene locus_tag LOCUS_02130 5599 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 5752 5851 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7076 5922 gene locus_tag LOCUS_02140 7076 5922 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109306.1 protein_id gnl|my_center|LOCUS_02140 10504 7073 gene locus_tag LOCUS_02150 10504 7073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 11711 10521 gene locus_tag LOCUS_02160 11711 10521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 15077 11724 gene locus_tag LOCUS_02170 15077 11724 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016371.1 protein_id gnl|my_center|LOCUS_02170 15980 15234 gene locus_tag LOCUS_02180 15980 15234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 16213 17235 gene locus_tag LOCUS_02190 gene ansA 16213 17235 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170162.1 protein_id gnl|my_center|LOCUS_02190 17225 18157 gene locus_tag LOCUS_02200 gene era 17225 18157 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134765.1 protein_id gnl|my_center|LOCUS_02200 18245 20398 gene locus_tag LOCUS_02210 18245 20398 CDS product BspA family leucine-rich repeat surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102756879.1 protein_id gnl|my_center|LOCUS_02210 20395 23541 gene locus_tag LOCUS_02220 20395 23541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 23645 26032 gene locus_tag LOCUS_02230 23645 26032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 26037 26408 gene locus_tag LOCUS_02240 26037 26408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 26836 26405 gene locus_tag LOCUS_02250 26836 26405 CDS product DUF2141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932889.1 protein_id gnl|my_center|LOCUS_02250 27299 26853 gene locus_tag LOCUS_02260 27299 26853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 30171 27310 gene locus_tag LOCUS_02270 30171 27310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 >Feature sequence009 2007 2106 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2135 3844 gene locus_tag LOCUS_02280 2135 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 3856 4422 gene locus_tag LOCUS_02290 3856 4422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 4424 6511 gene locus_tag LOCUS_02300 4424 6511 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937467.1 protein_id gnl|my_center|LOCUS_02300 6958 6557 gene locus_tag LOCUS_02310 6958 6557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 7438 7004 gene locus_tag LOCUS_02320 7438 7004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 8030 7455 gene locus_tag LOCUS_02330 8030 7455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 8403 8023 gene locus_tag LOCUS_02340 8403 8023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 8641 8970 gene locus_tag LOCUS_02350 8641 8970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 9990 9046 gene locus_tag LOCUS_02360 9990 9046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 10685 9987 gene locus_tag LOCUS_02370 10685 9987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 11620 10682 gene locus_tag LOCUS_02380 11620 10682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 12511 11636 gene locus_tag LOCUS_02390 12511 11636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 12671 14530 gene locus_tag LOCUS_02400 gene iorA 12671 14530 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877454.1 protein_id gnl|my_center|LOCUS_02400 14541 15107 gene locus_tag LOCUS_02410 14541 15107 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869131.1 protein_id gnl|my_center|LOCUS_02410 15997 15122 gene locus_tag LOCUS_02420 15997 15122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 17636 16182 gene locus_tag LOCUS_02430 17636 16182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 18681 17812 gene locus_tag LOCUS_02440 gene rhuM 18681 17812 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648596.1 protein_id gnl|my_center|LOCUS_02440 19978 18815 gene locus_tag LOCUS_02450 19978 18815 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017008.1 protein_id gnl|my_center|LOCUS_02450 21019 20003 gene locus_tag LOCUS_02460 21019 20003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 24028 21029 gene locus_tag LOCUS_02470 24028 21029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 24158 25060 gene locus_tag LOCUS_02480 24158 25060 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942049.1 protein_id gnl|my_center|LOCUS_02480 25756 25082 gene locus_tag LOCUS_02490 25756 25082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 26310 25753 gene locus_tag LOCUS_02500 26310 25753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 26452 27915 gene locus_tag LOCUS_02510 26452 27915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 28781 27912 gene locus_tag LOCUS_02520 28781 27912 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949138.1 protein_id gnl|my_center|LOCUS_02520 28928 29314 gene locus_tag LOCUS_02530 28928 29314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 29357 29444 gene locus_tag LOCUS_t00050 29357 29444 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence010 210 554 gene locus_tag LOCUS_02540 210 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 785 1372 gene locus_tag LOCUS_02550 785 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 1629 2168 gene locus_tag LOCUS_02560 1629 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 2842 2456 gene locus_tag LOCUS_02570 2842 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 3984 2860 gene locus_tag LOCUS_02580 3984 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 4390 3995 gene locus_tag LOCUS_02590 4390 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 6123 4402 gene locus_tag LOCUS_02600 6123 4402 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_02600 8099 6135 gene locus_tag LOCUS_02610 gene nuoF 8099 6135 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_02610 8571 8101 gene locus_tag LOCUS_02620 gene nuoE 8571 8101 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081672.1 protein_id gnl|my_center|LOCUS_02620 8972 8574 gene locus_tag LOCUS_02630 8972 8574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 10891 8984 gene locus_tag LOCUS_02640 10891 8984 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941439.1 protein_id gnl|my_center|LOCUS_02640 12167 11136 gene locus_tag LOCUS_02650 12167 11136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 13953 12193 gene locus_tag LOCUS_02660 13953 12193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 16211 13950 gene locus_tag LOCUS_02670 16211 13950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 17530 16220 gene locus_tag LOCUS_02680 17530 16220 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674820.1 protein_id gnl|my_center|LOCUS_02680 18339 17530 gene locus_tag LOCUS_02690 18339 17530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 18474 19325 gene locus_tag LOCUS_02700 18474 19325 CDS product DUF6279 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477260.1 protein_id gnl|my_center|LOCUS_02700 20150 19755 gene locus_tag LOCUS_02710 20150 19755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 20638 20255 gene locus_tag LOCUS_02720 20638 20255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 21140 20766 gene locus_tag LOCUS_02730 21140 20766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 22426 21227 gene locus_tag LOCUS_02740 22426 21227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 24324 22618 gene locus_tag LOCUS_02750 24324 22618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 25754 24411 gene locus_tag LOCUS_02760 25754 24411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 26801 25764 gene locus_tag LOCUS_02770 26801 25764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 26919 28703 gene locus_tag LOCUS_02780 26919 28703 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_02780 >Feature sequence011 <1 657 gene locus_tag LOCUS_02790 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048147298.1:sulfatase 883 2250 gene locus_tag LOCUS_02800 883 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 2351 3112 gene locus_tag LOCUS_02810 2351 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 3190 4236 gene locus_tag LOCUS_02820 3190 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 4321 4593 gene locus_tag LOCUS_02830 4321 4593 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_02830 4671 7175 gene locus_tag LOCUS_02840 4671 7175 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941031.1 protein_id gnl|my_center|LOCUS_02840 7319 8248 gene locus_tag LOCUS_02850 7319 8248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 8252 9019 gene locus_tag LOCUS_02860 8252 9019 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723065.1 protein_id gnl|my_center|LOCUS_02860 9039 9770 gene locus_tag LOCUS_02870 9039 9770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 9773 10327 gene locus_tag LOCUS_02880 9773 10327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 10324 12060 gene locus_tag LOCUS_02890 10324 12060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 12057 12422 gene locus_tag LOCUS_02900 12057 12422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 12403 12993 gene locus_tag LOCUS_02910 12403 12993 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881079.1 protein_id gnl|my_center|LOCUS_02910 12990 14552 gene locus_tag LOCUS_02920 12990 14552 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082429.1 protein_id gnl|my_center|LOCUS_02920 14584 15558 gene locus_tag LOCUS_02930 14584 15558 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797481.1 protein_id gnl|my_center|LOCUS_02930 15555 15920 gene locus_tag LOCUS_02940 15555 15920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 15899 16918 gene locus_tag LOCUS_02950 15899 16918 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771202.1 protein_id gnl|my_center|LOCUS_02950 16919 19387 gene locus_tag LOCUS_02960 gene polA 16919 19387 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583247.1 protein_id gnl|my_center|LOCUS_02960 19487 21280 gene locus_tag LOCUS_02970 19487 21280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 22651 21284 gene locus_tag LOCUS_02980 22651 21284 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_02980 22784 23785 gene locus_tag LOCUS_02990 22784 23785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 23806 24192 gene locus_tag LOCUS_03000 gene dksA 23806 24192 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940956.1 protein_id gnl|my_center|LOCUS_03000 24241 24837 gene locus_tag LOCUS_03010 24241 24837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 24853 26859 gene locus_tag LOCUS_03020 24853 26859 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597830.1 protein_id gnl|my_center|LOCUS_03020 27168 27917 gene locus_tag LOCUS_03030 27168 27917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 >Feature sequence012 <1 2167 gene locus_tag LOCUS_03040 <1 2167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790471.1:PEP/pyruvate-binding domain-containing protein 2184 5147 gene locus_tag LOCUS_03050 2184 5147 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_03050 5215 6924 gene locus_tag LOCUS_03060 5215 6924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03060 6926 8287 gene locus_tag LOCUS_03070 6926 8287 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_03070 8284 8490 gene locus_tag LOCUS_03080 8284 8490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 8888 9235 gene locus_tag LOCUS_03090 8888 9235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 9238 9522 gene locus_tag LOCUS_03100 9238 9522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 10977 9616 gene locus_tag LOCUS_03110 gene gdhA 10977 9616 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094817.1 protein_id gnl|my_center|LOCUS_03110 11644 11168 gene locus_tag LOCUS_03120 11644 11168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 13289 11736 gene locus_tag LOCUS_03130 13289 11736 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881359.1 protein_id gnl|my_center|LOCUS_03130 14468 13320 gene locus_tag LOCUS_03140 14468 13320 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249077.1 protein_id gnl|my_center|LOCUS_03140 16539 14470 gene locus_tag LOCUS_03150 16539 14470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 17633 17031 gene locus_tag LOCUS_03160 17633 17031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 18406 17633 gene locus_tag LOCUS_03170 18406 17633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 19516 18410 gene locus_tag LOCUS_03180 19516 18410 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942641.1 protein_id gnl|my_center|LOCUS_03180 20271 19513 gene locus_tag LOCUS_03190 20271 19513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 21230 20355 gene locus_tag LOCUS_03200 21230 20355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 21413 23062 gene locus_tag LOCUS_03210 21413 23062 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 protein_id gnl|my_center|LOCUS_03210 23069 24397 gene locus_tag LOCUS_03220 23069 24397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 24394 24996 gene locus_tag LOCUS_03230 24394 24996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 24990 25643 gene locus_tag LOCUS_03240 gene pgsA 24990 25643 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596626.1 protein_id gnl|my_center|LOCUS_03240 27247 25640 gene locus_tag LOCUS_03250 27247 25640 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926897.1 protein_id gnl|my_center|LOCUS_03250 27970 27290 gene locus_tag LOCUS_03260 27970 27290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 >Feature sequence013 890 1510 gene locus_tag LOCUS_03270 890 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 1507 2553 gene locus_tag LOCUS_03280 1507 2553 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933710.1 protein_id gnl|my_center|LOCUS_03280 2550 3551 gene locus_tag LOCUS_03290 2550 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 3573 3890 gene locus_tag LOCUS_03300 3573 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 3928 4992 gene locus_tag LOCUS_03310 gene recA 3928 4992 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940821.1 protein_id gnl|my_center|LOCUS_03310 4992 6173 gene locus_tag LOCUS_03320 4992 6173 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_03320 6160 6618 gene locus_tag LOCUS_03330 6160 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 8370 6775 gene locus_tag LOCUS_03340 gene gcvPB 8370 6775 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948420.1 protein_id gnl|my_center|LOCUS_03340 6916 7015 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9725 8367 gene locus_tag LOCUS_03350 gene gcvPA 9725 8367 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460675.1 protein_id gnl|my_center|LOCUS_03350 10203 9802 gene locus_tag LOCUS_03360 gene gcvH 10203 9802 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703428.1 protein_id gnl|my_center|LOCUS_03360 10705 10232 gene locus_tag LOCUS_03370 10705 10232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 10723 12153 gene locus_tag LOCUS_03380 10723 12153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 10757 10856 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12167 12319 gene locus_tag LOCUS_03390 12167 12319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 12456 12695 gene locus_tag LOCUS_03400 12456 12695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 12697 14013 gene locus_tag LOCUS_03410 12697 14013 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174384.1 protein_id gnl|my_center|LOCUS_03410 14729 14022 gene locus_tag LOCUS_03420 14729 14022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 15847 14726 gene locus_tag LOCUS_03430 gene hisC 15847 14726 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546009.1 protein_id gnl|my_center|LOCUS_03430 18425 15840 gene locus_tag LOCUS_03440 gene mutS 18425 15840 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583439.1 protein_id gnl|my_center|LOCUS_03440 18579 22049 gene locus_tag LOCUS_03450 18579 22049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 22133 22426 gene locus_tag LOCUS_03460 22133 22426 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022250.1 protein_id gnl|my_center|LOCUS_03460 22423 23718 gene locus_tag LOCUS_03470 22423 23718 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057723.1 protein_id gnl|my_center|LOCUS_03470 23740 23973 gene locus_tag LOCUS_03480 23740 23973 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868932.1 protein_id gnl|my_center|LOCUS_03480 23984 24466 gene locus_tag LOCUS_03490 23984 24466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 24463 25131 gene locus_tag LOCUS_03500 24463 25131 CDS product aromatic aminobenezylarsenical efflux permease ArsG family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107453.1 protein_id gnl|my_center|LOCUS_03500 25183 25566 gene locus_tag LOCUS_03510 25183 25566 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942790.1 protein_id gnl|my_center|LOCUS_03510 25803 26840 gene locus_tag LOCUS_03520 25803 26840 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939306.1 protein_id gnl|my_center|LOCUS_03520 26837 27352 gene locus_tag LOCUS_03530 26837 27352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939305.1 protein_id gnl|my_center|LOCUS_03530 >Feature sequence014 1 618 gene locus_tag LOCUS_03540 1 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 815 621 gene locus_tag LOCUS_03550 815 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 3201 817 gene locus_tag LOCUS_03560 gene pheT 3201 817 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016058.1 protein_id gnl|my_center|LOCUS_03560 4232 3216 gene locus_tag LOCUS_03570 gene pheS 4232 3216 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053743.1 protein_id gnl|my_center|LOCUS_03570 4387 5028 gene locus_tag LOCUS_03580 4387 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 5687 5034 gene locus_tag LOCUS_03590 5687 5034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 6522 5671 gene locus_tag LOCUS_03600 6522 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 11700 6529 gene locus_tag LOCUS_03610 11700 6529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 12974 11868 gene locus_tag LOCUS_03620 12974 11868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 14632 12971 gene locus_tag LOCUS_03630 14632 12971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 15537 14632 gene locus_tag LOCUS_03640 15537 14632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 16376 15534 gene locus_tag LOCUS_03650 gene nadC 16376 15534 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583119.1 protein_id gnl|my_center|LOCUS_03650 19039 16373 gene locus_tag LOCUS_03660 19039 16373 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942688.1 protein_id gnl|my_center|LOCUS_03660 19211 19915 gene locus_tag LOCUS_03670 19211 19915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 19896 20807 gene locus_tag LOCUS_03680 19896 20807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 20870 22804 gene locus_tag LOCUS_03690 20870 22804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 22913 24178 gene locus_tag LOCUS_03700 22913 24178 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986780.1 protein_id gnl|my_center|LOCUS_03700 24409 24215 gene locus_tag LOCUS_03710 gene rpmB 24409 24215 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942874.1 protein_id gnl|my_center|LOCUS_03710 25440 24499 gene locus_tag LOCUS_03720 25440 24499 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438310.1 protein_id gnl|my_center|LOCUS_03720 26453 25449 gene locus_tag LOCUS_03730 26453 25449 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763359.1 protein_id gnl|my_center|LOCUS_03730 >Feature sequence015 715 275 gene locus_tag LOCUS_03740 715 275 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880818.1 protein_id gnl|my_center|LOCUS_03740 1738 854 gene locus_tag LOCUS_03750 1738 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 4101 1735 gene locus_tag LOCUS_03760 4101 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 11882 4098 gene locus_tag LOCUS_03770 11882 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 12556 11882 gene locus_tag LOCUS_03780 12556 11882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 13241 12537 gene locus_tag LOCUS_03790 13241 12537 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616588.1 protein_id gnl|my_center|LOCUS_03790 13539 15062 gene locus_tag LOCUS_03800 13539 15062 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_03800 15207 17702 gene locus_tag LOCUS_03810 15207 17702 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678883.1 protein_id gnl|my_center|LOCUS_03810 18088 18966 gene locus_tag LOCUS_03820 18088 18966 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682267.1 protein_id gnl|my_center|LOCUS_03820 19106 20683 gene locus_tag LOCUS_03830 19106 20683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 20722 21906 gene locus_tag LOCUS_03840 20722 21906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 21987 24395 gene locus_tag LOCUS_03850 21987 24395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259586.1 protein_id gnl|my_center|LOCUS_03850 >Feature sequence016 1763 891 gene locus_tag LOCUS_03860 1763 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 3033 1843 gene locus_tag LOCUS_03870 3033 1843 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222346.1 protein_id gnl|my_center|LOCUS_03870 3806 3030 gene locus_tag LOCUS_03880 3806 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 4575 3772 gene locus_tag LOCUS_03890 4575 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 5785 4583 gene locus_tag LOCUS_03900 5785 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 6347 5916 gene locus_tag LOCUS_03910 6347 5916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 6512 7075 gene locus_tag LOCUS_03920 6512 7075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 8746 7175 gene locus_tag LOCUS_03930 8746 7175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 10887 8854 gene locus_tag LOCUS_03940 10887 8854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 11902 10880 gene locus_tag LOCUS_03950 gene asd 11902 10880 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881220.1 protein_id gnl|my_center|LOCUS_03950 12113 14107 gene locus_tag LOCUS_03960 12113 14107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 14373 14104 gene locus_tag LOCUS_03970 14373 14104 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249742.1 protein_id gnl|my_center|LOCUS_03970 14603 14373 gene locus_tag LOCUS_03980 14603 14373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 15366 14701 gene locus_tag LOCUS_03990 gene radC 15366 14701 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546157.1 protein_id gnl|my_center|LOCUS_03990 15546 15385 gene locus_tag LOCUS_04000 15546 15385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 15992 15498 gene locus_tag LOCUS_04010 15992 15498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 16534 15989 gene locus_tag LOCUS_04020 16534 15989 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039550.1 protein_id gnl|my_center|LOCUS_04020 20027 16683 gene locus_tag LOCUS_04030 20027 16683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 20652 21338 gene locus_tag LOCUS_04040 20652 21338 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039550.1 protein_id gnl|my_center|LOCUS_04040 21673 23073 gene locus_tag LOCUS_04050 21673 23073 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_04050 23307 24722 gene locus_tag LOCUS_04060 23307 24722 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_04060 >Feature sequence017 345 46 gene locus_tag LOCUS_04070 345 46 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066199.1 protein_id gnl|my_center|LOCUS_04070 506 2344 gene locus_tag LOCUS_04080 506 2344 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902257.1 protein_id gnl|my_center|LOCUS_04080 3427 2345 gene locus_tag LOCUS_04090 3427 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 3581 4870 gene locus_tag LOCUS_04100 3581 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 4925 6526 gene locus_tag LOCUS_04110 4925 6526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 6527 7243 gene locus_tag LOCUS_04120 6527 7243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 7244 7459 gene locus_tag LOCUS_04130 7244 7459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 7554 9251 gene locus_tag LOCUS_04140 7554 9251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 10835 9264 gene locus_tag LOCUS_04150 10835 9264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 16803 10915 gene locus_tag LOCUS_04160 16803 10915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 17531 17082 gene locus_tag LOCUS_04170 gene dut 17531 17082 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280519.1 protein_id gnl|my_center|LOCUS_04170 19740 17512 gene locus_tag LOCUS_04180 gene pnp 19740 17512 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_04180 20086 19820 gene locus_tag LOCUS_04190 gene rpsO 20086 19820 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583506.1 protein_id gnl|my_center|LOCUS_04190 21698 20229 gene locus_tag LOCUS_04200 gene guaB 21698 20229 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942835.1 protein_id gnl|my_center|LOCUS_04200 22861 21806 gene locus_tag LOCUS_04210 22861 21806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 23009 24037 gene locus_tag LOCUS_04220 gene purM 23009 24037 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457724.1 protein_id gnl|my_center|LOCUS_04220 >Feature sequence018 3840 2686 gene locus_tag LOCUS_04230 gene alr 3840 2686 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001982425.1 protein_id gnl|my_center|LOCUS_04230 4685 3855 gene locus_tag LOCUS_04240 gene folE2 4685 3855 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_04240 5580 4687 gene locus_tag LOCUS_04250 gene truB 5580 4687 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016546.1 protein_id gnl|my_center|LOCUS_04250 6529 5558 gene locus_tag LOCUS_04260 6529 5558 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_04260 6893 6522 gene locus_tag LOCUS_04270 6893 6522 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942234.1 protein_id gnl|my_center|LOCUS_04270 9538 6893 gene locus_tag LOCUS_04280 9538 6893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 10127 9528 gene locus_tag LOCUS_04290 10127 9528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 11676 10114 gene locus_tag LOCUS_04300 11676 10114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 12152 11676 gene locus_tag LOCUS_04310 12152 11676 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583566.1 protein_id gnl|my_center|LOCUS_04310 12384 13616 gene locus_tag LOCUS_04320 12384 13616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 14812 13625 gene locus_tag LOCUS_04330 14812 13625 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118841.1 protein_id gnl|my_center|LOCUS_04330 16589 14988 gene locus_tag LOCUS_04340 16589 14988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 22134 16687 gene locus_tag LOCUS_04350 22134 16687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 <24214 22472 gene locus_tag LOCUS_04360 <24214 22472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016651.1:urocanate hydratase >Feature sequence019 146 454 gene locus_tag LOCUS_04370 gene rpsJ 146 454 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943487.1 protein_id gnl|my_center|LOCUS_04370 497 1117 gene locus_tag LOCUS_04380 gene rplC 497 1117 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081835.1 protein_id gnl|my_center|LOCUS_04380 1129 1758 gene locus_tag LOCUS_04390 gene rplD 1129 1758 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127258.1 protein_id gnl|my_center|LOCUS_04390 1758 2057 gene locus_tag LOCUS_04400 1758 2057 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_04400 2090 2920 gene locus_tag LOCUS_04410 gene rplB 2090 2920 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943483.1 protein_id gnl|my_center|LOCUS_04410 2953 3219 gene locus_tag LOCUS_04420 gene rpsS 2953 3219 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545511.1 protein_id gnl|my_center|LOCUS_04420 3289 3633 gene locus_tag LOCUS_04430 gene rplV 3289 3633 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486710.1 protein_id gnl|my_center|LOCUS_04430 3659 4327 gene locus_tag LOCUS_04440 gene rpsC 3659 4327 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_04440 4345 4764 gene locus_tag LOCUS_04450 gene rplP 4345 4764 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966405.1 protein_id gnl|my_center|LOCUS_04450 4761 4967 gene locus_tag LOCUS_04460 gene rpmC 4761 4967 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205459.1 protein_id gnl|my_center|LOCUS_04460 4964 5221 gene locus_tag LOCUS_04470 gene rpsQ 4964 5221 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390429.1 protein_id gnl|my_center|LOCUS_04470 5224 5592 gene locus_tag LOCUS_04480 gene rplN 5224 5592 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779438.1 protein_id gnl|my_center|LOCUS_04480 5603 5914 gene locus_tag LOCUS_04490 gene rplX 5603 5914 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002447331.1 protein_id gnl|my_center|LOCUS_04490 5926 6477 gene locus_tag LOCUS_04500 gene rplE 5926 6477 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_04500 6499 6684 gene locus_tag LOCUS_04510 6499 6684 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938611.1 protein_id gnl|my_center|LOCUS_04510 6700 7098 gene locus_tag LOCUS_04520 gene rpsH 6700 7098 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215438.1 protein_id gnl|my_center|LOCUS_04520 7111 7653 gene locus_tag LOCUS_04530 gene rplF 7111 7653 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943471.1 protein_id gnl|my_center|LOCUS_04530 7669 8028 gene locus_tag LOCUS_04540 gene rplR 7669 8028 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829747.1 protein_id gnl|my_center|LOCUS_04540 8038 8562 gene locus_tag LOCUS_04550 gene rpsE 8038 8562 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943469.1 protein_id gnl|my_center|LOCUS_04550 8567 9016 gene locus_tag LOCUS_04560 gene rplO 8567 9016 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943467.1 protein_id gnl|my_center|LOCUS_04560 9006 10322 gene locus_tag LOCUS_04570 gene secY 9006 10322 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_04570 10462 10692 gene locus_tag LOCUS_04580 gene infA 10462 10692 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942395.1 protein_id gnl|my_center|LOCUS_04580 10840 11208 gene locus_tag LOCUS_04590 gene rpsM 10840 11208 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943462.1 protein_id gnl|my_center|LOCUS_04590 11223 11603 gene locus_tag LOCUS_04600 gene rpsK 11223 11603 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390415.1 protein_id gnl|my_center|LOCUS_04600 11648 12277 gene locus_tag LOCUS_04610 gene rpsD 11648 12277 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_04610 12292 13311 gene locus_tag LOCUS_04620 12292 13311 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626433.1 protein_id gnl|my_center|LOCUS_04620 13308 13871 gene locus_tag LOCUS_04630 13308 13871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 15166 13937 gene locus_tag LOCUS_04640 15166 13937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 16934 15192 gene locus_tag LOCUS_04650 16934 15192 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039157.1 protein_id gnl|my_center|LOCUS_04650 18532 16952 gene locus_tag LOCUS_04660 18532 16952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 19011 18541 gene locus_tag LOCUS_04670 19011 18541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 20605 19091 gene locus_tag LOCUS_04680 20605 19091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 21889 20726 gene locus_tag LOCUS_04690 21889 20726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 22069 23916 gene locus_tag LOCUS_04700 22069 23916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 >Feature sequence020 3 1040 gene locus_tag LOCUS_04710 3 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 3347 1041 gene locus_tag LOCUS_04720 3347 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 4896 3328 gene locus_tag LOCUS_04730 4896 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 5959 4889 gene locus_tag LOCUS_04740 gene buk 5959 4889 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420702.1 protein_id gnl|my_center|LOCUS_04740 6869 5970 gene locus_tag LOCUS_04750 gene ptb 6869 5970 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966357.1 protein_id gnl|my_center|LOCUS_04750 8640 6883 gene locus_tag LOCUS_04760 gene ptsP 8640 6883 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218638.1 protein_id gnl|my_center|LOCUS_04760 8911 8642 gene locus_tag LOCUS_04770 8911 8642 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686964.1 protein_id gnl|my_center|LOCUS_04770 9336 8908 gene locus_tag LOCUS_04780 9336 8908 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067454.1 protein_id gnl|my_center|LOCUS_04780 10292 9336 gene locus_tag LOCUS_04790 gene hprK 10292 9336 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942530.1 protein_id gnl|my_center|LOCUS_04790 10744 10292 gene locus_tag LOCUS_04800 gene ptsN 10744 10292 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766506.1 protein_id gnl|my_center|LOCUS_04800 12264 10747 gene locus_tag LOCUS_04810 gene rpoN 12264 10747 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403901.1 protein_id gnl|my_center|LOCUS_04810 12432 13472 gene locus_tag LOCUS_04820 12432 13472 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_04820 13474 14301 gene locus_tag LOCUS_04830 13474 14301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 14757 14527 gene locus_tag LOCUS_04840 14757 14527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 14773 16653 gene locus_tag LOCUS_04850 gene mrdA 14773 16653 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_04850 16650 17750 gene locus_tag LOCUS_04860 gene rodA 16650 17750 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016844.1 protein_id gnl|my_center|LOCUS_04860 17758 18690 gene locus_tag LOCUS_04870 17758 18690 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083159.1 protein_id gnl|my_center|LOCUS_04870 19074 18949 gene locus_tag LOCUS_04880 19074 18949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 22310 19095 gene locus_tag LOCUS_04890 22310 19095 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858356.1 protein_id gnl|my_center|LOCUS_04890 >Feature sequence021 832 29 gene locus_tag LOCUS_04900 832 29 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406424.1 protein_id gnl|my_center|LOCUS_04900 3515 855 gene locus_tag LOCUS_04910 3515 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 3543 3755 gene locus_tag LOCUS_04920 3543 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 3777 5696 gene locus_tag LOCUS_04930 3777 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 5729 6760 gene locus_tag LOCUS_04940 5729 6760 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681769.1 protein_id gnl|my_center|LOCUS_04940 7420 6776 gene locus_tag LOCUS_04950 7420 6776 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680231.1 protein_id gnl|my_center|LOCUS_04950 8532 7435 gene locus_tag LOCUS_04960 gene thiH 8532 7435 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260917.1 protein_id gnl|my_center|LOCUS_04960 8717 12451 gene locus_tag LOCUS_04970 gene dnaE 8717 12451 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880626.1 protein_id gnl|my_center|LOCUS_04970 12448 13383 gene locus_tag LOCUS_04980 12448 13383 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937980.1 protein_id gnl|my_center|LOCUS_04980 15662 13380 gene locus_tag LOCUS_04990 15662 13380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 19016 15759 gene locus_tag LOCUS_05000 19016 15759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 22213 19013 gene locus_tag LOCUS_05010 gene recC 22213 19013 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932746.1 protein_id gnl|my_center|LOCUS_05010 >Feature sequence022 451 2088 gene locus_tag LOCUS_05020 451 2088 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_05020 3263 2085 gene locus_tag LOCUS_05030 3263 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 4634 3357 gene locus_tag LOCUS_05040 4634 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 5467 4637 gene locus_tag LOCUS_05050 5467 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 5627 7225 gene locus_tag LOCUS_05060 5627 7225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 8005 7235 gene locus_tag LOCUS_05070 8005 7235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 8740 8030 gene locus_tag LOCUS_05080 8740 8030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 10080 8737 gene locus_tag LOCUS_05090 10080 8737 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094729231.1 protein_id gnl|my_center|LOCUS_05090 11173 10193 gene locus_tag LOCUS_05100 11173 10193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 14510 11235 gene locus_tag LOCUS_05110 14510 11235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 15800 14637 gene locus_tag LOCUS_05120 15800 14637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 16490 15825 gene locus_tag LOCUS_05130 16490 15825 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_05130 17153 16500 gene locus_tag LOCUS_05140 17153 16500 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946654.1 protein_id gnl|my_center|LOCUS_05140 18074 17154 gene locus_tag LOCUS_05150 gene xerD 18074 17154 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723602.1 protein_id gnl|my_center|LOCUS_05150 18905 18087 gene locus_tag LOCUS_05160 18905 18087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 19852 19055 gene locus_tag LOCUS_05170 19852 19055 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938913.1 protein_id gnl|my_center|LOCUS_05170 <22237 19862 gene locus_tag LOCUS_05180 <22237 19862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942279.1:phosphoribosylformylglycinamidine synthase subunit PurS >Feature sequence023 1 2067 gene locus_tag LOCUS_05190 1 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 2079 4988 gene locus_tag LOCUS_05200 2079 4988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 6470 4878 gene locus_tag LOCUS_05210 6470 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 4992 5091 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8256 6460 gene locus_tag LOCUS_05220 8256 6460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 8408 8333 gene locus_tag LOCUS_t00060 8408 8333 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 8603 9379 gene locus_tag LOCUS_05230 8603 9379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 9399 11303 gene locus_tag LOCUS_05240 gene dnaK 9399 11303 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_05240 11310 12431 gene locus_tag LOCUS_05250 gene dnaJ 11310 12431 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454751.1 protein_id gnl|my_center|LOCUS_05250 12431 13426 gene locus_tag LOCUS_05260 12431 13426 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880006.1 protein_id gnl|my_center|LOCUS_05260 13591 14601 gene locus_tag LOCUS_05270 13591 14601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 14884 16089 gene locus_tag LOCUS_05280 14884 16089 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785925.1 protein_id gnl|my_center|LOCUS_05280 17268 16126 gene locus_tag LOCUS_05290 17268 16126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 17795 17520 gene locus_tag LOCUS_05300 17795 17520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 18456 17779 gene locus_tag LOCUS_05310 18456 17779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 18653 19987 gene locus_tag LOCUS_05320 18653 19987 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_05320 21099 19984 gene locus_tag LOCUS_05330 21099 19984 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943453.1 protein_id gnl|my_center|LOCUS_05330 <22207 21102 gene locus_tag LOCUS_05340 <22207 21102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943452.1:ABC transporter permease >Feature sequence024 228 1637 gene locus_tag LOCUS_05350 228 1637 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107667.1 protein_id gnl|my_center|LOCUS_05350 1778 2896 gene locus_tag LOCUS_05360 1778 2896 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_05360 3011 3829 gene locus_tag LOCUS_05370 3011 3829 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816933.1 protein_id gnl|my_center|LOCUS_05370 3842 4345 gene locus_tag LOCUS_05380 3842 4345 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583695.1 protein_id gnl|my_center|LOCUS_05380 4355 4603 gene locus_tag LOCUS_05390 4355 4603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 4600 5733 gene locus_tag LOCUS_05400 4600 5733 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942114.1 protein_id gnl|my_center|LOCUS_05400 5751 6575 gene locus_tag LOCUS_05410 5751 6575 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942115.1 protein_id gnl|my_center|LOCUS_05410 6572 7114 gene locus_tag LOCUS_05420 6572 7114 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496537.1 protein_id gnl|my_center|LOCUS_05420 7189 7533 gene locus_tag LOCUS_05430 7189 7533 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880271.1 protein_id gnl|my_center|LOCUS_05430 7548 7913 gene locus_tag LOCUS_05440 7548 7913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 8929 7886 gene locus_tag LOCUS_05450 gene obgE 8929 7886 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246161.1 protein_id gnl|my_center|LOCUS_05450 9272 9003 gene locus_tag LOCUS_05460 gene rpmA 9272 9003 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938227.1 protein_id gnl|my_center|LOCUS_05460 9600 9289 gene locus_tag LOCUS_05470 gene rplU 9600 9289 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119318.1 protein_id gnl|my_center|LOCUS_05470 11289 9694 gene locus_tag LOCUS_05480 11289 9694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 11601 11290 gene locus_tag LOCUS_05490 11601 11290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 12542 11616 gene locus_tag LOCUS_05500 12542 11616 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 protein_id gnl|my_center|LOCUS_05500 12665 13576 gene locus_tag LOCUS_05510 12665 13576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 13616 15094 gene locus_tag LOCUS_05520 13616 15094 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334293.1 protein_id gnl|my_center|LOCUS_05520 15099 16331 gene locus_tag LOCUS_05530 15099 16331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 17891 16359 gene locus_tag LOCUS_05540 gene hutH 17891 16359 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681759.1 protein_id gnl|my_center|LOCUS_05540 18055 18903 gene locus_tag LOCUS_05550 gene folD 18055 18903 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545120.1 protein_id gnl|my_center|LOCUS_05550 18900 19337 gene locus_tag LOCUS_05560 18900 19337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 19337 20764 gene locus_tag LOCUS_05570 19337 20764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 20830 21132 gene locus_tag LOCUS_05580 20830 21132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 21145 21221 gene locus_tag LOCUS_t00070 21145 21221 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence025 423 797 gene locus_tag LOCUS_05590 423 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 981 1880 gene locus_tag LOCUS_05600 981 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 1983 2765 gene locus_tag LOCUS_05610 1983 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 4248 2830 gene locus_tag LOCUS_05620 4248 2830 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016159.1 protein_id gnl|my_center|LOCUS_05620 4612 5622 gene locus_tag LOCUS_05630 4612 5622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 5640 6461 gene locus_tag LOCUS_05640 5640 6461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 6458 7837 gene locus_tag LOCUS_05650 6458 7837 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459330.1 protein_id gnl|my_center|LOCUS_05650 7827 8444 gene locus_tag LOCUS_05660 7827 8444 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707898.1 protein_id gnl|my_center|LOCUS_05660 8434 8841 gene locus_tag LOCUS_05670 8434 8841 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_05670 8844 9488 gene locus_tag LOCUS_05680 8844 9488 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533089.1 protein_id gnl|my_center|LOCUS_05680 9533 10657 gene locus_tag LOCUS_05690 9533 10657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 10731 12623 gene locus_tag LOCUS_05700 10731 12623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 12624 14030 gene locus_tag LOCUS_05710 12624 14030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 14103 16151 gene locus_tag LOCUS_05720 14103 16151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 17837 16155 gene locus_tag LOCUS_05730 17837 16155 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096858.1 protein_id gnl|my_center|LOCUS_05730 17964 18536 gene locus_tag LOCUS_05740 17964 18536 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020385.1 protein_id gnl|my_center|LOCUS_05740 21529 18542 gene locus_tag LOCUS_05750 21529 18542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 >Feature sequence026 <1 1452 gene locus_tag LOCUS_05760 <1 1452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812165.1:2-hydroxyacyl-CoA dehydratase 2545 1517 gene locus_tag LOCUS_05770 2545 1517 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946960.1 protein_id gnl|my_center|LOCUS_05770 2937 2758 gene locus_tag LOCUS_05780 2937 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 3089 4414 gene locus_tag LOCUS_05790 3089 4414 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251170.1 protein_id gnl|my_center|LOCUS_05790 4502 5935 gene locus_tag LOCUS_05800 4502 5935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880130.1 protein_id gnl|my_center|LOCUS_05800 6022 6210 gene locus_tag LOCUS_05810 6022 6210 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720124.1 protein_id gnl|my_center|LOCUS_05810 6229 6600 gene locus_tag LOCUS_05820 6229 6600 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937348.1 protein_id gnl|my_center|LOCUS_05820 6601 7497 gene locus_tag LOCUS_05830 6601 7497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 7548 9065 gene locus_tag LOCUS_05840 7548 9065 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817435.1 protein_id gnl|my_center|LOCUS_05840 9055 9495 gene locus_tag LOCUS_05850 gene tsaE 9055 9495 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_05850 9461 10465 gene locus_tag LOCUS_05860 9461 10465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 13664 10458 gene locus_tag LOCUS_05870 13664 10458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 13870 15546 gene locus_tag LOCUS_05880 13870 15546 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_05880 16867 15596 gene locus_tag LOCUS_05890 16867 15596 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393972.1 protein_id gnl|my_center|LOCUS_05890 17284 16868 gene locus_tag LOCUS_05900 17284 16868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 17886 17302 gene locus_tag LOCUS_05910 17886 17302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 18089 19504 gene locus_tag LOCUS_05920 18089 19504 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964406.1 protein_id gnl|my_center|LOCUS_05920 19594 20472 gene locus_tag LOCUS_05930 gene rhuM 19594 20472 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648596.1 protein_id gnl|my_center|LOCUS_05930 >Feature sequence027 <1 896 gene locus_tag LOCUS_05940 <1 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256545.1:kelch repeat-containing protein 917 3004 gene locus_tag LOCUS_05950 917 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 2995 3408 gene locus_tag LOCUS_05960 2995 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 3479 4054 gene locus_tag LOCUS_05970 3479 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 4051 5715 gene locus_tag LOCUS_05980 4051 5715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 6803 6042 gene locus_tag LOCUS_05990 6803 6042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 7075 6833 gene locus_tag LOCUS_06000 7075 6833 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517660.1 protein_id gnl|my_center|LOCUS_06000 7292 7056 gene locus_tag LOCUS_06010 7292 7056 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933584.1 protein_id gnl|my_center|LOCUS_06010 9240 7399 gene locus_tag LOCUS_06020 9240 7399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 11111 9240 gene locus_tag LOCUS_06030 11111 9240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 11605 11114 gene locus_tag LOCUS_06040 11605 11114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 13948 11615 gene locus_tag LOCUS_06050 gene bamA 13948 11615 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_06050 14625 13945 gene locus_tag LOCUS_06060 14625 13945 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_06060 15919 14618 gene locus_tag LOCUS_06070 15919 14618 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_06070 17219 15912 gene locus_tag LOCUS_06080 17219 15912 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_06080 18733 17216 gene locus_tag LOCUS_06090 gene lysS 18733 17216 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942911.1 protein_id gnl|my_center|LOCUS_06090 19023 18730 gene locus_tag LOCUS_06100 19023 18730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 >Feature sequence028 <1 528 gene locus_tag LOCUS_06110 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021591.1:ATP-binding protein 1718 525 gene locus_tag LOCUS_06120 1718 525 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356704.1 protein_id gnl|my_center|LOCUS_06120 3804 1807 gene locus_tag LOCUS_06130 3804 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 4074 4586 gene locus_tag LOCUS_06140 4074 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 4603 4827 gene locus_tag LOCUS_06150 gene rpsR 4603 4827 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420527.1 protein_id gnl|my_center|LOCUS_06150 4838 5350 gene locus_tag LOCUS_06160 gene rplI 4838 5350 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545246.1 protein_id gnl|my_center|LOCUS_06160 5354 6733 gene locus_tag LOCUS_06170 gene dnaB 5354 6733 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938258.1 protein_id gnl|my_center|LOCUS_06170 6739 7437 gene locus_tag LOCUS_06180 6739 7437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 7498 8088 gene locus_tag LOCUS_06190 7498 8088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 8085 9395 gene locus_tag LOCUS_06200 gene thiC 8085 9395 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941266.1 protein_id gnl|my_center|LOCUS_06200 9385 9915 gene locus_tag LOCUS_06210 9385 9915 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939086.1 protein_id gnl|my_center|LOCUS_06210 9945 10826 gene locus_tag LOCUS_06220 9945 10826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 11007 10932 gene locus_tag LOCUS_t00080 11007 10932 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 14169 11056 gene locus_tag LOCUS_06230 14169 11056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 15004 14273 gene locus_tag LOCUS_06240 15004 14273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 15441 15001 gene locus_tag LOCUS_06250 15441 15001 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085366.1 protein_id gnl|my_center|LOCUS_06250 16388 15438 gene locus_tag LOCUS_06260 16388 15438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 18697 16388 gene locus_tag LOCUS_06270 18697 16388 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_06270 <20211 18774 gene locus_tag LOCUS_06280 <20211 18774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763594.1:nucleoside kinase >Feature sequence029 193 2316 gene locus_tag LOCUS_06290 193 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 2484 2924 gene locus_tag LOCUS_06300 2484 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 2928 4034 gene locus_tag LOCUS_06310 gene orr 2928 4034 CDS product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986511.1 protein_id gnl|my_center|LOCUS_06310 4045 4608 gene locus_tag LOCUS_06320 4045 4608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 6192 4609 gene locus_tag LOCUS_06330 6192 4609 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964426.1 protein_id gnl|my_center|LOCUS_06330 6842 6231 gene locus_tag LOCUS_06340 6842 6231 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177702.1 protein_id gnl|my_center|LOCUS_06340 7183 6845 gene locus_tag LOCUS_06350 7183 6845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 7287 7212 gene locus_tag LOCUS_t00090 7287 7212 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8622 7390 gene locus_tag LOCUS_06360 8622 7390 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_06360 10301 8757 gene locus_tag LOCUS_06370 10301 8757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 12017 10314 gene locus_tag LOCUS_06380 12017 10314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 13125 12022 gene locus_tag LOCUS_06390 13125 12022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 16394 13206 gene locus_tag LOCUS_06400 16394 13206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 18623 16539 gene locus_tag LOCUS_06410 gene clpB 18623 16539 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948176.1 protein_id gnl|my_center|LOCUS_06410 19751 18693 gene locus_tag LOCUS_06420 19751 18693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 >Feature sequence030 545 2251 gene locus_tag LOCUS_06430 545 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 2276 3268 gene locus_tag LOCUS_06440 2276 3268 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109478.1 protein_id gnl|my_center|LOCUS_06440 3268 3891 gene locus_tag LOCUS_06450 3268 3891 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765873.1 protein_id gnl|my_center|LOCUS_06450 3888 4499 gene locus_tag LOCUS_06460 3888 4499 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092895.1 protein_id gnl|my_center|LOCUS_06460 4496 5095 gene locus_tag LOCUS_06470 gene nqrE 4496 5095 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303538.1 protein_id gnl|my_center|LOCUS_06470 5110 6219 gene locus_tag LOCUS_06480 gene nqrF 5110 6219 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951261.1 protein_id gnl|my_center|LOCUS_06480 6231 6734 gene locus_tag LOCUS_06490 6231 6734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 6749 7537 gene locus_tag LOCUS_06500 6749 7537 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434727.1 protein_id gnl|my_center|LOCUS_06500 8113 7541 gene locus_tag LOCUS_06510 8113 7541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 8223 8660 gene locus_tag LOCUS_06520 8223 8660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 8768 8968 gene locus_tag LOCUS_06530 8768 8968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 9065 10267 gene locus_tag LOCUS_06540 9065 10267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 10875 13271 gene locus_tag LOCUS_06550 10875 13271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 13264 14037 gene locus_tag LOCUS_06560 13264 14037 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061323.1 protein_id gnl|my_center|LOCUS_06560 14034 15299 gene locus_tag LOCUS_06570 gene tviB 14034 15299 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073077.1 protein_id gnl|my_center|LOCUS_06570 15299 16249 gene locus_tag LOCUS_06580 15299 16249 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208044.1 protein_id gnl|my_center|LOCUS_06580 16249 16830 gene locus_tag LOCUS_06590 16249 16830 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_06590 16873 18075 gene locus_tag LOCUS_06600 16873 18075 CDS product TIGR00529 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867137.1 protein_id gnl|my_center|LOCUS_06600 18102 18623 gene locus_tag LOCUS_06610 gene arfB 18102 18623 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_06610 >Feature sequence031 <1 675 gene locus_tag LOCUS_06620 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002673537.1:HD domain-containing protein 2689 830 gene locus_tag LOCUS_06630 2689 830 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975332.1 protein_id gnl|my_center|LOCUS_06630 2854 2705 gene locus_tag LOCUS_06640 2854 2705 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975331.1 protein_id gnl|my_center|LOCUS_06640 3235 2864 gene locus_tag LOCUS_06650 3235 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 3726 3313 gene locus_tag LOCUS_06660 3726 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 3977 5347 gene locus_tag LOCUS_06670 3977 5347 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_06670 5519 9607 gene locus_tag LOCUS_06680 5519 9607 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545209.1 protein_id gnl|my_center|LOCUS_06680 9624 10829 gene locus_tag LOCUS_06690 9624 10829 CDS product glyceraldehyde 3-phosphate dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546756.1 protein_id gnl|my_center|LOCUS_06690 10857 11687 gene locus_tag LOCUS_06700 10857 11687 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048249.1 protein_id gnl|my_center|LOCUS_06700 11699 13084 gene locus_tag LOCUS_06710 gene gltA 11699 13084 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583430.1 protein_id gnl|my_center|LOCUS_06710 13432 14775 gene locus_tag LOCUS_06720 gene gdhA 13432 14775 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766346.1 protein_id gnl|my_center|LOCUS_06720 14816 15094 gene locus_tag LOCUS_06730 14816 15094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 15183 15596 gene locus_tag LOCUS_06740 15183 15596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 15615 16088 gene locus_tag LOCUS_06750 15615 16088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 16124 16291 gene locus_tag LOCUS_06760 16124 16291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 16392 16682 gene locus_tag LOCUS_06770 16392 16682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 17189 16668 gene locus_tag LOCUS_06780 gene pth 17189 16668 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672368.1 protein_id gnl|my_center|LOCUS_06780 19192 17216 gene locus_tag LOCUS_06790 19192 17216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 >Feature sequence032 1977 193 gene locus_tag LOCUS_06800 gene sppA 1977 193 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962568.1 protein_id gnl|my_center|LOCUS_06800 3078 2044 gene locus_tag LOCUS_06810 gene recF 3078 2044 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583898.1 protein_id gnl|my_center|LOCUS_06810 4231 3089 gene locus_tag LOCUS_06820 gene dnaN 4231 3089 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768226.1 protein_id gnl|my_center|LOCUS_06820 5742 4405 gene locus_tag LOCUS_06830 gene dnaA 5742 4405 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545093.1 protein_id gnl|my_center|LOCUS_06830 6619 5840 gene locus_tag LOCUS_06840 6619 5840 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_06840 7223 6594 gene locus_tag LOCUS_06850 7223 6594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 7713 7225 gene locus_tag LOCUS_06860 gene purE 7713 7225 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769750.1 protein_id gnl|my_center|LOCUS_06860 8232 7747 gene locus_tag LOCUS_06870 8232 7747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 8926 8282 gene locus_tag LOCUS_06880 gene rsmG 8926 8282 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932839.1 protein_id gnl|my_center|LOCUS_06880 10791 8923 gene locus_tag LOCUS_06890 gene mnmG 10791 8923 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546402.1 protein_id gnl|my_center|LOCUS_06890 12284 10938 gene locus_tag LOCUS_06900 gene mnmE 12284 10938 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611693.1 protein_id gnl|my_center|LOCUS_06900 13304 12291 gene locus_tag LOCUS_06910 13304 12291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 14768 13398 gene locus_tag LOCUS_06920 gene purB 14768 13398 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072582.1 protein_id gnl|my_center|LOCUS_06920 14919 15503 gene locus_tag LOCUS_06930 14919 15503 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_06930 15727 15509 gene locus_tag LOCUS_06940 15727 15509 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942676.1 protein_id gnl|my_center|LOCUS_06940 17022 15796 gene locus_tag LOCUS_06950 gene lysA 17022 15796 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_06950 18368 17019 gene locus_tag LOCUS_06960 gene lysC 18368 17019 CDS product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931789.1 protein_id gnl|my_center|LOCUS_06960 <19128 18365 gene locus_tag LOCUS_06970 <19128 18365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391762.1:MraY family glycosyltransferase >Feature sequence033 2434 788 gene locus_tag LOCUS_06980 2434 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 3127 2867 gene locus_tag LOCUS_06990 3127 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 3662 3120 gene locus_tag LOCUS_07000 3662 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 3852 4337 gene locus_tag LOCUS_07010 gene mraZ 3852 4337 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583616.1 protein_id gnl|my_center|LOCUS_07010 4334 5260 gene locus_tag LOCUS_07020 gene rsmH 4334 5260 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047697615.1 protein_id gnl|my_center|LOCUS_07020 5271 5627 gene locus_tag LOCUS_07030 5271 5627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 5639 7717 gene locus_tag LOCUS_07040 5639 7717 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_07040 7704 9182 gene locus_tag LOCUS_07050 7704 9182 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546153.1 protein_id gnl|my_center|LOCUS_07050 9160 10455 gene locus_tag LOCUS_07060 9160 10455 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_07060 10452 11744 gene locus_tag LOCUS_07070 gene murD 10452 11744 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_07070 11741 12826 gene locus_tag LOCUS_07080 gene ftsW 11741 12826 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_07080 12838 13932 gene locus_tag LOCUS_07090 gene murG 12838 13932 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626926.1 protein_id gnl|my_center|LOCUS_07090 13937 15292 gene locus_tag LOCUS_07100 gene murC 13937 15292 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425936.1 protein_id gnl|my_center|LOCUS_07100 15289 16131 gene locus_tag LOCUS_07110 gene murB 15289 16131 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546287.1 protein_id gnl|my_center|LOCUS_07110 16124 17029 gene locus_tag LOCUS_07120 16124 17029 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943691.1 protein_id gnl|my_center|LOCUS_07120 17029 17889 gene locus_tag LOCUS_07130 17029 17889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 >Feature sequence034 243 497 gene locus_tag LOCUS_07140 243 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 580 720 gene locus_tag LOCUS_07150 580 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 1733 939 gene locus_tag LOCUS_07160 1733 939 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637552.1 protein_id gnl|my_center|LOCUS_07160 3587 1743 gene locus_tag LOCUS_07170 3587 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 3911 3618 gene locus_tag LOCUS_07180 3911 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 4680 3931 gene locus_tag LOCUS_07190 gene map 4680 3931 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545375.1 protein_id gnl|my_center|LOCUS_07190 4850 5281 gene locus_tag LOCUS_07200 4850 5281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 5310 5495 gene locus_tag LOCUS_07210 gene rpmF 5310 5495 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419113.1 protein_id gnl|my_center|LOCUS_07210 5504 6538 gene locus_tag LOCUS_07220 gene plsX 5504 6538 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869848.1 protein_id gnl|my_center|LOCUS_07220 6884 6519 gene locus_tag LOCUS_07230 6884 6519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 11156 6999 gene locus_tag LOCUS_07240 gene rpoC 11156 6999 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_07240 15279 11167 gene locus_tag LOCUS_07250 gene rpoB 15279 11167 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943493.1 protein_id gnl|my_center|LOCUS_07250 15795 15427 gene locus_tag LOCUS_07260 gene rplL 15795 15427 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943494.1 protein_id gnl|my_center|LOCUS_07260 16351 15827 gene locus_tag LOCUS_07270 gene rplJ 16351 15827 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943495.1 protein_id gnl|my_center|LOCUS_07270 17170 16463 gene locus_tag LOCUS_07280 gene rplA 17170 16463 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 protein_id gnl|my_center|LOCUS_07280 17602 17180 gene locus_tag LOCUS_07290 gene rplK 17602 17180 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940184.1 protein_id gnl|my_center|LOCUS_07290 18196 17624 gene locus_tag LOCUS_07300 gene nusG 18196 17624 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943498.1 protein_id gnl|my_center|LOCUS_07300 18599 18216 gene locus_tag LOCUS_07310 18599 18216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 18696 18621 gene locus_tag LOCUS_t00100 18696 18621 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 18882 18706 gene locus_tag LOCUS_07320 gene rpmG 18882 18706 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940181.1 protein_id gnl|my_center|LOCUS_07320 >Feature sequence035 3105 2950 gene locus_tag LOCUS_07330 3105 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 6362 3105 gene locus_tag LOCUS_07340 6362 3105 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_07340 6905 6372 gene locus_tag LOCUS_07350 6905 6372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 7263 6925 gene locus_tag LOCUS_07360 7263 6925 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816465.1 protein_id gnl|my_center|LOCUS_07360 8660 7260 gene locus_tag LOCUS_07370 8660 7260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 9287 8679 gene locus_tag LOCUS_07380 9287 8679 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091486.1 protein_id gnl|my_center|LOCUS_07380 13601 9291 gene locus_tag LOCUS_07390 13601 9291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 15149 13617 gene locus_tag LOCUS_07400 gene guaA 15149 13617 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778965.1 protein_id gnl|my_center|LOCUS_07400 15330 15602 gene locus_tag LOCUS_07410 15330 15602 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080314.1 protein_id gnl|my_center|LOCUS_07410 16015 17187 gene locus_tag LOCUS_07420 16015 17187 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_07420 17315 18322 gene locus_tag LOCUS_07430 17315 18322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 >Feature sequence036 325 654 gene locus_tag LOCUS_07440 325 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 868 1752 gene locus_tag LOCUS_07450 868 1752 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762864.1 protein_id gnl|my_center|LOCUS_07450 1765 1998 gene locus_tag LOCUS_07460 1765 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 3986 2001 gene locus_tag LOCUS_07470 3986 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 4151 5296 gene locus_tag LOCUS_07480 gene gmd 4151 5296 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639973.1 protein_id gnl|my_center|LOCUS_07480 5298 6167 gene locus_tag LOCUS_07490 5298 6167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 8310 6169 gene locus_tag LOCUS_07500 8310 6169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 8431 10419 gene locus_tag LOCUS_07510 8431 10419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 10488 10961 gene locus_tag LOCUS_07520 10488 10961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 10958 12181 gene locus_tag LOCUS_07530 10958 12181 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230598.1 protein_id gnl|my_center|LOCUS_07530 13389 12178 gene locus_tag LOCUS_07540 13389 12178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 14230 13391 gene locus_tag LOCUS_07550 14230 13391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 14482 15573 gene locus_tag LOCUS_07560 gene pyrB 14482 15573 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478824.1 protein_id gnl|my_center|LOCUS_07560 15992 15723 gene locus_tag LOCUS_07570 15992 15723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 17491 16112 gene locus_tag LOCUS_07580 17491 16112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 17655 17488 gene locus_tag LOCUS_07590 17655 17488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 >Feature sequence037 551 997 gene locus_tag LOCUS_07600 551 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 3239 999 gene locus_tag LOCUS_07610 3239 999 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020948722.1 protein_id gnl|my_center|LOCUS_07610 4344 3364 gene locus_tag LOCUS_07620 4344 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 5336 4341 gene locus_tag LOCUS_07630 gene aroB 5336 4341 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021364.1 protein_id gnl|my_center|LOCUS_07630 5818 5315 gene locus_tag LOCUS_07640 5818 5315 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164290.1 protein_id gnl|my_center|LOCUS_07640 6849 5815 gene locus_tag LOCUS_07650 gene aroC 6849 5815 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583418.1 protein_id gnl|my_center|LOCUS_07650 9303 6859 gene locus_tag LOCUS_07660 9303 6859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 9966 9322 gene locus_tag LOCUS_07670 9966 9322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 10609 9953 gene locus_tag LOCUS_07680 10609 9953 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942673.1 protein_id gnl|my_center|LOCUS_07680 11262 10630 gene locus_tag LOCUS_07690 11262 10630 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942674.1 protein_id gnl|my_center|LOCUS_07690 12311 11259 gene locus_tag LOCUS_07700 12311 11259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 12536 12327 gene locus_tag LOCUS_07710 12536 12327 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942676.1 protein_id gnl|my_center|LOCUS_07710 13966 12680 gene locus_tag LOCUS_07720 gene murA 13966 12680 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669886.1 protein_id gnl|my_center|LOCUS_07720 14098 14173 gene locus_tag LOCUS_t00110 14098 14173 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 14291 15025 gene locus_tag LOCUS_07730 14291 15025 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938748.1 protein_id gnl|my_center|LOCUS_07730 17024 15396 gene locus_tag LOCUS_07740 17024 15396 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072703.1 protein_id gnl|my_center|LOCUS_07740 >Feature sequence038 1734 1156 gene locus_tag LOCUS_07750 1734 1156 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_07750 1875 2660 gene locus_tag LOCUS_07760 1875 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 2679 3062 gene locus_tag LOCUS_07770 2679 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 3059 4732 gene locus_tag LOCUS_07780 3059 4732 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838696.1 protein_id gnl|my_center|LOCUS_07780 4716 6380 gene locus_tag LOCUS_07790 4716 6380 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925143.1 protein_id gnl|my_center|LOCUS_07790 6382 6993 gene locus_tag LOCUS_07800 gene rpoE 6382 6993 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_07800 6993 7688 gene locus_tag LOCUS_07810 6993 7688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 7685 8209 gene locus_tag LOCUS_07820 7685 8209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 8187 9248 gene locus_tag LOCUS_07830 8187 9248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 9238 9717 gene locus_tag LOCUS_07840 9238 9717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 9772 10758 gene locus_tag LOCUS_07850 9772 10758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 11190 10762 gene locus_tag LOCUS_07860 11190 10762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 12113 11187 gene locus_tag LOCUS_07870 12113 11187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 12805 12110 gene locus_tag LOCUS_07880 12805 12110 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166033344.1 protein_id gnl|my_center|LOCUS_07880 13332 12802 gene locus_tag LOCUS_07890 13332 12802 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_07890 13462 14394 gene locus_tag LOCUS_07900 13462 14394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 14391 15149 gene locus_tag LOCUS_07910 14391 15149 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102484484.1 protein_id gnl|my_center|LOCUS_07910 15256 16566 gene locus_tag LOCUS_07920 15256 16566 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896573.1 protein_id gnl|my_center|LOCUS_07920 16916 16578 gene locus_tag LOCUS_07930 16916 16578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 17438 16932 gene locus_tag LOCUS_07940 17438 16932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 >Feature sequence039 2002 1397 gene locus_tag LOCUS_07950 2002 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 3428 2004 gene locus_tag LOCUS_07960 3428 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 4629 3418 gene locus_tag LOCUS_07970 4629 3418 CDS product aconitase/3-isopropylmalate dehydratase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870106.1 protein_id gnl|my_center|LOCUS_07970 5734 4718 gene locus_tag LOCUS_07980 5734 4718 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943556.1 protein_id gnl|my_center|LOCUS_07980 6516 5731 gene locus_tag LOCUS_07990 6516 5731 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_07990 7804 6518 gene locus_tag LOCUS_08000 7804 6518 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942871.1 protein_id gnl|my_center|LOCUS_08000 8669 7788 gene locus_tag LOCUS_08010 8669 7788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 9648 8719 gene locus_tag LOCUS_08020 9648 8719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 10103 9645 gene locus_tag LOCUS_08030 gene nusB 10103 9645 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965384.1 protein_id gnl|my_center|LOCUS_08030 10574 10113 gene locus_tag LOCUS_08040 gene ribE 10574 10113 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358088.1 protein_id gnl|my_center|LOCUS_08040 11802 10564 gene locus_tag LOCUS_08050 11802 10564 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_08050 13113 11815 gene locus_tag LOCUS_08060 13113 11815 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943920.1 protein_id gnl|my_center|LOCUS_08060 14941 13139 gene locus_tag LOCUS_08070 gene lepA 14941 13139 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941921.1 protein_id gnl|my_center|LOCUS_08070 16088 15042 gene locus_tag LOCUS_08080 16088 15042 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 protein_id gnl|my_center|LOCUS_08080 16421 17002 gene locus_tag LOCUS_08090 16421 17002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 >Feature sequence040 1695 268 gene locus_tag LOCUS_08100 1695 268 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016159.1 protein_id gnl|my_center|LOCUS_08100 1834 3087 gene locus_tag LOCUS_08110 1834 3087 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_08110 3947 3066 gene locus_tag LOCUS_08120 3947 3066 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986202.1 protein_id gnl|my_center|LOCUS_08120 4110 5327 gene locus_tag LOCUS_08130 4110 5327 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_08130 5701 5396 gene locus_tag LOCUS_08140 5701 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 7139 5943 gene locus_tag LOCUS_08150 7139 5943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 8529 7141 gene locus_tag LOCUS_08160 8529 7141 CDS product MBOAT family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035887521.1 protein_id gnl|my_center|LOCUS_08160 8666 10423 gene locus_tag LOCUS_08170 8666 10423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 10424 12421 gene locus_tag LOCUS_08180 gene rpoD 10424 12421 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530149.1 protein_id gnl|my_center|LOCUS_08180 14412 12418 gene locus_tag LOCUS_08190 14412 12418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 15104 14478 gene locus_tag LOCUS_08200 gene rnhB 15104 14478 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480979.1 protein_id gnl|my_center|LOCUS_08200 16213 15101 gene locus_tag LOCUS_08210 gene hemW 16213 15101 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080203.1 protein_id gnl|my_center|LOCUS_08210 17434 16226 gene locus_tag LOCUS_08220 17434 16226 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545078.1 protein_id gnl|my_center|LOCUS_08220 >Feature sequence041 477 1166 gene locus_tag LOCUS_08230 477 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 2323 1163 gene locus_tag LOCUS_08240 2323 1163 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949005.1 protein_id gnl|my_center|LOCUS_08240 3224 2325 gene locus_tag LOCUS_08250 3224 2325 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878017.1 protein_id gnl|my_center|LOCUS_08250 3527 3249 gene locus_tag LOCUS_08260 3527 3249 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_08260 3944 3537 gene locus_tag LOCUS_08270 3944 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 5850 4021 gene locus_tag LOCUS_08280 5850 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 6037 7257 gene locus_tag LOCUS_08290 gene coaBC 6037 7257 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989823.1 protein_id gnl|my_center|LOCUS_08290 7247 7681 gene locus_tag LOCUS_08300 7247 7681 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010885248.1 protein_id gnl|my_center|LOCUS_08300 7687 8361 gene locus_tag LOCUS_08310 7687 8361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 8370 12095 gene locus_tag LOCUS_08320 8370 12095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 12191 13414 gene locus_tag LOCUS_08330 gene rocD 12191 13414 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868785.1 protein_id gnl|my_center|LOCUS_08330 13882 13430 gene locus_tag LOCUS_08340 13882 13430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 >Feature sequence042 129 2447 gene locus_tag LOCUS_08350 129 2447 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 protein_id gnl|my_center|LOCUS_08350 2539 3786 gene locus_tag LOCUS_08360 gene pepT 2539 3786 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963798.1 protein_id gnl|my_center|LOCUS_08360 3844 6819 gene locus_tag LOCUS_08370 3844 6819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 7379 6852 gene locus_tag LOCUS_08380 7379 6852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 8086 7394 gene locus_tag LOCUS_08390 8086 7394 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038010.1 protein_id gnl|my_center|LOCUS_08390 8829 8083 gene locus_tag LOCUS_08400 8829 8083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 9986 8826 gene locus_tag LOCUS_08410 gene ftsY 9986 8826 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249530.1 protein_id gnl|my_center|LOCUS_08410 11439 10042 gene locus_tag LOCUS_08420 gene ahcY 11439 10042 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781763.1 protein_id gnl|my_center|LOCUS_08420 11607 12617 gene locus_tag LOCUS_08430 11607 12617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 12789 13133 gene locus_tag LOCUS_08440 12789 13133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 13293 14633 gene locus_tag LOCUS_08450 13293 14633 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_08450 16212 14641 gene locus_tag LOCUS_08460 16212 14641 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963143.1 protein_id gnl|my_center|LOCUS_08460 >Feature sequence043 1621 506 gene locus_tag LOCUS_08470 1621 506 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459608.1 protein_id gnl|my_center|LOCUS_08470 1776 3599 gene locus_tag LOCUS_08480 1776 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 3615 5261 gene locus_tag LOCUS_08490 gene pgi 3615 5261 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455828.1 protein_id gnl|my_center|LOCUS_08490 5925 5362 gene locus_tag LOCUS_08500 5925 5362 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485215.1 protein_id gnl|my_center|LOCUS_08500 6827 5937 gene locus_tag LOCUS_08510 6827 5937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 7937 6993 gene locus_tag LOCUS_08520 7937 6993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 8947 7934 gene locus_tag LOCUS_08530 8947 7934 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680669.1 protein_id gnl|my_center|LOCUS_08530 12171 9040 gene locus_tag LOCUS_08540 12171 9040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 12393 13391 gene locus_tag LOCUS_08550 gene argF 12393 13391 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861433.1 protein_id gnl|my_center|LOCUS_08550 13392 13802 gene locus_tag LOCUS_08560 13392 13802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 14499 13807 gene locus_tag LOCUS_08570 14499 13807 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279795.1 protein_id gnl|my_center|LOCUS_08570 15626 14496 gene locus_tag LOCUS_08580 15626 14496 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_08580 >Feature sequence044 506 2629 gene locus_tag LOCUS_08590 506 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 2631 3905 gene locus_tag LOCUS_08600 2631 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 3932 7666 gene locus_tag LOCUS_08610 3932 7666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 7672 9525 gene locus_tag LOCUS_08620 7672 9525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 9614 11650 gene locus_tag LOCUS_08630 9614 11650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 11647 13980 gene locus_tag LOCUS_08640 11647 13980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 >Feature sequence045 1 1029 gene locus_tag LOCUS_08650 1 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 1089 1817 gene locus_tag LOCUS_08660 1089 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 1814 2215 gene locus_tag LOCUS_08670 1814 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 2217 2663 gene locus_tag LOCUS_08680 2217 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 2664 5960 gene locus_tag LOCUS_08690 2664 5960 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_08690 6079 6378 gene locus_tag LOCUS_08700 gene rpsT 6079 6378 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902954.1 protein_id gnl|my_center|LOCUS_08700 6380 7636 gene locus_tag LOCUS_08710 gene hutI 6380 7636 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016618.1 protein_id gnl|my_center|LOCUS_08710 7665 8633 gene locus_tag LOCUS_08720 7665 8633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 8581 8940 gene locus_tag LOCUS_08730 8581 8940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 8940 9377 gene locus_tag LOCUS_08740 8940 9377 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583662.1 protein_id gnl|my_center|LOCUS_08740 9450 10319 gene locus_tag LOCUS_08750 9450 10319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 10322 10987 gene locus_tag LOCUS_08760 gene cps4B 10322 10987 CDS product capsular polysaccharide biosynthesis protein Cps4B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922734.1 protein_id gnl|my_center|LOCUS_08760 11060 12295 gene locus_tag LOCUS_08770 11060 12295 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943942.1 protein_id gnl|my_center|LOCUS_08770 12300 13058 gene locus_tag LOCUS_08780 12300 13058 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931876.1 protein_id gnl|my_center|LOCUS_08780 >Feature sequence046 342 2114 gene locus_tag LOCUS_08790 342 2114 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679753.1 protein_id gnl|my_center|LOCUS_08790 3078 2116 gene locus_tag LOCUS_08800 3078 2116 CDS product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817430.1 protein_id gnl|my_center|LOCUS_08800 4074 3088 gene locus_tag LOCUS_08810 4074 3088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 5119 4064 gene locus_tag LOCUS_08820 5119 4064 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_08820 6752 5112 gene locus_tag LOCUS_08830 6752 5112 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_08830 9316 6770 gene locus_tag LOCUS_08840 9316 6770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 11122 9341 gene locus_tag LOCUS_08850 11122 9341 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462045.1 protein_id gnl|my_center|LOCUS_08850 11702 11397 gene locus_tag LOCUS_08860 11702 11397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 12054 11692 gene locus_tag LOCUS_08870 12054 11692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 14294 12312 gene locus_tag LOCUS_08880 14294 12312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 14979 14296 gene locus_tag LOCUS_08890 14979 14296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 >Feature sequence047 360 1073 gene locus_tag LOCUS_08900 360 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 1141 3750 gene locus_tag LOCUS_08910 1141 3750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 4377 3754 gene locus_tag LOCUS_08920 4377 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 6324 4582 gene locus_tag LOCUS_08930 6324 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 6797 6366 gene locus_tag LOCUS_08940 6797 6366 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869046.1 protein_id gnl|my_center|LOCUS_08940 7194 6805 gene locus_tag LOCUS_08950 7194 6805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 8739 7204 gene locus_tag LOCUS_08960 8739 7204 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780626.1 protein_id gnl|my_center|LOCUS_08960 9169 8768 gene locus_tag LOCUS_08970 gene mce 9169 8768 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_08970 10104 9166 gene locus_tag LOCUS_08980 gene meaB 10104 9166 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_08980 11420 10104 gene locus_tag LOCUS_08990 11420 10104 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_08990 10158 10257 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12895 11411 gene locus_tag LOCUS_09000 12895 11411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 14561 12906 gene locus_tag LOCUS_09010 14561 12906 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943914.1 protein_id gnl|my_center|LOCUS_09010 >Feature sequence048 2022 460 gene locus_tag LOCUS_09020 gene purH 2022 460 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262778.1 protein_id gnl|my_center|LOCUS_09020 2147 2368 gene locus_tag LOCUS_09030 2147 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 2365 2817 gene locus_tag LOCUS_09040 gene aroQ 2365 2817 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070855.1 protein_id gnl|my_center|LOCUS_09040 2894 3457 gene locus_tag LOCUS_09050 gene efp 2894 3457 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_09050 3475 5568 gene locus_tag LOCUS_09060 3475 5568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 5570 6307 gene locus_tag LOCUS_09070 5570 6307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 6338 7867 gene locus_tag LOCUS_09080 6338 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 7937 8833 gene locus_tag LOCUS_09090 7937 8833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 8899 9393 gene locus_tag LOCUS_09100 gene rsmD 8899 9393 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775870.1 protein_id gnl|my_center|LOCUS_09100 9396 9884 gene locus_tag LOCUS_09110 gene coaD 9396 9884 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245283.1 protein_id gnl|my_center|LOCUS_09110 9875 10741 gene locus_tag LOCUS_09120 gene ispE 9875 10741 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545467.1 protein_id gnl|my_center|LOCUS_09120 10742 10816 gene locus_tag LOCUS_t00120 10742 10816 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 10838 11455 gene locus_tag LOCUS_09130 10838 11455 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760337.1 protein_id gnl|my_center|LOCUS_09130 11464 12063 gene locus_tag LOCUS_09140 gene pth 11464 12063 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880175.1 protein_id gnl|my_center|LOCUS_09140 12060 13175 gene locus_tag LOCUS_09150 12060 13175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 13224 13799 gene locus_tag LOCUS_09160 13224 13799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 >Feature sequence049 798 1736 gene locus_tag LOCUS_09170 798 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 1880 3082 gene locus_tag LOCUS_09180 1880 3082 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942466.1 protein_id gnl|my_center|LOCUS_09180 3102 4940 gene locus_tag LOCUS_09190 3102 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 6438 4945 gene locus_tag LOCUS_09200 6438 4945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 8129 6531 gene locus_tag LOCUS_09210 gene nadB 8129 6531 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_09210 8559 8131 gene locus_tag LOCUS_09220 8559 8131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 9193 8660 gene locus_tag LOCUS_09230 9193 8660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 9087 9284 gene locus_tag LOCUS_09240 9087 9284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 9453 10172 gene locus_tag LOCUS_09250 9453 10172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 10172 11107 gene locus_tag LOCUS_09260 10172 11107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 11104 12306 gene locus_tag LOCUS_09270 11104 12306 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544919.1 protein_id gnl|my_center|LOCUS_09270 12308 13939 gene locus_tag LOCUS_09280 gene recN 12308 13939 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016269.1 protein_id gnl|my_center|LOCUS_09280 >Feature sequence050 514 2337 gene locus_tag LOCUS_09290 514 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 4350 2344 gene locus_tag LOCUS_09300 gene pcrA 4350 2344 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357577.1 protein_id gnl|my_center|LOCUS_09300 4544 4756 gene locus_tag LOCUS_09310 4544 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 4996 5598 gene locus_tag LOCUS_09320 4996 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 5651 8149 gene locus_tag LOCUS_09330 5651 8149 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_09330 8160 8909 gene locus_tag LOCUS_09340 8160 8909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 8919 9854 gene locus_tag LOCUS_09350 gene nagZ 8919 9854 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957992.1 protein_id gnl|my_center|LOCUS_09350 10199 9834 gene locus_tag LOCUS_09360 10199 9834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 11066 10290 gene locus_tag LOCUS_09370 gene endA 11066 10290 CDS product endonuclease EndA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071125.1 protein_id gnl|my_center|LOCUS_09370 12660 11230 gene locus_tag LOCUS_09380 12660 11230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 13051 12704 gene locus_tag LOCUS_09390 13051 12704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 13700 13044 gene locus_tag LOCUS_09400 13700 13044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 14195 13785 gene locus_tag LOCUS_09410 14195 13785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 >Feature sequence051 <1 3338 gene locus_tag LOCUS_09420 <1 3338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817982.1:carbohydrate binding domain-containing protein 3404 4654 gene locus_tag LOCUS_09430 3404 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 4651 6783 gene locus_tag LOCUS_09440 4651 6783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 6814 8004 gene locus_tag LOCUS_09450 6814 8004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 8004 9056 gene locus_tag LOCUS_09460 8004 9056 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426511.1 protein_id gnl|my_center|LOCUS_09460 9073 10404 gene locus_tag LOCUS_09470 9073 10404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 10409 11896 gene locus_tag LOCUS_09480 10409 11896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 11789 11888 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13652 12243 gene locus_tag LOCUS_09490 13652 12243 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016159.1 protein_id gnl|my_center|LOCUS_09490 14188 13844 gene locus_tag LOCUS_09500 14188 13844 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_09500 >Feature sequence052 1464 2147 gene locus_tag LOCUS_09510 1464 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 2276 2375 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3095 2799 gene locus_tag LOCUS_09520 3095 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 3517 3101 gene locus_tag LOCUS_09530 3517 3101 CDS product type II toxin-antitoxin system toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073053.1 protein_id gnl|my_center|LOCUS_09530 3921 3502 gene locus_tag LOCUS_09540 3921 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 4916 4041 gene locus_tag LOCUS_09550 4916 4041 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203185.1 protein_id gnl|my_center|LOCUS_09550 6348 4975 gene locus_tag LOCUS_09560 gene der 6348 4975 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965018.1 protein_id gnl|my_center|LOCUS_09560 6562 7866 gene locus_tag LOCUS_09570 6562 7866 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814884.1 protein_id gnl|my_center|LOCUS_09570 9320 7893 gene locus_tag LOCUS_09580 gene abc-f 9320 7893 CDS product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070104985.1 protein_id gnl|my_center|LOCUS_09580 10637 9720 gene locus_tag LOCUS_09590 10637 9720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 10843 11412 gene locus_tag LOCUS_09600 10843 11412 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679998.1 protein_id gnl|my_center|LOCUS_09600 12190 11564 gene locus_tag LOCUS_09610 12190 11564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 12530 12219 gene locus_tag LOCUS_09620 12530 12219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 13946 12681 gene locus_tag LOCUS_09630 13946 12681 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659589.1 protein_id gnl|my_center|LOCUS_09630 >Feature sequence053 62 1042 gene locus_tag LOCUS_09640 62 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 1039 1641 gene locus_tag LOCUS_09650 1039 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 1634 3184 gene locus_tag LOCUS_09660 1634 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 3194 5629 gene locus_tag LOCUS_09670 3194 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 5654 6781 gene locus_tag LOCUS_09680 5654 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 6869 8323 gene locus_tag LOCUS_09690 6869 8323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 9706 8324 gene locus_tag LOCUS_09700 9706 8324 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250240.1 protein_id gnl|my_center|LOCUS_09700 9869 11500 gene locus_tag LOCUS_09710 9869 11500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 11515 12534 gene locus_tag LOCUS_09720 11515 12534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 12678 12980 gene locus_tag LOCUS_09730 12678 12980 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069253.1 protein_id gnl|my_center|LOCUS_09730 12977 13348 gene locus_tag LOCUS_09740 12977 13348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 >Feature sequence054 1015 29 gene locus_tag LOCUS_09750 1015 29 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963505.1 protein_id gnl|my_center|LOCUS_09750 1158 1307 gene locus_tag LOCUS_09760 gene rpmH 1158 1307 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198824.1 protein_id gnl|my_center|LOCUS_09760 1375 1671 gene locus_tag LOCUS_09770 1375 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1643 1855 gene locus_tag LOCUS_09780 gene yidD 1643 1855 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048456.1 protein_id gnl|my_center|LOCUS_09780 1867 3450 gene locus_tag LOCUS_09790 gene yidC 1867 3450 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_09790 3765 3544 gene locus_tag LOCUS_09800 3765 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 3955 4743 gene locus_tag LOCUS_09810 gene truA 3955 4743 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 protein_id gnl|my_center|LOCUS_09810 5815 4745 gene locus_tag LOCUS_09820 gene ribD 5815 4745 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943609.1 protein_id gnl|my_center|LOCUS_09820 6824 5802 gene locus_tag LOCUS_09830 6824 5802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 7183 6824 gene locus_tag LOCUS_09840 gene rplS 7183 6824 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938136.1 protein_id gnl|my_center|LOCUS_09840 7764 7216 gene locus_tag LOCUS_09850 7764 7216 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904383.1 protein_id gnl|my_center|LOCUS_09850 8468 7761 gene locus_tag LOCUS_09860 gene trmD 8468 7761 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724048.1 protein_id gnl|my_center|LOCUS_09860 8946 8470 gene locus_tag LOCUS_09870 8946 8470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 9176 8943 gene locus_tag LOCUS_09880 9176 8943 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_09880 9447 9205 gene locus_tag LOCUS_09890 gene rpsP 9447 9205 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130711.1 protein_id gnl|my_center|LOCUS_09890 10811 9471 gene locus_tag LOCUS_09900 gene ffh 10811 9471 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941303.1 protein_id gnl|my_center|LOCUS_09900 11114 12448 gene locus_tag LOCUS_09910 11114 12448 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_09910 12517 13452 gene locus_tag LOCUS_09920 gene arcC 12517 13452 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393446.1 protein_id gnl|my_center|LOCUS_09920 >Feature sequence055 913 2238 gene locus_tag LOCUS_09930 913 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 2258 3100 gene locus_tag LOCUS_09940 2258 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 3100 4815 gene locus_tag LOCUS_09950 3100 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 4906 4983 gene locus_tag LOCUS_t00130 4906 4983 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5003 5079 gene locus_tag LOCUS_t00140 5003 5079 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5108 5182 gene locus_tag LOCUS_t00150 5108 5182 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 5193 5268 gene locus_tag LOCUS_t00160 5193 5268 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5326 5408 gene locus_tag LOCUS_t00170 5326 5408 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5460 6764 gene locus_tag LOCUS_09960 gene tig 5460 6764 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095856.1 protein_id gnl|my_center|LOCUS_09960 6745 7347 gene locus_tag LOCUS_09970 gene clpP 6745 7347 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357557.1 protein_id gnl|my_center|LOCUS_09970 7357 8622 gene locus_tag LOCUS_09980 gene clpX 7357 8622 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472289.1 protein_id gnl|my_center|LOCUS_09980 8628 11009 gene locus_tag LOCUS_09990 gene lon 8628 11009 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193454.1 protein_id gnl|my_center|LOCUS_09990 11204 12454 gene locus_tag LOCUS_10000 gene rho 11204 12454 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence056 510 22 gene locus_tag LOCUS_10010 510 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 1082 1522 gene locus_tag LOCUS_10020 1082 1522 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928467.1 protein_id gnl|my_center|LOCUS_10020 1504 5025 gene locus_tag LOCUS_10030 1504 5025 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957290.1 protein_id gnl|my_center|LOCUS_10030 5036 7486 gene locus_tag LOCUS_10040 5036 7486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 7501 8313 gene locus_tag LOCUS_10050 7501 8313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 9074 8328 gene locus_tag LOCUS_10060 9074 8328 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358333.1 protein_id gnl|my_center|LOCUS_10060 9211 10398 gene locus_tag LOCUS_10070 9211 10398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 10388 10933 gene locus_tag LOCUS_10080 10388 10933 CDS product DJ-1/PfpI/YhbO family deglycase/protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870481.1 protein_id gnl|my_center|LOCUS_10080 10942 11238 gene locus_tag LOCUS_10090 10942 11238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 11353 11859 gene locus_tag LOCUS_10100 11353 11859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 11880 12872 gene locus_tag LOCUS_10110 11880 12872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 12874 13476 gene locus_tag LOCUS_10120 12874 13476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 >Feature sequence057 284 1636 gene locus_tag LOCUS_10130 284 1636 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958607.1 protein_id gnl|my_center|LOCUS_10130 1640 2521 gene locus_tag LOCUS_10140 gene xerD 1640 2521 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700300.1 protein_id gnl|my_center|LOCUS_10140 2597 4492 gene locus_tag LOCUS_10150 gene dnaK 2597 4492 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004595925.1 protein_id gnl|my_center|LOCUS_10150 4590 6842 gene locus_tag LOCUS_10160 4590 6842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 6844 8037 gene locus_tag LOCUS_10170 6844 8037 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943192.1 protein_id gnl|my_center|LOCUS_10170 8034 8240 gene locus_tag LOCUS_10180 8034 8240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 8233 8811 gene locus_tag LOCUS_10190 8233 8811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 8802 11207 gene locus_tag LOCUS_10200 8802 11207 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943854.1 protein_id gnl|my_center|LOCUS_10200 >Feature sequence058 1915 794 gene locus_tag LOCUS_10210 1915 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 3218 1929 gene locus_tag LOCUS_10220 3218 1929 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679056.1 protein_id gnl|my_center|LOCUS_10220 5778 3211 gene locus_tag LOCUS_10230 5778 3211 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679058.1 protein_id gnl|my_center|LOCUS_10230 8323 5771 gene locus_tag LOCUS_10240 8323 5771 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679058.1 protein_id gnl|my_center|LOCUS_10240 9654 8335 gene locus_tag LOCUS_10250 gene lat 9654 8335 CDS product L-lysine 6-transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869888.1 protein_id gnl|my_center|LOCUS_10250 10351 9635 gene locus_tag LOCUS_10260 10351 9635 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933691.1 protein_id gnl|my_center|LOCUS_10260 12400 10352 gene locus_tag LOCUS_10270 12400 10352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 >Feature sequence059 2161 1586 gene locus_tag LOCUS_10280 2161 1586 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002994966.1 protein_id gnl|my_center|LOCUS_10280 2371 4113 gene locus_tag LOCUS_10290 2371 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 4180 4716 gene locus_tag LOCUS_10300 4180 4716 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102894.1 protein_id gnl|my_center|LOCUS_10300 4719 6410 gene locus_tag LOCUS_10310 4719 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 7112 6414 gene locus_tag LOCUS_10320 7112 6414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937679.1 protein_id gnl|my_center|LOCUS_10320 7334 7765 gene locus_tag LOCUS_10330 gene rplM 7334 7765 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943505.1 protein_id gnl|my_center|LOCUS_10330 7794 8180 gene locus_tag LOCUS_10340 gene rpsI 7794 8180 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939789.1 protein_id gnl|my_center|LOCUS_10340 8259 9419 gene locus_tag LOCUS_10350 gene metK 8259 9419 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_10350 9524 12151 gene locus_tag LOCUS_10360 gene alaS 9524 12151 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940824.1 protein_id gnl|my_center|LOCUS_10360 13011 12163 gene locus_tag LOCUS_10370 13011 12163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence060 758 2323 gene locus_tag LOCUS_10380 758 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 2793 2320 gene locus_tag LOCUS_10390 2793 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 3961 2849 gene locus_tag LOCUS_10400 3961 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 5065 3962 gene locus_tag LOCUS_10410 5065 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 5421 5062 gene locus_tag LOCUS_10420 5421 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 6123 5494 gene locus_tag LOCUS_10430 6123 5494 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_10430 6236 7753 gene locus_tag LOCUS_10440 6236 7753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 7829 8638 gene locus_tag LOCUS_10450 7829 8638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 9182 8628 gene locus_tag LOCUS_10460 9182 8628 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966252.1 protein_id gnl|my_center|LOCUS_10460 9497 9264 gene locus_tag LOCUS_10470 9497 9264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 9838 9467 gene locus_tag LOCUS_10480 9838 9467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10480 11079 9937 gene locus_tag LOCUS_10490 11079 9937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 11955 11179 gene locus_tag LOCUS_10500 11955 11179 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107373.1 protein_id gnl|my_center|LOCUS_10500 12882 11968 gene locus_tag LOCUS_10510 gene nadA 12882 11968 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964343.1 protein_id gnl|my_center|LOCUS_10510 >Feature sequence061 331 963 gene locus_tag LOCUS_10520 331 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 982 1824 gene locus_tag LOCUS_10530 982 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1839 3599 gene locus_tag LOCUS_10540 1839 3599 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656082.1 protein_id gnl|my_center|LOCUS_10540 3601 4905 gene locus_tag LOCUS_10550 3601 4905 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669361.1 protein_id gnl|my_center|LOCUS_10550 4905 5531 gene locus_tag LOCUS_10560 4905 5531 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679385.1 protein_id gnl|my_center|LOCUS_10560 5531 7408 gene locus_tag LOCUS_10570 5531 7408 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660668.1 protein_id gnl|my_center|LOCUS_10570 7412 8929 gene locus_tag LOCUS_10580 7412 8929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 >Feature sequence062 417 995 gene locus_tag LOCUS_10590 417 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 1007 2179 gene locus_tag LOCUS_10600 1007 2179 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943270.1 protein_id gnl|my_center|LOCUS_10600 2190 2714 gene locus_tag LOCUS_10610 2190 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 3796 2702 gene locus_tag LOCUS_10620 3796 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 5118 3832 gene locus_tag LOCUS_10630 5118 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 6636 5176 gene locus_tag LOCUS_10640 6636 5176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 8675 6633 gene locus_tag LOCUS_10650 8675 6633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 8802 9536 gene locus_tag LOCUS_10660 8802 9536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941676.1 protein_id gnl|my_center|LOCUS_10660 9553 11385 gene locus_tag LOCUS_10670 gene typA 9553 11385 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939506.1 protein_id gnl|my_center|LOCUS_10670 11387 12061 gene locus_tag LOCUS_10680 gene bioD 11387 12061 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225454.1 protein_id gnl|my_center|LOCUS_10680 >Feature sequence063 891 349 gene locus_tag LOCUS_10690 891 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 2375 888 gene locus_tag LOCUS_10700 2375 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 3575 2391 gene locus_tag LOCUS_10710 3575 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 4256 3603 gene locus_tag LOCUS_10720 4256 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 4906 4259 gene locus_tag LOCUS_10730 4906 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 5718 4903 gene locus_tag LOCUS_10740 5718 4903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 6157 5726 gene locus_tag LOCUS_10750 gene gspG 6157 5726 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_10750 7403 6174 gene locus_tag LOCUS_10760 7403 6174 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_10760 9088 7403 gene locus_tag LOCUS_10770 9088 7403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 11621 9090 gene locus_tag LOCUS_10780 gene gspD 11621 9090 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940997.1 protein_id gnl|my_center|LOCUS_10780 12605 11631 gene locus_tag LOCUS_10790 12605 11631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 >Feature sequence064 244 1521 gene locus_tag LOCUS_10800 244 1521 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015670.1 protein_id gnl|my_center|LOCUS_10800 1524 2087 gene locus_tag LOCUS_10810 1524 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 2109 2208 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3567 2356 gene locus_tag LOCUS_10820 3567 2356 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816160.1 protein_id gnl|my_center|LOCUS_10820 5059 3623 gene locus_tag LOCUS_10830 5059 3623 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430454.1 protein_id gnl|my_center|LOCUS_10830 7643 5139 gene locus_tag LOCUS_10840 7643 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 7855 9147 gene locus_tag LOCUS_10850 7855 9147 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583175.1 protein_id gnl|my_center|LOCUS_10850 9170 9619 gene locus_tag LOCUS_10860 gene nrdR 9170 9619 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_10860 9616 10677 gene locus_tag LOCUS_10870 9616 10677 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 protein_id gnl|my_center|LOCUS_10870 11550 10708 gene locus_tag LOCUS_10880 11550 10708 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_10880 >Feature sequence065 799 2013 gene locus_tag LOCUS_10890 799 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 2022 3275 gene locus_tag LOCUS_10900 2022 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 3288 4181 gene locus_tag LOCUS_10910 3288 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 4202 5107 gene locus_tag LOCUS_10920 4202 5107 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765720.1 protein_id gnl|my_center|LOCUS_10920 5104 5805 gene locus_tag LOCUS_10930 5104 5805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 5916 7187 gene locus_tag LOCUS_10940 5916 7187 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021591.1 protein_id gnl|my_center|LOCUS_10940 7365 8588 gene locus_tag LOCUS_10950 gene pfp 7365 8588 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870466.1 protein_id gnl|my_center|LOCUS_10950 8678 10570 gene locus_tag LOCUS_10960 8678 10570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 11570 10554 gene locus_tag LOCUS_10970 11570 10554 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681377.1 protein_id gnl|my_center|LOCUS_10970 >Feature sequence066 2926 1109 gene locus_tag LOCUS_10980 2926 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 4172 2991 gene locus_tag LOCUS_10990 4172 2991 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036408.1 protein_id gnl|my_center|LOCUS_10990 4273 5829 gene locus_tag LOCUS_11000 4273 5829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 6478 5873 gene locus_tag LOCUS_11010 6478 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 6945 6475 gene locus_tag LOCUS_11020 6945 6475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 7274 6945 gene locus_tag LOCUS_11030 7274 6945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 8869 7400 gene locus_tag LOCUS_11040 8869 7400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 9972 8953 gene locus_tag LOCUS_11050 9972 8953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 10663 9974 gene locus_tag LOCUS_11060 10663 9974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 11335 10679 gene locus_tag LOCUS_11070 11335 10679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 <12321 11521 gene locus_tag LOCUS_11080 <12321 11521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986521.1:molecular chaperone HtpG >Feature sequence067 1295 699 gene locus_tag LOCUS_11090 1295 699 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_11090 1466 2809 gene locus_tag LOCUS_11100 gene gdhA 1466 2809 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766346.1 protein_id gnl|my_center|LOCUS_11100 2926 3993 gene locus_tag LOCUS_11110 2926 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 4024 4992 gene locus_tag LOCUS_11120 4024 4992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 4958 6052 gene locus_tag LOCUS_11130 gene mtnA 4958 6052 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166394793.1 protein_id gnl|my_center|LOCUS_11130 6144 6710 gene locus_tag LOCUS_11140 6144 6710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 6782 8410 gene locus_tag LOCUS_11150 6782 8410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 8410 9795 gene locus_tag LOCUS_11160 8410 9795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 9801 10580 gene locus_tag LOCUS_11170 9801 10580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 10567 11391 gene locus_tag LOCUS_11180 10567 11391 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_11180 11466 11780 gene locus_tag LOCUS_11190 11466 11780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 >Feature sequence068 81 3071 gene locus_tag LOCUS_11200 81 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 3644 3060 gene locus_tag LOCUS_11210 3644 3060 CDS product phospholipid scramblase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962725.1 protein_id gnl|my_center|LOCUS_11210 3796 4320 gene locus_tag LOCUS_11220 3796 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 4313 5527 gene locus_tag LOCUS_11230 gene aphB 4313 5527 CDS product acetylpolyamine amidohydrolase AphB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112950.1 protein_id gnl|my_center|LOCUS_11230 7357 5522 gene locus_tag LOCUS_11240 7357 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 8865 7381 gene locus_tag LOCUS_11250 8865 7381 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071688.1 protein_id gnl|my_center|LOCUS_11250 10284 8866 gene locus_tag LOCUS_11260 10284 8866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 10403 10867 gene locus_tag LOCUS_11270 10403 10867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 >Feature sequence069 35 919 gene locus_tag LOCUS_11280 35 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 3739 935 gene locus_tag LOCUS_11290 gene ppdK 3739 935 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_11290 5808 3751 gene locus_tag LOCUS_11300 gene glyS 5808 3751 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359749.1 protein_id gnl|my_center|LOCUS_11300 6674 5808 gene locus_tag LOCUS_11310 6674 5808 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546794.1 protein_id gnl|my_center|LOCUS_11310 6831 7322 gene locus_tag LOCUS_11320 6831 7322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 8450 7332 gene locus_tag LOCUS_11330 8450 7332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 9621 8479 gene locus_tag LOCUS_11340 9621 8479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 9740 11095 gene locus_tag LOCUS_11350 9740 11095 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451037.1 protein_id gnl|my_center|LOCUS_11350 >Feature sequence070 748 1827 gene locus_tag LOCUS_11360 gene wecB 748 1827 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113418.1 protein_id gnl|my_center|LOCUS_11360 2430 1864 gene locus_tag LOCUS_11370 2430 1864 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789400.1 protein_id gnl|my_center|LOCUS_11370 2530 3138 gene locus_tag LOCUS_11380 2530 3138 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266644.1 protein_id gnl|my_center|LOCUS_11380 3226 4683 gene locus_tag LOCUS_11390 3226 4683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 4680 5795 gene locus_tag LOCUS_11400 4680 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 6930 5797 gene locus_tag LOCUS_11410 6930 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 8316 7324 gene locus_tag LOCUS_11420 8316 7324 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437173.1 protein_id gnl|my_center|LOCUS_11420 8802 8341 gene locus_tag LOCUS_11430 8802 8341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 9219 8818 gene locus_tag LOCUS_11440 9219 8818 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868143.1 protein_id gnl|my_center|LOCUS_11440 9433 10008 gene locus_tag LOCUS_11450 9433 10008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 10145 11326 gene locus_tag LOCUS_11460 10145 11326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 11323 11781 gene locus_tag LOCUS_11470 11323 11781 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640456.1 protein_id gnl|my_center|LOCUS_11470 >Feature sequence071 <1 2657 gene locus_tag LOCUS_11480 <1 2657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256545.1:kelch repeat-containing protein 3693 2647 gene locus_tag LOCUS_11490 3693 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 3923 3675 gene locus_tag LOCUS_11500 3923 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 5092 3920 gene locus_tag LOCUS_11510 gene aroA 5092 3920 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545275.1 protein_id gnl|my_center|LOCUS_11510 6089 5079 gene locus_tag LOCUS_11520 gene aroF 6089 5079 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546648.1 protein_id gnl|my_center|LOCUS_11520 6767 6090 gene locus_tag LOCUS_11530 gene rph 6767 6090 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208997.1 protein_id gnl|my_center|LOCUS_11530 6906 7856 gene locus_tag LOCUS_11540 6906 7856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 7853 8455 gene locus_tag LOCUS_11550 gene purN 7853 8455 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065739.1 protein_id gnl|my_center|LOCUS_11550 8471 9664 gene locus_tag LOCUS_11560 8471 9664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 9673 10122 gene locus_tag LOCUS_11570 9673 10122 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_11570 11451 10129 gene locus_tag LOCUS_11580 11451 10129 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545232.1 protein_id gnl|my_center|LOCUS_11580 >Feature sequence072 1638 325 gene locus_tag LOCUS_11590 1638 325 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814884.1 protein_id gnl|my_center|LOCUS_11590 2153 1848 gene locus_tag LOCUS_11600 2153 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 2326 2165 gene locus_tag LOCUS_11610 2326 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 2554 4170 gene locus_tag LOCUS_11620 2554 4170 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327627.1 protein_id gnl|my_center|LOCUS_11620 4317 5864 gene locus_tag LOCUS_11630 4317 5864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 7358 5865 gene locus_tag LOCUS_11640 7358 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 9490 7361 gene locus_tag LOCUS_11650 9490 7361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 9683 9758 gene locus_tag LOCUS_t00180 9683 9758 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 11024 9789 gene locus_tag LOCUS_11660 11024 9789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 11872 11039 gene locus_tag LOCUS_11670 11872 11039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 >Feature sequence073 1188 130 gene locus_tag LOCUS_11680 1188 130 CDS product TIGR04133 family radical SAM/SPASM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765031.1 protein_id gnl|my_center|LOCUS_11680 1550 1185 gene locus_tag LOCUS_11690 1550 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 2030 1569 gene locus_tag LOCUS_11700 2030 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 2166 2534 gene locus_tag LOCUS_11710 2166 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 2693 3004 gene locus_tag LOCUS_11720 2693 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 3018 4436 gene locus_tag LOCUS_11730 3018 4436 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_11730 4423 4689 gene locus_tag LOCUS_11740 4423 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 4754 7018 gene locus_tag LOCUS_11750 4754 7018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 7015 7905 gene locus_tag LOCUS_11760 7015 7905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 7907 8659 gene locus_tag LOCUS_11770 7907 8659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 8656 9600 gene locus_tag LOCUS_11780 8656 9600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 9601 10650 gene locus_tag LOCUS_11790 9601 10650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 10653 11273 gene locus_tag LOCUS_11800 10653 11273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 >Feature sequence074 3079 1436 gene locus_tag LOCUS_11810 gene pckA 3079 1436 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392169.1 protein_id gnl|my_center|LOCUS_11810 3248 4639 gene locus_tag LOCUS_11820 3248 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 4731 5378 gene locus_tag LOCUS_11830 4731 5378 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245835.1 protein_id gnl|my_center|LOCUS_11830 5410 6360 gene locus_tag LOCUS_11840 5410 6360 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680329.1 protein_id gnl|my_center|LOCUS_11840 6376 7602 gene locus_tag LOCUS_11850 6376 7602 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972198.1 protein_id gnl|my_center|LOCUS_11850 7705 9147 gene locus_tag LOCUS_11860 7705 9147 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022613.1 protein_id gnl|my_center|LOCUS_11860 9157 10344 gene locus_tag LOCUS_11870 9157 10344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 10382 11140 gene locus_tag LOCUS_11880 10382 11140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 >Feature sequence075 <1 1484 gene locus_tag LOCUS_11890 <1 1484 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058062.1:type I restriction-modification system subunit M 2167 1493 gene locus_tag LOCUS_11900 2167 1493 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855103.1 protein_id gnl|my_center|LOCUS_11900 3385 2177 gene locus_tag LOCUS_11910 3385 2177 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390559.1 protein_id gnl|my_center|LOCUS_11910 4584 3385 gene locus_tag LOCUS_11920 4584 3385 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494103.1 protein_id gnl|my_center|LOCUS_11920 7040 4602 gene locus_tag LOCUS_11930 7040 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 7289 8494 gene locus_tag LOCUS_11940 7289 8494 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_11940 9852 8509 gene locus_tag LOCUS_11950 9852 8509 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958607.1 protein_id gnl|my_center|LOCUS_11950 11286 9994 gene locus_tag LOCUS_11960 11286 9994 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880349.1 protein_id gnl|my_center|LOCUS_11960 >Feature sequence076 268 1380 gene locus_tag LOCUS_11970 268 1380 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016886.1 protein_id gnl|my_center|LOCUS_11970 1373 1537 gene locus_tag LOCUS_11980 1373 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 1995 1567 gene locus_tag LOCUS_11990 1995 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 2382 2089 gene locus_tag LOCUS_12000 2382 2089 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016227.1 protein_id gnl|my_center|LOCUS_12000 2828 2382 gene locus_tag LOCUS_12010 2828 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 3138 3926 gene locus_tag LOCUS_12020 3138 3926 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867167.1 protein_id gnl|my_center|LOCUS_12020 3919 4380 gene locus_tag LOCUS_12030 3919 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 4364 4759 gene locus_tag LOCUS_12040 4364 4759 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496720.1 protein_id gnl|my_center|LOCUS_12040 4873 6174 gene locus_tag LOCUS_12050 4873 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 7433 6312 gene locus_tag LOCUS_12060 7433 6312 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_12060 8984 7662 gene locus_tag LOCUS_12070 8984 7662 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693372.1 protein_id gnl|my_center|LOCUS_12070 9398 9171 gene locus_tag LOCUS_12080 9398 9171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 10344 9358 gene locus_tag LOCUS_12090 10344 9358 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_12090 10685 10329 gene locus_tag LOCUS_12100 10685 10329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 11001 10660 gene locus_tag LOCUS_12110 11001 10660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 >Feature sequence077 785 1321 gene locus_tag LOCUS_12120 785 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 1400 2131 gene locus_tag LOCUS_12130 gene rlmB 1400 2131 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399684.1 protein_id gnl|my_center|LOCUS_12130 2131 2844 gene locus_tag LOCUS_12140 gene rnc 2131 2844 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938733.1 protein_id gnl|my_center|LOCUS_12140 2926 4257 gene locus_tag LOCUS_12150 2926 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 5140 4271 gene locus_tag LOCUS_12160 gene dapA 5140 4271 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940835.1 protein_id gnl|my_center|LOCUS_12160 7450 5156 gene locus_tag LOCUS_12170 7450 5156 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880511.1 protein_id gnl|my_center|LOCUS_12170 8078 7443 gene locus_tag LOCUS_12180 8078 7443 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080010664.1 protein_id gnl|my_center|LOCUS_12180 8884 8156 gene locus_tag LOCUS_12190 8884 8156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 9029 9877 gene locus_tag LOCUS_12200 9029 9877 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861146.1 protein_id gnl|my_center|LOCUS_12200 9870 10274 gene locus_tag LOCUS_12210 9870 10274 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964852.1 protein_id gnl|my_center|LOCUS_12210 10288 11271 gene locus_tag LOCUS_12220 gene galE 10288 11271 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880665.1 protein_id gnl|my_center|LOCUS_12220 >Feature sequence078 1172 816 gene locus_tag LOCUS_12230 1172 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 2392 1253 gene locus_tag LOCUS_12240 2392 1253 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081868.1 protein_id gnl|my_center|LOCUS_12240 3143 2376 gene locus_tag LOCUS_12250 3143 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 3286 3636 gene locus_tag LOCUS_12260 3286 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 3637 4836 gene locus_tag LOCUS_12270 3637 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 4852 5592 gene locus_tag LOCUS_12280 4852 5592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 5937 5659 gene locus_tag LOCUS_12290 5937 5659 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_12290 6200 6982 gene locus_tag LOCUS_12300 6200 6982 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545987.1 protein_id gnl|my_center|LOCUS_12300 6982 7737 gene locus_tag LOCUS_12310 6982 7737 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_12310 7747 9258 gene locus_tag LOCUS_12320 7747 9258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 9268 10098 gene locus_tag LOCUS_12330 9268 10098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 10100 10450 gene locus_tag LOCUS_12340 10100 10450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 >Feature sequence079 2249 606 gene locus_tag LOCUS_12350 2249 606 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627741.1 protein_id gnl|my_center|LOCUS_12350 3627 2260 gene locus_tag LOCUS_12360 gene lpdA 3627 2260 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087546.1 protein_id gnl|my_center|LOCUS_12360 5219 3615 gene locus_tag LOCUS_12370 gene murJ 5219 3615 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681318.1 protein_id gnl|my_center|LOCUS_12370 7828 5216 gene locus_tag LOCUS_12380 7828 5216 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937936.1 protein_id gnl|my_center|LOCUS_12380 8261 7818 gene locus_tag LOCUS_12390 8261 7818 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338602.1 protein_id gnl|my_center|LOCUS_12390 8640 8263 gene locus_tag LOCUS_12400 gene queD 8640 8263 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942365.1 protein_id gnl|my_center|LOCUS_12400 9305 8637 gene locus_tag LOCUS_12410 9305 8637 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248574.1 protein_id gnl|my_center|LOCUS_12410 9503 11074 gene locus_tag LOCUS_12420 9503 11074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 >Feature sequence080 195 2522 gene locus_tag LOCUS_12430 195 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 2649 3821 gene locus_tag LOCUS_12440 2649 3821 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545078.1 protein_id gnl|my_center|LOCUS_12440 4120 4632 gene locus_tag LOCUS_12450 4120 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 5078 6385 gene locus_tag LOCUS_12460 gene ltrA 5078 6385 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393716.1 protein_id gnl|my_center|LOCUS_12460 6894 9317 gene locus_tag LOCUS_12470 6894 9317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 >Feature sequence081 2928 31 gene locus_tag LOCUS_12480 2928 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 6682 2954 gene locus_tag LOCUS_12490 6682 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 6764 6689 gene locus_tag LOCUS_t00190 6764 6689 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7618 6833 gene locus_tag LOCUS_12500 7618 6833 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080933.1 protein_id gnl|my_center|LOCUS_12500 8181 7612 gene locus_tag LOCUS_12510 8181 7612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 8477 8178 gene locus_tag LOCUS_12520 8477 8178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 8604 9194 gene locus_tag LOCUS_12530 8604 9194 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893583.1 protein_id gnl|my_center|LOCUS_12530 9311 10180 gene locus_tag LOCUS_12540 9311 10180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 10611 10261 gene locus_tag LOCUS_12550 10611 10261 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809264.1 protein_id gnl|my_center|LOCUS_12550 10894 10604 gene locus_tag LOCUS_12560 10894 10604 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545356.1 protein_id gnl|my_center|LOCUS_12560 >Feature sequence082 <1 738 gene locus_tag LOCUS_12570 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_035214414.1:ATP-binding protein 749 1225 gene locus_tag LOCUS_12580 gene trmL 749 1225 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356826.1 protein_id gnl|my_center|LOCUS_12580 1683 1204 gene locus_tag LOCUS_12590 1683 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 2662 1667 gene locus_tag LOCUS_12600 2662 1667 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429344.1 protein_id gnl|my_center|LOCUS_12600 3635 2640 gene locus_tag LOCUS_12610 3635 2640 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838603.1 protein_id gnl|my_center|LOCUS_12610 4892 3660 gene locus_tag LOCUS_12620 gene ablA 4892 3660 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_12620 5266 6450 gene locus_tag LOCUS_12630 5266 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 6574 8700 gene locus_tag LOCUS_12640 6574 8700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 8717 9883 gene locus_tag LOCUS_12650 8717 9883 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941766.1 protein_id gnl|my_center|LOCUS_12650 9883 10764 gene locus_tag LOCUS_12660 9883 10764 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074319.1 protein_id gnl|my_center|LOCUS_12660 >Feature sequence083 2935 1985 gene locus_tag LOCUS_12670 2935 1985 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870250.1 protein_id gnl|my_center|LOCUS_12670 3707 2928 gene locus_tag LOCUS_12680 3707 2928 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080809.1 protein_id gnl|my_center|LOCUS_12680 4564 3704 gene locus_tag LOCUS_12690 4564 3704 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265874.1 protein_id gnl|my_center|LOCUS_12690 4645 5631 gene locus_tag LOCUS_12700 4645 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 5648 5887 gene locus_tag LOCUS_12710 5648 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 5875 6861 gene locus_tag LOCUS_12720 5875 6861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 6871 7593 gene locus_tag LOCUS_12730 6871 7593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 7595 9010 gene locus_tag LOCUS_12740 7595 9010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 9025 10782 gene locus_tag LOCUS_12750 9025 10782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 >Feature sequence084 789 175 gene locus_tag LOCUS_12760 789 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 1687 773 gene locus_tag LOCUS_12770 1687 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 3199 1817 gene locus_tag LOCUS_12780 gene hydG 3199 1817 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939053.1 protein_id gnl|my_center|LOCUS_12780 5051 3270 gene locus_tag LOCUS_12790 5051 3270 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_12790 6326 5070 gene locus_tag LOCUS_12800 gene nuoF 6326 5070 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082918.1 protein_id gnl|my_center|LOCUS_12800 6798 6337 gene locus_tag LOCUS_12810 gene nuoE 6798 6337 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584034.1 protein_id gnl|my_center|LOCUS_12810 8577 6922 gene locus_tag LOCUS_12820 gene pruA 8577 6922 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404266.1 protein_id gnl|my_center|LOCUS_12820 10148 8589 gene locus_tag LOCUS_12830 10148 8589 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947081.1 protein_id gnl|my_center|LOCUS_12830 10525 10334 gene locus_tag LOCUS_12840 10525 10334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 >Feature sequence085 <1 1624 gene locus_tag LOCUS_12850 <1 1624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258200.1:chromosome condensation regulator RCC1 1702 2775 gene locus_tag LOCUS_12860 1702 2775 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986423.1 protein_id gnl|my_center|LOCUS_12860 4001 2772 gene locus_tag LOCUS_12870 4001 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 5014 3998 gene locus_tag LOCUS_12880 gene ruvB 5014 3998 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344450.1 protein_id gnl|my_center|LOCUS_12880 5607 5011 gene locus_tag LOCUS_12890 gene ruvA 5607 5011 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426582.1 protein_id gnl|my_center|LOCUS_12890 6090 5611 gene locus_tag LOCUS_12900 gene ruvC 6090 5611 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941736.1 protein_id gnl|my_center|LOCUS_12900 6843 6097 gene locus_tag LOCUS_12910 6843 6097 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_12910 7014 8360 gene locus_tag LOCUS_12920 gene htrA 7014 8360 CDS product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872209.1 protein_id gnl|my_center|LOCUS_12920 >Feature sequence086 2387 1062 gene locus_tag LOCUS_12930 2387 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 5284 2402 gene locus_tag LOCUS_12940 5284 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 6294 5290 gene locus_tag LOCUS_12950 6294 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 6656 6534 gene locus_tag LOCUS_12960 6656 6534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 6843 8369 gene locus_tag LOCUS_12970 6843 8369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 8362 9219 gene locus_tag LOCUS_12980 8362 9219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 9326 9239 gene locus_tag LOCUS_t00200 9326 9239 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9418 9345 gene locus_tag LOCUS_t00210 9418 9345 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 9534 9460 gene locus_tag LOCUS_t00220 9534 9460 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence087 <1 1623 gene locus_tag LOCUS_12990 <1 1623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016207.1:ankyrin repeat domain-containing protein 1620 2762 gene locus_tag LOCUS_13000 1620 2762 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986366.1 protein_id gnl|my_center|LOCUS_13000 2875 4056 gene locus_tag LOCUS_13010 2875 4056 CDS product DUF1576 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869156.1 protein_id gnl|my_center|LOCUS_13010 4060 4407 gene locus_tag LOCUS_13020 4060 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 4419 5345 gene locus_tag LOCUS_13030 gene cysK 4419 5345 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461664.1 protein_id gnl|my_center|LOCUS_13030 5350 6405 gene locus_tag LOCUS_13040 gene hydE 5350 6405 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964939.1 protein_id gnl|my_center|LOCUS_13040 6392 7363 gene locus_tag LOCUS_13050 gene bioB 6392 7363 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880605.1 protein_id gnl|my_center|LOCUS_13050 8043 7369 gene locus_tag LOCUS_13060 gene pyrE 8043 7369 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_13060 8207 9331 gene locus_tag LOCUS_13070 8207 9331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 >Feature sequence088 7 1344 gene locus_tag LOCUS_13080 7 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 1341 2009 gene locus_tag LOCUS_13090 1341 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 2357 2019 gene locus_tag LOCUS_13100 2357 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 2504 3613 gene locus_tag LOCUS_13110 2504 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 3743 4774 gene locus_tag LOCUS_13120 3743 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 4872 6224 gene locus_tag LOCUS_13130 gene trkA 4872 6224 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545959.1 protein_id gnl|my_center|LOCUS_13130 6214 7662 gene locus_tag LOCUS_13140 6214 7662 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680943.1 protein_id gnl|my_center|LOCUS_13140 10268 7689 gene locus_tag LOCUS_13150 10268 7689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 >Feature sequence089 1240 209 gene locus_tag LOCUS_13160 gene mltG 1240 209 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217396.1 protein_id gnl|my_center|LOCUS_13160 1768 1250 gene locus_tag LOCUS_13170 gene cobO 1768 1250 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948638.1 protein_id gnl|my_center|LOCUS_13170 3029 1761 gene locus_tag LOCUS_13180 3029 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 3802 3041 gene locus_tag LOCUS_13190 3802 3041 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_13190 5294 3897 gene locus_tag LOCUS_13200 5294 3897 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924829.1 protein_id gnl|my_center|LOCUS_13200 6618 5284 gene locus_tag LOCUS_13210 6618 5284 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_13210 6634 6849 gene locus_tag LOCUS_13220 6634 6849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 8078 6882 gene locus_tag LOCUS_13230 8078 6882 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_13230 9178 8081 gene locus_tag LOCUS_13240 9178 8081 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_13240 10180 9194 gene locus_tag LOCUS_13250 10180 9194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 >Feature sequence090 299 655 gene locus_tag LOCUS_13260 299 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 657 1934 gene locus_tag LOCUS_13270 657 1934 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_13270 1931 2548 gene locus_tag LOCUS_13280 1931 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 2520 3419 gene locus_tag LOCUS_13290 2520 3419 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360266.1 protein_id gnl|my_center|LOCUS_13290 3479 4090 gene locus_tag LOCUS_13300 3479 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 4090 6294 gene locus_tag LOCUS_13310 4090 6294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 6296 7255 gene locus_tag LOCUS_13320 gene metF 6296 7255 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404822.1 protein_id gnl|my_center|LOCUS_13320 7257 8192 gene locus_tag LOCUS_13330 7257 8192 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919030.1 protein_id gnl|my_center|LOCUS_13330 8189 8911 gene locus_tag LOCUS_13340 8189 8911 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_13340 8908 9978 gene locus_tag LOCUS_13350 8908 9978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 >Feature sequence091 <1 680 gene locus_tag LOCUS_13360 <1 680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002719496.1:2-isopropylmalate synthase 709 4479 gene locus_tag LOCUS_13370 709 4479 CDS product DUF3857 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583095.1 protein_id gnl|my_center|LOCUS_13370 4489 5655 gene locus_tag LOCUS_13380 4489 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 5847 5665 gene locus_tag LOCUS_13390 5847 5665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 <10143 5978 gene locus_tag LOCUS_13400 <10143 5978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000052484.1:Ig-like domain-containing protein >Feature sequence092 <1 1025 gene locus_tag LOCUS_13410 <1 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545206.1:apolipoprotein N-acyltransferase 1032 1250 gene locus_tag LOCUS_13420 1032 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 1183 1872 gene locus_tag LOCUS_13430 1183 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 1969 2364 gene locus_tag LOCUS_13440 1969 2364 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460531.1 protein_id gnl|my_center|LOCUS_13440 2343 2651 gene locus_tag LOCUS_13450 2343 2651 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811823.1 protein_id gnl|my_center|LOCUS_13450 3495 2674 gene locus_tag LOCUS_13460 3495 2674 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861239.1 protein_id gnl|my_center|LOCUS_13460 3700 3488 gene locus_tag LOCUS_13470 3700 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 4476 3697 gene locus_tag LOCUS_13480 gene hadI 4476 3697 CDS product 2-hydroxyisocaproyl-CoA dehydratase activator HadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986690.1 protein_id gnl|my_center|LOCUS_13480 5267 4473 gene locus_tag LOCUS_13490 gene mazG 5267 4473 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941834.1 protein_id gnl|my_center|LOCUS_13490 6705 5269 gene locus_tag LOCUS_13500 gene purF 6705 5269 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086941.1 protein_id gnl|my_center|LOCUS_13500 6860 7756 gene locus_tag LOCUS_13510 6860 7756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 7753 8232 gene locus_tag LOCUS_13520 gene ispF 7753 8232 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488386.1 protein_id gnl|my_center|LOCUS_13520 8233 8835 gene locus_tag LOCUS_13530 8233 8835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence093 2534 861 gene locus_tag LOCUS_13540 2534 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 2771 3886 gene locus_tag LOCUS_13550 2771 3886 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_13550 4572 3949 gene locus_tag LOCUS_13560 4572 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 5750 4602 gene locus_tag LOCUS_13570 5750 4602 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410070.1 protein_id gnl|my_center|LOCUS_13570 6054 6551 gene locus_tag LOCUS_13580 6054 6551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 7903 6569 gene locus_tag LOCUS_13590 7903 6569 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_13590 9306 8041 gene locus_tag LOCUS_13600 9306 8041 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458380.1 protein_id gnl|my_center|LOCUS_13600 10059 9310 gene locus_tag LOCUS_13610 10059 9310 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048208.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence094 1133 273 gene locus_tag LOCUS_13620 1133 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 1993 1130 gene locus_tag LOCUS_13630 1993 1130 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_13630 2976 1999 gene locus_tag LOCUS_13640 2976 1999 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_13640 4719 3064 gene locus_tag LOCUS_13650 4719 3064 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786798.1 protein_id gnl|my_center|LOCUS_13650 6848 4797 gene locus_tag LOCUS_13660 6848 4797 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189745032.1 protein_id gnl|my_center|LOCUS_13660 7035 8690 gene locus_tag LOCUS_13670 7035 8690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 >Feature sequence095 363 779 gene locus_tag LOCUS_13680 363 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 783 1361 gene locus_tag LOCUS_13690 783 1361 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583271.1 protein_id gnl|my_center|LOCUS_13690 1383 2804 gene locus_tag LOCUS_13700 1383 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 2820 4088 gene locus_tag LOCUS_13710 gene tyrS 2820 4088 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830858.1 protein_id gnl|my_center|LOCUS_13710 4178 6250 gene locus_tag LOCUS_13720 4178 6250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 6250 6978 gene locus_tag LOCUS_13730 6250 6978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 6975 7979 gene locus_tag LOCUS_13740 6975 7979 CDS product RNA ligase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068264228.1 protein_id gnl|my_center|LOCUS_13740 9841 8045 gene locus_tag LOCUS_13750 9841 8045 CDS product OPT family oligopeptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768135.1 protein_id gnl|my_center|LOCUS_13750 >Feature sequence096 228 635 gene locus_tag LOCUS_13760 228 635 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151390.1 protein_id gnl|my_center|LOCUS_13760 645 1136 gene locus_tag LOCUS_13770 645 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 1129 3060 gene locus_tag LOCUS_13780 1129 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 3108 4106 gene locus_tag LOCUS_13790 3108 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 4152 4511 gene locus_tag LOCUS_13800 4152 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 4520 4593 gene locus_tag LOCUS_t00230 4520 4593 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4609 4683 gene locus_tag LOCUS_t00240 4609 4683 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5074 4754 gene locus_tag LOCUS_13810 5074 4754 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038658.1 protein_id gnl|my_center|LOCUS_13810 8046 5281 gene locus_tag LOCUS_13820 8046 5281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 8910 8068 gene locus_tag LOCUS_13830 8910 8068 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310179.1 protein_id gnl|my_center|LOCUS_13830 9262 9014 gene locus_tag LOCUS_13840 9262 9014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 9247 9723 gene locus_tag LOCUS_13850 9247 9723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 >Feature sequence097 73 324 gene locus_tag LOCUS_13860 73 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 334 1206 gene locus_tag LOCUS_13870 334 1206 CDS product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964372.1 protein_id gnl|my_center|LOCUS_13870 1203 2549 gene locus_tag LOCUS_13880 1203 2549 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_13880 2578 3225 gene locus_tag LOCUS_13890 2578 3225 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937441.1 protein_id gnl|my_center|LOCUS_13890 3322 4014 gene locus_tag LOCUS_13900 3322 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 4011 4562 gene locus_tag LOCUS_13910 4011 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 4559 4942 gene locus_tag LOCUS_13920 4559 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 7767 4966 gene locus_tag LOCUS_13930 7767 4966 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956687.1 protein_id gnl|my_center|LOCUS_13930 7880 8266 gene locus_tag LOCUS_13940 7880 8266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence098 2599 1787 gene locus_tag LOCUS_13950 2599 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 4103 2610 gene locus_tag LOCUS_13960 4103 2610 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227677.1 protein_id gnl|my_center|LOCUS_13960 4617 4201 gene locus_tag LOCUS_13970 4617 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 5716 4622 gene locus_tag LOCUS_13980 gene mraY 5716 4622 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_13980 7710 5713 gene locus_tag LOCUS_13990 7710 5713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 8854 7820 gene locus_tag LOCUS_14000 8854 7820 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 protein_id gnl|my_center|LOCUS_14000 <9644 9135 gene locus_tag LOCUS_14010 <9644 9135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005648596.1:RhuM family protein >Feature sequence099 1640 2104 gene locus_tag LOCUS_14020 1640 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 4347 2116 gene locus_tag LOCUS_14030 4347 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 5126 4350 gene locus_tag LOCUS_14040 5126 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 6835 5147 gene locus_tag LOCUS_14050 6835 5147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 8656 6941 gene locus_tag LOCUS_14060 gene argS 8656 6941 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016438.1 protein_id gnl|my_center|LOCUS_14060 >Feature sequence100 3159 796 gene locus_tag LOCUS_14070 3159 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 4465 3143 gene locus_tag LOCUS_14080 gene trmFO 4465 3143 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791925.1 protein_id gnl|my_center|LOCUS_14080 6687 4462 gene locus_tag LOCUS_14090 gene topA 6687 4462 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_14090 7586 6684 gene locus_tag LOCUS_14100 7586 6684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 8476 7583 gene locus_tag LOCUS_14110 gene ispH 8476 7583 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881128.1 protein_id gnl|my_center|LOCUS_14110 9147 8473 gene locus_tag LOCUS_14120 gene cmk 9147 8473 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106707.1 protein_id gnl|my_center|LOCUS_14120 9533 9324 gene locus_tag LOCUS_14130 9533 9324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 >Feature sequence101 2602 56 gene locus_tag LOCUS_14140 gene leuS 2602 56 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_14140 5060 2622 gene locus_tag LOCUS_14150 5060 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 5956 5060 gene locus_tag LOCUS_14160 5956 5060 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948018.1 protein_id gnl|my_center|LOCUS_14160 6187 6702 gene locus_tag LOCUS_14170 6187 6702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036263.1 protein_id gnl|my_center|LOCUS_14170 6689 7387 gene locus_tag LOCUS_14180 6689 7387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 7392 8579 gene locus_tag LOCUS_14190 7392 8579 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_14190 8580 9227 gene locus_tag LOCUS_14200 8580 9227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 >Feature sequence102 1798 362 gene locus_tag LOCUS_14210 gene cysS 1798 362 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546384.1 protein_id gnl|my_center|LOCUS_14210 1961 3922 gene locus_tag LOCUS_14220 1961 3922 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986282.1 protein_id gnl|my_center|LOCUS_14220 4712 3951 gene locus_tag LOCUS_14230 gene panB 4712 3951 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082243.1 protein_id gnl|my_center|LOCUS_14230 5524 4709 gene locus_tag LOCUS_14240 gene rsmA 5524 4709 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166215.1 protein_id gnl|my_center|LOCUS_14240 6531 5521 gene locus_tag LOCUS_14250 gene tsaD 6531 5521 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546527.1 protein_id gnl|my_center|LOCUS_14250 7379 6534 gene locus_tag LOCUS_14260 gene nfo 7379 6534 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706116.1 protein_id gnl|my_center|LOCUS_14260 8123 7407 gene locus_tag LOCUS_14270 8123 7407 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669614.1 protein_id gnl|my_center|LOCUS_14270 8275 9126 gene locus_tag LOCUS_14280 8275 9126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 >Feature sequence103 <1 1197 gene locus_tag LOCUS_14290 <1 1197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108877.1:ATP-binding protein 1248 1347 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1636 2838 gene locus_tag LOCUS_14300 1636 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 2967 5366 gene locus_tag LOCUS_14310 2967 5366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 6283 5387 gene locus_tag LOCUS_14320 6283 5387 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071683.1 protein_id gnl|my_center|LOCUS_14320 6376 8055 gene locus_tag LOCUS_14330 6376 8055 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016615.1 protein_id gnl|my_center|LOCUS_14330 <9254 8085 gene locus_tag LOCUS_14340 <9254 8085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048693189.1:cytochrome c biogenesis protein CcdA >Feature sequence104 3 548 gene locus_tag LOCUS_14350 3 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 3583 545 gene locus_tag LOCUS_14360 3583 545 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460042.1 protein_id gnl|my_center|LOCUS_14360 4044 3580 gene locus_tag LOCUS_14370 4044 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 4420 4082 gene locus_tag LOCUS_14380 4420 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 4563 5468 gene locus_tag LOCUS_14390 gene thiL 4563 5468 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_14390 5398 5853 gene locus_tag LOCUS_14400 5398 5853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 5957 7531 gene locus_tag LOCUS_14410 5957 7531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 7903 7532 gene locus_tag LOCUS_14420 gene trxA 7903 7532 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056655.1 protein_id gnl|my_center|LOCUS_14420 <9125 7916 gene locus_tag LOCUS_14430 <9125 7916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816615.1:subtilisin/kexin-like serine protease HreP >Feature sequence105 248 1000 gene locus_tag LOCUS_14440 248 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 1151 1366 gene locus_tag LOCUS_14450 1151 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 1326 1688 gene locus_tag LOCUS_14460 1326 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 1753 3009 gene locus_tag LOCUS_14470 1753 3009 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659589.1 protein_id gnl|my_center|LOCUS_14470 3942 3022 gene locus_tag LOCUS_14480 3942 3022 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292180.1 protein_id gnl|my_center|LOCUS_14480 4345 4055 gene locus_tag LOCUS_14490 4345 4055 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_14490 5974 4547 gene locus_tag LOCUS_14500 5974 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 5995 6094 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7683 6349 gene locus_tag LOCUS_14510 7683 6349 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839735.1 protein_id gnl|my_center|LOCUS_14510 8933 7764 gene locus_tag LOCUS_14520 8933 7764 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_14520 >Feature sequence106 2335 62 gene locus_tag LOCUS_14530 2335 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 2593 2348 gene locus_tag LOCUS_14540 2593 2348 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940916.1 protein_id gnl|my_center|LOCUS_14540 3151 2606 gene locus_tag LOCUS_14550 3151 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964358.1 protein_id gnl|my_center|LOCUS_14550 4200 3148 gene locus_tag LOCUS_14560 4200 3148 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964359.1 protein_id gnl|my_center|LOCUS_14560 4622 4197 gene locus_tag LOCUS_14570 4622 4197 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316680.1 protein_id gnl|my_center|LOCUS_14570 5038 4622 gene locus_tag LOCUS_14580 5038 4622 CDS product flexirubin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964367.1 protein_id gnl|my_center|LOCUS_14580 5168 5935 gene locus_tag LOCUS_14590 5168 5935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 7533 5938 gene locus_tag LOCUS_14600 7533 5938 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932499.1 protein_id gnl|my_center|LOCUS_14600 7655 8524 gene locus_tag LOCUS_14610 7655 8524 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765521.1 protein_id gnl|my_center|LOCUS_14610 >Feature sequence107 1108 167 gene locus_tag LOCUS_14620 1108 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 1429 1148 gene locus_tag LOCUS_14630 1429 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 1476 3380 gene locus_tag LOCUS_14640 1476 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 3493 3684 gene locus_tag LOCUS_14650 3493 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 4023 3694 gene locus_tag LOCUS_14660 4023 3694 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135500.1 protein_id gnl|my_center|LOCUS_14660 4237 5034 gene locus_tag LOCUS_14670 4237 5034 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545061.1 protein_id gnl|my_center|LOCUS_14670 5031 5474 gene locus_tag LOCUS_14680 5031 5474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 5467 6408 gene locus_tag LOCUS_14690 5467 6408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 6405 7058 gene locus_tag LOCUS_14700 6405 7058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 7081 8211 gene locus_tag LOCUS_14710 7081 8211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 8789 8208 gene locus_tag LOCUS_14720 8789 8208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 >Feature sequence108 188 1108 gene locus_tag LOCUS_14730 gene tsf 188 1108 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965094.1 protein_id gnl|my_center|LOCUS_14730 1200 2510 gene locus_tag LOCUS_14740 1200 2510 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544922.1 protein_id gnl|my_center|LOCUS_14740 2513 3229 gene locus_tag LOCUS_14750 2513 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 3234 3788 gene locus_tag LOCUS_14760 3234 3788 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_14760 3814 4098 gene locus_tag LOCUS_14770 3814 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 4105 4998 gene locus_tag LOCUS_14780 4105 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 5645 5022 gene locus_tag LOCUS_14790 gene upp 5645 5022 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262598.1 protein_id gnl|my_center|LOCUS_14790 6518 5664 gene locus_tag LOCUS_14800 6518 5664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 6643 7341 gene locus_tag LOCUS_14810 gene dapD 6643 7341 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081875.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence109 404 2995 gene locus_tag LOCUS_14820 404 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 3035 4672 gene locus_tag LOCUS_14830 3035 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 6636 5062 gene locus_tag LOCUS_14840 6636 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 >Feature sequence110 2197 110 gene locus_tag LOCUS_14850 gene fusA 2197 110 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_14850 2691 2221 gene locus_tag LOCUS_14860 gene rpsG 2691 2221 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005626581.1 protein_id gnl|my_center|LOCUS_14860 3080 2709 gene locus_tag LOCUS_14870 gene rpsL 3080 2709 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938593.1 protein_id gnl|my_center|LOCUS_14870 5412 3271 gene locus_tag LOCUS_14880 5412 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 7955 5412 gene locus_tag LOCUS_14890 7955 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 <8985 8042 gene locus_tag LOCUS_14900 <8985 8042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544939.1:PAS domain S-box protein >Feature sequence111 1674 2207 gene locus_tag LOCUS_14910 1674 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 2221 2541 gene locus_tag LOCUS_14920 gene trxA 2221 2541 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140882.1 protein_id gnl|my_center|LOCUS_14920 2957 2544 gene locus_tag LOCUS_14930 2957 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 3210 4340 gene locus_tag LOCUS_14940 3210 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 5158 4337 gene locus_tag LOCUS_14950 5158 4337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 6317 5193 gene locus_tag LOCUS_14960 6317 5193 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_14960 6650 6498 gene locus_tag LOCUS_14970 6650 6498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 7022 6675 gene locus_tag LOCUS_14980 7022 6675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 7543 7172 gene locus_tag LOCUS_14990 7543 7172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 8312 7530 gene locus_tag LOCUS_15000 8312 7530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 8537 8385 gene locus_tag LOCUS_15010 8537 8385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 >Feature sequence112 3713 2010 gene locus_tag LOCUS_15020 gene hreP 3713 2010 CDS product subtilisin/kexin-like serine protease HreP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816615.1 protein_id gnl|my_center|LOCUS_15020 3886 4611 gene locus_tag LOCUS_15030 3886 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 4648 5403 gene locus_tag LOCUS_15040 gene pssA 4648 5403 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122183.1 protein_id gnl|my_center|LOCUS_15040 5387 6583 gene locus_tag LOCUS_15050 5387 6583 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933712.1 protein_id gnl|my_center|LOCUS_15050 6584 7603 gene locus_tag LOCUS_15060 gene ychF 6584 7603 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256516.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence113 474 953 gene locus_tag LOCUS_15070 474 953 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065297.1 protein_id gnl|my_center|LOCUS_15070 1258 962 gene locus_tag LOCUS_15080 1258 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 2084 1296 gene locus_tag LOCUS_15090 2084 1296 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_15090 3641 2094 gene locus_tag LOCUS_15100 gene rny 3641 2094 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941798.1 protein_id gnl|my_center|LOCUS_15100 4174 3656 gene locus_tag LOCUS_15110 4174 3656 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881124.1 protein_id gnl|my_center|LOCUS_15110 5060 4362 gene locus_tag LOCUS_15120 5060 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 6386 5082 gene locus_tag LOCUS_15130 gene tolB 6386 5082 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_15130 7138 6365 gene locus_tag LOCUS_15140 7138 6365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 7578 7141 gene locus_tag LOCUS_15150 gene tolR 7578 7141 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_15150 8303 7578 gene locus_tag LOCUS_15160 gene tolQ 8303 7578 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence114 2612 2124 gene locus_tag LOCUS_15170 2612 2124 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_15170 3429 2590 gene locus_tag LOCUS_15180 3429 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 4826 3510 gene locus_tag LOCUS_15190 4826 3510 CDS product 5'-deoxyadenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392738.1 protein_id gnl|my_center|LOCUS_15190 4926 6068 gene locus_tag LOCUS_15200 4926 6068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 6065 7096 gene locus_tag LOCUS_15210 6065 7096 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249726.1 protein_id gnl|my_center|LOCUS_15210 7395 7111 gene locus_tag LOCUS_15220 7395 7111 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392154.1 protein_id gnl|my_center|LOCUS_15220 8374 7673 gene locus_tag LOCUS_15230 8374 7673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 >Feature sequence115 34 108 gene locus_tag LOCUS_t00250 34 108 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 203 1393 gene locus_tag LOCUS_15240 203 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 1547 3355 gene locus_tag LOCUS_15250 1547 3355 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_15250 3367 4407 gene locus_tag LOCUS_15260 3367 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 4528 4920 gene locus_tag LOCUS_15270 4528 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 4934 5878 gene locus_tag LOCUS_15280 4934 5878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 5955 6770 gene locus_tag LOCUS_15290 5955 6770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477844.1 protein_id gnl|my_center|LOCUS_15290 6767 7180 gene locus_tag LOCUS_15300 6767 7180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence116 49 1035 gene locus_tag LOCUS_15310 49 1035 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_15310 1032 2003 gene locus_tag LOCUS_15320 1032 2003 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_15320 2000 2737 gene locus_tag LOCUS_15330 2000 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 2750 4486 gene locus_tag LOCUS_15340 2750 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 4483 5193 gene locus_tag LOCUS_15350 4483 5193 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962306.1 protein_id gnl|my_center|LOCUS_15350 5190 5909 gene locus_tag LOCUS_15360 5190 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 5995 6708 gene locus_tag LOCUS_15370 5995 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 6946 7494 gene locus_tag LOCUS_15380 6946 7494 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974802.1 protein_id gnl|my_center|LOCUS_15380 7491 8498 gene locus_tag LOCUS_15390 7491 8498 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013448020.1 protein_id gnl|my_center|LOCUS_15390 >Feature sequence117 466 1290 gene locus_tag LOCUS_15400 466 1290 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 protein_id gnl|my_center|LOCUS_15400 1431 2324 gene locus_tag LOCUS_15410 1431 2324 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391779.1 protein_id gnl|my_center|LOCUS_15410 2600 2325 gene locus_tag LOCUS_15420 2600 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 3120 2581 gene locus_tag LOCUS_15430 3120 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 4265 3117 gene locus_tag LOCUS_15440 4265 3117 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880128.1 protein_id gnl|my_center|LOCUS_15440 5127 4267 gene locus_tag LOCUS_15450 gene panC 5127 4267 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208399.1 protein_id gnl|my_center|LOCUS_15450 6398 5148 gene locus_tag LOCUS_15460 6398 5148 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964343.1 protein_id gnl|my_center|LOCUS_15460 7883 6408 gene locus_tag LOCUS_15470 7883 6408 CDS product acyl-CoA--6-aminopenicillanic acid acyl-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964344.1 protein_id gnl|my_center|LOCUS_15470 <8508 7873 gene locus_tag LOCUS_15480 <8508 7873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964345.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence118 135 752 gene locus_tag LOCUS_15490 135 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 845 1513 gene locus_tag LOCUS_15500 845 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 1495 2610 gene locus_tag LOCUS_15510 gene add 1495 2610 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838307.1 protein_id gnl|my_center|LOCUS_15510 2612 3175 gene locus_tag LOCUS_15520 2612 3175 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343928.1 protein_id gnl|my_center|LOCUS_15520 3243 3833 gene locus_tag LOCUS_15530 3243 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 3834 4736 gene locus_tag LOCUS_15540 3834 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 6674 4881 gene locus_tag LOCUS_15550 6674 4881 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940946.1 protein_id gnl|my_center|LOCUS_15550 7975 7079 gene locus_tag LOCUS_15560 7975 7079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 >Feature sequence119 2889 1600 gene locus_tag LOCUS_15570 2889 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 3869 3072 gene locus_tag LOCUS_15580 3869 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 5169 3871 gene locus_tag LOCUS_15590 5169 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 5834 5166 gene locus_tag LOCUS_15600 5834 5166 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037424.1 protein_id gnl|my_center|LOCUS_15600 6239 5901 gene locus_tag LOCUS_15610 6239 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 7117 6236 gene locus_tag LOCUS_15620 7117 6236 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939380.1 protein_id gnl|my_center|LOCUS_15620 7959 7114 gene locus_tag LOCUS_15630 7959 7114 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_15630 >Feature sequence120 1664 558 gene locus_tag LOCUS_15640 1664 558 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461012.1 protein_id gnl|my_center|LOCUS_15640 1840 2124 gene locus_tag LOCUS_15650 1840 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 2057 2755 gene locus_tag LOCUS_15660 2057 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 2752 4116 gene locus_tag LOCUS_15670 2752 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 4931 4101 gene locus_tag LOCUS_15680 gene lgt 4931 4101 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583316.1 protein_id gnl|my_center|LOCUS_15680 5434 4928 gene locus_tag LOCUS_15690 gene lspA 5434 4928 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014705.1 protein_id gnl|my_center|LOCUS_15690 8187 5431 gene locus_tag LOCUS_15700 gene ileS 8187 5431 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943758.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence121 420 1628 gene locus_tag LOCUS_15710 420 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 1692 2648 gene locus_tag LOCUS_15720 1692 2648 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584138.1 protein_id gnl|my_center|LOCUS_15720 2648 3013 gene locus_tag LOCUS_15730 2648 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 4133 3006 gene locus_tag LOCUS_15740 4133 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 4939 4133 gene locus_tag LOCUS_15750 gene dapF 4939 4133 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944873.1 protein_id gnl|my_center|LOCUS_15750 5373 4939 gene locus_tag LOCUS_15760 5373 4939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 6275 5373 gene locus_tag LOCUS_15770 6275 5373 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262600.1 protein_id gnl|my_center|LOCUS_15770 7050 6277 gene locus_tag LOCUS_15780 7050 6277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 7211 7298 gene locus_tag LOCUS_t00260 7211 7298 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7317 7408 gene locus_tag LOCUS_t00270 7317 7408 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7421 7497 gene locus_tag LOCUS_t00280 7421 7497 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7531 8013 gene locus_tag LOCUS_15790 gene tadA 7531 8013 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545402.1 protein_id gnl|my_center|LOCUS_15790 8016 8107 gene locus_tag LOCUS_t00290 8016 8107 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence122 760 80 gene locus_tag LOCUS_15800 760 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 4032 844 gene locus_tag LOCUS_15810 4032 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 4291 4148 gene locus_tag LOCUS_15820 4291 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 4584 4288 gene locus_tag LOCUS_15830 4584 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 5612 4842 gene locus_tag LOCUS_15840 5612 4842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 7920 6715 gene locus_tag LOCUS_15850 7920 6715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 >Feature sequence123 7796 33 gene locus_tag LOCUS_15860 7796 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 >Feature sequence124 27 680 gene locus_tag LOCUS_15870 27 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 691 2028 gene locus_tag LOCUS_15880 gene rsxC 691 2028 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788158.1 protein_id gnl|my_center|LOCUS_15880 2025 3047 gene locus_tag LOCUS_15890 2025 3047 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_15890 3040 3609 gene locus_tag LOCUS_15900 3040 3609 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202941.1 protein_id gnl|my_center|LOCUS_15900 3609 4199 gene locus_tag LOCUS_15910 3609 4199 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_15910 4210 4785 gene locus_tag LOCUS_15920 gene rsxA 4210 4785 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778198.1 protein_id gnl|my_center|LOCUS_15920 4934 5803 gene locus_tag LOCUS_15930 4934 5803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 6662 5775 gene locus_tag LOCUS_15940 6662 5775 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774874.1 protein_id gnl|my_center|LOCUS_15940 >Feature sequence125 <1 774 gene locus_tag LOCUS_15950 <1 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011174683.1:CocE/NonD family hydrolase 2308 782 gene locus_tag LOCUS_15960 2308 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 3395 2325 gene locus_tag LOCUS_15970 gene ispG 3395 2325 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460411.1 protein_id gnl|my_center|LOCUS_15970 5240 3396 gene locus_tag LOCUS_15980 gene dxs 5240 3396 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_15980 6115 5237 gene locus_tag LOCUS_15990 6115 5237 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545645.1 protein_id gnl|my_center|LOCUS_15990 6339 6112 gene locus_tag LOCUS_16000 6339 6112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 6866 6408 gene locus_tag LOCUS_16010 gene ndk 6866 6408 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770040.1 protein_id gnl|my_center|LOCUS_16010 7010 7960 gene locus_tag LOCUS_16020 7010 7960 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767011.1 protein_id gnl|my_center|LOCUS_16020 >Feature sequence126 1 903 gene locus_tag LOCUS_16030 1 903 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935658.1 protein_id gnl|my_center|LOCUS_16030 905 1906 gene locus_tag LOCUS_16040 905 1906 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893542.1 protein_id gnl|my_center|LOCUS_16040 1919 3094 gene locus_tag LOCUS_16050 1919 3094 CDS product 5-methylthioribulose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389751.1 protein_id gnl|my_center|LOCUS_16050 3091 4377 gene locus_tag LOCUS_16060 3091 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 6065 4380 gene locus_tag LOCUS_16070 6065 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 7113 6067 gene locus_tag LOCUS_16080 7113 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 <7872 7313 gene locus_tag LOCUS_16090 <7872 7313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496733.1:tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 >Feature sequence127 1572 829 gene locus_tag LOCUS_16100 1572 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 1760 1569 gene locus_tag LOCUS_16110 1760 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 1942 3684 gene locus_tag LOCUS_16120 1942 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 4811 3705 gene locus_tag LOCUS_16130 gene serC 4811 3705 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256881.1 protein_id gnl|my_center|LOCUS_16130 5179 7026 gene locus_tag LOCUS_16140 5179 7026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 6987 7724 gene locus_tag LOCUS_16150 6987 7724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 >Feature sequence128 1184 1582 gene locus_tag LOCUS_16160 1184 1582 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941659.1 protein_id gnl|my_center|LOCUS_16160 3727 1616 gene locus_tag LOCUS_16170 3727 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 5130 3736 gene locus_tag LOCUS_16180 5130 3736 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480646.1 protein_id gnl|my_center|LOCUS_16180 5907 5212 gene locus_tag LOCUS_16190 5907 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 <7651 5897 gene locus_tag LOCUS_16200 <7651 5897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_200858940.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence129 991 284 gene locus_tag LOCUS_16210 991 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 1166 1498 gene locus_tag LOCUS_16220 1166 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 1510 1998 gene locus_tag LOCUS_16230 1510 1998 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867824.1 protein_id gnl|my_center|LOCUS_16230 1991 2251 gene locus_tag LOCUS_16240 1991 2251 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867825.1 protein_id gnl|my_center|LOCUS_16240 2248 2586 gene locus_tag LOCUS_16250 2248 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 2587 2832 gene locus_tag LOCUS_16260 2587 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 2825 3508 gene locus_tag LOCUS_16270 2825 3508 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053840.1 protein_id gnl|my_center|LOCUS_16270 3510 3863 gene locus_tag LOCUS_16280 3510 3863 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867829.1 protein_id gnl|my_center|LOCUS_16280 3860 6994 gene locus_tag LOCUS_16290 3860 6994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence130 611 84 gene locus_tag LOCUS_16300 611 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 749 1630 gene locus_tag LOCUS_16310 749 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 1627 2142 gene locus_tag LOCUS_16320 1627 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 2247 4556 gene locus_tag LOCUS_16330 2247 4556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 5072 4566 gene locus_tag LOCUS_16340 5072 4566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 5226 5480 gene locus_tag LOCUS_16350 5226 5480 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089200.1 protein_id gnl|my_center|LOCUS_16350 >Feature sequence131 462 2342 gene locus_tag LOCUS_16360 462 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 3259 2348 gene locus_tag LOCUS_16370 3259 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 4184 3252 gene locus_tag LOCUS_16380 4184 3252 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_16380 6321 4255 gene locus_tag LOCUS_16390 6321 4255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 >Feature sequence132 1735 1133 gene locus_tag LOCUS_16400 1735 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 2379 1732 gene locus_tag LOCUS_16410 gene lipB 2379 1732 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943071.1 protein_id gnl|my_center|LOCUS_16410 3130 2381 gene locus_tag LOCUS_16420 3130 2381 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583447.1 protein_id gnl|my_center|LOCUS_16420 4460 3132 gene locus_tag LOCUS_16430 4460 3132 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_16430 5950 4460 gene locus_tag LOCUS_16440 5950 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 6130 6684 gene locus_tag LOCUS_16450 6130 6684 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081962.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence133 1618 2073 gene locus_tag LOCUS_16460 1618 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 4760 2076 gene locus_tag LOCUS_16470 gene fdhF 4760 2076 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 transl_except (pos:complement(3702..3704),aa:Sec) note codon on position 353 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_16470 6549 4744 gene locus_tag LOCUS_16480 6549 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 4771 4870 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <7363 6644 gene locus_tag LOCUS_16490 <7363 6644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546707.1:[FeFe] hydrogenase H-cluster maturation GTPase HydF >Feature sequence134 1511 3064 gene locus_tag LOCUS_16500 1511 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 3067 3966 gene locus_tag LOCUS_16510 3067 3966 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812971.1 protein_id gnl|my_center|LOCUS_16510 4064 5428 gene locus_tag LOCUS_16520 4064 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 5456 6967 gene locus_tag LOCUS_16530 5456 6967 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334293.1 protein_id gnl|my_center|LOCUS_16530 >Feature sequence135 2030 1260 gene locus_tag LOCUS_16540 2030 1260 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057759.1 protein_id gnl|my_center|LOCUS_16540 2958 2023 gene locus_tag LOCUS_16550 2958 2023 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942147.1 protein_id gnl|my_center|LOCUS_16550 3465 3064 gene locus_tag LOCUS_16560 3465 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 4175 3549 gene locus_tag LOCUS_16570 4175 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 4333 5853 gene locus_tag LOCUS_16580 4333 5853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 >Feature sequence136 <1 1071 gene locus_tag LOCUS_16590 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022007.1:PAS domain-containing protein 1072 2157 gene locus_tag LOCUS_16600 1072 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 2181 4031 gene locus_tag LOCUS_16610 2181 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 4092 4733 gene locus_tag LOCUS_16620 4092 4733 CDS product DUF4433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143359.1 protein_id gnl|my_center|LOCUS_16620 4748 5797 gene locus_tag LOCUS_16630 4748 5797 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071656.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence137 408 1214 gene locus_tag LOCUS_16640 408 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 2033 1215 gene locus_tag LOCUS_16650 2033 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 2152 3111 gene locus_tag LOCUS_16660 gene rsgA 2152 3111 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001073056.1 protein_id gnl|my_center|LOCUS_16660 3111 4043 gene locus_tag LOCUS_16670 3111 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 4405 4730 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq actttggaaacattccagccggaaat 6934 6794 gene locus_tag LOCUS_16680 6934 6794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 >Feature sequence138 1851 2195 gene locus_tag LOCUS_tm00010 1851 2195 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 2363 2605 gene locus_tag LOCUS_16690 2363 2605 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532600.1 protein_id gnl|my_center|LOCUS_16690 3189 2629 gene locus_tag LOCUS_16700 3189 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 3327 3893 gene locus_tag LOCUS_16710 3327 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 3991 5367 gene locus_tag LOCUS_16720 3991 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 5378 6901 gene locus_tag LOCUS_16730 gene gpmI 5378 6901 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_16730 >Feature sequence139 1 1008 gene locus_tag LOCUS_16740 1 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 993 1931 gene locus_tag LOCUS_16750 993 1931 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461526.1 protein_id gnl|my_center|LOCUS_16750 1919 2215 gene locus_tag LOCUS_16760 1919 2215 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034585320.1 protein_id gnl|my_center|LOCUS_16760 2232 3140 gene locus_tag LOCUS_16770 2232 3140 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932009.1 protein_id gnl|my_center|LOCUS_16770 3144 4070 gene locus_tag LOCUS_16780 3144 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 4293 4129 gene locus_tag LOCUS_16790 4293 4129 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670897.1 protein_id gnl|my_center|LOCUS_16790 4479 5867 gene locus_tag LOCUS_16800 4479 5867 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392787.1 protein_id gnl|my_center|LOCUS_16800 5951 6370 gene locus_tag LOCUS_16810 5951 6370 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258723.1 protein_id gnl|my_center|LOCUS_16810 6372 6680 gene locus_tag LOCUS_16820 6372 6680 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258722.1 protein_id gnl|my_center|LOCUS_16820 >Feature sequence140 1610 2569 gene locus_tag LOCUS_16830 1610 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 2603 2791 gene locus_tag LOCUS_16840 2603 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 2793 3260 gene locus_tag LOCUS_16850 2793 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 3257 3712 gene locus_tag LOCUS_16860 3257 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 3709 4977 gene locus_tag LOCUS_16870 3709 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 5280 5846 gene locus_tag LOCUS_16880 5280 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence141 753 157 gene locus_tag LOCUS_16890 753 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 1325 753 gene locus_tag LOCUS_16900 1325 753 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870105.1 protein_id gnl|my_center|LOCUS_16900 1517 1359 gene locus_tag LOCUS_16910 1517 1359 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670545.1 protein_id gnl|my_center|LOCUS_16910 2736 1525 gene locus_tag LOCUS_16920 2736 1525 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940443.1 protein_id gnl|my_center|LOCUS_16920 3257 2748 gene locus_tag LOCUS_16930 3257 2748 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878337.1 protein_id gnl|my_center|LOCUS_16930 3649 3269 gene locus_tag LOCUS_16940 3649 3269 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940441.1 protein_id gnl|my_center|LOCUS_16940 4232 3660 gene locus_tag LOCUS_16950 4232 3660 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762794.1 protein_id gnl|my_center|LOCUS_16950 6016 4469 gene locus_tag LOCUS_16960 6016 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 >Feature sequence142 <1 915 gene locus_tag LOCUS_16970 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891828.1:class I SAM-dependent DNA methyltransferase 908 3031 gene locus_tag LOCUS_16980 908 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 3100 4260 gene locus_tag LOCUS_16990 3100 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 4548 4327 gene locus_tag LOCUS_17000 4548 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17000 4765 4538 gene locus_tag LOCUS_17010 4765 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17010 6219 4786 gene locus_tag LOCUS_17020 6219 4786 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_17020 >Feature sequence143 44 1174 gene locus_tag LOCUS_17030 44 1174 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545564.1 protein_id gnl|my_center|LOCUS_17030 1247 2287 gene locus_tag LOCUS_17040 1247 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 5570 2289 gene locus_tag LOCUS_17050 5570 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 5689 6495 gene locus_tag LOCUS_17060 5689 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 >Feature sequence144 1476 646 gene locus_tag LOCUS_17070 1476 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17070 2072 1473 gene locus_tag LOCUS_17080 gene trmB 2072 1473 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956879.1 protein_id gnl|my_center|LOCUS_17080 2588 2079 gene locus_tag LOCUS_17090 gene hpt 2588 2079 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817255.1 protein_id gnl|my_center|LOCUS_17090 4597 2585 gene locus_tag LOCUS_17100 4597 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 5111 4575 gene locus_tag LOCUS_17110 5111 4575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 6205 5129 gene locus_tag LOCUS_17120 6205 5129 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096064.1 protein_id gnl|my_center|LOCUS_17120 6822 6202 gene locus_tag LOCUS_17130 gene cheD 6822 6202 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072188.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence145 568 2337 gene locus_tag LOCUS_17140 gene recD 568 2337 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932748.1 protein_id gnl|my_center|LOCUS_17140 2451 3353 gene locus_tag LOCUS_17150 2451 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 3372 4811 gene locus_tag LOCUS_17160 3372 4811 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_17160 >Feature sequence146 2244 3218 gene locus_tag LOCUS_17170 2244 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 3241 4530 gene locus_tag LOCUS_17180 3241 4530 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963927.1 protein_id gnl|my_center|LOCUS_17180 4531 5298 gene locus_tag LOCUS_17190 4531 5298 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_17190 5304 6350 gene locus_tag LOCUS_17200 5304 6350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence147 <1 1120 gene locus_tag LOCUS_17210 <1 1120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005902604.1:phosphoglucosamine mutase 1117 1446 gene locus_tag LOCUS_17220 gene acpS 1117 1446 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704569.1 protein_id gnl|my_center|LOCUS_17220 1431 2279 gene locus_tag LOCUS_17230 1431 2279 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012644897.1 protein_id gnl|my_center|LOCUS_17230 2359 3207 gene locus_tag LOCUS_17240 2359 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 4811 3219 gene locus_tag LOCUS_17250 4811 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 5671 4808 gene locus_tag LOCUS_17260 5671 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 <6794 5668 gene locus_tag LOCUS_17270 <6794 5668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937547.1:serine--tRNA ligase >Feature sequence148 1321 878 gene locus_tag LOCUS_17280 1321 878 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208527.1 protein_id gnl|my_center|LOCUS_17280 2800 1334 gene locus_tag LOCUS_17290 2800 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 3046 2879 gene locus_tag LOCUS_17300 3046 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 2988 3722 gene locus_tag LOCUS_17310 2988 3722 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337312.1 protein_id gnl|my_center|LOCUS_17310 3725 4360 gene locus_tag LOCUS_17320 3725 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 4501 5367 gene locus_tag LOCUS_17330 4501 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 >Feature sequence149 1435 401 gene locus_tag LOCUS_17340 1435 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 1659 1450 gene locus_tag LOCUS_17350 1659 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 1791 3311 gene locus_tag LOCUS_17360 1791 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 >Feature sequence150 <1 1686 gene locus_tag LOCUS_17370 <1 1686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000601484.1:DUF1566 domain-containing protein 2294 1692 gene locus_tag LOCUS_17380 2294 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 2456 3505 gene locus_tag LOCUS_17390 2456 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 3349 3448 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4867 3515 gene locus_tag LOCUS_17400 gene pabB 4867 3515 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438631.1 protein_id gnl|my_center|LOCUS_17400 5004 5702 gene locus_tag LOCUS_17410 5004 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 >Feature sequence151 216 1298 gene locus_tag LOCUS_17420 216 1298 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940694.1 protein_id gnl|my_center|LOCUS_17420 1386 2240 gene locus_tag LOCUS_17430 1386 2240 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889131.1 protein_id gnl|my_center|LOCUS_17430 2224 3681 gene locus_tag LOCUS_17440 2224 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 4973 3690 gene locus_tag LOCUS_17450 4973 3690 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243051.1 protein_id gnl|my_center|LOCUS_17450 5104 5988 gene locus_tag LOCUS_17460 5104 5988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 >Feature sequence152 1800 1051 gene locus_tag LOCUS_17470 1800 1051 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941404.1 protein_id gnl|my_center|LOCUS_17470 3294 1816 gene locus_tag LOCUS_17480 3294 1816 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941403.1 protein_id gnl|my_center|LOCUS_17480 4745 3291 gene locus_tag LOCUS_17490 4745 3291 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941402.1 protein_id gnl|my_center|LOCUS_17490 5377 4748 gene locus_tag LOCUS_17500 5377 4748 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941401.1 protein_id gnl|my_center|LOCUS_17500 6312 5386 gene locus_tag LOCUS_17510 6312 5386 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941400.1 protein_id gnl|my_center|LOCUS_17510 >Feature sequence153 1660 446 gene locus_tag LOCUS_17520 1660 446 CDS product IS4-like element ISGsu1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940926.1 protein_id gnl|my_center|LOCUS_17520 1762 1986 gene locus_tag LOCUS_17530 1762 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 3894 1999 gene locus_tag LOCUS_17540 3894 1999 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449670.1 protein_id gnl|my_center|LOCUS_17540 5716 3932 gene locus_tag LOCUS_17550 5716 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 >Feature sequence154 <1 575 gene locus_tag LOCUS_17560 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938460.1:OFA family MFS transporter 648 1250 gene locus_tag LOCUS_17570 648 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 1247 2032 gene locus_tag LOCUS_17580 gene fdhD 1247 2032 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069995213.1 protein_id gnl|my_center|LOCUS_17580 2118 3638 gene locus_tag LOCUS_17590 2118 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 3733 5412 gene locus_tag LOCUS_17600 gene sulP 3733 5412 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937588.1 protein_id gnl|my_center|LOCUS_17600 >Feature sequence155 <1 838 gene locus_tag LOCUS_17610 <1 838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966838.1:ACP S-malonyltransferase 838 1581 gene locus_tag LOCUS_17620 gene fabG 838 1581 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_17620 1619 1855 gene locus_tag LOCUS_17630 gene acpP 1619 1855 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418905.1 protein_id gnl|my_center|LOCUS_17630 1893 3134 gene locus_tag LOCUS_17640 gene fabF 1893 3134 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438103.1 protein_id gnl|my_center|LOCUS_17640 3230 5221 gene locus_tag LOCUS_17650 3230 5221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 6110 5265 gene locus_tag LOCUS_17660 gene rhuM 6110 5265 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201977.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence156 2915 3403 gene locus_tag LOCUS_17670 2915 3403 CDS product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268675.1 protein_id gnl|my_center|LOCUS_17670 3496 3762 gene locus_tag LOCUS_17680 3496 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 3775 5373 gene locus_tag LOCUS_17690 3775 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 <6436 5411 gene locus_tag LOCUS_17700 <6436 5411 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194083.1:class I SAM-dependent RNA methyltransferase >Feature sequence157 1227 2609 gene locus_tag LOCUS_17710 1227 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 2602 3423 gene locus_tag LOCUS_17720 2602 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 3372 4292 gene locus_tag LOCUS_17730 3372 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 5147 4293 gene locus_tag LOCUS_17740 5147 4293 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432043.1 protein_id gnl|my_center|LOCUS_17740 5346 6218 gene locus_tag LOCUS_17750 5346 6218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 >Feature sequence158 230 847 gene locus_tag LOCUS_17760 230 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 850 1449 gene locus_tag LOCUS_17770 gene tmk 850 1449 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867602.1 protein_id gnl|my_center|LOCUS_17770 1449 2729 gene locus_tag LOCUS_17780 gene hisS 1449 2729 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545147.1 protein_id gnl|my_center|LOCUS_17780 2846 4555 gene locus_tag LOCUS_17790 2846 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 >Feature sequence159 1329 463 gene locus_tag LOCUS_17800 gene cdsA 1329 463 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212137.1 protein_id gnl|my_center|LOCUS_17800 2093 1332 gene locus_tag LOCUS_17810 2093 1332 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964194.1 protein_id gnl|my_center|LOCUS_17810 3026 2112 gene locus_tag LOCUS_17820 3026 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 4559 3030 gene locus_tag LOCUS_17830 gene dnaK 4559 3030 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_17830 5135 4572 gene locus_tag LOCUS_17840 gene frr 5135 4572 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071787.1 protein_id gnl|my_center|LOCUS_17840 5866 5156 gene locus_tag LOCUS_17850 gene pyrH 5866 5156 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880427.1 protein_id gnl|my_center|LOCUS_17850 >Feature sequence160 831 157 gene locus_tag LOCUS_17860 831 157 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141840.1 protein_id gnl|my_center|LOCUS_17860 1922 828 gene locus_tag LOCUS_17870 1922 828 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909134.1 protein_id gnl|my_center|LOCUS_17870 2935 2120 gene locus_tag LOCUS_17880 2935 2120 CDS product DUF4349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927507.1 protein_id gnl|my_center|LOCUS_17880 3454 3005 gene locus_tag LOCUS_17890 gene dtd 3454 3005 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941193.1 protein_id gnl|my_center|LOCUS_17890 3557 4876 gene locus_tag LOCUS_17900 3557 4876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 5374 6264 gene locus_tag LOCUS_17910 5374 6264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 >Feature sequence161 >Feature sequence162 1903 1166 gene locus_tag LOCUS_17920 1903 1166 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682279.1 protein_id gnl|my_center|LOCUS_17920 2679 1900 gene locus_tag LOCUS_17930 2679 1900 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 protein_id gnl|my_center|LOCUS_17930 3174 2680 gene locus_tag LOCUS_17940 3174 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 3770 3171 gene locus_tag LOCUS_17950 3770 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 >Feature sequence163 86 418 gene locus_tag LOCUS_17960 86 418 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942865.1 protein_id gnl|my_center|LOCUS_17960 576 1880 gene locus_tag LOCUS_17970 576 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 2256 3578 gene locus_tag LOCUS_17980 2256 3578 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552292.1 protein_id gnl|my_center|LOCUS_17980 3705 4298 gene locus_tag LOCUS_17990 3705 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 4374 4598 gene locus_tag LOCUS_18000 4374 4598 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053694.1 protein_id gnl|my_center|LOCUS_18000 >Feature sequence164 <1 1196 gene locus_tag LOCUS_18010 <1 1196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005478515.1:DUF1538 domain-containing protein 1193 2419 gene locus_tag LOCUS_18020 1193 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 2227 2326 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2628 3002 gene locus_tag LOCUS_18030 2628 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 3058 3432 gene locus_tag LOCUS_18040 3058 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 3533 5191 gene locus_tag LOCUS_18050 3533 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 5864 5199 gene locus_tag LOCUS_18060 5864 5199 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582946.1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence165 92 1165 gene locus_tag LOCUS_18070 gene buk 92 1165 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420702.1 protein_id gnl|my_center|LOCUS_18070 1187 2791 gene locus_tag LOCUS_18080 1187 2791 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766069.1 protein_id gnl|my_center|LOCUS_18080 2803 3384 gene locus_tag LOCUS_18090 2803 3384 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760706.1 protein_id gnl|my_center|LOCUS_18090 3465 3770 gene locus_tag LOCUS_18100 3465 3770 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107149.1 protein_id gnl|my_center|LOCUS_18100 3760 4089 gene locus_tag LOCUS_18110 3760 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 4199 5812 gene locus_tag LOCUS_18120 4199 5812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence166 678 1547 gene locus_tag LOCUS_18130 678 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 1639 1890 gene locus_tag LOCUS_18140 1639 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 1972 3021 gene locus_tag LOCUS_18150 gene corA 1972 3021 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081315.1 protein_id gnl|my_center|LOCUS_18150 3159 3467 gene locus_tag LOCUS_18160 3159 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 3585 4934 gene locus_tag LOCUS_18170 3585 4934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 >Feature sequence167 236 3367 gene locus_tag LOCUS_18180 236 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 3515 3730 gene locus_tag LOCUS_18190 3515 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 3690 4052 gene locus_tag LOCUS_18200 3690 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 4488 4060 gene locus_tag LOCUS_18210 gene rpiB 4488 4060 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080405.1 protein_id gnl|my_center|LOCUS_18210 <6126 4507 gene locus_tag LOCUS_18220 <6126 4507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545360.1:DUF294 nucleotidyltransferase-like domain-containing protein >Feature sequence168 1835 225 gene locus_tag LOCUS_18230 1835 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 1988 3316 gene locus_tag LOCUS_18240 1988 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 3318 4619 gene locus_tag LOCUS_18250 3318 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 4620 5168 gene locus_tag LOCUS_18260 4620 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 5753 5247 gene locus_tag LOCUS_18270 5753 5247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 >Feature sequence169 643 1425 gene locus_tag LOCUS_18280 643 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 2541 1426 gene locus_tag LOCUS_18290 2541 1426 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103855.1 protein_id gnl|my_center|LOCUS_18290 3121 2531 gene locus_tag LOCUS_18300 3121 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 3848 3114 gene locus_tag LOCUS_18310 3848 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 4756 3845 gene locus_tag LOCUS_18320 gene dusB 4756 3845 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941670.1 protein_id gnl|my_center|LOCUS_18320 4930 5250 gene locus_tag LOCUS_18330 4930 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 >Feature sequence170 1094 2278 gene locus_tag LOCUS_18340 1094 2278 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234976.1 protein_id gnl|my_center|LOCUS_18340 2318 2977 gene locus_tag LOCUS_18350 2318 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 3110 3670 gene locus_tag LOCUS_18360 3110 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 3688 3909 gene locus_tag LOCUS_18370 3688 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 5243 3912 gene locus_tag LOCUS_18380 5243 3912 CDS product putative glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797038.1 protein_id gnl|my_center|LOCUS_18380 >Feature sequence171 983 1753 gene locus_tag LOCUS_18390 983 1753 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992443.1 protein_id gnl|my_center|LOCUS_18390 1750 2286 gene locus_tag LOCUS_18400 1750 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 2393 2947 gene locus_tag LOCUS_18410 2393 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 4280 2925 gene locus_tag LOCUS_18420 4280 2925 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896573.1 protein_id gnl|my_center|LOCUS_18420 4458 5429 gene locus_tag LOCUS_18430 4458 5429 CDS product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409666.1 protein_id gnl|my_center|LOCUS_18430 >Feature sequence172 1485 2804 gene locus_tag LOCUS_18440 1485 2804 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_18440 2910 3128 gene locus_tag LOCUS_18450 gene rpmE 2910 3128 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003027123.1 protein_id gnl|my_center|LOCUS_18450 3201 4310 gene locus_tag LOCUS_18460 gene prfA 3201 4310 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019960.1 protein_id gnl|my_center|LOCUS_18460 4291 5139 gene locus_tag LOCUS_18470 gene prmC 4291 5139 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437849.1 protein_id gnl|my_center|LOCUS_18470 5599 5120 gene locus_tag LOCUS_18480 5599 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 >Feature sequence173 1254 133 gene locus_tag LOCUS_18490 1254 133 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459608.1 protein_id gnl|my_center|LOCUS_18490 2594 1347 gene locus_tag LOCUS_18500 2594 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 3243 2560 gene locus_tag LOCUS_18510 3243 2560 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482754.1 protein_id gnl|my_center|LOCUS_18510 4482 3259 gene locus_tag LOCUS_18520 4482 3259 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_18520 5723 4494 gene locus_tag LOCUS_18530 5723 4494 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095708.1 protein_id gnl|my_center|LOCUS_18530 >Feature sequence174 4814 651 gene locus_tag LOCUS_18540 4814 651 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924811.1 protein_id gnl|my_center|LOCUS_18540 4973 5287 gene locus_tag LOCUS_18550 4973 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 5767 5306 gene locus_tag LOCUS_18560 gene bcp 5767 5306 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854561.1 protein_id gnl|my_center|LOCUS_18560 >Feature sequence175 2172 2903 gene locus_tag LOCUS_18570 2172 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 2921 4069 gene locus_tag LOCUS_18580 2921 4069 CDS product DUF2891 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096575.1 protein_id gnl|my_center|LOCUS_18580 4609 4070 gene locus_tag LOCUS_18590 4609 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 <5826 4609 gene locus_tag LOCUS_18600 <5826 4609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004399303.1:D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase >Feature sequence176 2910 2608 gene locus_tag LOCUS_18610 2910 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 3823 3014 gene locus_tag LOCUS_18620 3823 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 4046 5422 gene locus_tag LOCUS_18630 gene bioA 4046 5422 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964671.1 protein_id gnl|my_center|LOCUS_18630 >Feature sequence177 785 192 gene locus_tag LOCUS_18640 785 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 1252 827 gene locus_tag LOCUS_18650 1252 827 CDS product pyrimidine dimer DNA glycosylase/endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152268637.1 protein_id gnl|my_center|LOCUS_18650 1356 4433 gene locus_tag LOCUS_18660 1356 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 4445 5524 gene locus_tag LOCUS_18670 4445 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 >Feature sequence178 916 119 gene locus_tag LOCUS_18680 916 119 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546330.1 protein_id gnl|my_center|LOCUS_18680 2412 916 gene locus_tag LOCUS_18690 2412 916 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932252.1 protein_id gnl|my_center|LOCUS_18690 3289 2414 gene locus_tag LOCUS_18700 3289 2414 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428573.1 protein_id gnl|my_center|LOCUS_18700 4725 3403 gene locus_tag LOCUS_18710 4725 3403 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879180.1 protein_id gnl|my_center|LOCUS_18710 5535 4729 gene locus_tag LOCUS_18720 5535 4729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18720 >Feature sequence179 3 206 gene locus_tag LOCUS_18730 3 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 210 629 gene locus_tag LOCUS_18740 210 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 1218 1823 gene locus_tag LOCUS_18750 1218 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 2026 3561 gene locus_tag LOCUS_18760 2026 3561 CDS product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964377.1 protein_id gnl|my_center|LOCUS_18760 3569 4297 gene locus_tag LOCUS_18770 gene fabG 3569 4297 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964375.1 protein_id gnl|my_center|LOCUS_18770 4313 5536 gene locus_tag LOCUS_18780 4313 5536 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964374.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence180 <1 731 gene locus_tag LOCUS_18790 <1 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964347.1:DUF2062 domain-containing protein 733 4614 gene locus_tag LOCUS_18800 733 4614 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964346.1 protein_id gnl|my_center|LOCUS_18800 >Feature sequence181 892 1221 gene locus_tag LOCUS_18810 892 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 1269 2222 gene locus_tag LOCUS_18820 1269 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 2219 2893 gene locus_tag LOCUS_18830 gene queC 2219 2893 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111415.1 protein_id gnl|my_center|LOCUS_18830 2945 4447 gene locus_tag LOCUS_18840 2945 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 >Feature sequence182 692 5146 gene locus_tag LOCUS_18850 692 5146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 >Feature sequence183 1493 186 gene locus_tag LOCUS_18860 gene rimO 1493 186 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082413.1 protein_id gnl|my_center|LOCUS_18860 2189 1497 gene locus_tag LOCUS_18870 2189 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 3057 2176 gene locus_tag LOCUS_18880 gene lgt 3057 2176 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014411631.1 protein_id gnl|my_center|LOCUS_18880 4165 3077 gene locus_tag LOCUS_18890 4165 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 5324 4203 gene locus_tag LOCUS_18900 gene prfB 5324 4203 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence184 >Feature sequence185 1032 1388 gene locus_tag LOCUS_18910 1032 1388 CDS product DsrE/DsrF/TusD sulfur relay family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870503.1 protein_id gnl|my_center|LOCUS_18910 3000 1414 gene locus_tag LOCUS_18920 3000 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 <5403 3093 gene locus_tag LOCUS_18930 <5403 3093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056556.1:pentapeptide repeat-containing protein >Feature sequence186 2006 783 gene locus_tag LOCUS_18940 2006 783 CDS product IS256-like element ISSod18 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071025.1 protein_id gnl|my_center|LOCUS_18940 3297 2077 gene locus_tag LOCUS_18950 3297 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 3706 3410 gene locus_tag LOCUS_18960 3706 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 5296 3716 gene locus_tag LOCUS_18970 5296 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 >Feature sequence187 1649 2563 gene locus_tag LOCUS_18980 1649 2563 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020082.1 protein_id gnl|my_center|LOCUS_18980 2547 3278 gene locus_tag LOCUS_18990 2547 3278 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933759.1 protein_id gnl|my_center|LOCUS_18990 3279 4103 gene locus_tag LOCUS_19000 3279 4103 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927154.1 protein_id gnl|my_center|LOCUS_19000 >Feature sequence188 721 8 gene locus_tag LOCUS_19010 721 8 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207920.1 protein_id gnl|my_center|LOCUS_19010 1416 733 gene locus_tag LOCUS_19020 1416 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 3145 1421 gene locus_tag LOCUS_19030 3145 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 5073 3169 gene locus_tag LOCUS_19040 5073 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 >Feature sequence189 324 626 gene locus_tag LOCUS_19050 324 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 672 3383 gene locus_tag LOCUS_19060 gene secA 672 3383 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942693.1 protein_id gnl|my_center|LOCUS_19060 3376 4110 gene locus_tag LOCUS_19070 3376 4110 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921919.1 protein_id gnl|my_center|LOCUS_19070 >Feature sequence190 276 584 gene locus_tag LOCUS_19080 276 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 768 2768 gene locus_tag LOCUS_19090 768 2768 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140584.1 protein_id gnl|my_center|LOCUS_19090 2779 3351 gene locus_tag LOCUS_19100 2779 3351 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785730.1 protein_id gnl|my_center|LOCUS_19100 <5200 3348 gene locus_tag LOCUS_19110 <5200 3348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022493.1:PQQ-binding-like beta-propeller repeat protein >Feature sequence191 941 1597 gene locus_tag LOCUS_19120 941 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 1588 1664 gene locus_tag LOCUS_t00300 1588 1664 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1834 2136 gene locus_tag LOCUS_19130 1834 2136 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173405.1 protein_id gnl|my_center|LOCUS_19130 2199 2381 gene locus_tag LOCUS_19140 2199 2381 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965947.1 protein_id gnl|my_center|LOCUS_19140 2438 3772 gene locus_tag LOCUS_19150 2438 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 3769 4860 gene locus_tag LOCUS_19160 3769 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 >Feature sequence192 3132 334 gene locus_tag LOCUS_19170 3132 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 4533 3133 gene locus_tag LOCUS_19180 4533 3133 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065307.1 protein_id gnl|my_center|LOCUS_19180 4907 4533 gene locus_tag LOCUS_19190 4907 4533 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119424.1 protein_id gnl|my_center|LOCUS_19190 >Feature sequence193 3484 2900 gene locus_tag LOCUS_19200 gene recR 3484 2900 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582670.1 protein_id gnl|my_center|LOCUS_19200 3802 3491 gene locus_tag LOCUS_19210 3802 3491 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_19210 4279 3965 gene locus_tag LOCUS_19220 4279 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 4607 4293 gene locus_tag LOCUS_19230 4607 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 >Feature sequence194 1087 194 gene locus_tag LOCUS_19240 1087 194 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_19240 2137 1109 gene locus_tag LOCUS_19250 2137 1109 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667047.1 protein_id gnl|my_center|LOCUS_19250 2298 2765 gene locus_tag LOCUS_19260 2298 2765 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083188.1 protein_id gnl|my_center|LOCUS_19260 >Feature sequence195 <1 2653 gene locus_tag LOCUS_19270 <1 2653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948432.1:excinuclease ABC subunit UvrA 3608 2646 gene locus_tag LOCUS_19280 3608 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 >Feature sequence196 157 2628 gene locus_tag LOCUS_19290 157 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 3296 4867 gene locus_tag LOCUS_19300 3296 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 >Feature sequence197 >Feature sequence198 248 2128 gene locus_tag LOCUS_19310 248 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 2266 2964 gene locus_tag LOCUS_19320 gene pyrF 2266 2964 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705694.1 protein_id gnl|my_center|LOCUS_19320 3040 3882 gene locus_tag LOCUS_19330 gene speD 3040 3882 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461599.1 protein_id gnl|my_center|LOCUS_19330 4016 4405 gene locus_tag LOCUS_19340 4016 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 >Feature sequence199 158 2428 gene locus_tag LOCUS_19350 158 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 2955 3054 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3448 3714 gene locus_tag LOCUS_19360 3448 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 3711 4916 gene locus_tag LOCUS_19370 3711 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 >Feature sequence200 104 1645 gene locus_tag LOCUS_19380 104 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 1626 2339 gene locus_tag LOCUS_19390 1626 2339 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228142.1 protein_id gnl|my_center|LOCUS_19390 3426 2317 gene locus_tag LOCUS_19400 gene rlmD 3426 2317 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_19400 3962 3423 gene locus_tag LOCUS_19410 gene nudF 3962 3423 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398600.1 protein_id gnl|my_center|LOCUS_19410 >Feature sequence201 2157 133 gene locus_tag LOCUS_19420 2157 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 3158 2202 gene locus_tag LOCUS_19430 3158 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 >Feature sequence202 1442 264 gene locus_tag LOCUS_19440 1442 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 3202 1454 gene locus_tag LOCUS_19450 3202 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 3735 3199 gene locus_tag LOCUS_19460 gene resA 3735 3199 CDS product thiol-disulfide oxidoreductase ResA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230513.1 protein_id gnl|my_center|LOCUS_19460 4577 3753 gene locus_tag LOCUS_19470 4577 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 >Feature sequence203 405 719 gene locus_tag LOCUS_19480 gene clpS 405 719 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440419.1 protein_id gnl|my_center|LOCUS_19480 723 2978 gene locus_tag LOCUS_19490 gene clpA 723 2978 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965130.1 protein_id gnl|my_center|LOCUS_19490 2975 3679 gene locus_tag LOCUS_19500 gene aat 2975 3679 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113368.1 protein_id gnl|my_center|LOCUS_19500 >Feature sequence204 2435 711 gene locus_tag LOCUS_19510 2435 711 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627741.1 protein_id gnl|my_center|LOCUS_19510 2657 3379 gene locus_tag LOCUS_19520 2657 3379 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903362.1 protein_id gnl|my_center|LOCUS_19520 4289 3384 gene locus_tag LOCUS_19530 4289 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 >Feature sequence205 927 2027 gene locus_tag LOCUS_19540 gene tgt 927 2027 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_19540 2046 3521 gene locus_tag LOCUS_19550 gene glgA 2046 3521 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679256.1 protein_id gnl|my_center|LOCUS_19550 3518 3940 gene locus_tag LOCUS_19560 3518 3940 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957957.1 protein_id gnl|my_center|LOCUS_19560 3933 4223 gene locus_tag LOCUS_19570 3933 4223 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693849.1 protein_id gnl|my_center|LOCUS_19570 4508 4278 gene locus_tag LOCUS_19580 4508 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 >Feature sequence206 4394 984 gene locus_tag LOCUS_19590 4394 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 >Feature sequence207 186 1214 gene locus_tag LOCUS_19600 186 1214 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989632.1 protein_id gnl|my_center|LOCUS_19600 1226 3274 gene locus_tag LOCUS_19610 1226 3274 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963494.1 protein_id gnl|my_center|LOCUS_19610 3445 3714 gene locus_tag LOCUS_19620 3445 3714 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_19620 3719 3940 gene locus_tag LOCUS_19630 3719 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 4180 4713 gene locus_tag LOCUS_19640 4180 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 >Feature sequence208 204 884 gene locus_tag LOCUS_19650 204 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 930 1667 gene locus_tag LOCUS_19660 930 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 1711 3468 gene locus_tag LOCUS_19670 gene aspS 1711 3468 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454140.1 protein_id gnl|my_center|LOCUS_19670 3455 4495 gene locus_tag LOCUS_19680 3455 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 >Feature sequence209 930 1250 gene locus_tag LOCUS_19690 930 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 1310 2617 gene locus_tag LOCUS_19700 1310 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 2614 3078 gene locus_tag LOCUS_19710 2614 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 <4678 3185 gene locus_tag LOCUS_19720 <4678 3185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235045002.1:PAS domain S-box protein >Feature sequence210 1483 791 gene locus_tag LOCUS_19730 1483 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 1690 2631 gene locus_tag LOCUS_19740 1690 2631 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742066.1 protein_id gnl|my_center|LOCUS_19740 2916 2701 gene locus_tag LOCUS_19750 2916 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 3577 2996 gene locus_tag LOCUS_19760 3577 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403820.1 protein_id gnl|my_center|LOCUS_19760 <4666 3654 gene locus_tag LOCUS_19770 <4666 3654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164996215.1:RNA-directed DNA polymerase >Feature sequence211 2876 411 gene locus_tag LOCUS_19780 2876 411 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626185.1 protein_id gnl|my_center|LOCUS_19780 3951 2914 gene locus_tag LOCUS_19790 3951 2914 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257479.1 protein_id gnl|my_center|LOCUS_19790 <4656 3964 gene locus_tag LOCUS_19800 <4656 3964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861057.1:decaprenyl-phosphate phosphoribosyltransferase >Feature sequence212 444 2261 gene locus_tag LOCUS_19810 444 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 4087 2258 gene locus_tag LOCUS_19820 4087 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 >Feature sequence213 <1 1138 gene locus_tag LOCUS_19830 <1 1138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002212197.1:multifunctional CCA addition/repair protein 1200 2060 gene locus_tag LOCUS_19840 1200 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 2073 2648 gene locus_tag LOCUS_19850 2073 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 2730 3533 gene locus_tag LOCUS_19860 2730 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 4063 3539 gene locus_tag LOCUS_19870 4063 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 >Feature sequence214 191 388 gene locus_tag LOCUS_19880 191 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 388 1098 gene locus_tag LOCUS_19890 388 1098 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656688.1 protein_id gnl|my_center|LOCUS_19890 1098 1898 gene locus_tag LOCUS_19900 1098 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 3105 3893 gene locus_tag LOCUS_19910 3105 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 >Feature sequence215 414 76 gene locus_tag LOCUS_19920 414 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 880 440 gene locus_tag LOCUS_19930 880 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 1022 1402 gene locus_tag LOCUS_19940 1022 1402 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583691.1 protein_id gnl|my_center|LOCUS_19940 1421 2599 gene locus_tag LOCUS_19950 1421 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 3239 2571 gene locus_tag LOCUS_19960 gene rpe 3239 2571 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_19960 <4538 3236 gene locus_tag LOCUS_19970 <4538 3236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004440956.1:16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB >Feature sequence216 3822 1087 gene locus_tag LOCUS_19980 3822 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479899.1 protein_id gnl|my_center|LOCUS_19980 >Feature sequence217 199 495 gene locus_tag LOCUS_19990 199 495 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759700.1 protein_id gnl|my_center|LOCUS_19990 488 865 gene locus_tag LOCUS_20000 488 865 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_20000 1768 866 gene locus_tag LOCUS_20010 1768 866 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_20010 1931 3133 gene locus_tag LOCUS_20020 1931 3133 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956840.1 protein_id gnl|my_center|LOCUS_20020 3946 3140 gene locus_tag LOCUS_20030 gene zupT 3946 3140 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861091.1 protein_id gnl|my_center|LOCUS_20030 >Feature sequence218 494 138 gene locus_tag LOCUS_20040 494 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 1115 561 gene locus_tag LOCUS_20050 1115 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 1896 1108 gene locus_tag LOCUS_20060 1896 1108 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903173.1 protein_id gnl|my_center|LOCUS_20060 2382 1897 gene locus_tag LOCUS_20070 2382 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 3212 2382 gene locus_tag LOCUS_20080 3212 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 3728 3216 gene locus_tag LOCUS_20090 3728 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 >Feature sequence219 183 1340 gene locus_tag LOCUS_20100 183 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 1571 2140 gene locus_tag LOCUS_20110 1571 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 2143 3009 gene locus_tag LOCUS_20120 2143 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 >Feature sequence220 71 313 gene locus_tag LOCUS_20130 71 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 326 787 gene locus_tag LOCUS_20140 326 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 784 1050 gene locus_tag LOCUS_20150 784 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 1983 1264 gene locus_tag LOCUS_20160 1983 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 2661 2035 gene locus_tag LOCUS_20170 2661 2035 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986882.1 protein_id gnl|my_center|LOCUS_20170 4014 2671 gene locus_tag LOCUS_20180 4014 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 >Feature sequence221 1636 245 gene locus_tag LOCUS_20190 1636 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 2490 1633 gene locus_tag LOCUS_20200 gene lipA 2490 1633 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393263.1 protein_id gnl|my_center|LOCUS_20200 3664 2483 gene locus_tag LOCUS_20210 gene thiI 3664 2483 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391742.1 protein_id gnl|my_center|LOCUS_20210 3848 3714 gene locus_tag LOCUS_20220 3848 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 >Feature sequence222 1540 395 gene locus_tag LOCUS_20230 gene pgsW 1540 395 CDS product poly-gamma-glutamate system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078607.1 protein_id gnl|my_center|LOCUS_20230 1995 1540 gene locus_tag LOCUS_20240 gene pgsC 1995 1540 CDS product poly-gamma-glutamate biosynthesis protein PgsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016687.1 protein_id gnl|my_center|LOCUS_20240 3189 1999 gene locus_tag LOCUS_20250 gene pgsB 3189 1999 CDS product poly-gamma-glutamate synthase PgsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118210.1 protein_id gnl|my_center|LOCUS_20250 3322 4203 gene locus_tag LOCUS_20260 3322 4203 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942309.1 protein_id gnl|my_center|LOCUS_20260 >Feature sequence223 <1 630 gene locus_tag LOCUS_20270 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250169.1:respiratory chain complex I subunit 1 family protein 635 1276 gene locus_tag LOCUS_20280 635 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 1285 1818 gene locus_tag LOCUS_20290 1285 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 1820 2998 gene locus_tag LOCUS_20300 1820 2998 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146623.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence224 224 787 gene locus_tag LOCUS_20310 224 787 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393343.1 protein_id gnl|my_center|LOCUS_20310 822 1397 gene locus_tag LOCUS_20320 822 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 1390 1665 gene locus_tag LOCUS_20330 1390 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 1616 2632 gene locus_tag LOCUS_20340 1616 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 2724 3074 gene locus_tag LOCUS_20350 2724 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 3137 3688 gene locus_tag LOCUS_20360 3137 3688 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205219106.1 protein_id gnl|my_center|LOCUS_20360 3794 4396 gene locus_tag LOCUS_20370 3794 4396 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166986.1 protein_id gnl|my_center|LOCUS_20370 >Feature sequence225 4312 860 gene locus_tag LOCUS_20380 4312 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 1271 1370 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence226 <1 1141 gene locus_tag LOCUS_20390 <1 1141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869551.1:aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein 1147 1353 gene locus_tag LOCUS_20400 1147 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 1355 1636 gene locus_tag LOCUS_20410 1355 1636 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087375.1 protein_id gnl|my_center|LOCUS_20410 1788 2462 gene locus_tag LOCUS_20420 1788 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 >Feature sequence227 452 267 gene locus_tag LOCUS_20430 452 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 1600 449 gene locus_tag LOCUS_20440 1600 449 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257682.1 protein_id gnl|my_center|LOCUS_20440 2784 1705 gene locus_tag LOCUS_20450 2784 1705 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_20450 3064 2795 gene locus_tag LOCUS_20460 3064 2795 CDS product killer suppression protein HigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387766.1 protein_id gnl|my_center|LOCUS_20460 4014 3331 gene locus_tag LOCUS_20470 4014 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 >Feature sequence228 1412 6 gene locus_tag LOCUS_20480 1412 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 3197 1494 gene locus_tag LOCUS_20490 3197 1494 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108558166.1 protein_id gnl|my_center|LOCUS_20490 3477 4169 gene locus_tag LOCUS_20500 3477 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 >Feature sequence229 2926 1310 gene locus_tag LOCUS_20510 2926 1310 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037435202.1 protein_id gnl|my_center|LOCUS_20510 <4269 2934 gene locus_tag LOCUS_20520 <4269 2934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921441.1:cadherin domain-containing protein >Feature sequence230 1620 622 gene locus_tag LOCUS_20530 1620 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 2905 1682 gene locus_tag LOCUS_20540 2905 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 3543 2920 gene locus_tag LOCUS_20550 3543 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 3669 3745 gene locus_tag LOCUS_t00310 3669 3745 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence231 1891 815 gene locus_tag LOCUS_20560 1891 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 2029 2391 gene locus_tag LOCUS_20570 2029 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 3871 2651 gene locus_tag LOCUS_20580 3871 2651 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481619.1 protein_id gnl|my_center|LOCUS_20580 >Feature sequence232 806 1513 gene locus_tag LOCUS_20590 806 1513 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167939808.1 protein_id gnl|my_center|LOCUS_20590 2668 1517 gene locus_tag LOCUS_20600 2668 1517 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644929.1 protein_id gnl|my_center|LOCUS_20600 4099 2753 gene locus_tag LOCUS_20610 gene orpR 4099 2753 CDS product sigma 54-interacting transcriptional regulator OrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 protein_id gnl|my_center|LOCUS_20610 >Feature sequence233 954 145 gene locus_tag LOCUS_20620 954 145 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_20620 3868 1043 gene locus_tag LOCUS_20630 3868 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 >Feature sequence234 1738 35 gene locus_tag LOCUS_20640 1738 35 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789707.1 protein_id gnl|my_center|LOCUS_20640 2734 1739 gene locus_tag LOCUS_20650 2734 1739 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763251.1 protein_id gnl|my_center|LOCUS_20650 3591 2731 gene locus_tag LOCUS_20660 3591 2731 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763252.1 protein_id gnl|my_center|LOCUS_20660 >Feature sequence235 2228 2644 gene locus_tag LOCUS_20670 2228 2644 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081009.1 protein_id gnl|my_center|LOCUS_20670 3342 2650 gene locus_tag LOCUS_20680 3342 2650 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880129.1 protein_id gnl|my_center|LOCUS_20680 <4067 3355 gene locus_tag LOCUS_20690 <4067 3355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080781.1:hemolysin family protein >Feature sequence236 1981 3867 gene locus_tag LOCUS_20700 1981 3867 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924872.1 protein_id gnl|my_center|LOCUS_20700 >Feature sequence237 79 612 gene locus_tag LOCUS_20710 79 612 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478721.1 protein_id gnl|my_center|LOCUS_20710 1187 618 gene locus_tag LOCUS_20720 1187 618 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687796.1 protein_id gnl|my_center|LOCUS_20720 1245 1344 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1474 1659 gene locus_tag LOCUS_20730 1474 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 1776 2621 gene locus_tag LOCUS_20740 1776 2621 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_20740 >Feature sequence238 1798 950 gene locus_tag LOCUS_20750 1798 950 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_20750 2859 2032 gene locus_tag LOCUS_20760 2859 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 3905 2907 gene locus_tag LOCUS_20770 3905 2907 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681377.1 protein_id gnl|my_center|LOCUS_20770 >Feature sequence239 2529 175 gene locus_tag LOCUS_20780 2529 175 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942922.1 protein_id gnl|my_center|LOCUS_20780 3288 2599 gene locus_tag LOCUS_20790 3288 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 3367 3291 gene locus_tag LOCUS_t00320 3367 3291 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence240 311 571 gene locus_tag LOCUS_20800 311 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 969 595 gene locus_tag LOCUS_20810 969 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 1180 1279 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2465 1692 gene locus_tag LOCUS_20820 2465 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 >Feature sequence241 220 906 gene locus_tag LOCUS_20830 220 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 918 1601 gene locus_tag LOCUS_20840 918 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 1610 3322 gene locus_tag LOCUS_20850 1610 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 3960 3331 gene locus_tag LOCUS_20860 3960 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 >Feature sequence242 105 329 gene locus_tag LOCUS_20870 105 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 1074 310 gene locus_tag LOCUS_20880 1074 310 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583102.1 protein_id gnl|my_center|LOCUS_20880 1166 3148 gene locus_tag LOCUS_20890 1166 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 >Feature sequence243 233 568 gene locus_tag LOCUS_20900 233 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 561 905 gene locus_tag LOCUS_20910 561 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 921 1850 gene locus_tag LOCUS_20920 gene trxB 921 1850 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583127.1 protein_id gnl|my_center|LOCUS_20920 3861 1864 gene locus_tag LOCUS_20930 3861 1864 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787253.1 protein_id gnl|my_center|LOCUS_20930 >Feature sequence244 114 2528 gene locus_tag LOCUS_20940 114 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 3386 2541 gene locus_tag LOCUS_20950 3386 2541 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477139.1 protein_id gnl|my_center|LOCUS_20950 3642 3367 gene locus_tag LOCUS_20960 3642 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 >Feature sequence245 <1 832 gene locus_tag LOCUS_20970 <1 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545970.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB 822 1604 gene locus_tag LOCUS_20980 822 1604 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546049.1 protein_id gnl|my_center|LOCUS_20980 1685 3712 gene locus_tag LOCUS_20990 1685 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 >Feature sequence246 866 285 gene locus_tag LOCUS_21000 866 285 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022892.1 protein_id gnl|my_center|LOCUS_21000 1093 2112 gene locus_tag LOCUS_21010 1093 2112 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_21010 2134 3132 gene locus_tag LOCUS_21020 gene gap 2134 3132 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942274.1 protein_id gnl|my_center|LOCUS_21020 >Feature sequence247 307 3087 gene locus_tag LOCUS_21030 gene uvrA 307 3087 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583250.1 protein_id gnl|my_center|LOCUS_21030 >Feature sequence248 2217 3533 gene locus_tag LOCUS_21040 2217 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 >Feature sequence249 2143 887 gene locus_tag LOCUS_21050 2143 887 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_21050 2585 2151 gene locus_tag LOCUS_21060 2585 2151 CDS product ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871651.1 protein_id gnl|my_center|LOCUS_21060 >Feature sequence250 383 1711 gene locus_tag LOCUS_21070 383 1711 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896573.1 protein_id gnl|my_center|LOCUS_21070 1795 2817 gene locus_tag LOCUS_21080 1795 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 3760 2825 gene locus_tag LOCUS_21090 3760 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 >Feature sequence251 2362 1370 gene locus_tag LOCUS_21100 gene pta 2362 1370 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_21100 3442 2456 gene locus_tag LOCUS_21110 3442 2456 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203072.1 protein_id gnl|my_center|LOCUS_21110 >Feature sequence252 1003 827 gene locus_tag LOCUS_21120 1003 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 1881 1000 gene locus_tag LOCUS_21130 1881 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21130 2180 1878 gene locus_tag LOCUS_21140 2180 1878 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069253.1 protein_id gnl|my_center|LOCUS_21140 2347 2748 gene locus_tag LOCUS_21150 2347 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 <3731 2761 gene locus_tag LOCUS_21160 <3731 2761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546259.1:galactose-1-phosphate uridylyltransferase >Feature sequence253 1803 160 gene locus_tag LOCUS_21170 gene groL 1803 160 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_21170 2120 1833 gene locus_tag LOCUS_21180 gene groES 2120 1833 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006583188.1 protein_id gnl|my_center|LOCUS_21180 <3727 2289 gene locus_tag LOCUS_21190 <3727 2289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941906.1:choice-of-anchor D domain-containing protein >Feature sequence254 156 1541 gene locus_tag LOCUS_21200 156 1541 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107821.1 protein_id gnl|my_center|LOCUS_21200 >Feature sequence255 1 843 gene locus_tag LOCUS_21210 1 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 1831 845 gene locus_tag LOCUS_21220 1831 845 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932715.1 protein_id gnl|my_center|LOCUS_21220 2449 1943 gene locus_tag LOCUS_21230 2449 1943 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880795.1 protein_id gnl|my_center|LOCUS_21230 3316 2528 gene locus_tag LOCUS_21240 3316 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 3431 3517 gene locus_tag LOCUS_t00330 3431 3517 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence256 1429 71 gene locus_tag LOCUS_21250 gene secY 1429 71 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545307.1 protein_id gnl|my_center|LOCUS_21250 1885 1445 gene locus_tag LOCUS_21260 gene rplO 1885 1445 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546521.1 protein_id gnl|my_center|LOCUS_21260 2084 1902 gene locus_tag LOCUS_21270 gene rpmD 2084 1902 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938616.1 protein_id gnl|my_center|LOCUS_21270 2605 2093 gene locus_tag LOCUS_21280 gene rpsE 2605 2093 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331210.1 protein_id gnl|my_center|LOCUS_21280 2996 2628 gene locus_tag LOCUS_21290 gene rplR 2996 2628 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166897.1 protein_id gnl|my_center|LOCUS_21290 3541 2996 gene locus_tag LOCUS_21300 gene rplF 3541 2996 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974253.1 protein_id gnl|my_center|LOCUS_21300 >Feature sequence257 81 935 gene locus_tag LOCUS_21310 gene speB 81 935 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808139.1 protein_id gnl|my_center|LOCUS_21310 >Feature sequence258 2110 1415 gene locus_tag LOCUS_21320 2110 1415 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966938.1 protein_id gnl|my_center|LOCUS_21320 3216 2107 gene locus_tag LOCUS_21330 3216 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 >Feature sequence259 1537 359 gene locus_tag LOCUS_21340 1537 359 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107783.1 protein_id gnl|my_center|LOCUS_21340 1774 2595 gene locus_tag LOCUS_21350 1774 2595 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867167.1 protein_id gnl|my_center|LOCUS_21350 2592 3395 gene locus_tag LOCUS_21360 2592 3395 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013747453.1 protein_id gnl|my_center|LOCUS_21360 >Feature sequence260 85 1011 gene locus_tag LOCUS_21370 85 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 1012 1584 gene locus_tag LOCUS_21380 1012 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 2323 1616 gene locus_tag LOCUS_21390 2323 1616 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962337.1 protein_id gnl|my_center|LOCUS_21390 2850 2338 gene locus_tag LOCUS_21400 gene tpx 2850 2338 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938524.1 protein_id gnl|my_center|LOCUS_21400 3512 2976 gene locus_tag LOCUS_21410 3512 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 >Feature sequence261 80 1195 gene locus_tag LOCUS_21420 80 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 1287 2126 gene locus_tag LOCUS_21430 gene rhuM 1287 2126 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648596.1 protein_id gnl|my_center|LOCUS_21430 2270 3391 gene locus_tag LOCUS_21440 2270 3391 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_21440 >Feature sequence262 860 96 gene locus_tag LOCUS_21450 gene istB 860 96 CDS product IS21-like element ISBj11 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018270204.1 protein_id gnl|my_center|LOCUS_21450 2332 857 gene locus_tag LOCUS_21460 gene istA 2332 857 CDS product IS21-like element ISBj11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084518.1 protein_id gnl|my_center|LOCUS_21460 2524 2396 gene locus_tag LOCUS_21470 2524 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 <3497 2524 gene locus_tag LOCUS_21480 <3497 2524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_179297780.1:RHS repeat-associated core domain-containing protein >Feature sequence263 219 1655 gene locus_tag LOCUS_21490 219 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 1687 3459 gene locus_tag LOCUS_21500 1687 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 >Feature sequence264 1279 104 gene locus_tag LOCUS_21510 1279 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 1474 1352 gene locus_tag LOCUS_21520 1474 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 3042 1474 gene locus_tag LOCUS_21530 3042 1474 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938997.1 protein_id gnl|my_center|LOCUS_21530 >Feature sequence265 3189 973 gene locus_tag LOCUS_21540 3189 973 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_21540 >Feature sequence266 540 196 gene locus_tag LOCUS_21550 540 196 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_21550 766 527 gene locus_tag LOCUS_21560 766 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 1255 827 gene locus_tag LOCUS_21570 1255 827 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_21570 2307 1252 gene locus_tag LOCUS_21580 gene arsB 2307 1252 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462028.1 protein_id gnl|my_center|LOCUS_21580 2672 2319 gene locus_tag LOCUS_21590 2672 2319 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462029.1 protein_id gnl|my_center|LOCUS_21590 2949 2686 gene locus_tag LOCUS_21600 gene hgcB 2949 2686 CDS product mercury methylation ferredoxin HgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942087.1 protein_id gnl|my_center|LOCUS_21600 >Feature sequence267 <1 786 gene locus_tag LOCUS_21610 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868514.1:nitrilase >Feature sequence268 1091 237 gene locus_tag LOCUS_21620 1091 237 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680889.1 protein_id gnl|my_center|LOCUS_21620 2741 1110 gene locus_tag LOCUS_21630 2741 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 >Feature sequence269 1208 735 gene locus_tag LOCUS_21640 gene greA 1208 735 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383382.1 protein_id gnl|my_center|LOCUS_21640 2250 1282 gene locus_tag LOCUS_21650 2250 1282 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256438.1 protein_id gnl|my_center|LOCUS_21650 2986 2237 gene locus_tag LOCUS_21660 2986 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 >Feature sequence270 <1 961 gene locus_tag LOCUS_21670 <1 961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109306.1:PDDEXK nuclease domain-containing protein 958 1698 gene locus_tag LOCUS_21680 958 1698 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390199.1 protein_id gnl|my_center|LOCUS_21680 1720 3237 gene locus_tag LOCUS_21690 1720 3237 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357216.1 protein_id gnl|my_center|LOCUS_21690 >Feature sequence271 1186 593 gene locus_tag LOCUS_21700 1186 593 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964030.1 protein_id gnl|my_center|LOCUS_21700 2903 1176 gene locus_tag LOCUS_21710 2903 1176 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence272 >Feature sequence273 1279 527 gene locus_tag LOCUS_21720 1279 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 2238 1273 gene locus_tag LOCUS_21730 2238 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 2978 2319 gene locus_tag LOCUS_21740 2978 2319 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256674.1 protein_id gnl|my_center|LOCUS_21740 >Feature sequence274 169 969 gene locus_tag LOCUS_21750 gene dacA 169 969 CDS product diadenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722380.1 protein_id gnl|my_center|LOCUS_21750 966 1685 gene locus_tag LOCUS_21760 966 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 1682 3022 gene locus_tag LOCUS_21770 gene glmM 1682 3022 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_21770 >Feature sequence275 1771 1028 gene locus_tag LOCUS_21780 1771 1028 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546386.1 protein_id gnl|my_center|LOCUS_21780 3070 1793 gene locus_tag LOCUS_21790 3070 1793 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545072.1 protein_id gnl|my_center|LOCUS_21790 >Feature sequence276 1844 906 gene locus_tag LOCUS_21800 1844 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 3124 1859 gene locus_tag LOCUS_21810 3124 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 >Feature sequence277 3181 2504 gene locus_tag LOCUS_21820 3181 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 >Feature sequence278 1226 2746 gene locus_tag LOCUS_21830 gene mtrF 1226 2746 CDS product AbgT family antimetabolite efflux transporter MtrF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951251.1 protein_id gnl|my_center|LOCUS_21830 >Feature sequence279 287 844 gene locus_tag LOCUS_21840 287 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 913 2307 gene locus_tag LOCUS_21850 913 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 >Feature sequence280 2832 439 gene locus_tag LOCUS_21860 2832 439 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105653.1 protein_id gnl|my_center|LOCUS_21860 >Feature sequence281 1362 37 gene locus_tag LOCUS_21870 1362 37 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251170.1 protein_id gnl|my_center|LOCUS_21870 2244 1483 gene locus_tag LOCUS_21880 2244 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 >Feature sequence282 81 2042 gene locus_tag LOCUS_21890 gene uvrB 81 2042 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229241.1 protein_id gnl|my_center|LOCUS_21890 2364 2044 gene locus_tag LOCUS_21900 2364 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 <3114 2366 gene locus_tag LOCUS_21910 <3114 2366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942540.1:CTP synthase >Feature sequence283 75 734 gene locus_tag LOCUS_21920 75 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 944 1306 gene locus_tag LOCUS_21930 944 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 2270 2794 gene locus_tag LOCUS_21940 2270 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 2899 3075 gene locus_tag LOCUS_21950 2899 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence284 1235 66 gene locus_tag LOCUS_21960 1235 66 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123362.1 protein_id gnl|my_center|LOCUS_21960 2803 1232 gene locus_tag LOCUS_21970 2803 1232 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627748.1 protein_id gnl|my_center|LOCUS_21970 >Feature sequence285 1589 243 gene locus_tag LOCUS_21980 1589 243 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839735.1 protein_id gnl|my_center|LOCUS_21980 2662 1781 gene locus_tag LOCUS_21990 2662 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 >Feature sequence286 2 274 gene locus_tag LOCUS_22000 2 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 986 1954 gene locus_tag LOCUS_22010 986 1954 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150388385.1 protein_id gnl|my_center|LOCUS_22010 2466 2669 gene locus_tag LOCUS_22020 2466 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 2666 2977 gene locus_tag LOCUS_22030 2666 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 >Feature sequence287 452 877 gene locus_tag LOCUS_22040 452 877 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938903.1 protein_id gnl|my_center|LOCUS_22040 892 2721 gene locus_tag LOCUS_22050 892 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 >Feature sequence288 2930 2346 gene locus_tag LOCUS_22060 2930 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 >Feature sequence289 1392 136 gene locus_tag LOCUS_22070 1392 136 CDS product ISL3-like element ISMac21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022377.1 protein_id gnl|my_center|LOCUS_22070 1519 2964 gene locus_tag LOCUS_22080 1519 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 >Feature sequence290 922 65 gene locus_tag LOCUS_22090 922 65 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941804.1 protein_id gnl|my_center|LOCUS_22090 2252 912 gene locus_tag LOCUS_22100 2252 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 2767 2261 gene locus_tag LOCUS_22110 2767 2261 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_22110 >Feature sequence291 2196 586 gene locus_tag LOCUS_22120 2196 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 >Feature sequence292 250 579 gene locus_tag LOCUS_22130 250 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 769 2892 gene locus_tag LOCUS_22140 769 2892 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665246.1 protein_id gnl|my_center|LOCUS_22140 >Feature sequence293 530 1276 gene locus_tag LOCUS_22150 530 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 >Feature sequence294 937 707 gene locus_tag LOCUS_22160 937 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 1087 2250 gene locus_tag LOCUS_22170 1087 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 2247 2780 gene locus_tag LOCUS_22180 2247 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 >Feature sequence295 419 742 gene locus_tag LOCUS_22190 419 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 720 1415 gene locus_tag LOCUS_22200 720 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 1412 2341 gene locus_tag LOCUS_22210 1412 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 >Feature sequence296 <1 752 gene locus_tag LOCUS_22220 <1 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544969.1:phosphomannomutase/phosphoglucomutase 765 2015 gene locus_tag LOCUS_22230 gene glgC 765 2015 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227648.1 protein_id gnl|my_center|LOCUS_22230 >Feature sequence297 <1 562 gene locus_tag LOCUS_22240 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010882798.1:SUMF1/EgtB/PvdO family nonheme iron enzyme 580 2334 gene locus_tag LOCUS_22250 580 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 >Feature sequence298 750 1 gene locus_tag LOCUS_22260 750 1 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_22260 2778 802 gene locus_tag LOCUS_22270 gene ligA 2778 802 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545963.1 protein_id gnl|my_center|LOCUS_22270 >Feature sequence299 1661 225 gene locus_tag LOCUS_22280 1661 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 <2900 1776 gene locus_tag LOCUS_22290 <2900 1776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964165.1:MATE family efflux transporter >Feature sequence300 1367 141 gene locus_tag LOCUS_22300 gene mtaB 1367 141 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_22300 1734 1354 gene locus_tag LOCUS_22310 gene nifU 1734 1354 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272433.1 protein_id gnl|my_center|LOCUS_22310 <2887 1731 gene locus_tag LOCUS_22320 <2887 1731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583089.1:cysteine desulfurase NifS >Feature sequence301 133 1059 gene locus_tag LOCUS_22330 gene gldA 133 1059 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209146359.1 protein_id gnl|my_center|LOCUS_22330 1059 1772 gene locus_tag LOCUS_22340 1059 1772 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109792089.1 protein_id gnl|my_center|LOCUS_22340 >Feature sequence302 1386 1144 gene locus_tag LOCUS_22350 1386 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 2708 1506 gene locus_tag LOCUS_22360 2708 1506 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_22360 >Feature sequence303 >Feature sequence304 >Feature sequence305 41 979 gene locus_tag LOCUS_22370 41 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 993 1241 gene locus_tag LOCUS_22380 993 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 1329 1404 gene locus_tag LOCUS_t00340 1329 1404 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1426 1502 gene locus_tag LOCUS_t00350 1426 1502 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1570 2700 gene locus_tag LOCUS_22390 1570 2700 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547041.1 protein_id gnl|my_center|LOCUS_22390 >Feature sequence306 <1 642 gene locus_tag LOCUS_22400 <1 642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107784.1:DUF452 family protein 630 1382 gene locus_tag LOCUS_22410 gene bioC 630 1382 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107785.1 protein_id gnl|my_center|LOCUS_22410 1361 2050 gene locus_tag LOCUS_22420 gene gntX 1361 2050 CDS product DNA utilization protein GntX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303702.1 protein_id gnl|my_center|LOCUS_22420 >Feature sequence307 809 156 gene locus_tag LOCUS_22430 809 156 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890570.1 protein_id gnl|my_center|LOCUS_22430 1363 1088 gene locus_tag LOCUS_22440 1363 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 1843 1391 gene locus_tag LOCUS_22450 1843 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 >Feature sequence308 900 472 gene locus_tag LOCUS_22460 900 472 CDS product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765125.1 protein_id gnl|my_center|LOCUS_22460 1156 2358 gene locus_tag LOCUS_22470 1156 2358 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_22470 >Feature sequence309 1216 164 gene locus_tag LOCUS_22480 1216 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 2414 1227 gene locus_tag LOCUS_22490 2414 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 >Feature sequence310 2262 715 gene locus_tag LOCUS_22500 2262 715 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082429.1 protein_id gnl|my_center|LOCUS_22500 >Feature sequence311 904 143 gene locus_tag LOCUS_22510 904 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 1818 901 gene locus_tag LOCUS_22520 1818 901 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943450.1 protein_id gnl|my_center|LOCUS_22520 <2636 1815 gene locus_tag LOCUS_22530 <2636 1815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943449.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence312 731 1060 gene locus_tag LOCUS_22540 731 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22540 1048 1941 gene locus_tag LOCUS_22550 1048 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22550 2369 1947 gene locus_tag LOCUS_22560 2369 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 >Feature sequence313 1061 1684 gene locus_tag LOCUS_22570 gene udk 1061 1684 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546365.1 protein_id gnl|my_center|LOCUS_22570 1768 2211 gene locus_tag LOCUS_22580 1768 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 2214 2504 gene locus_tag LOCUS_22590 2214 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 >Feature sequence314 >Feature sequence315 <1 527 gene locus_tag LOCUS_22600 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546330.1:electron transfer flavoprotein subunit beta/FixA family protein 596 2158 gene locus_tag LOCUS_22610 596 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 >Feature sequence316 700 2193 gene locus_tag LOCUS_22620 gene glpK 700 2193 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861192.1 protein_id gnl|my_center|LOCUS_22620 >Feature sequence317 1549 20 gene locus_tag LOCUS_22630 1549 20 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022342.1 protein_id gnl|my_center|LOCUS_22630 >Feature sequence318 1638 316 gene locus_tag LOCUS_22640 1638 316 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707249.1 protein_id gnl|my_center|LOCUS_22640 2250 1639 gene locus_tag LOCUS_22650 gene coaE 2250 1639 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438041.1 protein_id gnl|my_center|LOCUS_22650 >Feature sequence319 <1 1244 gene locus_tag LOCUS_22660 <1 1244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193486784.1:pullulanase-type alpha-1,6-glucosidase 1335 2426 gene locus_tag LOCUS_22670 gene ugpC 1335 2426 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531923.1 protein_id gnl|my_center|LOCUS_22670 >Feature sequence320 1519 854 gene locus_tag LOCUS_22680 1519 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 >Feature sequence321 1758 1 gene locus_tag LOCUS_22690 1758 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 2508 1768 gene locus_tag LOCUS_22700 2508 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 >Feature sequence322 567 1070 gene locus_tag LOCUS_22710 567 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 1299 2237 gene locus_tag LOCUS_22720 1299 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 >Feature sequence323 <2508 764 gene locus_tag LOCUS_22730 <2508 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584140.1:bifunctional UDP-sugar hydrolase/5'-nucleotidase