>Feature sequence001 275 1642 gene locus_tag LOCUS_00010 275 1642 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 protein_id gnl|my_center|LOCUS_00010 1703 2848 gene locus_tag LOCUS_00020 1703 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2889 3401 gene locus_tag LOCUS_00030 2889 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3981 3358 gene locus_tag LOCUS_00040 3981 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4275 4042 gene locus_tag LOCUS_00050 4275 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4648 4268 gene locus_tag LOCUS_00060 4648 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5298 4747 gene locus_tag LOCUS_00070 5298 4747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 16175 5295 gene locus_tag LOCUS_00080 16175 5295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 16871 16218 gene locus_tag LOCUS_00090 16871 16218 CDS product tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014072014.1 protein_id gnl|my_center|LOCUS_00090 17074 16895 gene locus_tag LOCUS_00100 17074 16895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 17883 17086 gene locus_tag LOCUS_00110 17883 17086 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113184.1 protein_id gnl|my_center|LOCUS_00110 18611 17892 gene locus_tag LOCUS_00120 18611 17892 CDS product phage minor tail protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113185.1 protein_id gnl|my_center|LOCUS_00120 19009 18665 gene locus_tag LOCUS_00130 19009 18665 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072856.1 protein_id gnl|my_center|LOCUS_00130 19475 19152 gene locus_tag LOCUS_00140 19475 19152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206096.1 protein_id gnl|my_center|LOCUS_00140 20005 19544 gene locus_tag LOCUS_00150 20005 19544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 20733 20002 gene locus_tag LOCUS_00160 20733 20002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 21563 21159 gene locus_tag LOCUS_00170 21563 21159 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566317.1 protein_id gnl|my_center|LOCUS_00170 21795 21613 gene locus_tag LOCUS_00180 21795 21613 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893919.1 protein_id gnl|my_center|LOCUS_00180 25982 21864 gene locus_tag LOCUS_00190 25982 21864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 26394 26047 gene locus_tag LOCUS_00200 26394 26047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 26819 26478 gene locus_tag LOCUS_00210 26819 26478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 27287 26823 gene locus_tag LOCUS_00220 27287 26823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 28249 27428 gene locus_tag LOCUS_00230 28249 27428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 28499 28329 gene locus_tag LOCUS_00240 28499 28329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 28615 29010 gene locus_tag LOCUS_00250 28615 29010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 29271 29035 gene locus_tag LOCUS_00260 29271 29035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 29822 29301 gene locus_tag LOCUS_00270 29822 29301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 30809 29880 gene locus_tag LOCUS_00280 30809 29880 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226992704.1 protein_id gnl|my_center|LOCUS_00280 31250 30909 gene locus_tag LOCUS_00290 31250 30909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 31504 31283 gene locus_tag LOCUS_00300 31504 31283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 31800 31552 gene locus_tag LOCUS_00310 31800 31552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 32255 31857 gene locus_tag LOCUS_00320 32255 31857 CDS product phage tail terminator-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103832.1 protein_id gnl|my_center|LOCUS_00320 32638 32258 gene locus_tag LOCUS_00330 32638 32258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103831.1 protein_id gnl|my_center|LOCUS_00330 33011 32613 gene locus_tag LOCUS_00340 33011 32613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 33184 33014 gene locus_tag LOCUS_00350 33184 33014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 33444 33187 gene locus_tag LOCUS_00360 33444 33187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 33818 33444 gene locus_tag LOCUS_00370 33818 33444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 34197 33820 gene locus_tag LOCUS_00380 34197 33820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 34596 34201 gene locus_tag LOCUS_00390 34596 34201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 35781 34642 gene locus_tag LOCUS_00400 35781 34642 CDS product P22 phage major capsid protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705696.1 protein_id gnl|my_center|LOCUS_00400 36587 35799 gene locus_tag LOCUS_00410 36587 35799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705697.1 protein_id gnl|my_center|LOCUS_00410 37828 36725 gene locus_tag LOCUS_00420 37828 36725 CDS product minor capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207062.1 protein_id gnl|my_center|LOCUS_00420 39265 37832 gene locus_tag LOCUS_00430 39265 37832 CDS product DUF4055 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138097923.1 protein_id gnl|my_center|LOCUS_00430 40395 39262 gene locus_tag LOCUS_00440 40395 39262 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705700.1 protein_id gnl|my_center|LOCUS_00440 40587 41426 gene locus_tag LOCUS_00450 40587 41426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 42034 41516 gene locus_tag LOCUS_00460 42034 41516 CDS product DUF2280 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267982.1 protein_id gnl|my_center|LOCUS_00460 42734 42093 gene locus_tag LOCUS_00470 42734 42093 CDS product putative metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095975.1 protein_id gnl|my_center|LOCUS_00470 43164 42703 gene locus_tag LOCUS_00480 43164 42703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 44281 43211 gene locus_tag LOCUS_00490 44281 43211 CDS product RelA/SpoT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943079.1 protein_id gnl|my_center|LOCUS_00490 44608 44369 gene locus_tag LOCUS_00500 44608 44369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 44807 44595 gene locus_tag LOCUS_00510 44807 44595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 45500 44865 gene locus_tag LOCUS_00520 45500 44865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 46264 45707 gene locus_tag LOCUS_00530 46264 45707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 46874 46446 gene locus_tag LOCUS_00540 46874 46446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072887.1 protein_id gnl|my_center|LOCUS_00540 47026 46871 gene locus_tag LOCUS_00550 47026 46871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 47625 47023 gene locus_tag LOCUS_00560 47625 47023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 48149 47622 gene locus_tag LOCUS_00570 48149 47622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 49093 48146 gene locus_tag LOCUS_00580 49093 48146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 >Feature sequence002 1399 527 gene locus_tag LOCUS_00590 1399 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 1746 1396 gene locus_tag LOCUS_00600 1746 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 2145 1831 gene locus_tag LOCUS_00610 2145 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 2781 2146 gene locus_tag LOCUS_00620 2781 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 3302 2778 gene locus_tag LOCUS_00630 3302 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 4200 3430 gene locus_tag LOCUS_00640 4200 3430 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104521.1 protein_id gnl|my_center|LOCUS_00640 8282 4470 gene locus_tag LOCUS_00650 8282 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 9114 8296 gene locus_tag LOCUS_00660 9114 8296 CDS product phage BR0599 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004094922.1 protein_id gnl|my_center|LOCUS_00660 10805 9111 gene locus_tag LOCUS_00670 10805 9111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 11752 10814 gene locus_tag LOCUS_00680 11752 10814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 12617 11763 gene locus_tag LOCUS_00690 12617 11763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 16757 12699 gene locus_tag LOCUS_00700 16757 12699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 17040 16762 gene locus_tag LOCUS_00710 17040 16762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 17396 16941 gene locus_tag LOCUS_00720 17396 16941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 18169 17396 gene locus_tag LOCUS_00730 18169 17396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 18357 18172 gene locus_tag LOCUS_00740 18357 18172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 18794 18360 gene locus_tag LOCUS_00750 18794 18360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 19222 18794 gene locus_tag LOCUS_00760 19222 18794 CDS product DUF1320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271668.1 protein_id gnl|my_center|LOCUS_00760 20234 19236 gene locus_tag LOCUS_00770 20234 19236 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104533.1 protein_id gnl|my_center|LOCUS_00770 20635 20261 gene locus_tag LOCUS_00780 20635 20261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 21669 20647 gene locus_tag LOCUS_00790 21669 20647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273072.1 protein_id gnl|my_center|LOCUS_00790 21970 21749 gene locus_tag LOCUS_00800 21970 21749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 22638 22132 gene locus_tag LOCUS_00810 22638 22132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 23971 22766 gene locus_tag LOCUS_00820 23971 22766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 25436 23961 gene locus_tag LOCUS_00830 25436 23961 CDS product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090679.1 protein_id gnl|my_center|LOCUS_00830 26776 25436 gene locus_tag LOCUS_00840 26776 25436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 27340 26777 gene locus_tag LOCUS_00850 27340 26777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 27642 27349 gene locus_tag LOCUS_00860 27642 27349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072623.1 protein_id gnl|my_center|LOCUS_00860 27930 27649 gene locus_tag LOCUS_00870 27930 27649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 28366 27923 gene locus_tag LOCUS_00880 28366 27923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 28863 28363 gene locus_tag LOCUS_00890 28863 28363 CDS product glycoside hydrolase family 108 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225286.1 protein_id gnl|my_center|LOCUS_00890 29479 28943 gene locus_tag LOCUS_00900 29479 28943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 30266 29613 gene locus_tag LOCUS_00910 30266 29613 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072597.1 protein_id gnl|my_center|LOCUS_00910 30372 30578 gene locus_tag LOCUS_00920 30372 30578 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200153.1 protein_id gnl|my_center|LOCUS_00920 30623 30781 gene locus_tag LOCUS_00930 30623 30781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 30762 31001 gene locus_tag LOCUS_00940 30762 31001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 30998 31291 gene locus_tag LOCUS_00950 30998 31291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 31306 32193 gene locus_tag LOCUS_00960 31306 32193 CDS product DUF3102 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533821.1 protein_id gnl|my_center|LOCUS_00960 32197 33960 gene locus_tag LOCUS_00970 32197 33960 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990532.1 protein_id gnl|my_center|LOCUS_00970 33963 35141 gene locus_tag LOCUS_00980 33963 35141 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960673.1 protein_id gnl|my_center|LOCUS_00980 35346 35558 gene locus_tag LOCUS_00990 35346 35558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 35563 35949 gene locus_tag LOCUS_01000 35563 35949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 35946 36314 gene locus_tag LOCUS_01010 35946 36314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 36311 36919 gene locus_tag LOCUS_01020 36311 36919 CDS product DUF3164 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072605.1 protein_id gnl|my_center|LOCUS_01020 36870 37061 gene locus_tag LOCUS_01030 36870 37061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 37068 37340 gene locus_tag LOCUS_01040 37068 37340 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043904.1 protein_id gnl|my_center|LOCUS_01040 37340 37627 gene locus_tag LOCUS_01050 37340 37627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 37766 38485 gene locus_tag LOCUS_01060 37766 38485 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072609.1 protein_id gnl|my_center|LOCUS_01060 38482 38769 gene locus_tag LOCUS_01070 38482 38769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 38763 38966 gene locus_tag LOCUS_01080 38763 38966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 38968 39174 gene locus_tag LOCUS_01090 38968 39174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 39178 39621 gene locus_tag LOCUS_01100 39178 39621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 39630 39995 gene locus_tag LOCUS_01110 39630 39995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 >Feature sequence003 46 121 gene locus_tag LOCUS_t00010 46 121 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 732 514 gene locus_tag LOCUS_01120 732 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 843 1058 gene locus_tag LOCUS_01130 843 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 1073 2257 gene locus_tag LOCUS_01140 1073 2257 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211738.1 protein_id gnl|my_center|LOCUS_01140 2247 2495 gene locus_tag LOCUS_01150 2247 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 2564 3148 gene locus_tag LOCUS_01160 2564 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 3159 3905 gene locus_tag LOCUS_01170 gene dnaC 3159 3905 CDS product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799913.1 protein_id gnl|my_center|LOCUS_01170 4010 4339 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttctaagctgcctatgcggcagtgaaca 5335 4418 gene locus_tag LOCUS_01180 5335 4418 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299612.1 protein_id gnl|my_center|LOCUS_01180 5652 5335 gene locus_tag LOCUS_01190 5652 5335 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163271.1 protein_id gnl|my_center|LOCUS_01190 6678 5941 gene locus_tag LOCUS_01200 6678 5941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 8702 6675 gene locus_tag LOCUS_01210 gene pglZ 8702 6675 CDS product BREX-3 system phosphatase PglZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870227.1 protein_id gnl|my_center|LOCUS_01210 11535 8695 gene locus_tag LOCUS_01220 11535 8695 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870228.1 protein_id gnl|my_center|LOCUS_01220 14324 11547 gene locus_tag LOCUS_01230 14324 11547 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280509.1 protein_id gnl|my_center|LOCUS_01230 18231 14503 gene locus_tag LOCUS_01240 18231 14503 CDS product DUF6079 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870232.1 protein_id gnl|my_center|LOCUS_01240 18550 18242 gene locus_tag LOCUS_01250 18550 18242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 18979 18770 gene locus_tag LOCUS_01260 18979 18770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 20184 19135 gene locus_tag LOCUS_01270 20184 19135 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705342.1 protein_id gnl|my_center|LOCUS_01270 20777 20187 gene locus_tag LOCUS_01280 20777 20187 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263037.1 protein_id gnl|my_center|LOCUS_01280 20929 21258 gene locus_tag LOCUS_01290 20929 21258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 21359 21673 gene locus_tag LOCUS_01300 21359 21673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 22010 21747 gene locus_tag LOCUS_01310 22010 21747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 25957 22610 gene locus_tag LOCUS_01320 25957 22610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 26421 26143 gene locus_tag LOCUS_01330 26421 26143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 27586 26414 gene locus_tag LOCUS_01340 27586 26414 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974376.1 protein_id gnl|my_center|LOCUS_01340 28038 27802 gene locus_tag LOCUS_01350 28038 27802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 28391 28209 gene locus_tag LOCUS_01360 28391 28209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 28846 28442 gene locus_tag LOCUS_01370 28846 28442 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969103.1 protein_id gnl|my_center|LOCUS_01370 29859 29077 gene locus_tag LOCUS_01380 29859 29077 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004747277.1 protein_id gnl|my_center|LOCUS_01380 30803 29931 gene locus_tag LOCUS_01390 30803 29931 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_01390 31222 30806 gene locus_tag LOCUS_01400 31222 30806 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206922.1 protein_id gnl|my_center|LOCUS_01400 31640 31224 gene locus_tag LOCUS_01410 31640 31224 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069081.1 protein_id gnl|my_center|LOCUS_01410 31761 32069 gene locus_tag LOCUS_01420 31761 32069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 33194 32454 gene locus_tag LOCUS_01430 gene dsbG 33194 32454 CDS product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089790.1 protein_id gnl|my_center|LOCUS_01430 34062 33214 gene locus_tag LOCUS_01440 34062 33214 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172934.1 protein_id gnl|my_center|LOCUS_01440 35996 34059 gene locus_tag LOCUS_01450 gene dsbD 35996 34059 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207940.1 protein_id gnl|my_center|LOCUS_01450 36105 36779 gene locus_tag LOCUS_01460 36105 36779 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103570.1 protein_id gnl|my_center|LOCUS_01460 36772 38154 gene locus_tag LOCUS_01470 36772 38154 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103567.1 protein_id gnl|my_center|LOCUS_01470 38569 38132 gene locus_tag LOCUS_01480 38569 38132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 39251 39018 gene locus_tag LOCUS_01490 39251 39018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 39542 39288 gene locus_tag LOCUS_01500 39542 39288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 >Feature sequence004 764 2350 gene locus_tag LOCUS_01510 764 2350 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206815.1 protein_id gnl|my_center|LOCUS_01510 2368 3690 gene locus_tag LOCUS_01520 2368 3690 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206814.1 protein_id gnl|my_center|LOCUS_01520 3687 4859 gene locus_tag LOCUS_01530 3687 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206813.1 protein_id gnl|my_center|LOCUS_01530 5162 7363 gene locus_tag LOCUS_01540 5162 7363 CDS product OsmC domain/YcaO domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206168.1 protein_id gnl|my_center|LOCUS_01540 7779 8852 gene locus_tag LOCUS_01550 7779 8852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 8868 9698 gene locus_tag LOCUS_01560 8868 9698 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207958.1 protein_id gnl|my_center|LOCUS_01560 10427 9774 gene locus_tag LOCUS_01570 10427 9774 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406576.1 protein_id gnl|my_center|LOCUS_01570 10543 11022 gene locus_tag LOCUS_01580 10543 11022 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266867.1 protein_id gnl|my_center|LOCUS_01580 11146 10946 gene locus_tag LOCUS_01590 11146 10946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 11295 12032 gene locus_tag LOCUS_01600 11295 12032 CDS product DUF1989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206332.1 protein_id gnl|my_center|LOCUS_01600 12050 12703 gene locus_tag LOCUS_01610 12050 12703 CDS product DUF1989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206333.1 protein_id gnl|my_center|LOCUS_01610 12707 16312 gene locus_tag LOCUS_01620 gene uca 12707 16312 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206334.1 protein_id gnl|my_center|LOCUS_01620 16843 16968 gene locus_tag LOCUS_01630 16843 16968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 16973 17407 gene locus_tag LOCUS_01640 16973 17407 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118705.1 protein_id gnl|my_center|LOCUS_01640 17472 18494 gene locus_tag LOCUS_01650 17472 18494 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206339.1 protein_id gnl|my_center|LOCUS_01650 19541 18663 gene locus_tag LOCUS_01660 19541 18663 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206340.1 protein_id gnl|my_center|LOCUS_01660 20485 19541 gene locus_tag LOCUS_01670 20485 19541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 20843 21190 gene locus_tag LOCUS_01680 20843 21190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 21195 22889 gene locus_tag LOCUS_01690 21195 22889 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064860.1 protein_id gnl|my_center|LOCUS_01690 22886 23221 gene locus_tag LOCUS_01700 22886 23221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 24281 23292 gene locus_tag LOCUS_01710 24281 23292 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112484.1 protein_id gnl|my_center|LOCUS_01710 25833 24388 gene locus_tag LOCUS_01720 25833 24388 CDS product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384711.1 protein_id gnl|my_center|LOCUS_01720 26245 26505 gene locus_tag LOCUS_01730 26245 26505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01730 26508 27080 gene locus_tag LOCUS_01740 26508 27080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01740 27279 28517 gene locus_tag LOCUS_01750 27279 28517 CDS product NADH:flavin oxidoreductase/NADH oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206886.1 protein_id gnl|my_center|LOCUS_01750 28536 29603 gene locus_tag LOCUS_01760 28536 29603 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206885.1 protein_id gnl|my_center|LOCUS_01760 29954 31345 gene locus_tag LOCUS_01770 29954 31345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 32431 31397 gene locus_tag LOCUS_01780 32431 31397 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206888.1 protein_id gnl|my_center|LOCUS_01780 33019 32645 gene locus_tag LOCUS_01790 33019 32645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01790 33444 32989 gene locus_tag LOCUS_01800 33444 32989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01800 33943 33530 gene locus_tag LOCUS_01810 33943 33530 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206884.1 protein_id gnl|my_center|LOCUS_01810 34032 34724 gene locus_tag LOCUS_01820 34032 34724 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206883.1 protein_id gnl|my_center|LOCUS_01820 <38179 34842 gene locus_tag LOCUS_01830 <38179 34842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206445.1:indolepyruvate ferredoxin oxidoreductase family protein >Feature sequence005 2716 1493 gene locus_tag LOCUS_01840 gene zigA 2716 1493 CDS product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207983.1 protein_id gnl|my_center|LOCUS_01840 3130 2732 gene locus_tag LOCUS_01850 3130 2732 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328657.1 protein_id gnl|my_center|LOCUS_01850 3850 3137 gene locus_tag LOCUS_01860 3850 3137 CDS product D-Ala-D-Ala carboxypeptidase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207984.1 protein_id gnl|my_center|LOCUS_01860 3960 4862 gene locus_tag LOCUS_01870 gene folE2 3960 4862 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099665.1 protein_id gnl|my_center|LOCUS_01870 4856 5275 gene locus_tag LOCUS_01880 gene hisI 4856 5275 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389302.1 protein_id gnl|my_center|LOCUS_01880 5297 5857 gene locus_tag LOCUS_01890 5297 5857 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617714.1 protein_id gnl|my_center|LOCUS_01890 5847 7202 gene locus_tag LOCUS_01900 5847 7202 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097095.1 protein_id gnl|my_center|LOCUS_01900 7903 7445 gene locus_tag LOCUS_01910 7903 7445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 12539 7893 gene locus_tag LOCUS_01920 12539 7893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 15821 12612 gene locus_tag LOCUS_01930 15821 12612 CDS product type VI secretion system Vgr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206344.1 protein_id gnl|my_center|LOCUS_01930 16240 17517 gene locus_tag LOCUS_01940 16240 17517 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938417.1 protein_id gnl|my_center|LOCUS_01940 17730 18632 gene locus_tag LOCUS_01950 gene gcvA 17730 18632 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972039.1 protein_id gnl|my_center|LOCUS_01950 18725 19246 gene locus_tag LOCUS_01960 18725 19246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 19243 19995 gene locus_tag LOCUS_01970 19243 19995 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206620.1 protein_id gnl|my_center|LOCUS_01970 20048 20395 gene locus_tag LOCUS_01980 20048 20395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 20398 21855 gene locus_tag LOCUS_01990 20398 21855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 22803 22057 gene locus_tag LOCUS_02000 gene dsbG 22803 22057 CDS product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039720.1 protein_id gnl|my_center|LOCUS_02000 23652 22816 gene locus_tag LOCUS_02010 23652 22816 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161797809.1 protein_id gnl|my_center|LOCUS_02010 25535 23649 gene locus_tag LOCUS_02020 gene dsbD 25535 23649 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207940.1 protein_id gnl|my_center|LOCUS_02020 25645 26316 gene locus_tag LOCUS_02030 25645 26316 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103570.1 protein_id gnl|my_center|LOCUS_02030 26313 27707 gene locus_tag LOCUS_02040 26313 27707 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103567.1 protein_id gnl|my_center|LOCUS_02040 28834 27830 gene locus_tag LOCUS_02050 gene cydB 28834 27830 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206500.1 protein_id gnl|my_center|LOCUS_02050 30264 28831 gene locus_tag LOCUS_02060 30264 28831 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206501.1 protein_id gnl|my_center|LOCUS_02060 31060 30278 gene locus_tag LOCUS_02070 31060 30278 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004747277.1 protein_id gnl|my_center|LOCUS_02070 32824 31163 gene locus_tag LOCUS_02080 32824 31163 CDS product bifunctional protein tyrosine phosphatase family protein/NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527135.1 protein_id gnl|my_center|LOCUS_02080 33520 32837 gene locus_tag LOCUS_02090 33520 32837 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206673.1 protein_id gnl|my_center|LOCUS_02090 33704 34687 gene locus_tag LOCUS_02100 33704 34687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 >Feature sequence006 39 125 gene locus_tag LOCUS_t00020 39 125 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 295 1362 gene locus_tag LOCUS_02110 295 1362 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121973463.1 protein_id gnl|my_center|LOCUS_02110 1774 1388 gene locus_tag LOCUS_02120 1774 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 4500 1774 gene locus_tag LOCUS_02130 4500 1774 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074056806.1 protein_id gnl|my_center|LOCUS_02130 4782 4591 gene locus_tag LOCUS_02140 4782 4591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 4875 5216 gene locus_tag LOCUS_02150 4875 5216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 5246 6145 gene locus_tag LOCUS_02160 5246 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 6378 6163 gene locus_tag LOCUS_02170 6378 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 7290 6469 gene locus_tag LOCUS_02180 7290 6469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 7487 7293 gene locus_tag LOCUS_02190 7487 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 7794 8678 gene locus_tag LOCUS_02200 7794 8678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 8671 9381 gene locus_tag LOCUS_02210 8671 9381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 9577 10794 gene locus_tag LOCUS_02220 9577 10794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 10769 12073 gene locus_tag LOCUS_02230 10769 12073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 12397 12161 gene locus_tag LOCUS_02240 12397 12161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 12598 12398 gene locus_tag LOCUS_02250 12598 12398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 12834 12595 gene locus_tag LOCUS_02260 12834 12595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 14269 12962 gene locus_tag LOCUS_02270 14269 12962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 14710 14270 gene locus_tag LOCUS_02280 14710 14270 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935906.1 protein_id gnl|my_center|LOCUS_02280 17181 14716 gene locus_tag LOCUS_02290 17181 14716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 17675 17334 gene locus_tag LOCUS_02300 17675 17334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 18258 17743 gene locus_tag LOCUS_02310 18258 17743 CDS product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207653.1 protein_id gnl|my_center|LOCUS_02310 19443 18271 gene locus_tag LOCUS_02320 19443 18271 CDS product phage tail sheath protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046101.1 protein_id gnl|my_center|LOCUS_02320 19733 19548 gene locus_tag LOCUS_02330 19733 19548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 21703 19730 gene locus_tag LOCUS_02340 21703 19730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 22317 21706 gene locus_tag LOCUS_02350 22317 21706 CDS product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895511.1 protein_id gnl|my_center|LOCUS_02350 23207 22317 gene locus_tag LOCUS_02360 23207 22317 CDS product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039067818.1 protein_id gnl|my_center|LOCUS_02360 23551 23204 gene locus_tag LOCUS_02370 23551 23204 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213447.1 protein_id gnl|my_center|LOCUS_02370 24198 23548 gene locus_tag LOCUS_02380 24198 23548 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038105.1 protein_id gnl|my_center|LOCUS_02380 24721 24275 gene locus_tag LOCUS_02390 24721 24275 CDS product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829146.1 protein_id gnl|my_center|LOCUS_02390 25245 24718 gene locus_tag LOCUS_02400 25245 24718 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038099.1 protein_id gnl|my_center|LOCUS_02400 26072 25242 gene locus_tag LOCUS_02410 26072 25242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 26338 26069 gene locus_tag LOCUS_02420 26338 26069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 26697 26341 gene locus_tag LOCUS_02430 26697 26341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 26915 26706 gene locus_tag LOCUS_02440 26915 26706 CDS product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868175.1 protein_id gnl|my_center|LOCUS_02440 27368 26916 gene locus_tag LOCUS_02450 27368 26916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 28215 27469 gene locus_tag LOCUS_02460 28215 27469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 29239 28229 gene locus_tag LOCUS_02470 29239 28229 CDS product phage major capsid protein, P2 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532901.1 protein_id gnl|my_center|LOCUS_02470 30073 29243 gene locus_tag LOCUS_02480 30073 29243 CDS product GPO family capsid scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038093.1 protein_id gnl|my_center|LOCUS_02480 30232 32019 gene locus_tag LOCUS_02490 30232 32019 CDS product terminase ATPase subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180334398.1 protein_id gnl|my_center|LOCUS_02490 32019 33011 gene locus_tag LOCUS_02500 32019 33011 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204766.1 protein_id gnl|my_center|LOCUS_02500 33013 33519 gene locus_tag LOCUS_02510 33013 33519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 >Feature sequence007 1358 285 gene locus_tag LOCUS_02520 gene czcD 1358 285 CDS product CDF family zinc transporter CzcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229873.1 protein_id gnl|my_center|LOCUS_02520 1914 1375 gene locus_tag LOCUS_02530 1914 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 2308 1925 gene locus_tag LOCUS_02540 2308 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 3866 2385 gene locus_tag LOCUS_02550 gene adeC 3866 2385 CDS product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811956.1 protein_id gnl|my_center|LOCUS_02550 7027 3863 gene locus_tag LOCUS_02560 gene mexQ 7027 3863 CDS product multidrug efflux RND transporter permease subunit MexQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112892.1 protein_id gnl|my_center|LOCUS_02560 8212 7031 gene locus_tag LOCUS_02570 gene mexP 8212 7031 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MexP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119548.1 protein_id gnl|my_center|LOCUS_02570 8783 8475 gene locus_tag LOCUS_02580 gene czrA 8783 8475 CDS product Zn(II)-responsive metalloregulatory transcriptional repressor CzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829898.1 protein_id gnl|my_center|LOCUS_02580 8905 11391 gene locus_tag LOCUS_02590 8905 11391 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206223.1 protein_id gnl|my_center|LOCUS_02590 11402 11860 gene locus_tag LOCUS_02600 gene cueR 11402 11860 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613681.1 protein_id gnl|my_center|LOCUS_02600 12261 12073 gene locus_tag LOCUS_02610 gene golB 12261 12073 CDS product gold resistance metallochaperone GolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159469.1 protein_id gnl|my_center|LOCUS_02610 12680 12342 gene locus_tag LOCUS_02620 gene fdx 12680 12342 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009387062.1 protein_id gnl|my_center|LOCUS_02620 13364 12771 gene locus_tag LOCUS_02630 13364 12771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 13940 15043 gene locus_tag LOCUS_02640 13940 15043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 15670 15032 gene locus_tag LOCUS_02650 15670 15032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 16599 15739 gene locus_tag LOCUS_02660 16599 15739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 17123 16932 gene locus_tag LOCUS_02670 17123 16932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 18265 17174 gene locus_tag LOCUS_02680 18265 17174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 19136 18285 gene locus_tag LOCUS_02690 19136 18285 CDS product TniB family NTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102975.1 protein_id gnl|my_center|LOCUS_02690 21022 19133 gene locus_tag LOCUS_02700 21022 19133 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044392641.1 protein_id gnl|my_center|LOCUS_02700 21713 21015 gene locus_tag LOCUS_02710 21713 21015 CDS product TnsA endonuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223862839.1 protein_id gnl|my_center|LOCUS_02710 21915 22478 gene locus_tag LOCUS_02720 21915 22478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 23306 22518 gene locus_tag LOCUS_02730 23306 22518 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070887.1 protein_id gnl|my_center|LOCUS_02730 24513 23701 gene locus_tag LOCUS_02740 24513 23701 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208160.1 protein_id gnl|my_center|LOCUS_02740 25249 26574 gene locus_tag LOCUS_02750 25249 26574 CDS product OprD family outer membrane porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208158.1 protein_id gnl|my_center|LOCUS_02750 27206 26679 gene locus_tag LOCUS_02760 gene ppa 27206 26679 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121243.1 protein_id gnl|my_center|LOCUS_02760 27724 27326 gene locus_tag LOCUS_02770 27724 27326 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208157.1 protein_id gnl|my_center|LOCUS_02770 27891 28277 gene locus_tag LOCUS_02780 27891 28277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208156.1 protein_id gnl|my_center|LOCUS_02780 <29737 28371 gene locus_tag LOCUS_02790 <29737 28371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002121274.1:long-chain-fatty-acid--CoA ligase >Feature sequence008 <1 2069 gene locus_tag LOCUS_02800 <1 2069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005071099.1:ribonucleoside-diphosphate reductase subunit alpha 2124 2255 gene locus_tag LOCUS_02810 2124 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 2394 3677 gene locus_tag LOCUS_02820 2394 3677 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005007934.1 protein_id gnl|my_center|LOCUS_02820 7275 3760 gene locus_tag LOCUS_02830 7275 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 9357 8014 gene locus_tag LOCUS_02840 9357 8014 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919394.1 protein_id gnl|my_center|LOCUS_02840 10784 9354 gene locus_tag LOCUS_02850 10784 9354 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038799.1 protein_id gnl|my_center|LOCUS_02850 11542 10781 gene locus_tag LOCUS_02860 11542 10781 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919392.1 protein_id gnl|my_center|LOCUS_02860 11998 11816 gene locus_tag LOCUS_02870 11998 11816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 12515 14155 gene locus_tag LOCUS_02880 gene mqo 12515 14155 CDS product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206017.1 protein_id gnl|my_center|LOCUS_02880 14520 14365 gene locus_tag LOCUS_02890 14520 14365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 14832 15023 gene locus_tag LOCUS_02900 14832 15023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 17136 15079 gene locus_tag LOCUS_02910 17136 15079 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070759.1 protein_id gnl|my_center|LOCUS_02910 18853 17255 gene locus_tag LOCUS_02920 18853 17255 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206021.1 protein_id gnl|my_center|LOCUS_02920 19010 19678 gene locus_tag LOCUS_02930 gene betI 19010 19678 CDS product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206020.1 protein_id gnl|my_center|LOCUS_02930 19671 21143 gene locus_tag LOCUS_02940 gene betB 19671 21143 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206019.1 protein_id gnl|my_center|LOCUS_02940 21222 22916 gene locus_tag LOCUS_02950 gene betA 21222 22916 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206018.1 protein_id gnl|my_center|LOCUS_02950 22981 23772 gene locus_tag LOCUS_02960 22981 23772 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206895.1 protein_id gnl|my_center|LOCUS_02960 25066 23891 gene locus_tag LOCUS_02970 25066 23891 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208445.1 protein_id gnl|my_center|LOCUS_02970 27019 25415 gene locus_tag LOCUS_02980 27019 25415 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966127.1 protein_id gnl|my_center|LOCUS_02980 27774 27307 gene locus_tag LOCUS_02990 27774 27307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 28174 28098 gene locus_tag LOCUS_t00030 28174 28098 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 28254 28179 gene locus_tag LOCUS_t00040 28254 28179 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 28370 28294 gene locus_tag LOCUS_t00050 28370 28294 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence009 313 1938 gene locus_tag LOCUS_03000 313 1938 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669793.1 protein_id gnl|my_center|LOCUS_03000 2192 3193 gene locus_tag LOCUS_03010 gene cysK 2192 3193 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208137.1 protein_id gnl|my_center|LOCUS_03010 3825 3256 gene locus_tag LOCUS_03020 3825 3256 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208138.1 protein_id gnl|my_center|LOCUS_03020 4357 4139 gene locus_tag LOCUS_03030 4357 4139 CDS product DUF2798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338670.1 protein_id gnl|my_center|LOCUS_03030 4599 5819 gene locus_tag LOCUS_03040 4599 5819 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091834.1 protein_id gnl|my_center|LOCUS_03040 5938 6444 gene locus_tag LOCUS_03050 5938 6444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 6632 9007 gene locus_tag LOCUS_03060 6632 9007 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065662.1 protein_id gnl|my_center|LOCUS_03060 9303 9839 gene locus_tag LOCUS_03070 9303 9839 CDS product DUF2726 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208143.1 protein_id gnl|my_center|LOCUS_03070 10192 9836 gene locus_tag LOCUS_03080 10192 9836 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208144.1 protein_id gnl|my_center|LOCUS_03080 10474 10271 gene locus_tag LOCUS_03090 10474 10271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208145.1 protein_id gnl|my_center|LOCUS_03090 11900 10536 gene locus_tag LOCUS_03100 gene creD 11900 10536 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208146.1 protein_id gnl|my_center|LOCUS_03100 13481 12015 gene locus_tag LOCUS_03110 gene creC 13481 12015 CDS product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208147.1 protein_id gnl|my_center|LOCUS_03110 14207 13485 gene locus_tag LOCUS_03120 gene creB 14207 13485 CDS product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208148.1 protein_id gnl|my_center|LOCUS_03120 15572 14505 gene locus_tag LOCUS_03130 gene dinB 15572 14505 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208149.1 protein_id gnl|my_center|LOCUS_03130 16320 15562 gene locus_tag LOCUS_03140 16320 15562 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208150.1 protein_id gnl|my_center|LOCUS_03140 17773 16376 gene locus_tag LOCUS_03150 gene mdtD 17773 16376 CDS product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208151.1 protein_id gnl|my_center|LOCUS_03150 17938 19938 gene locus_tag LOCUS_03160 17938 19938 CDS product choice-of-anchor I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385247.1 protein_id gnl|my_center|LOCUS_03160 20606 19986 gene locus_tag LOCUS_03170 20606 19986 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208152.1 protein_id gnl|my_center|LOCUS_03170 20923 22500 gene locus_tag LOCUS_03180 20923 22500 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208153.1 protein_id gnl|my_center|LOCUS_03180 22497 22979 gene locus_tag LOCUS_03190 22497 22979 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208154.1 protein_id gnl|my_center|LOCUS_03190 23032 23676 gene locus_tag LOCUS_03200 23032 23676 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121256.1 protein_id gnl|my_center|LOCUS_03200 23685 24275 gene locus_tag LOCUS_03210 23685 24275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 >Feature sequence010 498 1739 gene locus_tag LOCUS_03220 498 1739 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207501.1 protein_id gnl|my_center|LOCUS_03220 1743 2414 gene locus_tag LOCUS_03230 1743 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207502.1 protein_id gnl|my_center|LOCUS_03230 2616 2422 gene locus_tag LOCUS_03240 2616 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 3557 2541 gene locus_tag LOCUS_03250 3557 2541 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207503.1 protein_id gnl|my_center|LOCUS_03250 4591 3686 gene locus_tag LOCUS_03260 4591 3686 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207504.1 protein_id gnl|my_center|LOCUS_03260 5006 6193 gene locus_tag LOCUS_03270 5006 6193 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207506.1 protein_id gnl|my_center|LOCUS_03270 6628 7572 gene locus_tag LOCUS_03280 6628 7572 CDS product glutamate/aspartate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082770.1 protein_id gnl|my_center|LOCUS_03280 7730 8473 gene locus_tag LOCUS_03290 7730 8473 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396522.1 protein_id gnl|my_center|LOCUS_03290 8475 9158 gene locus_tag LOCUS_03300 8475 9158 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082765.1 protein_id gnl|my_center|LOCUS_03300 9155 9898 gene locus_tag LOCUS_03310 9155 9898 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082761.1 protein_id gnl|my_center|LOCUS_03310 10079 10897 gene locus_tag LOCUS_03320 10079 10897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688791.1 protein_id gnl|my_center|LOCUS_03320 12279 10909 gene locus_tag LOCUS_03330 12279 10909 CDS product two-component system sensor histidine kinase PmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207509.1 protein_id gnl|my_center|LOCUS_03330 12963 12286 gene locus_tag LOCUS_03340 12963 12286 CDS product DNA-binding response regulator PmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207510.1 protein_id gnl|my_center|LOCUS_03340 14564 12978 gene locus_tag LOCUS_03350 14564 12978 CDS product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207511.1 protein_id gnl|my_center|LOCUS_03350 16057 14852 gene locus_tag LOCUS_03360 16057 14852 CDS product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207512.1 protein_id gnl|my_center|LOCUS_03360 17851 16577 gene locus_tag LOCUS_03370 17851 16577 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207514.1 protein_id gnl|my_center|LOCUS_03370 17997 18623 gene locus_tag LOCUS_03380 17997 18623 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207515.1 protein_id gnl|my_center|LOCUS_03380 18650 19603 gene locus_tag LOCUS_03390 18650 19603 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207516.1 protein_id gnl|my_center|LOCUS_03390 19702 20163 gene locus_tag LOCUS_03400 19702 20163 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207517.1 protein_id gnl|my_center|LOCUS_03400 20183 21034 gene locus_tag LOCUS_03410 20183 21034 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116544.1 protein_id gnl|my_center|LOCUS_03410 21450 21082 gene locus_tag LOCUS_03420 21450 21082 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207518.1 protein_id gnl|my_center|LOCUS_03420 22418 21507 gene locus_tag LOCUS_03430 22418 21507 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207519.1 protein_id gnl|my_center|LOCUS_03430 23775 22588 gene locus_tag LOCUS_03440 gene prpF 23775 22588 CDS product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207520.1 protein_id gnl|my_center|LOCUS_03440 24206 25501 gene locus_tag LOCUS_03450 24206 25501 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207521.1 protein_id gnl|my_center|LOCUS_03450 25584 25659 gene locus_tag LOCUS_t00060 25584 25659 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence011 1777 764 gene locus_tag LOCUS_03460 1777 764 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207523.1 protein_id gnl|my_center|LOCUS_03460 2660 1785 gene locus_tag LOCUS_03470 2660 1785 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207524.1 protein_id gnl|my_center|LOCUS_03470 3063 2815 gene locus_tag LOCUS_03480 3063 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 3762 3067 gene locus_tag LOCUS_03490 3762 3067 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763967.1 protein_id gnl|my_center|LOCUS_03490 7379 3774 gene locus_tag LOCUS_03500 gene uca 7379 3774 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045751776.1 protein_id gnl|my_center|LOCUS_03500 9221 7395 gene locus_tag LOCUS_03510 gene atzF 9221 7395 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206338.1 protein_id gnl|my_center|LOCUS_03510 9557 10528 gene locus_tag LOCUS_03520 9557 10528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 10756 11736 gene locus_tag LOCUS_03530 10756 11736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 14711 11763 gene locus_tag LOCUS_03540 14711 11763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 17486 14727 gene locus_tag LOCUS_03550 17486 14727 CDS product type VI secretion system Vgr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206351.1 protein_id gnl|my_center|LOCUS_03550 17988 17635 gene locus_tag LOCUS_03560 17988 17635 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206717.1 protein_id gnl|my_center|LOCUS_03560 19162 18050 gene locus_tag LOCUS_03570 19162 18050 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206736.1 protein_id gnl|my_center|LOCUS_03570 19455 19180 gene locus_tag LOCUS_03580 19455 19180 CDS product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096678.1 protein_id gnl|my_center|LOCUS_03580 19812 21260 gene locus_tag LOCUS_03590 19812 21260 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206732.1 protein_id gnl|my_center|LOCUS_03590 21762 21277 gene locus_tag LOCUS_03600 21762 21277 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206731.1 protein_id gnl|my_center|LOCUS_03600 22234 22866 gene locus_tag LOCUS_03610 22234 22866 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206409.1 protein_id gnl|my_center|LOCUS_03610 23301 23041 gene locus_tag LOCUS_03620 23301 23041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 24175 23477 gene locus_tag LOCUS_03630 24175 23477 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206916.1 protein_id gnl|my_center|LOCUS_03630 >Feature sequence012 307 525 gene locus_tag LOCUS_03640 307 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 1963 599 gene locus_tag LOCUS_03650 1963 599 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464517.1 protein_id gnl|my_center|LOCUS_03650 2774 2022 gene locus_tag LOCUS_03660 2774 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111193.1 protein_id gnl|my_center|LOCUS_03660 2938 3450 gene locus_tag LOCUS_03670 2938 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 3734 4141 gene locus_tag LOCUS_03680 3734 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 6006 4189 gene locus_tag LOCUS_03690 6006 4189 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206519.1 protein_id gnl|my_center|LOCUS_03690 7730 6336 gene locus_tag LOCUS_03700 gene adeK 7730 6336 CDS product multidrug efflux RND transporter outer membrane channel subunit AdeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116015.1 protein_id gnl|my_center|LOCUS_03700 10920 7810 gene locus_tag LOCUS_03710 10920 7810 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206728.1 protein_id gnl|my_center|LOCUS_03710 12065 10920 gene locus_tag LOCUS_03720 12065 10920 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206729.1 protein_id gnl|my_center|LOCUS_03720 12212 12940 gene locus_tag LOCUS_03730 gene adeR 12212 12940 CDS product efflux system response regulator transcription factor AdeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113657.1 protein_id gnl|my_center|LOCUS_03730 12988 14067 gene locus_tag LOCUS_03740 gene adeS 12988 14067 CDS product two-component sensor histidine kinase AdeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206730.1 protein_id gnl|my_center|LOCUS_03740 15061 14186 gene locus_tag LOCUS_03750 15061 14186 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086755.1 protein_id gnl|my_center|LOCUS_03750 16174 15251 gene locus_tag LOCUS_03760 16174 15251 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893577.1 protein_id gnl|my_center|LOCUS_03760 17821 16247 gene locus_tag LOCUS_03770 17821 16247 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226334.1 protein_id gnl|my_center|LOCUS_03770 18199 18804 gene locus_tag LOCUS_03780 18199 18804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 19050 20402 gene locus_tag LOCUS_03790 19050 20402 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207529.1 protein_id gnl|my_center|LOCUS_03790 21377 20913 gene locus_tag LOCUS_03800 21377 20913 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193539.1 protein_id gnl|my_center|LOCUS_03800 21545 22411 gene locus_tag LOCUS_03810 21545 22411 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206939.1 protein_id gnl|my_center|LOCUS_03810 22447 22884 gene locus_tag LOCUS_03820 22447 22884 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207360.1 protein_id gnl|my_center|LOCUS_03820 >Feature sequence013 891 1793 gene locus_tag LOCUS_03830 891 1793 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495563.1 protein_id gnl|my_center|LOCUS_03830 1884 2942 gene locus_tag LOCUS_03840 1884 2942 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085564.1 protein_id gnl|my_center|LOCUS_03840 3068 3940 gene locus_tag LOCUS_03850 3068 3940 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266124.1 protein_id gnl|my_center|LOCUS_03850 4402 5157 gene locus_tag LOCUS_03860 4402 5157 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971780.1 protein_id gnl|my_center|LOCUS_03860 5518 6492 gene locus_tag LOCUS_03870 5518 6492 CDS product IS110-like element IS1663 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930153.1 protein_id gnl|my_center|LOCUS_03870 7318 6659 gene locus_tag LOCUS_03880 7318 6659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03880 8581 7640 gene locus_tag LOCUS_03890 8581 7640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 10076 8643 gene locus_tag LOCUS_03900 10076 8643 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038653.1 protein_id gnl|my_center|LOCUS_03900 11775 10144 gene locus_tag LOCUS_03910 11775 10144 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728663.1 protein_id gnl|my_center|LOCUS_03910 13961 12243 gene locus_tag LOCUS_03920 13961 12243 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065953.1 protein_id gnl|my_center|LOCUS_03920 15316 14162 gene locus_tag LOCUS_03930 15316 14162 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206430.1 protein_id gnl|my_center|LOCUS_03930 15587 16363 gene locus_tag LOCUS_03940 15587 16363 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206438.1 protein_id gnl|my_center|LOCUS_03940 16367 17884 gene locus_tag LOCUS_03950 16367 17884 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206436.1 protein_id gnl|my_center|LOCUS_03950 17897 19099 gene locus_tag LOCUS_03960 17897 19099 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206435.1 protein_id gnl|my_center|LOCUS_03960 19112 20329 gene locus_tag LOCUS_03970 19112 20329 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206431.1 protein_id gnl|my_center|LOCUS_03970 20447 21295 gene locus_tag LOCUS_03980 20447 21295 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996082.1 protein_id gnl|my_center|LOCUS_03980 22594 21299 gene locus_tag LOCUS_03990 22594 21299 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938417.1 protein_id gnl|my_center|LOCUS_03990 >Feature sequence014 78 1064 gene locus_tag LOCUS_04000 78 1064 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206446.1 protein_id gnl|my_center|LOCUS_04000 2074 1172 gene locus_tag LOCUS_04010 2074 1172 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206447.1 protein_id gnl|my_center|LOCUS_04010 4062 2071 gene locus_tag LOCUS_04020 4062 2071 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206448.1 protein_id gnl|my_center|LOCUS_04020 4877 4074 gene locus_tag LOCUS_04030 4877 4074 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206449.1 protein_id gnl|my_center|LOCUS_04030 6489 4888 gene locus_tag LOCUS_04040 6489 4888 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206450.1 protein_id gnl|my_center|LOCUS_04040 7686 6514 gene locus_tag LOCUS_04050 7686 6514 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076583.1 protein_id gnl|my_center|LOCUS_04050 7856 8449 gene locus_tag LOCUS_04060 7856 8449 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206451.1 protein_id gnl|my_center|LOCUS_04060 8560 10254 gene locus_tag LOCUS_04070 8560 10254 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206452.1 protein_id gnl|my_center|LOCUS_04070 10321 11025 gene locus_tag LOCUS_04080 10321 11025 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206453.1 protein_id gnl|my_center|LOCUS_04080 11322 12599 gene locus_tag LOCUS_04090 11322 12599 CDS product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206454.1 protein_id gnl|my_center|LOCUS_04090 12694 14058 gene locus_tag LOCUS_04100 12694 14058 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802478.1 protein_id gnl|my_center|LOCUS_04100 14641 14174 gene locus_tag LOCUS_04110 14641 14174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 15959 14787 gene locus_tag LOCUS_04120 15959 14787 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206694.1 protein_id gnl|my_center|LOCUS_04120 16680 16033 gene locus_tag LOCUS_04130 16680 16033 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206696.1 protein_id gnl|my_center|LOCUS_04130 17386 16682 gene locus_tag LOCUS_04140 17386 16682 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206697.1 protein_id gnl|my_center|LOCUS_04140 18498 17617 gene locus_tag LOCUS_04150 18498 17617 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206698.1 protein_id gnl|my_center|LOCUS_04150 19107 18676 gene locus_tag LOCUS_04160 19107 18676 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114206.1 protein_id gnl|my_center|LOCUS_04160 19339 21510 gene locus_tag LOCUS_04170 19339 21510 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206690.1 protein_id gnl|my_center|LOCUS_04170 22259 21561 gene locus_tag LOCUS_04180 22259 21561 CDS product DUF1826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206288.1 protein_id gnl|my_center|LOCUS_04180 >Feature sequence015 390 1493 gene locus_tag LOCUS_04190 gene alr 390 1493 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208091.1 protein_id gnl|my_center|LOCUS_04190 1520 1879 gene locus_tag LOCUS_04200 1520 1879 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208092.1 protein_id gnl|my_center|LOCUS_04200 2070 3503 gene locus_tag LOCUS_04210 2070 3503 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208093.1 protein_id gnl|my_center|LOCUS_04210 4458 3577 gene locus_tag LOCUS_04220 4458 3577 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208095.1 protein_id gnl|my_center|LOCUS_04220 4625 6142 gene locus_tag LOCUS_04230 4625 6142 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208096.1 protein_id gnl|my_center|LOCUS_04230 6154 7044 gene locus_tag LOCUS_04240 gene mmsB 6154 7044 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208097.1 protein_id gnl|my_center|LOCUS_04240 7135 8784 gene locus_tag LOCUS_04250 7135 8784 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102517.1 protein_id gnl|my_center|LOCUS_04250 8796 9923 gene locus_tag LOCUS_04260 8796 9923 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160774.1 protein_id gnl|my_center|LOCUS_04260 9945 10718 gene locus_tag LOCUS_04270 9945 10718 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002069758.1 protein_id gnl|my_center|LOCUS_04270 10731 11756 gene locus_tag LOCUS_04280 10731 11756 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208100.1 protein_id gnl|my_center|LOCUS_04280 11879 13240 gene locus_tag LOCUS_04290 11879 13240 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208101.1 protein_id gnl|my_center|LOCUS_04290 13425 13883 gene locus_tag LOCUS_04300 13425 13883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 15480 14221 gene locus_tag LOCUS_04310 15480 14221 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268088.1 protein_id gnl|my_center|LOCUS_04310 15787 15485 gene locus_tag LOCUS_04320 15787 15485 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083182810.1 protein_id gnl|my_center|LOCUS_04320 19344 16387 gene locus_tag LOCUS_04330 19344 16387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 21521 19341 gene locus_tag LOCUS_04340 21521 19341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 22150 21518 gene locus_tag LOCUS_04350 22150 21518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 >Feature sequence016 805 32 gene locus_tag LOCUS_04360 805 32 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004791496.1 protein_id gnl|my_center|LOCUS_04360 1019 1189 gene locus_tag LOCUS_04370 1019 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 2234 1203 gene locus_tag LOCUS_04380 2234 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 3405 2317 gene locus_tag LOCUS_04390 gene lipC 3405 2317 CDS product lipase LipC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112346.1 protein_id gnl|my_center|LOCUS_04390 3616 4638 gene locus_tag LOCUS_04400 3616 4638 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121430.1 protein_id gnl|my_center|LOCUS_04400 5384 4701 gene locus_tag LOCUS_04410 5384 4701 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035648.1 protein_id gnl|my_center|LOCUS_04410 6303 5533 gene locus_tag LOCUS_04420 6303 5533 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207124.1 protein_id gnl|my_center|LOCUS_04420 6448 7506 gene locus_tag LOCUS_04430 6448 7506 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207125.1 protein_id gnl|my_center|LOCUS_04430 7523 8155 gene locus_tag LOCUS_04440 7523 8155 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206488.1 protein_id gnl|my_center|LOCUS_04440 8970 8152 gene locus_tag LOCUS_04450 gene prmC 8970 8152 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207128.1 protein_id gnl|my_center|LOCUS_04450 10058 8970 gene locus_tag LOCUS_04460 gene prfA 10058 8970 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119588.1 protein_id gnl|my_center|LOCUS_04460 10312 10779 gene locus_tag LOCUS_04470 gene yiaA 10312 10779 CDS product inner membrane protein YiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208936.1 protein_id gnl|my_center|LOCUS_04470 11038 11469 gene locus_tag LOCUS_04480 11038 11469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119687.1 protein_id gnl|my_center|LOCUS_04480 12880 11624 gene locus_tag LOCUS_04490 12880 11624 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207236.1 protein_id gnl|my_center|LOCUS_04490 14411 13173 gene locus_tag LOCUS_04500 14411 13173 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207237.1 protein_id gnl|my_center|LOCUS_04500 14669 15361 gene locus_tag LOCUS_04510 14669 15361 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118253.1 protein_id gnl|my_center|LOCUS_04510 15461 16033 gene locus_tag LOCUS_04520 15461 16033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207238.1 protein_id gnl|my_center|LOCUS_04520 16156 16231 gene locus_tag LOCUS_t00070 16156 16231 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 16861 16445 gene locus_tag LOCUS_04530 16861 16445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 17255 18190 gene locus_tag LOCUS_04540 17255 18190 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118101.1 protein_id gnl|my_center|LOCUS_04540 18187 18960 gene locus_tag LOCUS_04550 18187 18960 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118099.1 protein_id gnl|my_center|LOCUS_04550 18957 19772 gene locus_tag LOCUS_04560 gene queF 18957 19772 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207239.1 protein_id gnl|my_center|LOCUS_04560 19806 20465 gene locus_tag LOCUS_04570 19806 20465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118229.1 protein_id gnl|my_center|LOCUS_04570 >Feature sequence017 <1 1049 gene locus_tag LOCUS_04580 <1 1049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096884.1:ABC transporter ATP-binding protein 1338 3296 gene locus_tag LOCUS_04590 1338 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 3417 6425 gene locus_tag LOCUS_04600 3417 6425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 7061 8197 gene locus_tag LOCUS_04610 7061 8197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 8197 9231 gene locus_tag LOCUS_04620 gene gmd 8197 9231 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074056622.1 protein_id gnl|my_center|LOCUS_04620 9247 10212 gene locus_tag LOCUS_04630 9247 10212 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_04630 10205 10768 gene locus_tag LOCUS_04640 10205 10768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 10765 11406 gene locus_tag LOCUS_04650 10765 11406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 11462 12301 gene locus_tag LOCUS_04660 11462 12301 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389971.1 protein_id gnl|my_center|LOCUS_04660 12351 15089 gene locus_tag LOCUS_04670 12351 15089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 15095 16285 gene locus_tag LOCUS_04680 gene ugd 15095 16285 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097850.1 protein_id gnl|my_center|LOCUS_04680 17718 18809 gene locus_tag LOCUS_04690 17718 18809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 19280 19089 gene locus_tag LOCUS_04700 19280 19089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 19246 19677 gene locus_tag LOCUS_04710 19246 19677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 >Feature sequence018 1104 2771 gene locus_tag LOCUS_04720 1104 2771 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208426.1 protein_id gnl|my_center|LOCUS_04720 2783 4015 gene locus_tag LOCUS_04730 2783 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 4039 6003 gene locus_tag LOCUS_04740 4039 6003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208429.1 protein_id gnl|my_center|LOCUS_04740 6594 6046 gene locus_tag LOCUS_04750 6594 6046 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208430.1 protein_id gnl|my_center|LOCUS_04750 6724 7329 gene locus_tag LOCUS_04760 6724 7329 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208431.1 protein_id gnl|my_center|LOCUS_04760 7352 7882 gene locus_tag LOCUS_04770 7352 7882 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208432.1 protein_id gnl|my_center|LOCUS_04770 8021 8689 gene locus_tag LOCUS_04780 gene tsaB 8021 8689 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208433.1 protein_id gnl|my_center|LOCUS_04780 8692 9516 gene locus_tag LOCUS_04790 8692 9516 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_04790 9510 10319 gene locus_tag LOCUS_04800 9510 10319 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208434.1 protein_id gnl|my_center|LOCUS_04800 10511 11956 gene locus_tag LOCUS_04810 10511 11956 CDS product C13 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208435.1 protein_id gnl|my_center|LOCUS_04810 11925 12770 gene locus_tag LOCUS_04820 gene fghA 11925 12770 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208436.1 protein_id gnl|my_center|LOCUS_04820 13075 12800 gene locus_tag LOCUS_04830 13075 12800 CDS product DUF2218 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843456.1 protein_id gnl|my_center|LOCUS_04830 13258 13944 gene locus_tag LOCUS_04840 gene rpe 13258 13944 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043044.1 protein_id gnl|my_center|LOCUS_04840 14301 14726 gene locus_tag LOCUS_04850 14301 14726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 14828 16648 gene locus_tag LOCUS_04860 14828 16648 CDS product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208439.1 protein_id gnl|my_center|LOCUS_04860 16635 17525 gene locus_tag LOCUS_04870 16635 17525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 17608 18114 gene locus_tag LOCUS_04880 17608 18114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 18116 18658 gene locus_tag LOCUS_04890 18116 18658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207794.1 protein_id gnl|my_center|LOCUS_04890 18818 19135 gene locus_tag LOCUS_04900 18818 19135 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115842.1 protein_id gnl|my_center|LOCUS_04900 19202 19690 gene locus_tag LOCUS_04910 19202 19690 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208442.1 protein_id gnl|my_center|LOCUS_04910 >Feature sequence019 811 374 gene locus_tag LOCUS_04920 811 374 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207360.1 protein_id gnl|my_center|LOCUS_04920 1716 850 gene locus_tag LOCUS_04930 1716 850 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206939.1 protein_id gnl|my_center|LOCUS_04930 1885 2355 gene locus_tag LOCUS_04940 1885 2355 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193539.1 protein_id gnl|my_center|LOCUS_04940 3878 2550 gene locus_tag LOCUS_04950 3878 2550 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103653.1 protein_id gnl|my_center|LOCUS_04950 6286 3887 gene locus_tag LOCUS_04960 6286 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 9577 6317 gene locus_tag LOCUS_04970 9577 6317 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704238.1 protein_id gnl|my_center|LOCUS_04970 10530 9613 gene locus_tag LOCUS_04980 10530 9613 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947828.1 protein_id gnl|my_center|LOCUS_04980 12124 10751 gene locus_tag LOCUS_04990 12124 10751 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 protein_id gnl|my_center|LOCUS_04990 14442 12124 gene locus_tag LOCUS_05000 14442 12124 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038162489.1 protein_id gnl|my_center|LOCUS_05000 14758 15324 gene locus_tag LOCUS_05010 14758 15324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 15327 16031 gene locus_tag LOCUS_05020 15327 16031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206866.1 protein_id gnl|my_center|LOCUS_05020 15991 16470 gene locus_tag LOCUS_05030 15991 16470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 16770 16573 gene locus_tag LOCUS_05040 16770 16573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 17086 16721 gene locus_tag LOCUS_05050 17086 16721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 17857 17096 gene locus_tag LOCUS_05060 17857 17096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 18317 17922 gene locus_tag LOCUS_05070 18317 17922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119864.1 protein_id gnl|my_center|LOCUS_05070 >Feature sequence020 69 1118 gene locus_tag LOCUS_05080 69 1118 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207172.1 protein_id gnl|my_center|LOCUS_05080 1149 2477 gene locus_tag LOCUS_05090 1149 2477 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207171.1 protein_id gnl|my_center|LOCUS_05090 3169 2474 gene locus_tag LOCUS_05100 3169 2474 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207170.1 protein_id gnl|my_center|LOCUS_05100 3683 3183 gene locus_tag LOCUS_05110 3683 3183 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207169.1 protein_id gnl|my_center|LOCUS_05110 4358 3768 gene locus_tag LOCUS_05120 4358 3768 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207168.1 protein_id gnl|my_center|LOCUS_05120 5337 4513 gene locus_tag LOCUS_05130 gene pcaU 5337 4513 CDS product IclR family transcriptional regulator PcaU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120879.1 protein_id gnl|my_center|LOCUS_05130 5588 6274 gene locus_tag LOCUS_05140 5588 6274 CDS product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206898.1 protein_id gnl|my_center|LOCUS_05140 6286 6939 gene locus_tag LOCUS_05150 6286 6939 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206933.1 protein_id gnl|my_center|LOCUS_05150 7341 8549 gene locus_tag LOCUS_05160 gene pcaF 7341 8549 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206932.1 protein_id gnl|my_center|LOCUS_05160 8558 9913 gene locus_tag LOCUS_05170 8558 9913 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206931.1 protein_id gnl|my_center|LOCUS_05170 9910 10695 gene locus_tag LOCUS_05180 gene pcaD 9910 10695 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206930.1 protein_id gnl|my_center|LOCUS_05180 10738 12090 gene locus_tag LOCUS_05190 10738 12090 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206929.1 protein_id gnl|my_center|LOCUS_05190 12117 12530 gene locus_tag LOCUS_05200 gene pcaC 12117 12530 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004701356.1 protein_id gnl|my_center|LOCUS_05200 12541 13266 gene locus_tag LOCUS_05210 gene pcaH 12541 13266 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077913.1 protein_id gnl|my_center|LOCUS_05210 13281 13910 gene locus_tag LOCUS_05220 gene pcaG 13281 13910 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206928.1 protein_id gnl|my_center|LOCUS_05220 13989 14828 gene locus_tag LOCUS_05230 gene aroD 13989 14828 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206927.1 protein_id gnl|my_center|LOCUS_05230 14847 16307 gene locus_tag LOCUS_05240 14847 16307 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206926.1 protein_id gnl|my_center|LOCUS_05240 16368 17696 gene locus_tag LOCUS_05250 16368 17696 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206925.1 protein_id gnl|my_center|LOCUS_05250 >Feature sequence021 <1 869 gene locus_tag LOCUS_05260 <1 869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005071840.1:methylisocitrate lyase 1045 2202 gene locus_tag LOCUS_05270 gene prpC 1045 2202 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097521.1 protein_id gnl|my_center|LOCUS_05270 2204 4825 gene locus_tag LOCUS_05280 gene acnD 2204 4825 CDS product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208069.1 protein_id gnl|my_center|LOCUS_05280 4927 5145 gene locus_tag LOCUS_05290 4927 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 5213 6151 gene locus_tag LOCUS_05300 5213 6151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 6533 7108 gene locus_tag LOCUS_05310 6533 7108 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 protein_id gnl|my_center|LOCUS_05310 7257 8213 gene locus_tag LOCUS_05320 7257 8213 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113106.1 protein_id gnl|my_center|LOCUS_05320 8414 9271 gene locus_tag LOCUS_05330 8414 9271 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219805.1 protein_id gnl|my_center|LOCUS_05330 10031 10831 gene locus_tag LOCUS_05340 gene dapB 10031 10831 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861884.1 protein_id gnl|my_center|LOCUS_05340 10953 11618 gene locus_tag LOCUS_05350 10953 11618 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208085.1 protein_id gnl|my_center|LOCUS_05350 11643 12128 gene locus_tag LOCUS_05360 11643 12128 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931149.1 protein_id gnl|my_center|LOCUS_05360 12255 12620 gene locus_tag LOCUS_05370 12255 12620 CDS product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079563.1 protein_id gnl|my_center|LOCUS_05370 14765 12729 gene locus_tag LOCUS_05380 14765 12729 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208087.1 protein_id gnl|my_center|LOCUS_05380 14845 15993 gene locus_tag LOCUS_05390 14845 15993 CDS product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208088.1 protein_id gnl|my_center|LOCUS_05390 16543 16073 gene locus_tag LOCUS_05400 16543 16073 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208089.1 protein_id gnl|my_center|LOCUS_05400 >Feature sequence022 1241 96 gene locus_tag LOCUS_05410 1241 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 3379 1310 gene locus_tag LOCUS_05420 gene glyS 3379 1310 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207776.1 protein_id gnl|my_center|LOCUS_05420 4368 3379 gene locus_tag LOCUS_05430 gene glyQ 4368 3379 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002044989.1 protein_id gnl|my_center|LOCUS_05430 5093 6355 gene locus_tag LOCUS_05440 5093 6355 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207773.1 protein_id gnl|my_center|LOCUS_05440 6358 7152 gene locus_tag LOCUS_05450 6358 7152 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207772.1 protein_id gnl|my_center|LOCUS_05450 7308 8576 gene locus_tag LOCUS_05460 7308 8576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 10076 8661 gene locus_tag LOCUS_05470 10076 8661 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010359883.1 protein_id gnl|my_center|LOCUS_05470 10580 11683 gene locus_tag LOCUS_05480 10580 11683 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117107.1 protein_id gnl|my_center|LOCUS_05480 12024 11755 gene locus_tag LOCUS_05490 12024 11755 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207771.1 protein_id gnl|my_center|LOCUS_05490 12425 13039 gene locus_tag LOCUS_05500 12425 13039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207770.1 protein_id gnl|my_center|LOCUS_05500 14911 13088 gene locus_tag LOCUS_05510 14911 13088 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116803.1 protein_id gnl|my_center|LOCUS_05510 >Feature sequence023 801 400 gene locus_tag LOCUS_05520 801 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 1965 970 gene locus_tag LOCUS_05530 gene ruvB 1965 970 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002052424.1 protein_id gnl|my_center|LOCUS_05530 2586 1984 gene locus_tag LOCUS_05540 gene ruvA 2586 1984 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118762.1 protein_id gnl|my_center|LOCUS_05540 3017 2694 gene locus_tag LOCUS_05550 3017 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 4383 3043 gene locus_tag LOCUS_05560 4383 3043 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207388.1 protein_id gnl|my_center|LOCUS_05560 4382 4594 gene locus_tag LOCUS_05570 4382 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 4780 8610 gene locus_tag LOCUS_05580 gene purL 4780 8610 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207387.1 protein_id gnl|my_center|LOCUS_05580 8708 9367 gene locus_tag LOCUS_05590 8708 9367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 9648 9962 gene locus_tag LOCUS_05600 9648 9962 CDS product NIF3 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207385.1 protein_id gnl|my_center|LOCUS_05600 10727 9963 gene locus_tag LOCUS_05610 10727 9963 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993299.1 protein_id gnl|my_center|LOCUS_05610 12642 10921 gene locus_tag LOCUS_05620 12642 10921 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206968.1 protein_id gnl|my_center|LOCUS_05620 13579 12629 gene locus_tag LOCUS_05630 gene pfkB 13579 12629 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206967.1 protein_id gnl|my_center|LOCUS_05630 16424 13572 gene locus_tag LOCUS_05640 gene ptsP 16424 13572 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206966.1 protein_id gnl|my_center|LOCUS_05640 >Feature sequence024 1353 193 gene locus_tag LOCUS_05650 1353 193 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876982.1 protein_id gnl|my_center|LOCUS_05650 1890 1540 gene locus_tag LOCUS_05660 1890 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 2442 1894 gene locus_tag LOCUS_05670 2442 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 2696 2445 gene locus_tag LOCUS_05680 2696 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 4330 2693 gene locus_tag LOCUS_05690 4330 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 4737 4333 gene locus_tag LOCUS_05700 4737 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 4937 5167 gene locus_tag LOCUS_05710 4937 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 5338 5111 gene locus_tag LOCUS_05720 5338 5111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 6099 5386 gene locus_tag LOCUS_05730 6099 5386 CDS product LexA family transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848748.1 protein_id gnl|my_center|LOCUS_05730 6230 6463 gene locus_tag LOCUS_05740 6230 6463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 6460 6723 gene locus_tag LOCUS_05750 6460 6723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 6844 7266 gene locus_tag LOCUS_05760 6844 7266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 7263 7436 gene locus_tag LOCUS_05770 7263 7436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 7433 8125 gene locus_tag LOCUS_05780 7433 8125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268017.1 protein_id gnl|my_center|LOCUS_05780 8122 9096 gene locus_tag LOCUS_05790 8122 9096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 9099 10499 gene locus_tag LOCUS_05800 gene dnaB 9099 10499 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119718.1 protein_id gnl|my_center|LOCUS_05800 10588 11115 gene locus_tag LOCUS_05810 10588 11115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 11206 11757 gene locus_tag LOCUS_05820 11206 11757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 11868 12014 gene locus_tag LOCUS_05830 11868 12014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 12098 12634 gene locus_tag LOCUS_05840 12098 12634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 12736 13116 gene locus_tag LOCUS_05850 12736 13116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 13217 13420 gene locus_tag LOCUS_05860 13217 13420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 13311 13511 gene locus_tag LOCUS_05870 13311 13511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 13514 13870 gene locus_tag LOCUS_05880 13514 13870 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938797.1 protein_id gnl|my_center|LOCUS_05880 14016 14507 gene locus_tag LOCUS_05890 14016 14507 CDS product phage terminase small subunit P27 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929175.1 protein_id gnl|my_center|LOCUS_05890 14517 16244 gene locus_tag LOCUS_05900 14517 16244 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088178.1 protein_id gnl|my_center|LOCUS_05900 >Feature sequence025 113 967 gene locus_tag LOCUS_05910 113 967 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000336721.1 protein_id gnl|my_center|LOCUS_05910 2318 1461 gene locus_tag LOCUS_05920 2318 1461 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909376.1 protein_id gnl|my_center|LOCUS_05920 3322 2315 gene locus_tag LOCUS_05930 3322 2315 CDS product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817430.1 protein_id gnl|my_center|LOCUS_05930 4149 3352 gene locus_tag LOCUS_05940 gene phnE 4149 3352 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267540.1 protein_id gnl|my_center|LOCUS_05940 5028 4168 gene locus_tag LOCUS_05950 gene phnD 5028 4168 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992009.1 protein_id gnl|my_center|LOCUS_05950 5827 5096 gene locus_tag LOCUS_05960 gene phnC 5827 5096 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258841.1 protein_id gnl|my_center|LOCUS_05960 7258 6155 gene locus_tag LOCUS_05970 gene xseA 7258 6155 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206230.1 protein_id gnl|my_center|LOCUS_05970 7690 10104 gene locus_tag LOCUS_05980 7690 10104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 10501 11430 gene locus_tag LOCUS_05990 10501 11430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 11492 12421 gene locus_tag LOCUS_06000 11492 12421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 12820 12494 gene locus_tag LOCUS_06010 12820 12494 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115102.1 protein_id gnl|my_center|LOCUS_06010 13439 14551 gene locus_tag LOCUS_06020 13439 14551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 14544 14888 gene locus_tag LOCUS_06030 14544 14888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 >Feature sequence026 447 1130 gene locus_tag LOCUS_06040 447 1130 CDS product pirin-like bicupin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207293.1 protein_id gnl|my_center|LOCUS_06040 2465 1668 gene locus_tag LOCUS_06050 2465 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 2690 2532 gene locus_tag LOCUS_06060 2690 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 2842 3126 gene locus_tag LOCUS_06070 2842 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 4146 3232 gene locus_tag LOCUS_06080 4146 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 4402 4121 gene locus_tag LOCUS_06090 4402 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 6069 4648 gene locus_tag LOCUS_06100 6069 4648 CDS product DUF4041 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195116.1 protein_id gnl|my_center|LOCUS_06100 6124 6348 gene locus_tag LOCUS_06110 6124 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 6358 7011 gene locus_tag LOCUS_06120 6358 7011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 7132 7365 gene locus_tag LOCUS_06130 7132 7365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 8068 7526 gene locus_tag LOCUS_06140 8068 7526 CDS product glycosyl hydrolase 108 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206231.1 protein_id gnl|my_center|LOCUS_06140 8528 8334 gene locus_tag LOCUS_06150 8528 8334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 9110 8715 gene locus_tag LOCUS_06160 9110 8715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119864.1 protein_id gnl|my_center|LOCUS_06160 9211 9456 gene locus_tag LOCUS_06170 9211 9456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 9657 9581 gene locus_tag LOCUS_t00080 9657 9581 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11681 9693 gene locus_tag LOCUS_06180 11681 9693 CDS product DUF3488 and DUF4129 domain-containing transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463435.1 protein_id gnl|my_center|LOCUS_06180 12601 11684 gene locus_tag LOCUS_06190 12601 11684 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072204.1 protein_id gnl|my_center|LOCUS_06190 13575 12616 gene locus_tag LOCUS_06200 13575 12616 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738027.1 protein_id gnl|my_center|LOCUS_06200 13964 13662 gene locus_tag LOCUS_06210 13964 13662 CDS product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980869.1 protein_id gnl|my_center|LOCUS_06210 15424 13967 gene locus_tag LOCUS_06220 15424 13967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 >Feature sequence027 <1 1145 gene locus_tag LOCUS_06230 <1 1145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206118.1:NADPH-dependent 2,4-dienoyl-CoA reductase 1232 1321 gene locus_tag LOCUS_t00090 1232 1321 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2667 1597 gene locus_tag LOCUS_06240 2667 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 3884 2667 gene locus_tag LOCUS_06250 3884 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 4481 4260 gene locus_tag LOCUS_06260 4481 4260 CDS product AlpA family phage regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071638.1 protein_id gnl|my_center|LOCUS_06260 6084 4819 gene locus_tag LOCUS_06270 6084 4819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 6796 6476 gene locus_tag LOCUS_06280 6796 6476 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115102.1 protein_id gnl|my_center|LOCUS_06280 7416 8528 gene locus_tag LOCUS_06290 7416 8528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 8521 8865 gene locus_tag LOCUS_06300 8521 8865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 8971 9492 gene locus_tag LOCUS_06310 8971 9492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 9786 10433 gene locus_tag LOCUS_06320 9786 10433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 10470 10826 gene locus_tag LOCUS_06330 10470 10826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 11083 11505 gene locus_tag LOCUS_06340 11083 11505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 11550 12623 gene locus_tag LOCUS_06350 11550 12623 CDS product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705015.1 protein_id gnl|my_center|LOCUS_06350 12855 13982 gene locus_tag LOCUS_06360 12855 13982 CDS product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705014.1 protein_id gnl|my_center|LOCUS_06360 >Feature sequence028 <1 1157 gene locus_tag LOCUS_06370 <1 1157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206612.1:ABC transporter substrate-binding protein 1172 2983 gene locus_tag LOCUS_06380 1172 2983 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206613.1 protein_id gnl|my_center|LOCUS_06380 3005 5020 gene locus_tag LOCUS_06390 3005 5020 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206614.1 protein_id gnl|my_center|LOCUS_06390 5032 5970 gene locus_tag LOCUS_06400 5032 5970 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069490.1 protein_id gnl|my_center|LOCUS_06400 5978 7120 gene locus_tag LOCUS_06410 5978 7120 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206615.1 protein_id gnl|my_center|LOCUS_06410 7135 8865 gene locus_tag LOCUS_06420 7135 8865 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206616.1 protein_id gnl|my_center|LOCUS_06420 9862 8918 gene locus_tag LOCUS_06430 9862 8918 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120431.1 protein_id gnl|my_center|LOCUS_06430 10503 9904 gene locus_tag LOCUS_06440 gene scpB 10503 9904 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120355.1 protein_id gnl|my_center|LOCUS_06440 11294 10500 gene locus_tag LOCUS_06450 11294 10500 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070982.1 protein_id gnl|my_center|LOCUS_06450 11539 12258 gene locus_tag LOCUS_06460 11539 12258 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816567.1 protein_id gnl|my_center|LOCUS_06460 12459 12941 gene locus_tag LOCUS_06470 12459 12941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 13013 13573 gene locus_tag LOCUS_06480 13013 13573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 14202 13585 gene locus_tag LOCUS_06490 14202 13585 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205941.1 protein_id gnl|my_center|LOCUS_06490 >Feature sequence029 <1 759 gene locus_tag LOCUS_06500 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014205991.1:FAD-dependent oxidoreductase 1653 745 gene locus_tag LOCUS_06510 1653 745 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205990.1 protein_id gnl|my_center|LOCUS_06510 2174 1728 gene locus_tag LOCUS_06520 2174 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 2673 3050 gene locus_tag LOCUS_06530 2673 3050 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205987.1 protein_id gnl|my_center|LOCUS_06530 3088 3483 gene locus_tag LOCUS_06540 3088 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 4330 3548 gene locus_tag LOCUS_06550 4330 3548 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086719.1 protein_id gnl|my_center|LOCUS_06550 4801 6840 gene locus_tag LOCUS_06560 gene betT 4801 6840 CDS product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096496.1 protein_id gnl|my_center|LOCUS_06560 7008 8258 gene locus_tag LOCUS_06570 7008 8258 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205985.1 protein_id gnl|my_center|LOCUS_06570 8268 11864 gene locus_tag LOCUS_06580 8268 11864 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205984.1 protein_id gnl|my_center|LOCUS_06580 12547 11861 gene locus_tag LOCUS_06590 12547 11861 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205983.1 protein_id gnl|my_center|LOCUS_06590 >Feature sequence030 699 349 gene locus_tag LOCUS_06600 699 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 850 1533 gene locus_tag LOCUS_06610 850 1533 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186914724.1 protein_id gnl|my_center|LOCUS_06610 1523 2899 gene locus_tag LOCUS_06620 gene pcoS 1523 2899 CDS product copper resistance membrane spanning protein PcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211180.1 protein_id gnl|my_center|LOCUS_06620 5318 2973 gene locus_tag LOCUS_06630 5318 2973 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921601.1 protein_id gnl|my_center|LOCUS_06630 5596 5976 gene locus_tag LOCUS_06640 gene yobA 5596 5976 CDS product CopC domain-containing protein YobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042893410.1 protein_id gnl|my_center|LOCUS_06640 6043 6924 gene locus_tag LOCUS_06650 6043 6924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 8045 7113 gene locus_tag LOCUS_06660 8045 7113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042012908.1 protein_id gnl|my_center|LOCUS_06660 9227 8184 gene locus_tag LOCUS_06670 9227 8184 CDS product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705014.1 protein_id gnl|my_center|LOCUS_06670 10416 9370 gene locus_tag LOCUS_06680 10416 9370 CDS product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705015.1 protein_id gnl|my_center|LOCUS_06680 10804 10505 gene locus_tag LOCUS_06690 10804 10505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 11317 10937 gene locus_tag LOCUS_06700 11317 10937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 11910 11329 gene locus_tag LOCUS_06710 11910 11329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 12194 11928 gene locus_tag LOCUS_06720 12194 11928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 13071 12982 gene locus_tag LOCUS_t00100 13071 12982 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence031 1173 310 gene locus_tag LOCUS_06730 1173 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 3073 1454 gene locus_tag LOCUS_06740 3073 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 4635 3130 gene locus_tag LOCUS_06750 4635 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 5079 5429 gene locus_tag LOCUS_06760 5079 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 6268 5444 gene locus_tag LOCUS_06770 6268 5444 CDS product DUF6502 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207485.1 protein_id gnl|my_center|LOCUS_06770 7009 7437 gene locus_tag LOCUS_06780 7009 7437 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207251.1 protein_id gnl|my_center|LOCUS_06780 7861 9369 gene locus_tag LOCUS_06790 7861 9369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206056.1 protein_id gnl|my_center|LOCUS_06790 11142 9445 gene locus_tag LOCUS_06800 11142 9445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 12525 11452 gene locus_tag LOCUS_06810 12525 11452 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113970.1 protein_id gnl|my_center|LOCUS_06810 >Feature sequence032 208 753 gene locus_tag LOCUS_06820 208 753 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060300.1 protein_id gnl|my_center|LOCUS_06820 2701 803 gene locus_tag LOCUS_06830 2701 803 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208297.1 protein_id gnl|my_center|LOCUS_06830 2734 2979 gene locus_tag LOCUS_06840 2734 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 3075 3524 gene locus_tag LOCUS_06850 3075 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004842579.1 protein_id gnl|my_center|LOCUS_06850 3558 6197 gene locus_tag LOCUS_06860 gene topA 3558 6197 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208301.1 protein_id gnl|my_center|LOCUS_06860 6287 7045 gene locus_tag LOCUS_06870 6287 7045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208302.1 protein_id gnl|my_center|LOCUS_06870 7245 7817 gene locus_tag LOCUS_06880 7245 7817 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208303.1 protein_id gnl|my_center|LOCUS_06880 7939 9918 gene locus_tag LOCUS_06890 7939 9918 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208304.1 protein_id gnl|my_center|LOCUS_06890 9958 10227 gene locus_tag LOCUS_06900 9958 10227 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115113.1 protein_id gnl|my_center|LOCUS_06900 10234 10590 gene locus_tag LOCUS_06910 10234 10590 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208305.1 protein_id gnl|my_center|LOCUS_06910 10666 11169 gene locus_tag LOCUS_06920 10666 11169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114779.1 protein_id gnl|my_center|LOCUS_06920 11283 11561 gene locus_tag LOCUS_06930 11283 11561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114792.1 protein_id gnl|my_center|LOCUS_06930 <13158 11621 gene locus_tag LOCUS_06940 <13158 11621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005079171.1:cation:proton antiporter >Feature sequence033 2078 3064 gene locus_tag LOCUS_06950 2078 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036006.1 protein_id gnl|my_center|LOCUS_06950 3219 3905 gene locus_tag LOCUS_06960 3219 3905 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206160.1 protein_id gnl|my_center|LOCUS_06960 4890 3946 gene locus_tag LOCUS_06970 4890 3946 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206161.1 protein_id gnl|my_center|LOCUS_06970 5979 4903 gene locus_tag LOCUS_06980 5979 4903 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206162.1 protein_id gnl|my_center|LOCUS_06980 7361 6174 gene locus_tag LOCUS_06990 7361 6174 CDS product OprD family outer membrane porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206163.1 protein_id gnl|my_center|LOCUS_06990 8325 7363 gene locus_tag LOCUS_07000 8325 7363 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206164.1 protein_id gnl|my_center|LOCUS_07000 10012 8336 gene locus_tag LOCUS_07010 10012 8336 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206165.1 protein_id gnl|my_center|LOCUS_07010 10243 10067 gene locus_tag LOCUS_07020 10243 10067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 10411 11757 gene locus_tag LOCUS_07030 10411 11757 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206166.1 protein_id gnl|my_center|LOCUS_07030 >Feature sequence034 <1 773 gene locus_tag LOCUS_07040 <1 773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088575.1:aldehyde reductase 2840 816 gene locus_tag LOCUS_07050 gene ligA 2840 816 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205932.1 protein_id gnl|my_center|LOCUS_07050 3928 2915 gene locus_tag LOCUS_07060 3928 2915 CDS product cell division protein ZipA C-terminal FtsZ-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205931.1 protein_id gnl|my_center|LOCUS_07060 7433 3930 gene locus_tag LOCUS_07070 gene smc 7433 3930 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205930.1 protein_id gnl|my_center|LOCUS_07070 8150 7455 gene locus_tag LOCUS_07080 8150 7455 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120391.1 protein_id gnl|my_center|LOCUS_07080 9360 8560 gene locus_tag LOCUS_07090 9360 8560 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205929.1 protein_id gnl|my_center|LOCUS_07090 9390 10142 gene locus_tag LOCUS_07100 9390 10142 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205928.1 protein_id gnl|my_center|LOCUS_07100 10158 10901 gene locus_tag LOCUS_07110 10158 10901 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071015.1 protein_id gnl|my_center|LOCUS_07110 11458 10871 gene locus_tag LOCUS_07120 11458 10871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 <12411 11621 gene locus_tag LOCUS_07130 <12411 11621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002120334.1:signal recognition particle protein >Feature sequence035 1395 349 gene locus_tag LOCUS_07140 gene rtcA 1395 349 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306323.1 protein_id gnl|my_center|LOCUS_07140 2112 1654 gene locus_tag LOCUS_07150 2112 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 2558 2115 gene locus_tag LOCUS_07160 2558 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 3834 2563 gene locus_tag LOCUS_07170 3834 2563 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112811.1 protein_id gnl|my_center|LOCUS_07170 5078 4113 gene locus_tag LOCUS_07180 5078 4113 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207210.1 protein_id gnl|my_center|LOCUS_07180 5146 6744 gene locus_tag LOCUS_07190 gene rtcR 5146 6744 CDS product RNA repair transcriptional activator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112813.1 protein_id gnl|my_center|LOCUS_07190 7824 6748 gene locus_tag LOCUS_07200 7824 6748 CDS product DUF2157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704683.1 protein_id gnl|my_center|LOCUS_07200 8544 7915 gene locus_tag LOCUS_07210 8544 7915 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207209.1 protein_id gnl|my_center|LOCUS_07210 8669 9442 gene locus_tag LOCUS_07220 gene yaaA 8669 9442 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207208.1 protein_id gnl|my_center|LOCUS_07220 9473 9733 gene locus_tag LOCUS_07230 9473 9733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 9746 10360 gene locus_tag LOCUS_07240 9746 10360 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207207.1 protein_id gnl|my_center|LOCUS_07240 10458 10775 gene locus_tag LOCUS_07250 10458 10775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 11749 10964 gene locus_tag LOCUS_07260 11749 10964 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154366.1 protein_id gnl|my_center|LOCUS_07260 11973 11776 gene locus_tag LOCUS_07270 gene thiS 11973 11776 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115323.1 protein_id gnl|my_center|LOCUS_07270 >Feature sequence036 <1 968 gene locus_tag LOCUS_07280 <1 968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206539.1:SfnB family sulfur acquisition oxidoreductase 982 2205 gene locus_tag LOCUS_07290 982 2205 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206538.1 protein_id gnl|my_center|LOCUS_07290 2205 3617 gene locus_tag LOCUS_07300 2205 3617 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206537.1 protein_id gnl|my_center|LOCUS_07300 3642 4472 gene locus_tag LOCUS_07310 3642 4472 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206536.1 protein_id gnl|my_center|LOCUS_07310 4484 5554 gene locus_tag LOCUS_07320 4484 5554 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206534.1 protein_id gnl|my_center|LOCUS_07320 5535 6194 gene locus_tag LOCUS_07330 5535 6194 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069679.1 protein_id gnl|my_center|LOCUS_07330 6294 7385 gene locus_tag LOCUS_07340 gene ychF 6294 7385 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002050104.1 protein_id gnl|my_center|LOCUS_07340 7983 7450 gene locus_tag LOCUS_07350 7983 7450 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206533.1 protein_id gnl|my_center|LOCUS_07350 8090 8794 gene locus_tag LOCUS_07360 8090 8794 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206532.1 protein_id gnl|my_center|LOCUS_07360 10022 8892 gene locus_tag LOCUS_07370 10022 8892 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_07370 10851 10387 gene locus_tag LOCUS_07380 10851 10387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483316.1 protein_id gnl|my_center|LOCUS_07380 11150 11539 gene locus_tag LOCUS_07390 11150 11539 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206529.1 protein_id gnl|my_center|LOCUS_07390 >Feature sequence037 1691 2680 gene locus_tag LOCUS_07400 1691 2680 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207107.1 protein_id gnl|my_center|LOCUS_07400 2771 3388 gene locus_tag LOCUS_07410 2771 3388 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113093.1 protein_id gnl|my_center|LOCUS_07410 3706 4659 gene locus_tag LOCUS_07420 3706 4659 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454520.1 protein_id gnl|my_center|LOCUS_07420 4652 5608 gene locus_tag LOCUS_07430 gene yclO 4652 5608 CDS product petrobactin ABC transporter permease YclO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246705.1 protein_id gnl|my_center|LOCUS_07430 5599 6363 gene locus_tag LOCUS_07440 gene yclP 5599 6363 CDS product petrobactin ABC transporter ATP-binding protein YclP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234487.1 protein_id gnl|my_center|LOCUS_07440 6373 7323 gene locus_tag LOCUS_07450 gene yclQ 6373 7323 CDS product petrobactin ABC transporter substrate-binding protein YclQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246619.1 protein_id gnl|my_center|LOCUS_07450 8528 7368 gene locus_tag LOCUS_07460 8528 7368 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207106.1 protein_id gnl|my_center|LOCUS_07460 8798 9610 gene locus_tag LOCUS_07470 8798 9610 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207105.1 protein_id gnl|my_center|LOCUS_07470 10269 9685 gene locus_tag LOCUS_07480 10269 9685 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206379.1 protein_id gnl|my_center|LOCUS_07480 10431 10625 gene locus_tag LOCUS_07490 10431 10625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 >Feature sequence038 <1 896 gene locus_tag LOCUS_07500 <1 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002114135.1:NAD-dependent malic enzyme 1612 2163 gene locus_tag LOCUS_07510 1612 2163 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117499.1 protein_id gnl|my_center|LOCUS_07510 2296 2811 gene locus_tag LOCUS_07520 2296 2811 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070756.1 protein_id gnl|my_center|LOCUS_07520 3127 2939 gene locus_tag LOCUS_07530 3127 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 3599 4603 gene locus_tag LOCUS_07540 3599 4603 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206022.1 protein_id gnl|my_center|LOCUS_07540 4671 5201 gene locus_tag LOCUS_07550 4671 5201 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075397.1 protein_id gnl|my_center|LOCUS_07550 5294 5635 gene locus_tag LOCUS_07560 5294 5635 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117532.1 protein_id gnl|my_center|LOCUS_07560 6002 6397 gene locus_tag LOCUS_07570 6002 6397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 6558 6473 gene locus_tag LOCUS_t00110 6558 6473 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6767 8527 gene locus_tag LOCUS_07580 6767 8527 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207455.1 protein_id gnl|my_center|LOCUS_07580 8734 8649 gene locus_tag LOCUS_t00120 8734 8649 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8816 8743 gene locus_tag LOCUS_t00130 8816 8743 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 8969 9817 gene locus_tag LOCUS_07590 gene folD 8969 9817 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207454.1 protein_id gnl|my_center|LOCUS_07590 9873 10541 gene locus_tag LOCUS_07600 9873 10541 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207453.1 protein_id gnl|my_center|LOCUS_07600 10698 10982 gene locus_tag LOCUS_07610 10698 10982 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025680.1 protein_id gnl|my_center|LOCUS_07610 11463 11041 gene locus_tag LOCUS_07620 11463 11041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115580.1 protein_id gnl|my_center|LOCUS_07620 >Feature sequence039 468 1991 gene locus_tag LOCUS_07630 gene murD 468 1991 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203798.1 protein_id gnl|my_center|LOCUS_07630 1988 3250 gene locus_tag LOCUS_07640 gene ftsW 1988 3250 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194175.1 protein_id gnl|my_center|LOCUS_07640 3247 4329 gene locus_tag LOCUS_07650 gene murG 3247 4329 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039095.1 protein_id gnl|my_center|LOCUS_07650 4326 5762 gene locus_tag LOCUS_07660 gene murC 4326 5762 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814572.1 protein_id gnl|my_center|LOCUS_07660 5759 6781 gene locus_tag LOCUS_07670 5759 6781 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814571.1 protein_id gnl|my_center|LOCUS_07670 6786 7592 gene locus_tag LOCUS_07680 6786 7592 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522020.1 protein_id gnl|my_center|LOCUS_07680 7599 8828 gene locus_tag LOCUS_07690 gene ftsA 7599 8828 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194020.1 protein_id gnl|my_center|LOCUS_07690 8950 10176 gene locus_tag LOCUS_07700 gene ftsZ 8950 10176 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194380.1 protein_id gnl|my_center|LOCUS_07700 10273 11220 gene locus_tag LOCUS_07710 gene lpxC 10273 11220 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194158.1 protein_id gnl|my_center|LOCUS_07710 >Feature sequence040 <1 1367 gene locus_tag LOCUS_07720 <1 1367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002121274.1:long-chain-fatty-acid--CoA ligase 1845 1459 gene locus_tag LOCUS_07730 1845 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208156.1 protein_id gnl|my_center|LOCUS_07730 2013 2411 gene locus_tag LOCUS_07740 2013 2411 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208157.1 protein_id gnl|my_center|LOCUS_07740 2531 3058 gene locus_tag LOCUS_07750 gene ppa 2531 3058 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121243.1 protein_id gnl|my_center|LOCUS_07750 4438 3164 gene locus_tag LOCUS_07760 4438 3164 CDS product OprD family outer membrane porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208158.1 protein_id gnl|my_center|LOCUS_07760 5174 5947 gene locus_tag LOCUS_07770 5174 5947 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208160.1 protein_id gnl|my_center|LOCUS_07770 6393 7181 gene locus_tag LOCUS_07780 6393 7181 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070887.1 protein_id gnl|my_center|LOCUS_07780 8749 7223 gene locus_tag LOCUS_07790 8749 7223 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208165.1 protein_id gnl|my_center|LOCUS_07790 9007 8780 gene locus_tag LOCUS_07800 9007 8780 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121136.1 protein_id gnl|my_center|LOCUS_07800 9283 9621 gene locus_tag LOCUS_07810 gene glnK 9283 9621 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_07810 9690 11075 gene locus_tag LOCUS_07820 9690 11075 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208166.1 protein_id gnl|my_center|LOCUS_07820 >Feature sequence041 <1 2051 gene locus_tag LOCUS_07830 <1 2051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014205915.1:methionine--tRNA ligase 3169 2147 gene locus_tag LOCUS_07840 3169 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 4008 3391 gene locus_tag LOCUS_07850 4008 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 4163 5140 gene locus_tag LOCUS_07860 4163 5140 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207446.1 protein_id gnl|my_center|LOCUS_07860 5821 5198 gene locus_tag LOCUS_07870 5821 5198 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205912.1 protein_id gnl|my_center|LOCUS_07870 6007 6555 gene locus_tag LOCUS_07880 6007 6555 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120318.1 protein_id gnl|my_center|LOCUS_07880 6569 8224 gene locus_tag LOCUS_07890 6569 8224 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205911.1 protein_id gnl|my_center|LOCUS_07890 8246 9409 gene locus_tag LOCUS_07900 8246 9409 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205910.1 protein_id gnl|my_center|LOCUS_07900 9508 9750 gene locus_tag LOCUS_07910 9508 9750 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074401.1 protein_id gnl|my_center|LOCUS_07910 9743 10036 gene locus_tag LOCUS_07920 9743 10036 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074402.1 protein_id gnl|my_center|LOCUS_07920 >Feature sequence042 99 2252 gene locus_tag LOCUS_07930 gene yccS 99 2252 CDS product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207796.1 protein_id gnl|my_center|LOCUS_07930 3506 2274 gene locus_tag LOCUS_07940 3506 2274 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207797.1 protein_id gnl|my_center|LOCUS_07940 4218 3847 gene locus_tag LOCUS_07950 4218 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207798.1 protein_id gnl|my_center|LOCUS_07950 4483 4256 gene locus_tag LOCUS_07960 4483 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 4401 5273 gene locus_tag LOCUS_07970 4401 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 5380 5970 gene locus_tag LOCUS_07980 5380 5970 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207799.1 protein_id gnl|my_center|LOCUS_07980 5983 6297 gene locus_tag LOCUS_07990 5983 6297 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207800.1 protein_id gnl|my_center|LOCUS_07990 7361 6600 gene locus_tag LOCUS_08000 7361 6600 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246492.1 protein_id gnl|my_center|LOCUS_08000 8869 7397 gene locus_tag LOCUS_08010 8869 7397 CDS product AbiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207803.1 protein_id gnl|my_center|LOCUS_08010 <10147 8946 gene locus_tag LOCUS_08020 <10147 8946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004789757.1:FAD-binding oxidoreductase >Feature sequence043 926 2203 gene locus_tag LOCUS_08030 926 2203 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938417.1 protein_id gnl|my_center|LOCUS_08030 2532 3851 gene locus_tag LOCUS_08040 2532 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 3984 4217 gene locus_tag LOCUS_08050 3984 4217 CDS product AlpA family phage regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071638.1 protein_id gnl|my_center|LOCUS_08050 4606 5787 gene locus_tag LOCUS_08060 4606 5787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 5784 6848 gene locus_tag LOCUS_08070 5784 6848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 7489 7304 gene locus_tag LOCUS_08080 7489 7304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 7959 7669 gene locus_tag LOCUS_08090 7959 7669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 9080 8187 gene locus_tag LOCUS_08100 9080 8187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 <10139 9067 gene locus_tag LOCUS_08110 <10139 9067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208439.1:copper resistance system multicopper oxidase >Feature sequence044 <1 1193 gene locus_tag LOCUS_08120 <1 1193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207736.1:TRAP transporter large permease subunit 2127 1336 gene locus_tag LOCUS_08130 2127 1336 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181015.1 protein_id gnl|my_center|LOCUS_08130 3075 2296 gene locus_tag LOCUS_08140 3075 2296 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098431.1 protein_id gnl|my_center|LOCUS_08140 3266 4108 gene locus_tag LOCUS_08150 3266 4108 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209722.1 protein_id gnl|my_center|LOCUS_08150 4609 4157 gene locus_tag LOCUS_08160 4609 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207735.1 protein_id gnl|my_center|LOCUS_08160 4829 4623 gene locus_tag LOCUS_08170 4829 4623 CDS product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117042.1 protein_id gnl|my_center|LOCUS_08170 6907 4868 gene locus_tag LOCUS_08180 6907 4868 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207734.1 protein_id gnl|my_center|LOCUS_08180 7570 6983 gene locus_tag LOCUS_08190 7570 6983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 <10075 7656 gene locus_tag LOCUS_08200 <10075 7656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207733.1:ribonuclease R >Feature sequence045 2314 1334 gene locus_tag LOCUS_08210 gene pheS 2314 1334 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117277.1 protein_id gnl|my_center|LOCUS_08210 2471 3469 gene locus_tag LOCUS_08220 2471 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208406.1 protein_id gnl|my_center|LOCUS_08220 3633 3466 gene locus_tag LOCUS_08230 3633 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 3905 4936 gene locus_tag LOCUS_08240 3905 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 5434 5075 gene locus_tag LOCUS_08250 gene rplT 5434 5075 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124858.1 protein_id gnl|my_center|LOCUS_08250 5640 5446 gene locus_tag LOCUS_08260 gene rpmI 5640 5446 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002054552.1 protein_id gnl|my_center|LOCUS_08260 6265 5837 gene locus_tag LOCUS_08270 6265 5837 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114414.1 protein_id gnl|my_center|LOCUS_08270 7183 6332 gene locus_tag LOCUS_08280 7183 6332 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556107.1 protein_id gnl|my_center|LOCUS_08280 7751 7305 gene locus_tag LOCUS_08290 7751 7305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 8368 7751 gene locus_tag LOCUS_08300 8368 7751 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208403.1 protein_id gnl|my_center|LOCUS_08300 8816 8499 gene locus_tag LOCUS_08310 8816 8499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207835.1 protein_id gnl|my_center|LOCUS_08310 >Feature sequence046 2092 386 gene locus_tag LOCUS_08320 2092 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 3470 2457 gene locus_tag LOCUS_08330 gene lipA 3470 2457 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207249.1 protein_id gnl|my_center|LOCUS_08330 3659 5074 gene locus_tag LOCUS_08340 gene sthA 3659 5074 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118117.1 protein_id gnl|my_center|LOCUS_08340 5155 5622 gene locus_tag LOCUS_08350 5155 5622 CDS product DUF3465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207244.1 protein_id gnl|my_center|LOCUS_08350 6115 5663 gene locus_tag LOCUS_08360 6115 5663 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118194.1 protein_id gnl|my_center|LOCUS_08360 6885 6274 gene locus_tag LOCUS_08370 6885 6274 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207241.1 protein_id gnl|my_center|LOCUS_08370 8219 7218 gene locus_tag LOCUS_08380 gene mltB 8219 7218 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207240.1 protein_id gnl|my_center|LOCUS_08380 <9323 8239 gene locus_tag LOCUS_08390 <9323 8239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005068220.1:rod shape-determining protein RodA >Feature sequence047 1745 225 gene locus_tag LOCUS_08400 1745 225 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206178.1 protein_id gnl|my_center|LOCUS_08400 2665 1841 gene locus_tag LOCUS_08410 2665 1841 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206179.1 protein_id gnl|my_center|LOCUS_08410 3677 2703 gene locus_tag LOCUS_08420 3677 2703 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070390.1 protein_id gnl|my_center|LOCUS_08420 4758 3799 gene locus_tag LOCUS_08430 4758 3799 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070390.1 protein_id gnl|my_center|LOCUS_08430 5179 5880 gene locus_tag LOCUS_08440 5179 5880 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163161.1 protein_id gnl|my_center|LOCUS_08440 6872 5844 gene locus_tag LOCUS_08450 6872 5844 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206173.1 protein_id gnl|my_center|LOCUS_08450 7071 6898 gene locus_tag LOCUS_08460 7071 6898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 7047 8537 gene locus_tag LOCUS_08470 7047 8537 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206172.1 protein_id gnl|my_center|LOCUS_08470 >Feature sequence048 593 961 gene locus_tag LOCUS_08480 593 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 1612 1310 gene locus_tag LOCUS_08490 1612 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 5515 1829 gene locus_tag LOCUS_08500 gene metH 5515 1829 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113602.1 protein_id gnl|my_center|LOCUS_08500 5952 7580 gene locus_tag LOCUS_08510 5952 7580 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206054.1 protein_id gnl|my_center|LOCUS_08510 7903 8397 gene locus_tag LOCUS_08520 7903 8397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 >Feature sequence049 <1 1123 gene locus_tag LOCUS_08530 <1 1123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206637.1:HAD family hydrolase 1201 1824 gene locus_tag LOCUS_08540 1201 1824 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206638.1 protein_id gnl|my_center|LOCUS_08540 1827 2345 gene locus_tag LOCUS_08550 gene cobU 1827 2345 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206639.1 protein_id gnl|my_center|LOCUS_08550 2347 3417 gene locus_tag LOCUS_08560 gene cobT 2347 3417 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206640.1 protein_id gnl|my_center|LOCUS_08560 3407 4015 gene locus_tag LOCUS_08570 3407 4015 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206641.1 protein_id gnl|my_center|LOCUS_08570 4122 5708 gene locus_tag LOCUS_08580 4122 5708 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206642.1 protein_id gnl|my_center|LOCUS_08580 5811 6554 gene locus_tag LOCUS_08590 5811 6554 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206643.1 protein_id gnl|my_center|LOCUS_08590 8082 6619 gene locus_tag LOCUS_08600 8082 6619 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963892.1 protein_id gnl|my_center|LOCUS_08600 <8705 8086 gene locus_tag LOCUS_08610 <8705 8086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000689344.1:TonB-dependent receptor PqqU >Feature sequence050 1220 2032 gene locus_tag LOCUS_08620 1220 2032 CDS product rRNA large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067912.1 protein_id gnl|my_center|LOCUS_08620 4353 2122 gene locus_tag LOCUS_08630 4353 2122 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400583.1 protein_id gnl|my_center|LOCUS_08630 5527 5048 gene locus_tag LOCUS_08640 5527 5048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 5917 5594 gene locus_tag LOCUS_08650 5917 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 6482 6216 gene locus_tag LOCUS_08660 6482 6216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 7061 6516 gene locus_tag LOCUS_08670 7061 6516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 8406 7576 gene locus_tag LOCUS_08680 8406 7576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 >Feature sequence051 824 255 gene locus_tag LOCUS_08690 824 255 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201417637.1 protein_id gnl|my_center|LOCUS_08690 2083 938 gene locus_tag LOCUS_08700 2083 938 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118240.1 protein_id gnl|my_center|LOCUS_08700 2240 3328 gene locus_tag LOCUS_08710 2240 3328 CDS product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207217.1 protein_id gnl|my_center|LOCUS_08710 4278 3397 gene locus_tag LOCUS_08720 4278 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 5374 4262 gene locus_tag LOCUS_08730 5374 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 8143 5378 gene locus_tag LOCUS_08740 8143 5378 CDS product type VI secretion system Vgr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206344.1 protein_id gnl|my_center|LOCUS_08740 >Feature sequence052 774 2906 gene locus_tag LOCUS_08750 774 2906 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207578.1 protein_id gnl|my_center|LOCUS_08750 3777 2974 gene locus_tag LOCUS_08760 3777 2974 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207576.1 protein_id gnl|my_center|LOCUS_08760 4361 4026 gene locus_tag LOCUS_08770 4361 4026 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122463.1 protein_id gnl|my_center|LOCUS_08770 4582 4349 gene locus_tag LOCUS_08780 4582 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 5396 4674 gene locus_tag LOCUS_08790 5396 4674 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207574.1 protein_id gnl|my_center|LOCUS_08790 5584 6030 gene locus_tag LOCUS_08800 5584 6030 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207573.1 protein_id gnl|my_center|LOCUS_08800 6089 6433 gene locus_tag LOCUS_08810 6089 6433 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116259.1 protein_id gnl|my_center|LOCUS_08810 6595 6930 gene locus_tag LOCUS_08820 6595 6930 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207563.1 protein_id gnl|my_center|LOCUS_08820 <8483 6997 gene locus_tag LOCUS_08830 <8483 6997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207562.1:proline--tRNA ligase >Feature sequence053 3026 171 gene locus_tag LOCUS_08840 3026 171 CDS product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208412.1 protein_id gnl|my_center|LOCUS_08840 3215 5980 gene locus_tag LOCUS_08850 gene polA 3215 5980 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208411.1 protein_id gnl|my_center|LOCUS_08850 6586 6038 gene locus_tag LOCUS_08860 6586 6038 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501183.1 protein_id gnl|my_center|LOCUS_08860 7442 6603 gene locus_tag LOCUS_08870 gene proC 7442 6603 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804294.1 protein_id gnl|my_center|LOCUS_08870 <8449 7446 gene locus_tag LOCUS_08880 <8449 7446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208410.1:tRNA lysidine(34) synthetase TilS >Feature sequence054 1044 376 gene locus_tag LOCUS_08890 1044 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 2377 1322 gene locus_tag LOCUS_08900 2377 1322 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207677.1 protein_id gnl|my_center|LOCUS_08900 2560 3477 gene locus_tag LOCUS_08910 gene hpxR 2560 3477 CDS product LysR family hpxDE operon transcriptional regulator HpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705425.1 protein_id gnl|my_center|LOCUS_08910 3619 4569 gene locus_tag LOCUS_08920 gene puuE 3619 4569 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207942.1 protein_id gnl|my_center|LOCUS_08920 4670 5251 gene locus_tag LOCUS_08930 4670 5251 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179664825.1 protein_id gnl|my_center|LOCUS_08930 6913 5459 gene locus_tag LOCUS_08940 6913 5459 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266553.1 protein_id gnl|my_center|LOCUS_08940 7704 6910 gene locus_tag LOCUS_08950 7704 6910 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531128.1 protein_id gnl|my_center|LOCUS_08950 <8418 7697 gene locus_tag LOCUS_08960 <8418 7697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531127.1:ABC transporter ATP-binding protein >Feature sequence055 <1 1298 gene locus_tag LOCUS_08970 <1 1298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002121221.1:DNA adenine methylase 1682 2518 gene locus_tag LOCUS_08980 1682 2518 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405433.1 protein_id gnl|my_center|LOCUS_08980 2684 3343 gene locus_tag LOCUS_08990 2684 3343 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005301612.1 protein_id gnl|my_center|LOCUS_08990 4018 3392 gene locus_tag LOCUS_09000 4018 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121184.1 protein_id gnl|my_center|LOCUS_09000 4461 4054 gene locus_tag LOCUS_09010 4461 4054 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121193.1 protein_id gnl|my_center|LOCUS_09010 5914 4466 gene locus_tag LOCUS_09020 5914 4466 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208168.1 protein_id gnl|my_center|LOCUS_09020 6072 7172 gene locus_tag LOCUS_09030 gene lptF 6072 7172 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208169.1 protein_id gnl|my_center|LOCUS_09030 7172 8242 gene locus_tag LOCUS_09040 gene lptG 7172 8242 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121203.1 protein_id gnl|my_center|LOCUS_09040 >Feature sequence056 655 242 gene locus_tag LOCUS_09050 655 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975153.1 protein_id gnl|my_center|LOCUS_09050 825 1322 gene locus_tag LOCUS_09060 825 1322 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116490.1 protein_id gnl|my_center|LOCUS_09060 1727 1362 gene locus_tag LOCUS_09070 1727 1362 CDS product RcnB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064209.1 protein_id gnl|my_center|LOCUS_09070 2371 1880 gene locus_tag LOCUS_09080 2371 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 2541 2987 gene locus_tag LOCUS_09090 2541 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116392.1 protein_id gnl|my_center|LOCUS_09090 3850 3044 gene locus_tag LOCUS_09100 3850 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 5249 3864 gene locus_tag LOCUS_09110 5249 3864 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207627.1 protein_id gnl|my_center|LOCUS_09110 7532 5445 gene locus_tag LOCUS_09120 gene znuD 7532 5445 CDS product zinc piracy TonB-dependent receptor ZnuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207628.1 protein_id gnl|my_center|LOCUS_09120 >Feature sequence057 546 1244 gene locus_tag LOCUS_09130 546 1244 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114898.1 protein_id gnl|my_center|LOCUS_09130 1296 1904 gene locus_tag LOCUS_09140 1296 1904 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208278.1 protein_id gnl|my_center|LOCUS_09140 2327 3379 gene locus_tag LOCUS_09150 2327 3379 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208279.1 protein_id gnl|my_center|LOCUS_09150 3430 3861 gene locus_tag LOCUS_09160 3430 3861 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263862.1 protein_id gnl|my_center|LOCUS_09160 5443 3923 gene locus_tag LOCUS_09170 gene katA 5443 3923 CDS product catalase KatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951343.1 protein_id gnl|my_center|LOCUS_09170 5984 6433 gene locus_tag LOCUS_09180 5984 6433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 <8229 6512 gene locus_tag LOCUS_09190 <8229 6512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208281.1:phosphoenolpyruvate--protein phosphotransferase >Feature sequence058 54 608 gene locus_tag LOCUS_09200 gene orn 54 608 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099436.1 protein_id gnl|my_center|LOCUS_09200 738 1466 gene locus_tag LOCUS_09210 738 1466 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004794670.1 protein_id gnl|my_center|LOCUS_09210 1612 2415 gene locus_tag LOCUS_09220 1612 2415 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208365.1 protein_id gnl|my_center|LOCUS_09220 3047 2505 gene locus_tag LOCUS_09230 3047 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 3371 3796 gene locus_tag LOCUS_09240 3371 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068582.1 protein_id gnl|my_center|LOCUS_09240 5183 3807 gene locus_tag LOCUS_09250 5183 3807 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208366.1 protein_id gnl|my_center|LOCUS_09250 7416 5425 gene locus_tag LOCUS_09260 7416 5425 CDS product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208367.1 protein_id gnl|my_center|LOCUS_09260 <8217 7418 gene locus_tag LOCUS_09270 <8217 7418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208368.1:MacA family efflux pump subunit >Feature sequence059 <1 734 gene locus_tag LOCUS_09280 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002210838.1:L-cystine transporter 1604 804 gene locus_tag LOCUS_09290 1604 804 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113973.1 protein_id gnl|my_center|LOCUS_09290 1870 2925 gene locus_tag LOCUS_09300 gene trpD 1870 2925 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118605.1 protein_id gnl|my_center|LOCUS_09300 2935 3741 gene locus_tag LOCUS_09310 gene trpC 2935 3741 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207267.1 protein_id gnl|my_center|LOCUS_09310 3868 4383 gene locus_tag LOCUS_09320 3868 4383 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994099.1 protein_id gnl|my_center|LOCUS_09320 4604 5293 gene locus_tag LOCUS_09330 4604 5293 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207268.1 protein_id gnl|my_center|LOCUS_09330 5378 5932 gene locus_tag LOCUS_09340 gene folE 5378 5932 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118643.1 protein_id gnl|my_center|LOCUS_09340 5956 6318 gene locus_tag LOCUS_09350 5956 6318 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336963.1 protein_id gnl|my_center|LOCUS_09350 <7990 6351 gene locus_tag LOCUS_09360 <7990 6351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207273.1:DUF4105 domain-containing protein >Feature sequence060 1144 659 gene locus_tag LOCUS_09370 gene soxR 1144 659 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973425.1 protein_id gnl|my_center|LOCUS_09370 1216 1635 gene locus_tag LOCUS_09380 1216 1635 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208381.1 protein_id gnl|my_center|LOCUS_09380 1655 2842 gene locus_tag LOCUS_09390 1655 2842 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208380.1 protein_id gnl|my_center|LOCUS_09390 3800 2895 gene locus_tag LOCUS_09400 gene thpD 3800 2895 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040098.1 protein_id gnl|my_center|LOCUS_09400 4216 3803 gene locus_tag LOCUS_09410 4216 3803 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063969.1 protein_id gnl|my_center|LOCUS_09410 5532 4213 gene locus_tag LOCUS_09420 gene ectB 5532 4213 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063970.1 protein_id gnl|my_center|LOCUS_09420 6155 5580 gene locus_tag LOCUS_09430 gene ectA 6155 5580 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810598.1 protein_id gnl|my_center|LOCUS_09430 6717 6283 gene locus_tag LOCUS_09440 6717 6283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 >Feature sequence061 <1 572 gene locus_tag LOCUS_09450 <1 572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208258.1:DUF4062 domain-containing protein 643 1659 gene locus_tag LOCUS_09460 gene hemH 643 1659 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065964.1 protein_id gnl|my_center|LOCUS_09460 1689 2333 gene locus_tag LOCUS_09470 1689 2333 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065967.1 protein_id gnl|my_center|LOCUS_09470 4136 2400 gene locus_tag LOCUS_09480 4136 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 4733 5644 gene locus_tag LOCUS_09490 gene pqqB 4733 5644 CDS product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206723.1 protein_id gnl|my_center|LOCUS_09490 5654 6415 gene locus_tag LOCUS_09500 gene pqqC 5654 6415 CDS product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113690.1 protein_id gnl|my_center|LOCUS_09500 6408 6692 gene locus_tag LOCUS_09510 gene pqqD 6408 6692 CDS product pyrroloquinoline quinone biosynthesis peptide chaperone PqqD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004792407.1 protein_id gnl|my_center|LOCUS_09510 >Feature sequence062 143 1075 gene locus_tag LOCUS_09520 143 1075 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205925.1 protein_id gnl|my_center|LOCUS_09520 2120 1158 gene locus_tag LOCUS_09530 2120 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205924.1 protein_id gnl|my_center|LOCUS_09530 3172 2300 gene locus_tag LOCUS_09540 3172 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09540 3799 3215 gene locus_tag LOCUS_09550 3799 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09550 5355 3859 gene locus_tag LOCUS_09560 5355 3859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205920.1 protein_id gnl|my_center|LOCUS_09560 >Feature sequence063 130 2754 gene locus_tag LOCUS_09570 130 2754 CDS product type VI secretion system Vgr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206351.1 protein_id gnl|my_center|LOCUS_09570 2756 3331 gene locus_tag LOCUS_09580 2756 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 3265 3471 gene locus_tag LOCUS_09590 3265 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 3464 5962 gene locus_tag LOCUS_09600 3464 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 5974 7212 gene locus_tag LOCUS_09610 5974 7212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 7203 7349 gene locus_tag LOCUS_09620 7203 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 >Feature sequence064 2098 1082 gene locus_tag LOCUS_09630 gene galE 2098 1082 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705040.1 protein_id gnl|my_center|LOCUS_09630 2291 2848 gene locus_tag LOCUS_09640 2291 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 6507 3871 gene locus_tag LOCUS_09650 6507 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 <7244 6504 gene locus_tag LOCUS_09660 <7244 6504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003089047.1:ABC transporter substrate-binding protein >Feature sequence065 1136 348 gene locus_tag LOCUS_09670 1136 348 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207399.1 protein_id gnl|my_center|LOCUS_09670 2319 1282 gene locus_tag LOCUS_09680 gene sppA 2319 1282 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207400.1 protein_id gnl|my_center|LOCUS_09680 2456 3409 gene locus_tag LOCUS_09690 2456 3409 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207401.1 protein_id gnl|my_center|LOCUS_09690 5837 3411 gene locus_tag LOCUS_09700 5837 3411 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207402.1 protein_id gnl|my_center|LOCUS_09700 6609 5923 gene locus_tag LOCUS_09710 gene lolD 6609 5923 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207403.1 protein_id gnl|my_center|LOCUS_09710 <7155 6602 gene locus_tag LOCUS_09720 <7155 6602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002118590.1:lipoprotein-releasing ABC transporter permease subunit >Feature sequence066 1432 977 gene locus_tag LOCUS_09730 1432 977 CDS product phosphoglycerate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068324.1 protein_id gnl|my_center|LOCUS_09730 2697 1624 gene locus_tag LOCUS_09740 2697 1624 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207203.1 protein_id gnl|my_center|LOCUS_09740 3329 2745 gene locus_tag LOCUS_09750 3329 2745 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073504.1 protein_id gnl|my_center|LOCUS_09750 3547 3954 gene locus_tag LOCUS_09760 3547 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073503.1 protein_id gnl|my_center|LOCUS_09760 4251 4006 gene locus_tag LOCUS_09770 4251 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206585.1 protein_id gnl|my_center|LOCUS_09770 5593 4403 gene locus_tag LOCUS_09780 5593 4403 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206584.1 protein_id gnl|my_center|LOCUS_09780 5734 6117 gene locus_tag LOCUS_09790 5734 6117 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121396.1 protein_id gnl|my_center|LOCUS_09790 6117 6710 gene locus_tag LOCUS_09800 6117 6710 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121436.1 protein_id gnl|my_center|LOCUS_09800 >Feature sequence067 464 1918 gene locus_tag LOCUS_09810 464 1918 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207856.1 protein_id gnl|my_center|LOCUS_09810 4209 2338 gene locus_tag LOCUS_09820 4209 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 4268 4423 gene locus_tag LOCUS_09830 4268 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 4852 5016 gene locus_tag LOCUS_09840 4852 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 5135 6652 gene locus_tag LOCUS_09850 5135 6652 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116671.1 protein_id gnl|my_center|LOCUS_09850 6997 6922 gene locus_tag LOCUS_t00140 6997 6922 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence068 956 363 gene locus_tag LOCUS_09860 956 363 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121436.1 protein_id gnl|my_center|LOCUS_09860 1339 956 gene locus_tag LOCUS_09870 1339 956 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121396.1 protein_id gnl|my_center|LOCUS_09870 1480 2670 gene locus_tag LOCUS_09880 1480 2670 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206584.1 protein_id gnl|my_center|LOCUS_09880 2822 3067 gene locus_tag LOCUS_09890 2822 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206585.1 protein_id gnl|my_center|LOCUS_09890 3526 3119 gene locus_tag LOCUS_09900 3526 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073503.1 protein_id gnl|my_center|LOCUS_09900 3744 4328 gene locus_tag LOCUS_09910 3744 4328 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073504.1 protein_id gnl|my_center|LOCUS_09910 4376 5449 gene locus_tag LOCUS_09920 4376 5449 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207203.1 protein_id gnl|my_center|LOCUS_09920 5507 5962 gene locus_tag LOCUS_09930 5507 5962 CDS product phosphoglycerate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068324.1 protein_id gnl|my_center|LOCUS_09930 >Feature sequence069 1465 365 gene locus_tag LOCUS_09940 1465 365 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118415.1 protein_id gnl|my_center|LOCUS_09940 2490 1474 gene locus_tag LOCUS_09950 2490 1474 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207321.1 protein_id gnl|my_center|LOCUS_09950 2685 3380 gene locus_tag LOCUS_09960 gene fabR 2685 3380 CDS product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118668.1 protein_id gnl|my_center|LOCUS_09960 3581 4078 gene locus_tag LOCUS_09970 gene dps 3581 4078 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816761.1 protein_id gnl|my_center|LOCUS_09970 <6931 4140 gene locus_tag LOCUS_09980 <6931 4140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207322.1:RNA polymerase-associated protein RapA >Feature sequence070 <1 664 gene locus_tag LOCUS_09990 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206718.1:molybdate ABC transporter substrate-binding protein 661 1350 gene locus_tag LOCUS_10000 gene modB 661 1350 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206719.1 protein_id gnl|my_center|LOCUS_10000 1350 1967 gene locus_tag LOCUS_10010 1350 1967 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206720.1 protein_id gnl|my_center|LOCUS_10010 3302 1962 gene locus_tag LOCUS_10020 gene chrA 3302 1962 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206681.1 protein_id gnl|my_center|LOCUS_10020 3599 4621 gene locus_tag LOCUS_10030 gene tauA 3599 4621 CDS product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206506.1 protein_id gnl|my_center|LOCUS_10030 4631 5422 gene locus_tag LOCUS_10040 4631 5422 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049389.1 protein_id gnl|my_center|LOCUS_10040 5419 6297 gene locus_tag LOCUS_10050 gene tauC 5419 6297 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206507.1 protein_id gnl|my_center|LOCUS_10050 >Feature sequence071 1789 227 gene locus_tag LOCUS_10060 1789 227 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071062.1 protein_id gnl|my_center|LOCUS_10060 2227 2027 gene locus_tag LOCUS_10070 2227 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 2436 2858 gene locus_tag LOCUS_10080 2436 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205905.1 protein_id gnl|my_center|LOCUS_10080 3746 2985 gene locus_tag LOCUS_10090 3746 2985 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120057.1 protein_id gnl|my_center|LOCUS_10090 3859 4743 gene locus_tag LOCUS_10100 gene gigC 3859 4743 CDS product LysR family transcriptional regulator GigC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120024.1 protein_id gnl|my_center|LOCUS_10100 5450 4755 gene locus_tag LOCUS_10110 5450 4755 CDS product excalibur calcium-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071042.1 protein_id gnl|my_center|LOCUS_10110 5855 5565 gene locus_tag LOCUS_10120 5855 5565 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205904.1 protein_id gnl|my_center|LOCUS_10120 6610 5975 gene locus_tag LOCUS_10130 gene upp 6610 5975 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120045.1 protein_id gnl|my_center|LOCUS_10130 >Feature sequence072 5 778 gene locus_tag LOCUS_10140 5 778 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208308.1 protein_id gnl|my_center|LOCUS_10140 823 1443 gene locus_tag LOCUS_10150 823 1443 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011664.1 protein_id gnl|my_center|LOCUS_10150 1445 1849 gene locus_tag LOCUS_10160 1445 1849 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885432.1 protein_id gnl|my_center|LOCUS_10160 2430 1906 gene locus_tag LOCUS_10170 gene msrA 2430 1906 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005036987.1 protein_id gnl|my_center|LOCUS_10170 3014 2538 gene locus_tag LOCUS_10180 3014 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 4196 3141 gene locus_tag LOCUS_10190 4196 3141 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208309.1 protein_id gnl|my_center|LOCUS_10190 4726 4217 gene locus_tag LOCUS_10200 4726 4217 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208310.1 protein_id gnl|my_center|LOCUS_10200 5591 4749 gene locus_tag LOCUS_10210 gene thyA 5591 4749 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208311.1 protein_id gnl|my_center|LOCUS_10210 5763 6587 gene locus_tag LOCUS_10220 5763 6587 CDS product YwqG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986634.1 protein_id gnl|my_center|LOCUS_10220 >Feature sequence073 <1 668 gene locus_tag LOCUS_10230 <1 668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707645.1:ligand-gated channel protein 1705 695 gene locus_tag LOCUS_10240 1705 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206061.1 protein_id gnl|my_center|LOCUS_10240 2741 1731 gene locus_tag LOCUS_10250 2741 1731 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206062.1 protein_id gnl|my_center|LOCUS_10250 2979 3593 gene locus_tag LOCUS_10260 2979 3593 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206063.1 protein_id gnl|my_center|LOCUS_10260 3682 4119 gene locus_tag LOCUS_10270 3682 4119 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706546.1 protein_id gnl|my_center|LOCUS_10270 4809 4141 gene locus_tag LOCUS_10280 4809 4141 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005129345.1 protein_id gnl|my_center|LOCUS_10280 4808 5527 gene locus_tag LOCUS_10290 4808 5527 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070633.1 protein_id gnl|my_center|LOCUS_10290 >Feature sequence074 775 1794 gene locus_tag LOCUS_10300 775 1794 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208461.1 protein_id gnl|my_center|LOCUS_10300 3229 1856 gene locus_tag LOCUS_10310 3229 1856 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208460.1 protein_id gnl|my_center|LOCUS_10310 4153 3257 gene locus_tag LOCUS_10320 4153 3257 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206870.1 protein_id gnl|my_center|LOCUS_10320 5579 4197 gene locus_tag LOCUS_10330 5579 4197 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208459.1 protein_id gnl|my_center|LOCUS_10330 <6726 5822 gene locus_tag LOCUS_10340 <6726 5822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207791.1:amino acid permease >Feature sequence075 3 377 gene locus_tag LOCUS_10350 gene bfr 3 377 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214863.1 protein_id gnl|my_center|LOCUS_10350 999 427 gene locus_tag LOCUS_10360 gene bcp 999 427 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582794.1 protein_id gnl|my_center|LOCUS_10360 1269 1991 gene locus_tag LOCUS_10370 1269 1991 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205936.1 protein_id gnl|my_center|LOCUS_10370 2299 3594 gene locus_tag LOCUS_10380 gene bioA 2299 3594 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205937.1 protein_id gnl|my_center|LOCUS_10380 3581 4735 gene locus_tag LOCUS_10390 3581 4735 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205938.1 protein_id gnl|my_center|LOCUS_10390 4732 5520 gene locus_tag LOCUS_10400 gene bioC 4732 5520 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205939.1 protein_id gnl|my_center|LOCUS_10400 5517 6161 gene locus_tag LOCUS_10410 gene bioD 5517 6161 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205940.1 protein_id gnl|my_center|LOCUS_10410 6666 6247 gene locus_tag LOCUS_10420 6666 6247 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206607.1 protein_id gnl|my_center|LOCUS_10420 >Feature sequence076 509 24 gene locus_tag LOCUS_10430 509 24 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170995.1 protein_id gnl|my_center|LOCUS_10430 2004 562 gene locus_tag LOCUS_10440 2004 562 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207196.1 protein_id gnl|my_center|LOCUS_10440 2714 2121 gene locus_tag LOCUS_10450 2714 2121 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_10450 3775 2810 gene locus_tag LOCUS_10460 3775 2810 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115253.1 protein_id gnl|my_center|LOCUS_10460 4441 3794 gene locus_tag LOCUS_10470 4441 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207197.1 protein_id gnl|my_center|LOCUS_10470 4723 5823 gene locus_tag LOCUS_10480 4723 5823 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020079396.1 protein_id gnl|my_center|LOCUS_10480 <6679 5901 gene locus_tag LOCUS_10490 <6679 5901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_122552737.1:translesion error-prone DNA polymerase V subunit UmuC >Feature sequence077 <1 1589 gene locus_tag LOCUS_10500 <1 1589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208040.1:polysaccharide biosynthesis tyrosine autokinase 1789 2496 gene locus_tag LOCUS_10510 1789 2496 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208039.1 protein_id gnl|my_center|LOCUS_10510 2556 3239 gene locus_tag LOCUS_10520 2556 3239 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208038.1 protein_id gnl|my_center|LOCUS_10520 4838 3297 gene locus_tag LOCUS_10530 gene murJ 4838 3297 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804817.1 protein_id gnl|my_center|LOCUS_10530 5542 4937 gene locus_tag LOCUS_10540 gene ampD 5542 4937 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208037.1 protein_id gnl|my_center|LOCUS_10540 5649 6494 gene locus_tag LOCUS_10550 gene nadC 5649 6494 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208036.1 protein_id gnl|my_center|LOCUS_10550 >Feature sequence078 <1 1478 gene locus_tag LOCUS_10560 <1 1478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207529.1:outer membrane protein transport protein 1702 2931 gene locus_tag LOCUS_10570 1702 2931 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208459.1 protein_id gnl|my_center|LOCUS_10570 3627 3010 gene locus_tag LOCUS_10580 gene thrH 3627 3010 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_10580 3801 4532 gene locus_tag LOCUS_10590 3801 4532 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207530.1 protein_id gnl|my_center|LOCUS_10590 4757 6142 gene locus_tag LOCUS_10600 4757 6142 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064414.1 protein_id gnl|my_center|LOCUS_10600 >Feature sequence079 1031 585 gene locus_tag LOCUS_10610 1031 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 1487 1068 gene locus_tag LOCUS_10620 1487 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207781.1 protein_id gnl|my_center|LOCUS_10620 2276 3577 gene locus_tag LOCUS_10630 2276 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 5898 3829 gene locus_tag LOCUS_10640 gene glyS 5898 3829 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207776.1 protein_id gnl|my_center|LOCUS_10640 6368 5898 gene locus_tag LOCUS_10650 6368 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 >Feature sequence080 <1 2045 gene locus_tag LOCUS_10660 <1 2045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002116875.1:Tex family protein 2240 3070 gene locus_tag LOCUS_10670 2240 3070 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207243.1 protein_id gnl|my_center|LOCUS_10670 3141 3857 gene locus_tag LOCUS_10680 3141 3857 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207242.1 protein_id gnl|my_center|LOCUS_10680 3854 4171 gene locus_tag LOCUS_10690 3854 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 4979 4224 gene locus_tag LOCUS_10700 4979 4224 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208271.1 protein_id gnl|my_center|LOCUS_10700 5084 5968 gene locus_tag LOCUS_10710 5084 5968 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208272.1 protein_id gnl|my_center|LOCUS_10710 >Feature sequence081 <1 944 gene locus_tag LOCUS_10720 <1 944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002114136.1:glutamine-hydrolyzing GMP synthase 947 1828 gene locus_tag LOCUS_10730 947 1828 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964247.1 protein_id gnl|my_center|LOCUS_10730 1803 2411 gene locus_tag LOCUS_10740 1803 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 2696 3697 gene locus_tag LOCUS_10750 2696 3697 CDS product DUF1852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031350.1 protein_id gnl|my_center|LOCUS_10750 3719 4753 gene locus_tag LOCUS_10760 3719 4753 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973349.1 protein_id gnl|my_center|LOCUS_10760 4913 5404 gene locus_tag LOCUS_10770 4913 5404 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249487.1 protein_id gnl|my_center|LOCUS_10770 >Feature sequence082 1887 1099 gene locus_tag LOCUS_10780 1887 1099 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208389.1 protein_id gnl|my_center|LOCUS_10780 4775 1965 gene locus_tag LOCUS_10790 4775 1965 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208390.1 protein_id gnl|my_center|LOCUS_10790 4932 5873 gene locus_tag LOCUS_10800 gene cysM 4932 5873 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208391.1 protein_id gnl|my_center|LOCUS_10800 >Feature sequence083 2452 725 gene locus_tag LOCUS_10810 gene uvrC 2452 725 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208216.1 protein_id gnl|my_center|LOCUS_10810 3484 2621 gene locus_tag LOCUS_10820 3484 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 4584 3670 gene locus_tag LOCUS_10830 4584 3670 CDS product aspartyl/asparaginyl beta-hydroxylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002000673.1 protein_id gnl|my_center|LOCUS_10830 5789 4707 gene locus_tag LOCUS_10840 5789 4707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 >Feature sequence084 <1 1410 gene locus_tag LOCUS_10850 <1 1410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208273.1:long-chain-acyl-CoA synthetase 1626 1701 gene locus_tag LOCUS_t00150 1626 1701 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1800 1875 gene locus_tag LOCUS_t00160 1800 1875 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3157 2003 gene locus_tag LOCUS_10860 gene hemW 3157 2003 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208270.1 protein_id gnl|my_center|LOCUS_10860 3318 3184 gene locus_tag LOCUS_10870 3318 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 3298 3759 gene locus_tag LOCUS_10880 3298 3759 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208269.1 protein_id gnl|my_center|LOCUS_10880 4113 5396 gene locus_tag LOCUS_10890 gene abeM 4113 5396 CDS product multidrug efflux MATE transporter AbeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208268.1 protein_id gnl|my_center|LOCUS_10890 >Feature sequence085 921 622 gene locus_tag LOCUS_10900 921 622 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815479.1 protein_id gnl|my_center|LOCUS_10900 1156 911 gene locus_tag LOCUS_10910 1156 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 2691 1270 gene locus_tag LOCUS_10920 2691 1270 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206498.1 protein_id gnl|my_center|LOCUS_10920 2929 3747 gene locus_tag LOCUS_10930 2929 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076457.1 protein_id gnl|my_center|LOCUS_10930 3789 3962 gene locus_tag LOCUS_10940 3789 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 >Feature sequence086 <1 1328 gene locus_tag LOCUS_10950 <1 1328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207171.1:HAMP domain-containing sensor histidine kinase 2020 1325 gene locus_tag LOCUS_10960 2020 1325 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207170.1 protein_id gnl|my_center|LOCUS_10960 2534 2034 gene locus_tag LOCUS_10970 2534 2034 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207169.1 protein_id gnl|my_center|LOCUS_10970 3209 2619 gene locus_tag LOCUS_10980 3209 2619 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207168.1 protein_id gnl|my_center|LOCUS_10980 4188 3364 gene locus_tag LOCUS_10990 gene pcaU 4188 3364 CDS product IclR family transcriptional regulator PcaU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120879.1 protein_id gnl|my_center|LOCUS_10990 4439 5125 gene locus_tag LOCUS_11000 4439 5125 CDS product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206898.1 protein_id gnl|my_center|LOCUS_11000 5136 5789 gene locus_tag LOCUS_11010 5136 5789 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206933.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence087 3597 3379 gene locus_tag LOCUS_11020 3597 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 4507 3602 gene locus_tag LOCUS_11030 4507 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11030 4896 4558 gene locus_tag LOCUS_11040 4896 4558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11040 5537 4911 gene locus_tag LOCUS_11050 gene umuD 5537 4911 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069871.1 protein_id gnl|my_center|LOCUS_11050 >Feature sequence088 308 988 gene locus_tag LOCUS_11060 308 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207352.1 protein_id gnl|my_center|LOCUS_11060 1105 2325 gene locus_tag LOCUS_11070 gene cgtA 1105 2325 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118576.1 protein_id gnl|my_center|LOCUS_11070 2393 3526 gene locus_tag LOCUS_11080 gene proB 2393 3526 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118789.1 protein_id gnl|my_center|LOCUS_11080 5233 3599 gene locus_tag LOCUS_11090 5233 3599 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970878.1 protein_id gnl|my_center|LOCUS_11090 <5934 5327 gene locus_tag LOCUS_11100 <5934 5327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004550682.1:Fe(3+) ABC transporter substrate-binding protein >Feature sequence089 613 1203 gene locus_tag LOCUS_11110 613 1203 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186304.1 protein_id gnl|my_center|LOCUS_11110 1211 1564 gene locus_tag LOCUS_11120 1211 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 1540 1935 gene locus_tag LOCUS_11130 1540 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 2031 2384 gene locus_tag LOCUS_11140 2031 2384 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065147.1 protein_id gnl|my_center|LOCUS_11140 3457 2387 gene locus_tag LOCUS_11150 gene lptG 3457 2387 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191705.1 protein_id gnl|my_center|LOCUS_11150 4545 3454 gene locus_tag LOCUS_11160 gene lptF 4545 3454 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192178.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence090 422 90 gene locus_tag LOCUS_11170 422 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 1353 478 gene locus_tag LOCUS_11180 1353 478 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528434.1 protein_id gnl|my_center|LOCUS_11180 1457 1627 gene locus_tag LOCUS_11190 1457 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 2118 1678 gene locus_tag LOCUS_11200 2118 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 2462 2211 gene locus_tag LOCUS_11210 2462 2211 CDS product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 protein_id gnl|my_center|LOCUS_11210 3155 4054 gene locus_tag LOCUS_11220 3155 4054 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943748.1 protein_id gnl|my_center|LOCUS_11220 4202 5116 gene locus_tag LOCUS_11230 4202 5116 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860032.1 protein_id gnl|my_center|LOCUS_11230 5293 5700 gene locus_tag LOCUS_11240 5293 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 >Feature sequence091 407 1876 gene locus_tag LOCUS_11250 gene gatB 407 1876 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207537.1 protein_id gnl|my_center|LOCUS_11250 3135 1930 gene locus_tag LOCUS_11260 3135 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 3934 3368 gene locus_tag LOCUS_11270 3934 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207539.1 protein_id gnl|my_center|LOCUS_11270 5041 3971 gene locus_tag LOCUS_11280 5041 3971 CDS product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207540.1 protein_id gnl|my_center|LOCUS_11280 <5681 5122 gene locus_tag LOCUS_11290 <5681 5122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206516.1:LysR family transcriptional regulator >Feature sequence092 <1 1142 gene locus_tag LOCUS_11300 <1 1142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002116237.1:protein translocase subunit SecD 1153 2121 gene locus_tag LOCUS_11310 gene secF 1153 2121 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207646.1 protein_id gnl|my_center|LOCUS_11310 2875 2228 gene locus_tag LOCUS_11320 2875 2228 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208363.1 protein_id gnl|my_center|LOCUS_11320 4349 2940 gene locus_tag LOCUS_11330 gene der 4349 2940 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208345.1 protein_id gnl|my_center|LOCUS_11330 <5629 4527 gene locus_tag LOCUS_11340 <5629 4527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208344.1:outer membrane protein assembly factor BamB >Feature sequence093 988 47 gene locus_tag LOCUS_11350 gene bauD 988 47 CDS product ferric acinetobactin ABC transporter permease subunit BauD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207289.1 protein_id gnl|my_center|LOCUS_11350 1543 3639 gene locus_tag LOCUS_11360 gene basB 1543 3639 CDS product acinetobactin non-ribosomal peptide synthetase subunit BasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207290.1 protein_id gnl|my_center|LOCUS_11360 <5482 3770 gene locus_tag LOCUS_11370 <5482 3770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207291.1:AMP-binding protein >Feature sequence094 401 2965 gene locus_tag LOCUS_11380 401 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 4005 3031 gene locus_tag LOCUS_11390 4005 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 4191 4574 gene locus_tag LOCUS_11400 gene gcvH 4191 4574 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723327.1 protein_id gnl|my_center|LOCUS_11400 4995 4567 gene locus_tag LOCUS_11410 4995 4567 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193228.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence095 462 1631 gene locus_tag LOCUS_11420 462 1631 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207995.1 protein_id gnl|my_center|LOCUS_11420 1732 2844 gene locus_tag LOCUS_11430 gene ampC 1732 2844 CDS product class C beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975881.1 protein_id gnl|my_center|LOCUS_11430 2928 4208 gene locus_tag LOCUS_11440 2928 4208 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207994.1 protein_id gnl|my_center|LOCUS_11440 4208 5110 gene locus_tag LOCUS_11450 gene yddG 4208 5110 CDS product aromatic amino acid DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705524.1 protein_id gnl|my_center|LOCUS_11450 >Feature sequence096 <1 1466 gene locus_tag LOCUS_11460 <1 1466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208009.1:phosphoenolpyruvate carboxylase 1778 3073 gene locus_tag LOCUS_11470 1778 3073 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119102.1 protein_id gnl|my_center|LOCUS_11470 3188 4084 gene locus_tag LOCUS_11480 3188 4084 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208010.1 protein_id gnl|my_center|LOCUS_11480 4825 4094 gene locus_tag LOCUS_11490 4825 4094 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208011.1 protein_id gnl|my_center|LOCUS_11490 >Feature sequence097 <1 1307 gene locus_tag LOCUS_11500 <1 1307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207223.1:GspE/PulE family protein 1561 1391 gene locus_tag LOCUS_11510 1561 1391 CDS product hemin uptake protein HemP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118129.1 protein_id gnl|my_center|LOCUS_11510 1739 2650 gene locus_tag LOCUS_11520 1739 2650 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207219.1 protein_id gnl|my_center|LOCUS_11520 3219 2659 gene locus_tag LOCUS_11530 3219 2659 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207218.1 protein_id gnl|my_center|LOCUS_11530 <5289 3239 gene locus_tag LOCUS_11540 <5289 3239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005073474.1:penicillin-binding protein 1B >Feature sequence098 2535 1294 gene locus_tag LOCUS_11550 2535 1294 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207845.1 protein_id gnl|my_center|LOCUS_11550 3958 2540 gene locus_tag LOCUS_11560 3958 2540 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207846.1 protein_id gnl|my_center|LOCUS_11560 4431 4003 gene locus_tag LOCUS_11570 4431 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence099 3373 2561 gene locus_tag LOCUS_11580 3373 2561 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208373.1 protein_id gnl|my_center|LOCUS_11580 4284 3373 gene locus_tag LOCUS_11590 4284 3373 CDS product RsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208372.1 protein_id gnl|my_center|LOCUS_11590 5216 4389 gene locus_tag LOCUS_11600 5216 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117238.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence100 1654 20 gene locus_tag LOCUS_11610 gene urtB 1654 20 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269026.1 protein_id gnl|my_center|LOCUS_11610 3022 1745 gene locus_tag LOCUS_11620 gene urtA 3022 1745 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096636.1 protein_id gnl|my_center|LOCUS_11620 5158 3275 gene locus_tag LOCUS_11630 gene parE 5158 3275 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122026.1 protein_id gnl|my_center|LOCUS_11630 >Feature sequence101 607 1464 gene locus_tag LOCUS_11640 607 1464 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207096.1 protein_id gnl|my_center|LOCUS_11640 1711 2307 gene locus_tag LOCUS_11650 1711 2307 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064380616.1 protein_id gnl|my_center|LOCUS_11650 2376 3002 gene locus_tag LOCUS_11660 2376 3002 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096725.1 protein_id gnl|my_center|LOCUS_11660 3771 3118 gene locus_tag LOCUS_11670 gene nfsB 3771 3118 CDS product oxygen-insensitive NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207095.1 protein_id gnl|my_center|LOCUS_11670 4668 3952 gene locus_tag LOCUS_11680 4668 3952 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207093.1 protein_id gnl|my_center|LOCUS_11680 >Feature sequence102 63 1481 gene locus_tag LOCUS_11690 63 1481 CDS product polyphosphate--AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065911.1 protein_id gnl|my_center|LOCUS_11690 2833 1520 gene locus_tag LOCUS_11700 2833 1520 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767375.1 protein_id gnl|my_center|LOCUS_11700 3595 3095 gene locus_tag LOCUS_11710 3595 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208241.1 protein_id gnl|my_center|LOCUS_11710 >Feature sequence103 481 1299 gene locus_tag LOCUS_11720 481 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207347.1 protein_id gnl|my_center|LOCUS_11720 2432 1305 gene locus_tag LOCUS_11730 gene wecB 2432 1305 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703970.1 protein_id gnl|my_center|LOCUS_11730 3649 2435 gene locus_tag LOCUS_11740 3649 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207348.1 protein_id gnl|my_center|LOCUS_11740 3893 4594 gene locus_tag LOCUS_11750 3893 4594 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118524.1 protein_id gnl|my_center|LOCUS_11750 4899 4705 gene locus_tag LOCUS_11760 4899 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 >Feature sequence104 <1 1642 gene locus_tag LOCUS_11770 <1 1642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002115528.1:phosphoenolpyruvate carboxykinase (GTP) 2329 1766 gene locus_tag LOCUS_11780 2329 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 2850 2410 gene locus_tag LOCUS_11790 2850 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 3443 3015 gene locus_tag LOCUS_11800 3443 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 4224 3553 gene locus_tag LOCUS_11810 4224 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 >Feature sequence105 <1 1196 gene locus_tag LOCUS_11820 <1 1196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207647.1:bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC 1279 2118 gene locus_tag LOCUS_11830 1279 2118 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 protein_id gnl|my_center|LOCUS_11830 2105 2713 gene locus_tag LOCUS_11840 2105 2713 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_11840 3238 2780 gene locus_tag LOCUS_11850 gene secB 3238 2780 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115005.1 protein_id gnl|my_center|LOCUS_11850 3528 3271 gene locus_tag LOCUS_11860 gene grxC 3528 3271 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114715.1 protein_id gnl|my_center|LOCUS_11860 3956 3540 gene locus_tag LOCUS_11870 3956 3540 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443006.1 protein_id gnl|my_center|LOCUS_11870 4953 4051 gene locus_tag LOCUS_11880 gene rsgA 4953 4051 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208364.1 protein_id gnl|my_center|LOCUS_11880 >Feature sequence106 1978 572 gene locus_tag LOCUS_11890 1978 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 2313 1975 gene locus_tag LOCUS_11900 2313 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 3733 2318 gene locus_tag LOCUS_11910 3733 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 4136 3855 gene locus_tag LOCUS_11920 4136 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 4338 4147 gene locus_tag LOCUS_11930 4338 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 4646 4335 gene locus_tag LOCUS_11940 4646 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 >Feature sequence107 <1 1355 gene locus_tag LOCUS_11950 <1 1355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002115528.1:phosphoenolpyruvate carboxykinase (GTP) 2122 1634 gene locus_tag LOCUS_11960 2122 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 3166 2603 gene locus_tag LOCUS_11970 3166 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 3498 3223 gene locus_tag LOCUS_11980 3498 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 4089 3718 gene locus_tag LOCUS_11990 4089 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 4527 4243 gene locus_tag LOCUS_12000 4527 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 >Feature sequence108 3 1310 gene locus_tag LOCUS_12010 gene fahA 3 1310 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207985.1 protein_id gnl|my_center|LOCUS_12010 1297 1929 gene locus_tag LOCUS_12020 gene maiA 1297 1929 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207986.1 protein_id gnl|my_center|LOCUS_12020 1949 2497 gene locus_tag LOCUS_12030 1949 2497 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119119.1 protein_id gnl|my_center|LOCUS_12030 2858 3637 gene locus_tag LOCUS_12040 2858 3637 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119135.1 protein_id gnl|my_center|LOCUS_12040 <4735 3720 gene locus_tag LOCUS_12050 <4735 3720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002119157.1:4-hydroxyphenylpyruvate dioxygenase >Feature sequence109 <1 1016 gene locus_tag LOCUS_12060 <1 1016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002119157.1:4-hydroxyphenylpyruvate dioxygenase 1878 1099 gene locus_tag LOCUS_12070 1878 1099 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119135.1 protein_id gnl|my_center|LOCUS_12070 2787 2239 gene locus_tag LOCUS_12080 2787 2239 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119119.1 protein_id gnl|my_center|LOCUS_12080 3439 2807 gene locus_tag LOCUS_12090 gene maiA 3439 2807 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207986.1 protein_id gnl|my_center|LOCUS_12090 4733 3426 gene locus_tag LOCUS_12100 gene fahA 4733 3426 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207985.1 protein_id gnl|my_center|LOCUS_12100 >Feature sequence110 <1 1082 gene locus_tag LOCUS_12110 <1 1082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206099.1:Xaa-Pro aminopeptidase 1268 2479 gene locus_tag LOCUS_12120 gene ubiH 1268 2479 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206100.1 protein_id gnl|my_center|LOCUS_12120 2476 3708 gene locus_tag LOCUS_12130 2476 3708 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206101.1 protein_id gnl|my_center|LOCUS_12130 3882 4133 gene locus_tag LOCUS_12140 3882 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117665.1 protein_id gnl|my_center|LOCUS_12140 >Feature sequence111 271 1194 gene locus_tag LOCUS_12150 gene rsmH 271 1194 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207838.1 protein_id gnl|my_center|LOCUS_12150 1194 1532 gene locus_tag LOCUS_12160 gene ftsL 1194 1532 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116847.1 protein_id gnl|my_center|LOCUS_12160 1543 3375 gene locus_tag LOCUS_12170 gene ftsI 1543 3375 CDS product penicillin-binding protein PBP3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117016.1 protein_id gnl|my_center|LOCUS_12170 >Feature sequence112 <1 1901 gene locus_tag LOCUS_12180 <1 1901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208221.1:FUSC family protein 1894 2100 gene locus_tag LOCUS_12190 1894 2100 CDS product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115096.1 protein_id gnl|my_center|LOCUS_12190 2166 3167 gene locus_tag LOCUS_12200 2166 3167 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114928.1 protein_id gnl|my_center|LOCUS_12200 3612 3169 gene locus_tag LOCUS_12210 gene ruvX 3612 3169 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115066.1 protein_id gnl|my_center|LOCUS_12210 4159 3605 gene locus_tag LOCUS_12220 4159 3605 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114753.1 protein_id gnl|my_center|LOCUS_12220 >Feature sequence113 1621 377 gene locus_tag LOCUS_12230 1621 377 CDS product NADH:flavin oxidoreductase/NADH oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206115.1 protein_id gnl|my_center|LOCUS_12230 3299 1707 gene locus_tag LOCUS_12240 3299 1707 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206114.1 protein_id gnl|my_center|LOCUS_12240 4287 3277 gene locus_tag LOCUS_12250 4287 3277 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206113.1 protein_id gnl|my_center|LOCUS_12250 >Feature sequence114 <1 1157 gene locus_tag LOCUS_12260 <1 1157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207024.1:MFS transporter 2649 1159 gene locus_tag LOCUS_12270 2649 1159 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017586463.1 protein_id gnl|my_center|LOCUS_12270 2814 3323 gene locus_tag LOCUS_12280 2814 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207023.1 protein_id gnl|my_center|LOCUS_12280 <4589 3394 gene locus_tag LOCUS_12290 <4589 3394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002115704.1:acetyl-CoA carboxylase biotin carboxylase subunit >Feature sequence115 2094 1375 gene locus_tag LOCUS_12300 2094 1375 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706774.1 protein_id gnl|my_center|LOCUS_12300 2933 2226 gene locus_tag LOCUS_12310 2933 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206308.1 protein_id gnl|my_center|LOCUS_12310 3697 3260 gene locus_tag LOCUS_12320 3697 3260 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068725.1 protein_id gnl|my_center|LOCUS_12320 4468 3773 gene locus_tag LOCUS_12330 4468 3773 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527204.1 protein_id gnl|my_center|LOCUS_12330 >Feature sequence116 <1 1163 gene locus_tag LOCUS_12340 <1 1163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207024.1:MFS transporter 2602 1160 gene locus_tag LOCUS_12350 2602 1160 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017586463.1 protein_id gnl|my_center|LOCUS_12350 2754 3263 gene locus_tag LOCUS_12360 2754 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207023.1 protein_id gnl|my_center|LOCUS_12360 <4529 3334 gene locus_tag LOCUS_12370 <4529 3334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002115704.1:acetyl-CoA carboxylase biotin carboxylase subunit >Feature sequence117 183 914 gene locus_tag LOCUS_12380 183 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 940 1836 gene locus_tag LOCUS_12390 940 1836 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066796.1 protein_id gnl|my_center|LOCUS_12390 2026 2943 gene locus_tag LOCUS_12400 2026 2943 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943748.1 protein_id gnl|my_center|LOCUS_12400 3689 3054 gene locus_tag LOCUS_12410 3689 3054 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800177.1 protein_id gnl|my_center|LOCUS_12410 >Feature sequence118 475 801 gene locus_tag LOCUS_12420 475 801 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706250.1 protein_id gnl|my_center|LOCUS_12420 1696 812 gene locus_tag LOCUS_12430 1696 812 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207863.1 protein_id gnl|my_center|LOCUS_12430 2617 1766 gene locus_tag LOCUS_12440 2617 1766 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263859.1 protein_id gnl|my_center|LOCUS_12440 4124 2637 gene locus_tag LOCUS_12450 4124 2637 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 protein_id gnl|my_center|LOCUS_12450 >Feature sequence119 123 1316 gene locus_tag LOCUS_12460 123 1316 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207748.1 protein_id gnl|my_center|LOCUS_12460 1336 2883 gene locus_tag LOCUS_12470 1336 2883 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207749.1 protein_id gnl|my_center|LOCUS_12470 3025 4236 gene locus_tag LOCUS_12480 gene hmpA 3025 4236 CDS product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040024.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence120 1370 2722 gene locus_tag LOCUS_12490 1370 2722 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208422.1 protein_id gnl|my_center|LOCUS_12490 3824 2736 gene locus_tag LOCUS_12500 gene hisC 3824 2736 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208421.1 protein_id gnl|my_center|LOCUS_12500 >Feature sequence121 1477 1974 gene locus_tag LOCUS_12510 1477 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 3566 2040 gene locus_tag LOCUS_12520 gene lysS 3566 2040 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206074.1 protein_id gnl|my_center|LOCUS_12520 4166 3729 gene locus_tag LOCUS_12530 4166 3729 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206072.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence122 1252 128 gene locus_tag LOCUS_12540 1252 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 1552 2079 gene locus_tag LOCUS_12550 1552 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 2072 3376 gene locus_tag LOCUS_12560 2072 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 3513 4076 gene locus_tag LOCUS_12570 3513 4076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 >Feature sequence123 <1 2108 gene locus_tag LOCUS_12580 <1 2108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208134.1:TonB-dependent copper receptor 2914 2153 gene locus_tag LOCUS_12590 2914 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207913.1 protein_id gnl|my_center|LOCUS_12590 <4305 3335 gene locus_tag LOCUS_12600 <4305 3335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207912.1:PAS domain-containing hybrid sensor histidine kinase/response regulator >Feature sequence124 <1 875 gene locus_tag LOCUS_12610 <1 875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002121066.1:phosphopyruvate hydratase 1003 1368 gene locus_tag LOCUS_12620 gene ftsB 1003 1368 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121014.1 protein_id gnl|my_center|LOCUS_12620 1358 2053 gene locus_tag LOCUS_12630 gene ispD 1358 2053 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206935.1 protein_id gnl|my_center|LOCUS_12630 2188 2664 gene locus_tag LOCUS_12640 2188 2664 CDS product DUF6438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206923.1 protein_id gnl|my_center|LOCUS_12640 3488 2724 gene locus_tag LOCUS_12650 3488 2724 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112528.1 protein_id gnl|my_center|LOCUS_12650 3856 3485 gene locus_tag LOCUS_12660 3856 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 >Feature sequence125 168 743 gene locus_tag LOCUS_12670 168 743 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207928.1 protein_id gnl|my_center|LOCUS_12670 2959 800 gene locus_tag LOCUS_12680 2959 800 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207927.1 protein_id gnl|my_center|LOCUS_12680 >Feature sequence126 <1 781 gene locus_tag LOCUS_12690 <1 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207838.1:16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH 781 1119 gene locus_tag LOCUS_12700 gene ftsL 781 1119 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116847.1 protein_id gnl|my_center|LOCUS_12700 1130 2962 gene locus_tag LOCUS_12710 gene ftsI 1130 2962 CDS product penicillin-binding protein PBP3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117016.1 protein_id gnl|my_center|LOCUS_12710 >Feature sequence127 467 682 gene locus_tag LOCUS_12720 467 682 CDS product KTSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070287.1 protein_id gnl|my_center|LOCUS_12720 1936 743 gene locus_tag LOCUS_12730 1936 743 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206630.1 protein_id gnl|my_center|LOCUS_12730 2056 3105 gene locus_tag LOCUS_12740 2056 3105 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121430.1 protein_id gnl|my_center|LOCUS_12740 3669 3082 gene locus_tag LOCUS_12750 3669 3082 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206205.1 protein_id gnl|my_center|LOCUS_12750 3925 3710 gene locus_tag LOCUS_12760 3925 3710 CDS product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206204.1 protein_id gnl|my_center|LOCUS_12760 >Feature sequence128 225 692 gene locus_tag LOCUS_12770 225 692 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705267.1 protein_id gnl|my_center|LOCUS_12770 719 880 gene locus_tag LOCUS_12780 719 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 954 1388 gene locus_tag LOCUS_12790 954 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 1514 1822 gene locus_tag LOCUS_12800 1514 1822 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208019.1 protein_id gnl|my_center|LOCUS_12800 2184 3977 gene locus_tag LOCUS_12810 2184 3977 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_12810 >Feature sequence129 <1 2120 gene locus_tag LOCUS_12820 <1 2120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812546.1:UvrD-helicase domain-containing protein 2129 2854 gene locus_tag LOCUS_12830 2129 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 2854 4044 gene locus_tag LOCUS_12840 2854 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 >Feature sequence130 1299 541 gene locus_tag LOCUS_12850 1299 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 3860 1485 gene locus_tag LOCUS_12860 3860 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 >Feature sequence131 2151 1453 gene locus_tag LOCUS_12870 2151 1453 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208206.1 protein_id gnl|my_center|LOCUS_12870 2327 3076 gene locus_tag LOCUS_12880 2327 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208207.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence132 413 619 gene locus_tag LOCUS_12890 413 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 1486 782 gene locus_tag LOCUS_12900 1486 782 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 protein_id gnl|my_center|LOCUS_12900 2698 1490 gene locus_tag LOCUS_12910 2698 1490 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_12910 3846 2695 gene locus_tag LOCUS_12920 3846 2695 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266337.1 protein_id gnl|my_center|LOCUS_12920 >Feature sequence133 460 2451 gene locus_tag LOCUS_12930 gene tkt 460 2451 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071210.1 protein_id gnl|my_center|LOCUS_12930 2521 3540 gene locus_tag LOCUS_12940 gene gap 2521 3540 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194065.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence134 1295 360 gene locus_tag LOCUS_12950 1295 360 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338116.1 protein_id gnl|my_center|LOCUS_12950 2785 1292 gene locus_tag LOCUS_12960 2785 1292 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404788.1 protein_id gnl|my_center|LOCUS_12960 3701 2769 gene locus_tag LOCUS_12970 3701 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 >Feature sequence135 <1 650 gene locus_tag LOCUS_12980 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206722.1:bifunctional metallophosphatase/5'-nucleotidase 1960 716 gene locus_tag LOCUS_12990 gene trpB 1960 716 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116129.1 protein_id gnl|my_center|LOCUS_12990 2600 1941 gene locus_tag LOCUS_13000 2600 1941 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207615.1 protein_id gnl|my_center|LOCUS_13000 >Feature sequence136 485 820 gene locus_tag LOCUS_13010 gene uraH 485 820 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626013.1 protein_id gnl|my_center|LOCUS_13010 867 2240 gene locus_tag LOCUS_13020 867 2240 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066765.1 protein_id gnl|my_center|LOCUS_13020 2474 3715 gene locus_tag LOCUS_13030 2474 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 >Feature sequence137 485 820 gene locus_tag LOCUS_13040 gene uraH 485 820 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626013.1 protein_id gnl|my_center|LOCUS_13040 867 2240 gene locus_tag LOCUS_13050 867 2240 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066765.1 protein_id gnl|my_center|LOCUS_13050 2473 3714 gene locus_tag LOCUS_13060 2473 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 >Feature sequence138 <1 1640 gene locus_tag LOCUS_13070 <1 1640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207940.1:protein-disulfide reductase DsbD 1643 2338 gene locus_tag LOCUS_13080 1643 2338 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925693.1 protein_id gnl|my_center|LOCUS_13080 >Feature sequence139 <1 1367 gene locus_tag LOCUS_13090 <1 1367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207906.1:excinuclease ABC subunit UvrA 3154 1391 gene locus_tag LOCUS_13100 3154 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 <3963 3209 gene locus_tag LOCUS_13110 <3963 3209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207907.1:GGDEF domain-containing protein >Feature sequence140 <1 1334 gene locus_tag LOCUS_13120 <1 1334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207622.1:sensor histidine kinase efflux regulator BaeS 1380 2066 gene locus_tag LOCUS_13130 1380 2066 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116101.1 protein_id gnl|my_center|LOCUS_13130 2789 2193 gene locus_tag LOCUS_13140 2789 2193 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207621.1 protein_id gnl|my_center|LOCUS_13140 <3957 2805 gene locus_tag LOCUS_13150 <3957 2805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207620.1:YdiU family protein >Feature sequence141 1291 50 gene locus_tag LOCUS_13160 1291 50 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207595.1 protein_id gnl|my_center|LOCUS_13160 2533 1415 gene locus_tag LOCUS_13170 2533 1415 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207596.1 protein_id gnl|my_center|LOCUS_13170 2747 3760 gene locus_tag LOCUS_13180 2747 3760 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207597.1 protein_id gnl|my_center|LOCUS_13180 >Feature sequence142 778 428 gene locus_tag LOCUS_13190 778 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 1073 2023 gene locus_tag LOCUS_13200 1073 2023 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208249.1 protein_id gnl|my_center|LOCUS_13200 2035 2361 gene locus_tag LOCUS_13210 2035 2361 CDS product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114963.1 protein_id gnl|my_center|LOCUS_13210 <3934 2406 gene locus_tag LOCUS_13220 <3934 2406 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208247.1:polyribonucleotide nucleotidyltransferase >Feature sequence143 2811 1225 gene locus_tag LOCUS_13230 2811 1225 CDS product urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206323.1 protein_id gnl|my_center|LOCUS_13230 3605 2847 gene locus_tag LOCUS_13240 3605 2847 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206321.1 protein_id gnl|my_center|LOCUS_13240 >Feature sequence144 65 703 gene locus_tag LOCUS_13250 65 703 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198307.1 protein_id gnl|my_center|LOCUS_13250 754 1332 gene locus_tag LOCUS_13260 gene slmA 754 1332 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198306.1 protein_id gnl|my_center|LOCUS_13260 2547 1333 gene locus_tag LOCUS_13270 2547 1333 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197240.1 protein_id gnl|my_center|LOCUS_13270 3492 2551 gene locus_tag LOCUS_13280 3492 2551 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197236.1 protein_id gnl|my_center|LOCUS_13280 3869 3522 gene locus_tag LOCUS_13290 3869 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 >Feature sequence145 122 703 gene locus_tag LOCUS_13300 122 703 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192535.1 protein_id gnl|my_center|LOCUS_13300 730 1440 gene locus_tag LOCUS_13310 730 1440 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_13310 1652 1437 gene locus_tag LOCUS_13320 1652 1437 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968955.1 protein_id gnl|my_center|LOCUS_13320 2259 1678 gene locus_tag LOCUS_13330 gene rnhB 2259 1678 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693388.1 protein_id gnl|my_center|LOCUS_13330 3417 2260 gene locus_tag LOCUS_13340 gene lpxB 3417 2260 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205135.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence146 <1 695 gene locus_tag LOCUS_13350 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002001007.1:imidazole glycerol phosphate synthase subunit HisF 1678 1034 gene locus_tag LOCUS_13360 1678 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207867.1 protein_id gnl|my_center|LOCUS_13360 1793 2800 gene locus_tag LOCUS_13370 1793 2800 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207868.1 protein_id gnl|my_center|LOCUS_13370 2976 3668 gene locus_tag LOCUS_13380 gene aqpZ 2976 3668 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207869.1 protein_id gnl|my_center|LOCUS_13380 >Feature sequence147 <1 734 gene locus_tag LOCUS_13390 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207649.1:PHP domain-containing protein 1657 740 gene locus_tag LOCUS_13400 1657 740 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037803.1 protein_id gnl|my_center|LOCUS_13400 1764 2810 gene locus_tag LOCUS_13410 1764 2810 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057648430.1 protein_id gnl|my_center|LOCUS_13410 <3800 2881 gene locus_tag LOCUS_13420 <3800 2881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005064169.1:bestrophin family protein >Feature sequence148 2308 1760 gene locus_tag LOCUS_13430 2308 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 2939 3061 gene locus_tag LOCUS_13440 2939 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 3445 3131 gene locus_tag LOCUS_13450 3445 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 >Feature sequence149 3453 934 gene locus_tag LOCUS_13460 3453 934 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 protein_id gnl|my_center|LOCUS_13460 >Feature sequence150 427 134 gene locus_tag LOCUS_13470 427 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 2841 646 gene locus_tag LOCUS_13480 2841 646 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207935.1 protein_id gnl|my_center|LOCUS_13480 3163 3435 gene locus_tag LOCUS_13490 3163 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 >Feature sequence151 <1 2074 gene locus_tag LOCUS_13500 <1 2074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207305.1:EAL domain-containing protein 2461 2237 gene locus_tag LOCUS_13510 gene rpmE 2461 2237 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200845.1 protein_id gnl|my_center|LOCUS_13510 3628 2660 gene locus_tag LOCUS_13520 3628 2660 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207306.1 protein_id gnl|my_center|LOCUS_13520 >Feature sequence152 705 151 gene locus_tag LOCUS_13530 705 151 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207877.1 protein_id gnl|my_center|LOCUS_13530 840 1175 gene locus_tag LOCUS_13540 840 1175 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207878.1 protein_id gnl|my_center|LOCUS_13540 1295 2740 gene locus_tag LOCUS_13550 gene dnaB 1295 2740 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119718.1 protein_id gnl|my_center|LOCUS_13550 >Feature sequence153 1254 658 gene locus_tag LOCUS_13560 1254 658 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064380616.1 protein_id gnl|my_center|LOCUS_13560 2357 1500 gene locus_tag LOCUS_13570 2357 1500 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207096.1 protein_id gnl|my_center|LOCUS_13570 3231 2710 gene locus_tag LOCUS_13580 3231 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 >Feature sequence154 679 152 gene locus_tag LOCUS_13590 679 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 811 1110 gene locus_tag LOCUS_13600 811 1110 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207671.1 protein_id gnl|my_center|LOCUS_13600 1246 1758 gene locus_tag LOCUS_13610 gene purE 1246 1758 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115451.1 protein_id gnl|my_center|LOCUS_13610 1827 2948 gene locus_tag LOCUS_13620 1827 2948 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207670.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence155 <1 1048 gene locus_tag LOCUS_13630 <1 1048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002215003.1:cytochrome bc complex cytochrome b subunit 1048 1758 gene locus_tag LOCUS_13640 1048 1758 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199892.1 protein_id gnl|my_center|LOCUS_13640 1832 2431 gene locus_tag LOCUS_13650 1832 2431 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185176.1 protein_id gnl|my_center|LOCUS_13650 2437 2853 gene locus_tag LOCUS_13660 2437 2853 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377610.1 protein_id gnl|my_center|LOCUS_13660 2888 2963 gene locus_tag LOCUS_t00170 2888 2963 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3152 3236 gene locus_tag LOCUS_t00180 3152 3236 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3313 3386 gene locus_tag LOCUS_t00190 3313 3386 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3420 3494 gene locus_tag LOCUS_t00200 3420 3494 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence156 1675 3318 gene locus_tag LOCUS_13670 1675 3318 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208402.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence157 1240 206 gene locus_tag LOCUS_13680 1240 206 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207015.1 protein_id gnl|my_center|LOCUS_13680 1831 1241 gene locus_tag LOCUS_13690 1831 1241 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115726.1 protein_id gnl|my_center|LOCUS_13690 >Feature sequence158 >Feature sequence159 1099 179 gene locus_tag LOCUS_13700 gene lpxC 1099 179 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194158.1 protein_id gnl|my_center|LOCUS_13700 2447 1221 gene locus_tag LOCUS_13710 gene ftsZ 2447 1221 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194380.1 protein_id gnl|my_center|LOCUS_13710 <3411 2571 gene locus_tag LOCUS_13720 <3411 2571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004545961.1:cell division protein FtsA >Feature sequence160 111 794 gene locus_tag LOCUS_13730 gene ybiX 111 794 CDS product PKHD-type hydroxylase YbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990161.1 protein_id gnl|my_center|LOCUS_13730 794 1894 gene locus_tag LOCUS_13740 794 1894 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_13740 >Feature sequence161 239 373 gene locus_tag LOCUS_13750 gene rpmH 239 373 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831329.1 protein_id gnl|my_center|LOCUS_13750 407 796 gene locus_tag LOCUS_13760 gene rnpA 407 796 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207683.1 protein_id gnl|my_center|LOCUS_13760 806 1126 gene locus_tag LOCUS_13770 806 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 1132 2895 gene locus_tag LOCUS_13780 gene yidC 1132 2895 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207682.1 protein_id gnl|my_center|LOCUS_13780 >Feature sequence162 901 335 gene locus_tag LOCUS_13790 901 335 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206263.1 protein_id gnl|my_center|LOCUS_13790 <3313 1026 gene locus_tag LOCUS_13800 <3313 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206264.1:DNA mismatch repair protein MutS >Feature sequence163 382 993 gene locus_tag LOCUS_13810 382 993 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_13810 1138 3096 gene locus_tag LOCUS_13820 1138 3096 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527907.1 protein_id gnl|my_center|LOCUS_13820 >Feature sequence164 492 1550 gene locus_tag LOCUS_13830 gene hisC 492 1550 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268858.1 protein_id gnl|my_center|LOCUS_13830 1714 2394 gene locus_tag LOCUS_13840 1714 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 2500 3087 gene locus_tag LOCUS_13850 gene hisB 2500 3087 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence165 1205 297 gene locus_tag LOCUS_13860 1205 297 CDS product M57 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207667.1 protein_id gnl|my_center|LOCUS_13860 1618 1202 gene locus_tag LOCUS_13870 1618 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207664.1 protein_id gnl|my_center|LOCUS_13870 1801 2685 gene locus_tag LOCUS_13880 1801 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 3239 2937 gene locus_tag LOCUS_13890 3239 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 >Feature sequence166 <1 761 gene locus_tag LOCUS_13900 <1 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392632.1:AAA family ATPase 979 1263 gene locus_tag LOCUS_13910 gene bprA 979 1263 CDS product T3SS protein BprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187356.1 protein_id gnl|my_center|LOCUS_13910 1474 1605 gene locus_tag LOCUS_13920 1474 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 1655 2749 gene locus_tag LOCUS_13930 1655 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 >Feature sequence167 <1 1129 gene locus_tag LOCUS_13940 <1 1129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206603.1:NAD(P)/FAD-dependent oxidoreductase 1177 2094 gene locus_tag LOCUS_13950 1177 2094 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206602.1 protein_id gnl|my_center|LOCUS_13950 2844 2164 gene locus_tag LOCUS_13960 gene pyrF 2844 2164 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069518.1 protein_id gnl|my_center|LOCUS_13960 >Feature sequence168 <1 917 gene locus_tag LOCUS_13970 <1 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207693.1:anhydro-N-acetylmuramic acid kinase 1304 969 gene locus_tag LOCUS_13980 gene erpA 1304 969 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115421.1 protein_id gnl|my_center|LOCUS_13980 2433 1429 gene locus_tag LOCUS_13990 2433 1429 CDS product DUF6091 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207691.1 protein_id gnl|my_center|LOCUS_13990 >Feature sequence169 1037 387 gene locus_tag LOCUS_14000 gene pyrE 1037 387 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211305.1 protein_id gnl|my_center|LOCUS_14000 1079 1903 gene locus_tag LOCUS_14010 1079 1903 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122009.1 protein_id gnl|my_center|LOCUS_14010 2243 2557 gene locus_tag LOCUS_14020 2243 2557 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207938.1 protein_id gnl|my_center|LOCUS_14020 3054 2617 gene locus_tag LOCUS_14030 3054 2617 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121971.1 protein_id gnl|my_center|LOCUS_14030 >Feature sequence170 67 228 gene locus_tag LOCUS_14040 67 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 237 677 gene locus_tag LOCUS_14050 237 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 1267 1004 gene locus_tag LOCUS_14060 1267 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 1495 1268 gene locus_tag LOCUS_14070 1495 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 1926 1492 gene locus_tag LOCUS_14080 1926 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 2283 1930 gene locus_tag LOCUS_14090 2283 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 2660 2286 gene locus_tag LOCUS_14100 2660 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 2806 2663 gene locus_tag LOCUS_14110 2806 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 >Feature sequence171 1215 355 gene locus_tag LOCUS_14120 1215 355 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206545.1 protein_id gnl|my_center|LOCUS_14120 1667 2227 gene locus_tag LOCUS_14130 1667 2227 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121343.1 protein_id gnl|my_center|LOCUS_14130 <3093 2324 gene locus_tag LOCUS_14140 <3093 2324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002118187.1:ferredoxin--NADP reductase >Feature sequence172 583 194 gene locus_tag LOCUS_14150 583 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 1463 612 gene locus_tag LOCUS_14160 gene czcR 1463 612 CDS product LysR family transcriptional regulator CzcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398672.1 protein_id gnl|my_center|LOCUS_14160 1726 2625 gene locus_tag LOCUS_14170 1726 2625 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399570.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence173 1278 373 gene locus_tag LOCUS_14180 1278 373 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691917.1 protein_id gnl|my_center|LOCUS_14180 1551 1309 gene locus_tag LOCUS_14190 gene xseB 1551 1309 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208660.1 protein_id gnl|my_center|LOCUS_14190 2240 1575 gene locus_tag LOCUS_14200 2240 1575 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_14200 2848 2312 gene locus_tag LOCUS_14210 2848 2312 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087475.1 protein_id gnl|my_center|LOCUS_14210 >Feature sequence174 1310 288 gene locus_tag LOCUS_14220 1310 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 1425 2300 gene locus_tag LOCUS_14230 1425 2300 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207613.1 protein_id gnl|my_center|LOCUS_14230 <2986 2361 gene locus_tag LOCUS_14240 <2986 2361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207614.1:DUF2804 domain-containing protein >Feature sequence175 >Feature sequence176 <1 719 gene locus_tag LOCUS_14250 <1 719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207417.1:diaminopimelate decarboxylase 726 1580 gene locus_tag LOCUS_14260 gene dapF 726 1580 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207416.1 protein_id gnl|my_center|LOCUS_14260 1642 2247 gene locus_tag LOCUS_14270 1642 2247 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207415.1 protein_id gnl|my_center|LOCUS_14270 <2899 2250 gene locus_tag LOCUS_14280 <2899 2250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207414.1:LysE family translocator >Feature sequence177 467 682 gene locus_tag LOCUS_14290 467 682 CDS product KTSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070287.1 protein_id gnl|my_center|LOCUS_14290 1936 743 gene locus_tag LOCUS_14300 1936 743 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206630.1 protein_id gnl|my_center|LOCUS_14300 >Feature sequence178 712 1620 gene locus_tag LOCUS_14310 gene gnd 712 1620 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350162.1 protein_id gnl|my_center|LOCUS_14310 >Feature sequence179 610 212 gene locus_tag LOCUS_14320 610 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 1303 941 gene locus_tag LOCUS_14330 1303 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 2367 1750 gene locus_tag LOCUS_14340 2367 1750 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095305.1 protein_id gnl|my_center|LOCUS_14340 >Feature sequence180 451 134 gene locus_tag LOCUS_14350 451 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 <2811 647 gene locus_tag LOCUS_14360 <2811 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207935.1:TonB-dependent siderophore receptor >Feature sequence181 2086 854 gene locus_tag LOCUS_14370 gene serA 2086 854 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116919.1 protein_id gnl|my_center|LOCUS_14370 2075 2215 gene locus_tag LOCUS_14380 2075 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 >Feature sequence182 232 936 gene locus_tag LOCUS_14390 232 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 1718 987 gene locus_tag LOCUS_14400 gene hisA 1718 987 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207860.1 protein_id gnl|my_center|LOCUS_14400 2433 1891 gene locus_tag LOCUS_14410 2433 1891 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067011.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence183 3 482 gene locus_tag LOCUS_14420 3 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 1893 547 gene locus_tag LOCUS_14430 gene gdhA 1893 547 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206092.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence184 <1 1520 gene locus_tag LOCUS_14440 <1 1520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207452.1:glycerol kinase GlpK 1574 2332 gene locus_tag LOCUS_14450 1574 2332 CDS product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011169330.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence185 1025 474 gene locus_tag LOCUS_14460 1025 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 1721 1038 gene locus_tag LOCUS_14470 1721 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 2291 1755 gene locus_tag LOCUS_14480 2291 1755 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112742.1 protein_id gnl|my_center|LOCUS_14480 >Feature sequence186 371 853 gene locus_tag LOCUS_14490 371 853 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068860.1 protein_id gnl|my_center|LOCUS_14490 2252 855 gene locus_tag LOCUS_14500 2252 855 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207005.1 protein_id gnl|my_center|LOCUS_14500