>Feature sequence001 3757 1550 gene locus_tag LOCUS_00010 3757 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 4748 3771 gene locus_tag LOCUS_00020 4748 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 5250 4882 gene locus_tag LOCUS_00030 gene mscL 5250 4882 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267001.1 protein_id gnl|my_center|LOCUS_00030 6175 5297 gene locus_tag LOCUS_00040 6175 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 7774 6257 gene locus_tag LOCUS_00050 7774 6257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 9728 7779 gene locus_tag LOCUS_00060 9728 7779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 9989 11674 gene locus_tag LOCUS_00070 9989 11674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 11843 12715 gene locus_tag LOCUS_00080 11843 12715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 12961 13464 gene locus_tag LOCUS_00090 gene dcd 12961 13464 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546770.1 protein_id gnl|my_center|LOCUS_00090 13617 14117 gene locus_tag LOCUS_00100 13617 14117 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120379.1 protein_id gnl|my_center|LOCUS_00100 14357 15598 gene locus_tag LOCUS_00110 14357 15598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 16196 15765 gene locus_tag LOCUS_00120 gene ssb 16196 15765 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806953.1 protein_id gnl|my_center|LOCUS_00120 16494 16868 gene locus_tag LOCUS_00130 16494 16868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 16903 17862 gene locus_tag LOCUS_00140 16903 17862 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257444.1 protein_id gnl|my_center|LOCUS_00140 17874 18299 gene locus_tag LOCUS_00150 17874 18299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 18841 18353 gene locus_tag LOCUS_00160 18841 18353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 18955 21747 gene locus_tag LOCUS_00170 18955 21747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 21927 23639 gene locus_tag LOCUS_00180 21927 23639 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430205.1 protein_id gnl|my_center|LOCUS_00180 23784 24488 gene locus_tag LOCUS_00190 gene ubiE 23784 24488 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259480.1 protein_id gnl|my_center|LOCUS_00190 24530 25159 gene locus_tag LOCUS_00200 24530 25159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 28121 25191 gene locus_tag LOCUS_00210 28121 25191 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257471.1 protein_id gnl|my_center|LOCUS_00210 29147 28215 gene locus_tag LOCUS_00220 29147 28215 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258807.1 protein_id gnl|my_center|LOCUS_00220 30136 29261 gene locus_tag LOCUS_00230 gene truB 30136 29261 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100522.1 protein_id gnl|my_center|LOCUS_00230 31113 30133 gene locus_tag LOCUS_00240 31113 30133 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_00240 31498 31118 gene locus_tag LOCUS_00250 gene rbfA 31498 31118 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002994317.1 protein_id gnl|my_center|LOCUS_00250 33288 31501 gene locus_tag LOCUS_00260 33288 31501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 33649 33347 gene locus_tag LOCUS_00270 33649 33347 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258864.1 protein_id gnl|my_center|LOCUS_00270 35659 33659 gene locus_tag LOCUS_00280 35659 33659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 36099 37304 gene locus_tag LOCUS_00290 36099 37304 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257553.1 protein_id gnl|my_center|LOCUS_00290 37431 38822 gene locus_tag LOCUS_00300 37431 38822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 39104 39673 gene locus_tag LOCUS_00310 39104 39673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 39722 40876 gene locus_tag LOCUS_00320 39722 40876 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257556.1 protein_id gnl|my_center|LOCUS_00320 41267 40959 gene locus_tag LOCUS_00330 41267 40959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 43224 41347 gene locus_tag LOCUS_00340 43224 41347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 43866 43246 gene locus_tag LOCUS_00350 43866 43246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 44463 43882 gene locus_tag LOCUS_00360 44463 43882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 44988 44494 gene locus_tag LOCUS_00370 44988 44494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 46990 44999 gene locus_tag LOCUS_00380 46990 44999 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_00380 47580 47074 gene locus_tag LOCUS_00390 47580 47074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 47958 47605 gene locus_tag LOCUS_00400 47958 47605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 49114 48452 gene locus_tag LOCUS_00410 49114 48452 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727243.1 protein_id gnl|my_center|LOCUS_00410 50660 49104 gene locus_tag LOCUS_00420 50660 49104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 51619 50660 gene locus_tag LOCUS_00430 51619 50660 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_00430 52232 51609 gene locus_tag LOCUS_00440 52232 51609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 53659 52379 gene locus_tag LOCUS_00450 gene hybB 53659 52379 CDS product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941443.1 protein_id gnl|my_center|LOCUS_00450 54474 53656 gene locus_tag LOCUS_00460 54474 53656 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902581.1 protein_id gnl|my_center|LOCUS_00460 55456 54458 gene locus_tag LOCUS_00470 55456 54458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 55988 56140 gene locus_tag LOCUS_00480 55988 56140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 58648 56393 gene locus_tag LOCUS_00490 58648 56393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 59813 58752 gene locus_tag LOCUS_00500 59813 58752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 61535 59835 gene locus_tag LOCUS_00510 61535 59835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 62813 61569 gene locus_tag LOCUS_00520 62813 61569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 63164 65713 gene locus_tag LOCUS_00530 gene gyrA 63164 65713 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257126.1 protein_id gnl|my_center|LOCUS_00530 65975 68872 gene locus_tag LOCUS_00540 65975 68872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 69137 68856 gene locus_tag LOCUS_00550 69137 68856 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391906.1 protein_id gnl|my_center|LOCUS_00550 70097 69882 gene locus_tag LOCUS_00560 70097 69882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 70045 71280 gene locus_tag LOCUS_00570 70045 71280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 71703 71281 gene locus_tag LOCUS_00580 71703 71281 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144326.1 protein_id gnl|my_center|LOCUS_00580 71987 71700 gene locus_tag LOCUS_00590 71987 71700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 72143 72373 gene locus_tag LOCUS_00600 72143 72373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 72382 72747 gene locus_tag LOCUS_00610 72382 72747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 73716 72880 gene locus_tag LOCUS_00620 73716 72880 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933356.1 protein_id gnl|my_center|LOCUS_00620 73888 74124 gene locus_tag LOCUS_00630 73888 74124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790422.1 protein_id gnl|my_center|LOCUS_00630 74111 74557 gene locus_tag LOCUS_00640 74111 74557 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653660.1 protein_id gnl|my_center|LOCUS_00640 74648 75253 gene locus_tag LOCUS_00650 74648 75253 CDS product CadD family cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485755.1 protein_id gnl|my_center|LOCUS_00650 76423 75215 gene locus_tag LOCUS_00660 76423 75215 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941297.1 protein_id gnl|my_center|LOCUS_00660 77263 76556 gene locus_tag LOCUS_00670 77263 76556 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_00670 78247 77327 gene locus_tag LOCUS_00680 78247 77327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 78364 79053 gene locus_tag LOCUS_00690 gene nth 78364 79053 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_00690 79064 79423 gene locus_tag LOCUS_00700 79064 79423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 80669 79434 gene locus_tag LOCUS_00710 gene rlmD 80669 79434 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703308.1 protein_id gnl|my_center|LOCUS_00710 81624 80677 gene locus_tag LOCUS_00720 gene rnz 81624 80677 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086661.1 protein_id gnl|my_center|LOCUS_00720 82458 81817 gene locus_tag LOCUS_00730 82458 81817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 83132 82635 gene locus_tag LOCUS_00740 83132 82635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 84286 83132 gene locus_tag LOCUS_00750 84286 83132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258216.1 protein_id gnl|my_center|LOCUS_00750 85688 84357 gene locus_tag LOCUS_00760 85688 84357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 88990 85880 gene locus_tag LOCUS_00770 88990 85880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 89510 89830 gene locus_tag LOCUS_00780 89510 89830 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529756.1 protein_id gnl|my_center|LOCUS_00780 91959 89920 gene locus_tag LOCUS_00790 91959 89920 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257772.1 protein_id gnl|my_center|LOCUS_00790 92045 93379 gene locus_tag LOCUS_00800 92045 93379 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986425.1 protein_id gnl|my_center|LOCUS_00800 93393 94187 gene locus_tag LOCUS_00810 93393 94187 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775698.1 protein_id gnl|my_center|LOCUS_00810 94284 95636 gene locus_tag LOCUS_00820 94284 95636 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909443.1 protein_id gnl|my_center|LOCUS_00820 95727 98642 gene locus_tag LOCUS_00830 95727 98642 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258962.1 protein_id gnl|my_center|LOCUS_00830 98851 99867 gene locus_tag LOCUS_00840 gene aztC 98851 99867 CDS product zinc ABC transporter substrate-binding protein AztC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731003.1 protein_id gnl|my_center|LOCUS_00840 99864 100691 gene locus_tag LOCUS_00850 99864 100691 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257863.1 protein_id gnl|my_center|LOCUS_00850 100715 101575 gene locus_tag LOCUS_00860 100715 101575 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257864.1 protein_id gnl|my_center|LOCUS_00860 101572 102009 gene locus_tag LOCUS_00870 101572 102009 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964989.1 protein_id gnl|my_center|LOCUS_00870 102456 102121 gene locus_tag LOCUS_00880 102456 102121 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142925.1 protein_id gnl|my_center|LOCUS_00880 102788 102459 gene locus_tag LOCUS_00890 102788 102459 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142926.1 protein_id gnl|my_center|LOCUS_00890 102997 104775 gene locus_tag LOCUS_00900 102997 104775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 104865 106724 gene locus_tag LOCUS_00910 104865 106724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 109193 106725 gene locus_tag LOCUS_00920 109193 106725 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141000.1 protein_id gnl|my_center|LOCUS_00920 110878 109394 gene locus_tag LOCUS_00930 110878 109394 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258761.1 protein_id gnl|my_center|LOCUS_00930 111339 112928 gene locus_tag LOCUS_00940 111339 112928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 112978 114150 gene locus_tag LOCUS_00950 112978 114150 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257531.1 protein_id gnl|my_center|LOCUS_00950 114193 115200 gene locus_tag LOCUS_00960 114193 115200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256558.1 protein_id gnl|my_center|LOCUS_00960 115222 115665 gene locus_tag LOCUS_00970 115222 115665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 115883 117604 gene locus_tag LOCUS_00980 115883 117604 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259553.1 protein_id gnl|my_center|LOCUS_00980 117608 118915 gene locus_tag LOCUS_00990 117608 118915 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259552.1 protein_id gnl|my_center|LOCUS_00990 118945 120714 gene locus_tag LOCUS_01000 118945 120714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 121193 120762 gene locus_tag LOCUS_01010 121193 120762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 122463 121204 gene locus_tag LOCUS_01020 122463 121204 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 protein_id gnl|my_center|LOCUS_01020 >Feature sequence002 47 973 gene locus_tag LOCUS_01030 47 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 1041 1577 gene locus_tag LOCUS_01040 1041 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 1662 2402 gene locus_tag LOCUS_01050 1662 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 2517 3494 gene locus_tag LOCUS_01060 2517 3494 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256709.1 protein_id gnl|my_center|LOCUS_01060 3510 4394 gene locus_tag LOCUS_01070 3510 4394 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816301.1 protein_id gnl|my_center|LOCUS_01070 4875 4384 gene locus_tag LOCUS_01080 4875 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 5871 4939 gene locus_tag LOCUS_01090 5871 4939 CDS product DUF4349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256099.1 protein_id gnl|my_center|LOCUS_01090 6698 5958 gene locus_tag LOCUS_01100 6698 5958 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259632.1 protein_id gnl|my_center|LOCUS_01100 6920 7420 gene locus_tag LOCUS_01110 gene tsaE 6920 7420 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257860.1 protein_id gnl|my_center|LOCUS_01110 7507 8166 gene locus_tag LOCUS_01120 gene tsaB 7507 8166 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257859.1 protein_id gnl|my_center|LOCUS_01120 8173 8715 gene locus_tag LOCUS_01130 gene rimI 8173 8715 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393645.1 protein_id gnl|my_center|LOCUS_01130 8780 9826 gene locus_tag LOCUS_01140 8780 9826 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909115.1 protein_id gnl|my_center|LOCUS_01140 9912 11963 gene locus_tag LOCUS_01150 9912 11963 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141702.1 protein_id gnl|my_center|LOCUS_01150 11974 12354 gene locus_tag LOCUS_01160 11974 12354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 12341 12679 gene locus_tag LOCUS_01170 12341 12679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 12775 13854 gene locus_tag LOCUS_01180 gene prfA 12775 13854 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583170.1 protein_id gnl|my_center|LOCUS_01180 13914 14378 gene locus_tag LOCUS_01190 13914 14378 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_01190 14443 18066 gene locus_tag LOCUS_01200 14443 18066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 18302 19090 gene locus_tag LOCUS_01210 18302 19090 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929229.1 protein_id gnl|my_center|LOCUS_01210 19092 20165 gene locus_tag LOCUS_01220 19092 20165 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061730.1 protein_id gnl|my_center|LOCUS_01220 20158 20808 gene locus_tag LOCUS_01230 20158 20808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 20916 22055 gene locus_tag LOCUS_01240 20916 22055 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_01240 22207 23514 gene locus_tag LOCUS_01250 22207 23514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 23776 24894 gene locus_tag LOCUS_01260 23776 24894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 25063 26277 gene locus_tag LOCUS_01270 25063 26277 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456721.1 protein_id gnl|my_center|LOCUS_01270 26519 27541 gene locus_tag LOCUS_01280 26519 27541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 27578 28348 gene locus_tag LOCUS_01290 gene rfbF 27578 28348 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435696.1 protein_id gnl|my_center|LOCUS_01290 28366 29406 gene locus_tag LOCUS_01300 28366 29406 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613588.1 protein_id gnl|my_center|LOCUS_01300 29503 30738 gene locus_tag LOCUS_01310 29503 30738 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975517.1 protein_id gnl|my_center|LOCUS_01310 30940 31731 gene locus_tag LOCUS_01320 30940 31731 CDS product putative capsular polysaccharide synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478215.1 protein_id gnl|my_center|LOCUS_01320 31738 32568 gene locus_tag LOCUS_01330 31738 32568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 32618 33928 gene locus_tag LOCUS_01340 32618 33928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 33993 35609 gene locus_tag LOCUS_01350 33993 35609 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258202.1 protein_id gnl|my_center|LOCUS_01350 35719 36267 gene locus_tag LOCUS_01360 35719 36267 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257304.1 protein_id gnl|my_center|LOCUS_01360 36378 37721 gene locus_tag LOCUS_01370 gene dnaB 36378 37721 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256839.1 protein_id gnl|my_center|LOCUS_01370 37792 38520 gene locus_tag LOCUS_01380 37792 38520 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257454.1 protein_id gnl|my_center|LOCUS_01380 38441 39904 gene locus_tag LOCUS_01390 38441 39904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 41724 39952 gene locus_tag LOCUS_01400 41724 39952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 41983 43224 gene locus_tag LOCUS_01410 41983 43224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 43663 43319 gene locus_tag LOCUS_01420 43663 43319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 43857 43630 gene locus_tag LOCUS_01430 43857 43630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402859.1 protein_id gnl|my_center|LOCUS_01430 44299 43949 gene locus_tag LOCUS_01440 44299 43949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 45293 44970 gene locus_tag LOCUS_01450 45293 44970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 45686 45964 gene locus_tag LOCUS_01460 45686 45964 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_01460 45945 46142 gene locus_tag LOCUS_01470 45945 46142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 46323 47888 gene locus_tag LOCUS_01480 46323 47888 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162015845.1 protein_id gnl|my_center|LOCUS_01480 48557 48123 gene locus_tag LOCUS_01490 gene aroQ 48557 48123 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583808.1 protein_id gnl|my_center|LOCUS_01490 50189 48579 gene locus_tag LOCUS_01500 50189 48579 CDS product bifunctional shikimate kinase/3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870357.1 protein_id gnl|my_center|LOCUS_01500 51155 50199 gene locus_tag LOCUS_01510 gene holA 51155 50199 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392113.1 protein_id gnl|my_center|LOCUS_01510 51758 51177 gene locus_tag LOCUS_01520 51758 51177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 52189 51767 gene locus_tag LOCUS_01530 52189 51767 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532393.1 protein_id gnl|my_center|LOCUS_01530 52454 53803 gene locus_tag LOCUS_01540 52454 53803 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329291.1 protein_id gnl|my_center|LOCUS_01540 53979 54857 gene locus_tag LOCUS_01550 53979 54857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 55065 57860 gene locus_tag LOCUS_01560 55065 57860 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256081.1 protein_id gnl|my_center|LOCUS_01560 58029 58271 gene locus_tag LOCUS_01570 58029 58271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 58268 58669 gene locus_tag LOCUS_01580 58268 58669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 59264 58674 gene locus_tag LOCUS_01590 59264 58674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 59372 59977 gene locus_tag LOCUS_01600 59372 59977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 60056 60832 gene locus_tag LOCUS_01610 60056 60832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 60972 61196 gene locus_tag LOCUS_01620 60972 61196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 61298 62173 gene locus_tag LOCUS_01630 61298 62173 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_01630 62332 63387 gene locus_tag LOCUS_01640 62332 63387 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480024.1 protein_id gnl|my_center|LOCUS_01640 63414 65288 gene locus_tag LOCUS_01650 63414 65288 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921313.1 protein_id gnl|my_center|LOCUS_01650 67456 65321 gene locus_tag LOCUS_01660 67456 65321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 68259 67453 gene locus_tag LOCUS_01670 68259 67453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 68471 69082 gene locus_tag LOCUS_01680 68471 69082 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 protein_id gnl|my_center|LOCUS_01680 69129 69680 gene locus_tag LOCUS_01690 69129 69680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 69729 70874 gene locus_tag LOCUS_01700 69729 70874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 71633 70977 gene locus_tag LOCUS_01710 71633 70977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 71756 73003 gene locus_tag LOCUS_01720 gene dpaL 71756 73003 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812104.1 protein_id gnl|my_center|LOCUS_01720 73593 75422 gene locus_tag LOCUS_01730 gene thrS 73593 75422 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888712.1 protein_id gnl|my_center|LOCUS_01730 75548 75751 gene locus_tag LOCUS_01740 75548 75751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 75915 77834 gene locus_tag LOCUS_01750 75915 77834 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929086.1 protein_id gnl|my_center|LOCUS_01750 77959 79824 gene locus_tag LOCUS_01760 77959 79824 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142714.1 protein_id gnl|my_center|LOCUS_01760 80564 79896 gene locus_tag LOCUS_01770 80564 79896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 80989 80561 gene locus_tag LOCUS_01780 80989 80561 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531012.1 protein_id gnl|my_center|LOCUS_01780 81148 82953 gene locus_tag LOCUS_01790 81148 82953 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111158892.1 protein_id gnl|my_center|LOCUS_01790 83086 83601 gene locus_tag LOCUS_01800 83086 83601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 83614 84447 gene locus_tag LOCUS_01810 83614 84447 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887660.1 protein_id gnl|my_center|LOCUS_01810 84643 85629 gene locus_tag LOCUS_01820 84643 85629 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048017.1 protein_id gnl|my_center|LOCUS_01820 85690 86097 gene locus_tag LOCUS_01830 gene mce 85690 86097 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_01830 86182 87573 gene locus_tag LOCUS_01840 gene lpdA 86182 87573 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892330.1 protein_id gnl|my_center|LOCUS_01840 87566 87964 gene locus_tag LOCUS_01850 gene higA 87566 87964 CDS product type II toxin-antitoxin system antitoxin HigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560266.1 protein_id gnl|my_center|LOCUS_01850 88176 88397 gene locus_tag LOCUS_01860 88176 88397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 89000 88578 gene locus_tag LOCUS_01870 89000 88578 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404325.1 protein_id gnl|my_center|LOCUS_01870 89230 89000 gene locus_tag LOCUS_01880 89230 89000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 >Feature sequence003 1147 1554 gene locus_tag LOCUS_01890 1147 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 1551 1985 gene locus_tag LOCUS_01900 1551 1985 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141668.1 protein_id gnl|my_center|LOCUS_01900 2041 2304 gene locus_tag LOCUS_01910 2041 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 3195 2311 gene locus_tag LOCUS_01920 3195 2311 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257001.1 protein_id gnl|my_center|LOCUS_01920 3918 3223 gene locus_tag LOCUS_01930 gene rnc 3918 3223 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354946.1 protein_id gnl|my_center|LOCUS_01930 5186 3918 gene locus_tag LOCUS_01940 gene fabF 5186 3918 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144002.1 protein_id gnl|my_center|LOCUS_01940 5918 5202 gene locus_tag LOCUS_01950 5918 5202 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227680.1 protein_id gnl|my_center|LOCUS_01950 6498 6010 gene locus_tag LOCUS_01960 gene moaC 6498 6010 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256659.1 protein_id gnl|my_center|LOCUS_01960 6611 7465 gene locus_tag LOCUS_01970 6611 7465 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258204.1 protein_id gnl|my_center|LOCUS_01970 7584 9566 gene locus_tag LOCUS_01980 7584 9566 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259648.1 protein_id gnl|my_center|LOCUS_01980 9574 10374 gene locus_tag LOCUS_01990 9574 10374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 10440 11930 gene locus_tag LOCUS_02000 10440 11930 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259646.1 protein_id gnl|my_center|LOCUS_02000 11927 12484 gene locus_tag LOCUS_02010 11927 12484 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259645.1 protein_id gnl|my_center|LOCUS_02010 12608 12853 gene locus_tag LOCUS_02020 12608 12853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 12861 13592 gene locus_tag LOCUS_02030 12861 13592 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_02030 13741 16014 gene locus_tag LOCUS_02040 13741 16014 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257324.1 protein_id gnl|my_center|LOCUS_02040 16240 16533 gene locus_tag LOCUS_02050 16240 16533 CDS product isoamylase early set domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477072.1 protein_id gnl|my_center|LOCUS_02050 16548 16859 gene locus_tag LOCUS_02060 16548 16859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 18925 16982 gene locus_tag LOCUS_02070 18925 16982 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_02070 22403 18963 gene locus_tag LOCUS_02080 22403 18963 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969249.1 protein_id gnl|my_center|LOCUS_02080 23973 22723 gene locus_tag LOCUS_02090 23973 22723 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927136.1 protein_id gnl|my_center|LOCUS_02090 25631 24114 gene locus_tag LOCUS_02100 25631 24114 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926839.1 protein_id gnl|my_center|LOCUS_02100 28451 25752 gene locus_tag LOCUS_02110 28451 25752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 28693 29349 gene locus_tag LOCUS_02120 28693 29349 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919766.1 protein_id gnl|my_center|LOCUS_02120 29709 29395 gene locus_tag LOCUS_02130 29709 29395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 32253 29722 gene locus_tag LOCUS_02140 32253 29722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 32751 32266 gene locus_tag LOCUS_02150 32751 32266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 33406 32744 gene locus_tag LOCUS_02160 33406 32744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 33664 34485 gene locus_tag LOCUS_02170 33664 34485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 34852 34511 gene locus_tag LOCUS_02180 34852 34511 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112991.1 protein_id gnl|my_center|LOCUS_02180 36599 34944 gene locus_tag LOCUS_02190 gene groL 36599 34944 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258594.1 protein_id gnl|my_center|LOCUS_02190 36920 36627 gene locus_tag LOCUS_02200 gene groES 36920 36627 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114319.1 protein_id gnl|my_center|LOCUS_02200 38319 37099 gene locus_tag LOCUS_02210 38319 37099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 39630 38647 gene locus_tag LOCUS_02220 39630 38647 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257470.1 protein_id gnl|my_center|LOCUS_02220 39696 40259 gene locus_tag LOCUS_02230 39696 40259 CDS product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147114.1 protein_id gnl|my_center|LOCUS_02230 40347 41837 gene locus_tag LOCUS_02240 40347 41837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 41986 43557 gene locus_tag LOCUS_02250 41986 43557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 43587 44036 gene locus_tag LOCUS_02260 43587 44036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 44243 44317 gene locus_tag LOCUS_t00010 44243 44317 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 44351 45994 gene locus_tag LOCUS_02270 44351 45994 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256378.1 protein_id gnl|my_center|LOCUS_02270 46053 46880 gene locus_tag LOCUS_02280 46053 46880 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229628.1 protein_id gnl|my_center|LOCUS_02280 46909 49548 gene locus_tag LOCUS_02290 46909 49548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 49635 50291 gene locus_tag LOCUS_02300 49635 50291 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007388333.1 protein_id gnl|my_center|LOCUS_02300 51185 50331 gene locus_tag LOCUS_02310 51185 50331 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814610.1 protein_id gnl|my_center|LOCUS_02310 51540 52325 gene locus_tag LOCUS_02320 51540 52325 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223226.1 protein_id gnl|my_center|LOCUS_02320 53128 52319 gene locus_tag LOCUS_02330 gene trpC 53128 52319 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943016.1 protein_id gnl|my_center|LOCUS_02330 53741 53133 gene locus_tag LOCUS_02340 53741 53133 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183791.1 protein_id gnl|my_center|LOCUS_02340 53869 54639 gene locus_tag LOCUS_02350 53869 54639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 55451 54654 gene locus_tag LOCUS_02360 55451 54654 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393254.1 protein_id gnl|my_center|LOCUS_02360 56683 55484 gene locus_tag LOCUS_02370 56683 55484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 56858 57724 gene locus_tag LOCUS_02380 56858 57724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 57725 58939 gene locus_tag LOCUS_02390 57725 58939 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258675.1 protein_id gnl|my_center|LOCUS_02390 59396 59698 gene locus_tag LOCUS_02400 59396 59698 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389060.1 protein_id gnl|my_center|LOCUS_02400 59757 60068 gene locus_tag LOCUS_02410 59757 60068 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258305.1 protein_id gnl|my_center|LOCUS_02410 60107 60256 gene locus_tag LOCUS_02420 60107 60256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 61449 60274 gene locus_tag LOCUS_02430 61449 60274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 61600 63846 gene locus_tag LOCUS_02440 61600 63846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 64781 63834 gene locus_tag LOCUS_02450 64781 63834 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_02450 64949 65536 gene locus_tag LOCUS_02460 64949 65536 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706171.1 protein_id gnl|my_center|LOCUS_02460 65599 66309 gene locus_tag LOCUS_02470 65599 66309 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392843.1 protein_id gnl|my_center|LOCUS_02470 66598 69078 gene locus_tag LOCUS_02480 66598 69078 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257621.1 protein_id gnl|my_center|LOCUS_02480 70786 69137 gene locus_tag LOCUS_02490 70786 69137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 71230 72237 gene locus_tag LOCUS_02500 gene argC 71230 72237 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259290.1 protein_id gnl|my_center|LOCUS_02500 72258 73070 gene locus_tag LOCUS_02510 gene argB 72258 73070 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259245.1 protein_id gnl|my_center|LOCUS_02510 73102 74277 gene locus_tag LOCUS_02520 73102 74277 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257809.1 protein_id gnl|my_center|LOCUS_02520 74369 74869 gene locus_tag LOCUS_02530 74369 74869 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205378591.1 protein_id gnl|my_center|LOCUS_02530 75290 74901 gene locus_tag LOCUS_02540 75290 74901 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_02540 75511 75287 gene locus_tag LOCUS_02550 75511 75287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 75664 78951 gene locus_tag LOCUS_02560 75664 78951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 79128 79589 gene locus_tag LOCUS_02570 79128 79589 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258972.1 protein_id gnl|my_center|LOCUS_02570 >Feature sequence004 1884 547 gene locus_tag LOCUS_02580 gene asnS 1884 547 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257312.1 protein_id gnl|my_center|LOCUS_02580 3268 2018 gene locus_tag LOCUS_02590 3268 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 5728 3341 gene locus_tag LOCUS_02600 5728 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 7533 5818 gene locus_tag LOCUS_02610 7533 5818 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256397.1 protein_id gnl|my_center|LOCUS_02610 7968 7582 gene locus_tag LOCUS_02620 7968 7582 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053649.1 protein_id gnl|my_center|LOCUS_02620 8297 7971 gene locus_tag LOCUS_02630 8297 7971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 11689 8435 gene locus_tag LOCUS_02640 11689 8435 CDS product glucodextranase DOMON-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583045.1 protein_id gnl|my_center|LOCUS_02640 12706 11795 gene locus_tag LOCUS_02650 12706 11795 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583080.1 protein_id gnl|my_center|LOCUS_02650 14310 12703 gene locus_tag LOCUS_02660 gene malF 14310 12703 CDS product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583081.1 protein_id gnl|my_center|LOCUS_02660 16258 14507 gene locus_tag LOCUS_02670 16258 14507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 16874 16419 gene locus_tag LOCUS_02680 16874 16419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 17030 17104 gene locus_tag LOCUS_t00020 17030 17104 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 17226 18917 gene locus_tag LOCUS_02690 gene kstD 17226 18917 CDS product 3-oxosteroid 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730906.1 protein_id gnl|my_center|LOCUS_02690 18965 19801 gene locus_tag LOCUS_02700 18965 19801 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258662.1 protein_id gnl|my_center|LOCUS_02700 20128 19871 gene locus_tag LOCUS_02710 20128 19871 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530146.1 protein_id gnl|my_center|LOCUS_02710 21227 20178 gene locus_tag LOCUS_02720 21227 20178 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258816.1 protein_id gnl|my_center|LOCUS_02720 21413 23296 gene locus_tag LOCUS_02730 gene dnaK 21413 23296 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258113.1 protein_id gnl|my_center|LOCUS_02730 25477 23477 gene locus_tag LOCUS_02740 25477 23477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 28475 25932 gene locus_tag LOCUS_02750 28475 25932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 30215 28713 gene locus_tag LOCUS_02760 30215 28713 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143698.1 protein_id gnl|my_center|LOCUS_02760 31476 30334 gene locus_tag LOCUS_02770 31476 30334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 31475 31702 gene locus_tag LOCUS_02780 31475 31702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 32576 31599 gene locus_tag LOCUS_02790 gene galE 32576 31599 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255969.1 protein_id gnl|my_center|LOCUS_02790 33226 32669 gene locus_tag LOCUS_02800 gene gmhB 33226 32669 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259582.1 protein_id gnl|my_center|LOCUS_02800 33838 33248 gene locus_tag LOCUS_02810 33838 33248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 34829 33849 gene locus_tag LOCUS_02820 34829 33849 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_02820 35774 34890 gene locus_tag LOCUS_02830 35774 34890 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142189.1 protein_id gnl|my_center|LOCUS_02830 36687 35833 gene locus_tag LOCUS_02840 36687 35833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 38297 36777 gene locus_tag LOCUS_02850 38297 36777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 38569 38641 gene locus_tag LOCUS_t00030 38569 38641 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 39456 38668 gene locus_tag LOCUS_02860 gene rlmB 39456 38668 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257938.1 protein_id gnl|my_center|LOCUS_02860 40873 39431 gene locus_tag LOCUS_02870 gene cysS 40873 39431 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933811.1 protein_id gnl|my_center|LOCUS_02870 41987 40911 gene locus_tag LOCUS_02880 41987 40911 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919684.1 protein_id gnl|my_center|LOCUS_02880 42496 43437 gene locus_tag LOCUS_02890 42496 43437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 43538 43915 gene locus_tag LOCUS_02900 43538 43915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 44014 44400 gene locus_tag LOCUS_02910 44014 44400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 44477 45778 gene locus_tag LOCUS_02920 44477 45778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 45786 46442 gene locus_tag LOCUS_02930 45786 46442 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226658.1 protein_id gnl|my_center|LOCUS_02930 48169 46439 gene locus_tag LOCUS_02940 48169 46439 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258660.1 protein_id gnl|my_center|LOCUS_02940 48828 48169 gene locus_tag LOCUS_02950 48828 48169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 50166 48907 gene locus_tag LOCUS_02960 50166 48907 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404146.1 protein_id gnl|my_center|LOCUS_02960 50347 51927 gene locus_tag LOCUS_02970 gene dnaX 50347 51927 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121572.1 protein_id gnl|my_center|LOCUS_02970 51980 52351 gene locus_tag LOCUS_02980 51980 52351 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256425.1 protein_id gnl|my_center|LOCUS_02980 52355 52960 gene locus_tag LOCUS_02990 gene recR 52355 52960 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_02990 53004 54431 gene locus_tag LOCUS_03000 53004 54431 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948141.1 protein_id gnl|my_center|LOCUS_03000 54646 55884 gene locus_tag LOCUS_03010 54646 55884 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258677.1 protein_id gnl|my_center|LOCUS_03010 57112 55997 gene locus_tag LOCUS_03020 gene asd 57112 55997 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404575.1 protein_id gnl|my_center|LOCUS_03020 57333 57251 gene locus_tag LOCUS_t00040 57333 57251 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 57537 58085 gene locus_tag LOCUS_03030 57537 58085 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633254.1 protein_id gnl|my_center|LOCUS_03030 58155 59762 gene locus_tag LOCUS_03040 58155 59762 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402899.1 protein_id gnl|my_center|LOCUS_03040 59908 60990 gene locus_tag LOCUS_03050 59908 60990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 61332 61955 gene locus_tag LOCUS_03060 61332 61955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 61979 63586 gene locus_tag LOCUS_03070 61979 63586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 64986 63601 gene locus_tag LOCUS_03080 64986 63601 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_03080 67981 65078 gene locus_tag LOCUS_03090 67981 65078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 69509 67974 gene locus_tag LOCUS_03100 69509 67974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 70260 69553 gene locus_tag LOCUS_03110 70260 69553 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_03110 70483 71307 gene locus_tag LOCUS_03120 70483 71307 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909158.1 protein_id gnl|my_center|LOCUS_03120 71294 72379 gene locus_tag LOCUS_03130 gene rlmN 71294 72379 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258793.1 protein_id gnl|my_center|LOCUS_03130 73461 72376 gene locus_tag LOCUS_03140 73461 72376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 74953 73676 gene locus_tag LOCUS_03150 gene rho 74953 73676 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256183.1 protein_id gnl|my_center|LOCUS_03150 >Feature sequence005 96 1382 gene locus_tag LOCUS_03160 gene eno 96 1382 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259639.1 protein_id gnl|my_center|LOCUS_03160 1457 2122 gene locus_tag LOCUS_03170 1457 2122 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721539.1 protein_id gnl|my_center|LOCUS_03170 2209 2697 gene locus_tag LOCUS_03180 2209 2697 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263523.1 protein_id gnl|my_center|LOCUS_03180 7777 2759 gene locus_tag LOCUS_03190 7777 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 8861 7752 gene locus_tag LOCUS_03200 8861 7752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 8922 9125 gene locus_tag LOCUS_03210 8922 9125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 9447 10508 gene locus_tag LOCUS_03220 9447 10508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 10534 11865 gene locus_tag LOCUS_03230 gene trmFO 10534 11865 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001991958.1 protein_id gnl|my_center|LOCUS_03230 11953 13566 gene locus_tag LOCUS_03240 gene muiA 11953 13566 CDS product mucoidy inhibitor MuiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114297.1 protein_id gnl|my_center|LOCUS_03240 13695 14933 gene locus_tag LOCUS_03250 gene hflX 13695 14933 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_03250 14930 16102 gene locus_tag LOCUS_03260 14930 16102 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257313.1 protein_id gnl|my_center|LOCUS_03260 16148 17290 gene locus_tag LOCUS_03270 16148 17290 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245114.1 protein_id gnl|my_center|LOCUS_03270 18779 17304 gene locus_tag LOCUS_03280 18779 17304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 19012 20316 gene locus_tag LOCUS_03290 19012 20316 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257876.1 protein_id gnl|my_center|LOCUS_03290 21576 20347 gene locus_tag LOCUS_03300 gene odhB 21576 20347 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259557.1 protein_id gnl|my_center|LOCUS_03300 24401 21573 gene locus_tag LOCUS_03310 24401 21573 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259558.1 protein_id gnl|my_center|LOCUS_03310 24703 24476 gene locus_tag LOCUS_03320 24703 24476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 25962 24751 gene locus_tag LOCUS_03330 25962 24751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 26736 26059 gene locus_tag LOCUS_03340 gene lexA 26736 26059 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256381.1 protein_id gnl|my_center|LOCUS_03340 26893 28455 gene locus_tag LOCUS_03350 26893 28455 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112648.1 protein_id gnl|my_center|LOCUS_03350 30367 28505 gene locus_tag LOCUS_03360 gene malZ 30367 28505 CDS product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257409.1 protein_id gnl|my_center|LOCUS_03360 30878 30426 gene locus_tag LOCUS_03370 30878 30426 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258548.1 protein_id gnl|my_center|LOCUS_03370 31307 30969 gene locus_tag LOCUS_03380 31307 30969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 32038 31304 gene locus_tag LOCUS_03390 32038 31304 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368777.1 protein_id gnl|my_center|LOCUS_03390 34920 32086 gene locus_tag LOCUS_03400 34920 32086 CDS product clostripain-related cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257646.1 protein_id gnl|my_center|LOCUS_03400 35397 36506 gene locus_tag LOCUS_03410 35397 36506 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255993.1 protein_id gnl|my_center|LOCUS_03410 39345 36532 gene locus_tag LOCUS_03420 39345 36532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 40214 39345 gene locus_tag LOCUS_03430 gene mtnP 40214 39345 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259453.1 protein_id gnl|my_center|LOCUS_03430 40628 41881 gene locus_tag LOCUS_03440 40628 41881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 42032 44308 gene locus_tag LOCUS_03450 42032 44308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 44381 45523 gene locus_tag LOCUS_03460 44381 45523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 45560 47512 gene locus_tag LOCUS_03470 gene ftsH 45560 47512 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257906.1 protein_id gnl|my_center|LOCUS_03470 47571 49532 gene locus_tag LOCUS_03480 47571 49532 CDS product histidine kinase N-terminal 7TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258668.1 protein_id gnl|my_center|LOCUS_03480 49522 50772 gene locus_tag LOCUS_03490 gene lysA 49522 50772 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_03490 51000 50830 gene locus_tag LOCUS_03500 51000 50830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 53886 51220 gene locus_tag LOCUS_03510 53886 51220 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258507.1 protein_id gnl|my_center|LOCUS_03510 55446 54202 gene locus_tag LOCUS_03520 55446 54202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 56237 55491 gene locus_tag LOCUS_03530 56237 55491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 58147 56291 gene locus_tag LOCUS_03540 58147 56291 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279209.1 protein_id gnl|my_center|LOCUS_03540 59150 58131 gene locus_tag LOCUS_03550 59150 58131 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256508.1 protein_id gnl|my_center|LOCUS_03550 63106 59195 gene locus_tag LOCUS_03560 63106 59195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 64368 63184 gene locus_tag LOCUS_03570 64368 63184 CDS product TIGR03087 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_03570 64488 65438 gene locus_tag LOCUS_03580 64488 65438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 66583 65420 gene locus_tag LOCUS_03590 66583 65420 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115615.1 protein_id gnl|my_center|LOCUS_03590 67617 66580 gene locus_tag LOCUS_03600 67617 66580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 68557 67628 gene locus_tag LOCUS_03610 68557 67628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 69501 68554 gene locus_tag LOCUS_03620 69501 68554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 71033 69579 gene locus_tag LOCUS_03630 71033 69579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 72029 71058 gene locus_tag LOCUS_03640 72029 71058 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_03640 72712 72026 gene locus_tag LOCUS_03650 gene udk 72712 72026 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257573.1 protein_id gnl|my_center|LOCUS_03650 72842 72769 gene locus_tag LOCUS_t00050 72842 72769 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence006 576 1034 gene locus_tag LOCUS_03660 576 1034 CDS product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 protein_id gnl|my_center|LOCUS_03660 1262 1540 gene locus_tag LOCUS_03670 1262 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 2418 1627 gene locus_tag LOCUS_03680 2418 1627 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256575.1 protein_id gnl|my_center|LOCUS_03680 2746 2435 gene locus_tag LOCUS_03690 2746 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 2953 4131 gene locus_tag LOCUS_03700 2953 4131 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275113.1 protein_id gnl|my_center|LOCUS_03700 4158 4478 gene locus_tag LOCUS_03710 4158 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 4518 5312 gene locus_tag LOCUS_03720 4518 5312 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114596.1 protein_id gnl|my_center|LOCUS_03720 5333 6106 gene locus_tag LOCUS_03730 5333 6106 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257316.1 protein_id gnl|my_center|LOCUS_03730 7776 6103 gene locus_tag LOCUS_03740 7776 6103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 8698 7790 gene locus_tag LOCUS_03750 8698 7790 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_03750 8844 10349 gene locus_tag LOCUS_03760 8844 10349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 10567 10755 gene locus_tag LOCUS_03770 gene rpmF 10567 10755 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355952.1 protein_id gnl|my_center|LOCUS_03770 10887 11789 gene locus_tag LOCUS_03780 gene fabD 10887 11789 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_03780 11874 12620 gene locus_tag LOCUS_03790 gene fabG 11874 12620 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_03790 12617 12976 gene locus_tag LOCUS_03800 12617 12976 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699841.1 protein_id gnl|my_center|LOCUS_03800 13034 13483 gene locus_tag LOCUS_03810 gene nusB 13034 13483 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909412.1 protein_id gnl|my_center|LOCUS_03810 15046 13670 gene locus_tag LOCUS_03820 15046 13670 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 protein_id gnl|my_center|LOCUS_03820 15842 15102 gene locus_tag LOCUS_03830 15842 15102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 16074 17285 gene locus_tag LOCUS_03840 16074 17285 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087747.1 protein_id gnl|my_center|LOCUS_03840 17657 17753 gene locus_tag LOCUS_t00060 17657 17753 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 17845 18237 gene locus_tag LOCUS_03850 17845 18237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 18279 19262 gene locus_tag LOCUS_03860 18279 19262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 20314 19271 gene locus_tag LOCUS_03870 20314 19271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 21519 20395 gene locus_tag LOCUS_03880 21519 20395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 22418 21786 gene locus_tag LOCUS_03890 22418 21786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 22649 23239 gene locus_tag LOCUS_03900 22649 23239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 23236 24048 gene locus_tag LOCUS_03910 23236 24048 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256708.1 protein_id gnl|my_center|LOCUS_03910 24206 24436 gene locus_tag LOCUS_03920 24206 24436 CDS product hexameric tyrosine-coordinated heme protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143643.1 protein_id gnl|my_center|LOCUS_03920 24558 24893 gene locus_tag LOCUS_03930 24558 24893 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941369.1 protein_id gnl|my_center|LOCUS_03930 25761 24910 gene locus_tag LOCUS_03940 25761 24910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 27362 25848 gene locus_tag LOCUS_03950 27362 25848 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258760.1 protein_id gnl|my_center|LOCUS_03950 29621 27408 gene locus_tag LOCUS_03960 gene nuoL 29621 27408 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258759.1 protein_id gnl|my_center|LOCUS_03960 29995 29684 gene locus_tag LOCUS_03970 gene nuoK 29995 29684 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258758.1 protein_id gnl|my_center|LOCUS_03970 30515 29988 gene locus_tag LOCUS_03980 30515 29988 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258757.1 protein_id gnl|my_center|LOCUS_03980 31098 30598 gene locus_tag LOCUS_03990 gene nuoI 31098 30598 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258756.1 protein_id gnl|my_center|LOCUS_03990 32283 31180 gene locus_tag LOCUS_04000 gene nuoH 32283 31180 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258755.1 protein_id gnl|my_center|LOCUS_04000 34978 32375 gene locus_tag LOCUS_04010 gene nuoG 34978 32375 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258754.1 protein_id gnl|my_center|LOCUS_04010 36305 35022 gene locus_tag LOCUS_04020 gene nuoF 36305 35022 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909320.1 protein_id gnl|my_center|LOCUS_04020 36893 36366 gene locus_tag LOCUS_04030 36893 36366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 38205 36943 gene locus_tag LOCUS_04040 gene nuoD 38205 36943 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258751.1 protein_id gnl|my_center|LOCUS_04040 38815 38294 gene locus_tag LOCUS_04050 38815 38294 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258750.1 protein_id gnl|my_center|LOCUS_04050 39360 38878 gene locus_tag LOCUS_04060 39360 38878 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258749.1 protein_id gnl|my_center|LOCUS_04060 39716 39351 gene locus_tag LOCUS_04070 gene ndhC 39716 39351 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258748.1 protein_id gnl|my_center|LOCUS_04070 39977 40237 gene locus_tag LOCUS_04080 39977 40237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 40240 40647 gene locus_tag LOCUS_04090 40240 40647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 40687 41064 gene locus_tag LOCUS_04100 40687 41064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142930.1 protein_id gnl|my_center|LOCUS_04100 41061 41486 gene locus_tag LOCUS_04110 41061 41486 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141668.1 protein_id gnl|my_center|LOCUS_04110 41596 43650 gene locus_tag LOCUS_04120 41596 43650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 43746 45536 gene locus_tag LOCUS_04130 43746 45536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 48543 45553 gene locus_tag LOCUS_04140 48543 45553 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010892217.1 protein_id gnl|my_center|LOCUS_04140 48715 51360 gene locus_tag LOCUS_04150 gene mrfA 48715 51360 CDS product ATP-dependent helicase MrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246149.1 protein_id gnl|my_center|LOCUS_04150 51434 51820 gene locus_tag LOCUS_04160 51434 51820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 51822 52682 gene locus_tag LOCUS_04170 51822 52682 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257914.1 protein_id gnl|my_center|LOCUS_04170 52851 54506 gene locus_tag LOCUS_04180 52851 54506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 57431 54606 gene locus_tag LOCUS_04190 57431 54606 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257493.1 protein_id gnl|my_center|LOCUS_04190 58542 57559 gene locus_tag LOCUS_04200 58542 57559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 59619 58588 gene locus_tag LOCUS_04210 59619 58588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 62543 59622 gene locus_tag LOCUS_04220 62543 59622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 63892 62588 gene locus_tag LOCUS_04230 63892 62588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 66244 64031 gene locus_tag LOCUS_04240 gene mrdA 66244 64031 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530035.1 protein_id gnl|my_center|LOCUS_04240 <70111 66455 gene locus_tag LOCUS_04250 <70111 66455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393372.1:DNA polymerase III subunit alpha >Feature sequence007 1690 104 gene locus_tag LOCUS_04260 1690 104 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_04260 2207 1806 gene locus_tag LOCUS_04270 2207 1806 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957424.1 protein_id gnl|my_center|LOCUS_04270 3443 2244 gene locus_tag LOCUS_04280 3443 2244 CDS product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968121.1 protein_id gnl|my_center|LOCUS_04280 4317 3511 gene locus_tag LOCUS_04290 4317 3511 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014630030.1 protein_id gnl|my_center|LOCUS_04290 5828 4314 gene locus_tag LOCUS_04300 gene mtgB 5828 4314 CDS product glycine betaine--corrinoid protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816521.1 protein_id gnl|my_center|LOCUS_04300 6869 5934 gene locus_tag LOCUS_04310 6869 5934 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258871.1 protein_id gnl|my_center|LOCUS_04310 7391 8641 gene locus_tag LOCUS_04320 7391 8641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 9521 8700 gene locus_tag LOCUS_04330 9521 8700 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257343.1 protein_id gnl|my_center|LOCUS_04330 9770 10606 gene locus_tag LOCUS_04340 9770 10606 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257972.1 protein_id gnl|my_center|LOCUS_04340 10620 11909 gene locus_tag LOCUS_04350 10620 11909 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942151.1 protein_id gnl|my_center|LOCUS_04350 11912 12715 gene locus_tag LOCUS_04360 11912 12715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 12741 14612 gene locus_tag LOCUS_04370 gene asnB 12741 14612 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387983.1 protein_id gnl|my_center|LOCUS_04370 14659 15492 gene locus_tag LOCUS_04380 14659 15492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 15498 16745 gene locus_tag LOCUS_04390 15498 16745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 16944 18614 gene locus_tag LOCUS_04400 16944 18614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 19181 19822 gene locus_tag LOCUS_04410 19181 19822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 19825 21054 gene locus_tag LOCUS_04420 19825 21054 CDS product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142460.1 protein_id gnl|my_center|LOCUS_04420 21044 22708 gene locus_tag LOCUS_04430 21044 22708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 22855 24168 gene locus_tag LOCUS_04440 22855 24168 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963377.1 protein_id gnl|my_center|LOCUS_04440 24228 25382 gene locus_tag LOCUS_04450 24228 25382 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403060.1 protein_id gnl|my_center|LOCUS_04450 25396 26568 gene locus_tag LOCUS_04460 25396 26568 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963379.1 protein_id gnl|my_center|LOCUS_04460 26704 27669 gene locus_tag LOCUS_04470 26704 27669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 27662 29062 gene locus_tag LOCUS_04480 27662 29062 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257994.1 protein_id gnl|my_center|LOCUS_04480 29059 30345 gene locus_tag LOCUS_04490 29059 30345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 30412 31449 gene locus_tag LOCUS_04500 30412 31449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 31462 33387 gene locus_tag LOCUS_04510 31462 33387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 33388 34110 gene locus_tag LOCUS_04520 33388 34110 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820420.1 protein_id gnl|my_center|LOCUS_04520 34114 35832 gene locus_tag LOCUS_04530 34114 35832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 35924 36916 gene locus_tag LOCUS_04540 35924 36916 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808328.1 protein_id gnl|my_center|LOCUS_04540 36947 37711 gene locus_tag LOCUS_04550 36947 37711 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808326.1 protein_id gnl|my_center|LOCUS_04550 37719 38921 gene locus_tag LOCUS_04560 37719 38921 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533116.1 protein_id gnl|my_center|LOCUS_04560 39001 40929 gene locus_tag LOCUS_04570 39001 40929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 41244 42509 gene locus_tag LOCUS_04580 41244 42509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 42603 44618 gene locus_tag LOCUS_04590 42603 44618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 44714 46777 gene locus_tag LOCUS_04600 gene abc-f 44714 46777 CDS product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195117.1 protein_id gnl|my_center|LOCUS_04600 46743 47342 gene locus_tag LOCUS_04610 gene coaE 46743 47342 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257771.1 protein_id gnl|my_center|LOCUS_04610 47435 47692 gene locus_tag LOCUS_04620 47435 47692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 47713 48840 gene locus_tag LOCUS_04630 47713 48840 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257004.1 protein_id gnl|my_center|LOCUS_04630 48963 48769 gene locus_tag LOCUS_04640 48963 48769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 49028 50806 gene locus_tag LOCUS_04650 49028 50806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 50852 52231 gene locus_tag LOCUS_04660 50852 52231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 52734 52255 gene locus_tag LOCUS_04670 52734 52255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 52880 52806 gene locus_tag LOCUS_t00070 52880 52806 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 53023 53580 gene locus_tag LOCUS_04680 gene hpt 53023 53580 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257905.1 protein_id gnl|my_center|LOCUS_04680 54585 53557 gene locus_tag LOCUS_04690 54585 53557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 55265 54636 gene locus_tag LOCUS_04700 55265 54636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 56745 55351 gene locus_tag LOCUS_04710 56745 55351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 57814 56891 gene locus_tag LOCUS_04720 57814 56891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 59333 57870 gene locus_tag LOCUS_04730 59333 57870 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875981.1 protein_id gnl|my_center|LOCUS_04730 60072 59305 gene locus_tag LOCUS_04740 60072 59305 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941293.1 protein_id gnl|my_center|LOCUS_04740 61105 60209 gene locus_tag LOCUS_04750 61105 60209 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_04750 61982 61107 gene locus_tag LOCUS_04760 61982 61107 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119848.1 protein_id gnl|my_center|LOCUS_04760 63250 61982 gene locus_tag LOCUS_04770 63250 61982 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257135.1 protein_id gnl|my_center|LOCUS_04770 64129 63302 gene locus_tag LOCUS_04780 64129 63302 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707673.1 protein_id gnl|my_center|LOCUS_04780 >Feature sequence008 3562 2573 gene locus_tag LOCUS_04790 3562 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 4239 3601 gene locus_tag LOCUS_04800 4239 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 5404 4220 gene locus_tag LOCUS_04810 gene mltG 5404 4220 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257814.1 protein_id gnl|my_center|LOCUS_04810 5849 5394 gene locus_tag LOCUS_04820 gene ruvX 5849 5394 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259679.1 protein_id gnl|my_center|LOCUS_04820 7157 5982 gene locus_tag LOCUS_04830 7157 5982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 9927 7225 gene locus_tag LOCUS_04840 gene alaS 9927 7225 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259677.1 protein_id gnl|my_center|LOCUS_04840 10169 9930 gene locus_tag LOCUS_04850 10169 9930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 11170 10223 gene locus_tag LOCUS_04860 11170 10223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 12205 11528 gene locus_tag LOCUS_04870 12205 11528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 12828 12220 gene locus_tag LOCUS_04880 12828 12220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 13665 12856 gene locus_tag LOCUS_04890 gene cyoE 13665 12856 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879528.1 protein_id gnl|my_center|LOCUS_04890 14710 13751 gene locus_tag LOCUS_04900 14710 13751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 16248 14707 gene locus_tag LOCUS_04910 16248 14707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 16558 16406 gene locus_tag LOCUS_04920 16558 16406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 16665 17084 gene locus_tag LOCUS_04930 16665 17084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 17161 18357 gene locus_tag LOCUS_04940 17161 18357 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_04940 18315 19418 gene locus_tag LOCUS_04950 18315 19418 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889453.1 protein_id gnl|my_center|LOCUS_04950 19590 20093 gene locus_tag LOCUS_04960 gene nrfH 19590 20093 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325128.1 protein_id gnl|my_center|LOCUS_04960 20109 21419 gene locus_tag LOCUS_04970 20109 21419 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810724.1 protein_id gnl|my_center|LOCUS_04970 21516 22361 gene locus_tag LOCUS_04980 21516 22361 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090991.1 protein_id gnl|my_center|LOCUS_04980 22683 23387 gene locus_tag LOCUS_04990 22683 23387 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716356.1 protein_id gnl|my_center|LOCUS_04990 23766 23999 gene locus_tag LOCUS_05000 23766 23999 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943111.1 protein_id gnl|my_center|LOCUS_05000 23996 24406 gene locus_tag LOCUS_05010 23996 24406 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943110.1 protein_id gnl|my_center|LOCUS_05010 25224 24418 gene locus_tag LOCUS_05020 25224 24418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 25427 27064 gene locus_tag LOCUS_05030 25427 27064 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972394.1 protein_id gnl|my_center|LOCUS_05030 27181 27492 gene locus_tag LOCUS_05040 27181 27492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 27489 27842 gene locus_tag LOCUS_05050 27489 27842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 29152 27860 gene locus_tag LOCUS_05060 29152 27860 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015207390.1 protein_id gnl|my_center|LOCUS_05060 29263 30063 gene locus_tag LOCUS_05070 29263 30063 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_05070 30882 30115 gene locus_tag LOCUS_05080 30882 30115 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258881.1 protein_id gnl|my_center|LOCUS_05080 32375 30993 gene locus_tag LOCUS_05090 32375 30993 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259685.1 protein_id gnl|my_center|LOCUS_05090 33081 32380 gene locus_tag LOCUS_05100 33081 32380 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259684.1 protein_id gnl|my_center|LOCUS_05100 33976 33305 gene locus_tag LOCUS_05110 33976 33305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 36349 34187 gene locus_tag LOCUS_05120 gene ppk1 36349 34187 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233899.1 protein_id gnl|my_center|LOCUS_05120 36433 38229 gene locus_tag LOCUS_05130 36433 38229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 38320 38391 gene locus_tag LOCUS_t00080 38320 38391 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 40871 38460 gene locus_tag LOCUS_05140 gene lon 40871 38460 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229618.1 protein_id gnl|my_center|LOCUS_05140 41165 43129 gene locus_tag LOCUS_05150 41165 43129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 43209 43595 gene locus_tag LOCUS_05160 43209 43595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 43639 46440 gene locus_tag LOCUS_05170 gene polA 43639 46440 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256248.1 protein_id gnl|my_center|LOCUS_05170 46437 47879 gene locus_tag LOCUS_05180 46437 47879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 48514 47870 gene locus_tag LOCUS_05190 48514 47870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 49225 49641 gene locus_tag LOCUS_05200 49225 49641 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258700.1 protein_id gnl|my_center|LOCUS_05200 49750 50928 gene locus_tag LOCUS_05210 49750 50928 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893677.1 protein_id gnl|my_center|LOCUS_05210 51335 50952 gene locus_tag LOCUS_05220 51335 50952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 51694 51473 gene locus_tag LOCUS_05230 51694 51473 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419624.1 protein_id gnl|my_center|LOCUS_05230 52658 51921 gene locus_tag LOCUS_05240 52658 51921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 53452 52697 gene locus_tag LOCUS_05250 gene udp 53452 52697 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_05250 54521 53526 gene locus_tag LOCUS_05260 54521 53526 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036002.1 protein_id gnl|my_center|LOCUS_05260 56263 54518 gene locus_tag LOCUS_05270 gene aceK 56263 54518 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038861.1 protein_id gnl|my_center|LOCUS_05270 56703 56260 gene locus_tag LOCUS_05280 56703 56260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 57940 56858 gene locus_tag LOCUS_05290 57940 56858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 59204 58041 gene locus_tag LOCUS_05300 59204 58041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 62595 59524 gene locus_tag LOCUS_05310 62595 59524 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256947.1 protein_id gnl|my_center|LOCUS_05310 62972 62616 gene locus_tag LOCUS_05320 62972 62616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 63436 62969 gene locus_tag LOCUS_05330 63436 62969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05330 63935 63591 gene locus_tag LOCUS_05340 63935 63591 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176701.1 protein_id gnl|my_center|LOCUS_05340 >Feature sequence009 235 1515 gene locus_tag LOCUS_05350 235 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 1795 1601 gene locus_tag LOCUS_05360 1795 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 3049 1958 gene locus_tag LOCUS_05370 3049 1958 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258698.1 protein_id gnl|my_center|LOCUS_05370 3113 4522 gene locus_tag LOCUS_05380 gene rsmF 3113 4522 CDS product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228642.1 protein_id gnl|my_center|LOCUS_05380 5851 4517 gene locus_tag LOCUS_05390 5851 4517 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_05390 6527 5976 gene locus_tag LOCUS_05400 gene rfaH 6527 5976 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268290.1 protein_id gnl|my_center|LOCUS_05400 7859 6534 gene locus_tag LOCUS_05410 7859 6534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 8577 7861 gene locus_tag LOCUS_05420 8577 7861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 10102 8585 gene locus_tag LOCUS_05430 10102 8585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 11042 10197 gene locus_tag LOCUS_05440 11042 10197 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553932.1 protein_id gnl|my_center|LOCUS_05440 11541 11131 gene locus_tag LOCUS_05450 11541 11131 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172491.1 protein_id gnl|my_center|LOCUS_05450 12475 11684 gene locus_tag LOCUS_05460 12475 11684 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804111.1 protein_id gnl|my_center|LOCUS_05460 12974 12606 gene locus_tag LOCUS_05470 12974 12606 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056657.1 protein_id gnl|my_center|LOCUS_05470 13198 15258 gene locus_tag LOCUS_05480 13198 15258 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_05480 16034 15276 gene locus_tag LOCUS_05490 16034 15276 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257381.1 protein_id gnl|my_center|LOCUS_05490 16860 16078 gene locus_tag LOCUS_05500 16860 16078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 16793 17026 gene locus_tag LOCUS_05510 16793 17026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 17949 17509 gene locus_tag LOCUS_05520 17949 17509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 20190 18847 gene locus_tag LOCUS_05530 20190 18847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 21384 20386 gene locus_tag LOCUS_05540 21384 20386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 22675 21359 gene locus_tag LOCUS_05550 22675 21359 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257374.1 protein_id gnl|my_center|LOCUS_05550 23206 22775 gene locus_tag LOCUS_05560 23206 22775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 24219 23224 gene locus_tag LOCUS_05570 24219 23224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 24345 24719 gene locus_tag LOCUS_05580 24345 24719 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259125.1 protein_id gnl|my_center|LOCUS_05580 24813 25385 gene locus_tag LOCUS_05590 24813 25385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 25443 26018 gene locus_tag LOCUS_05600 25443 26018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 26072 26770 gene locus_tag LOCUS_05610 26072 26770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 26778 27644 gene locus_tag LOCUS_05620 gene murI 26778 27644 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768855.1 protein_id gnl|my_center|LOCUS_05620 27790 28185 gene locus_tag LOCUS_05630 27790 28185 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256497.1 protein_id gnl|my_center|LOCUS_05630 28339 30831 gene locus_tag LOCUS_05640 28339 30831 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256922.1 protein_id gnl|my_center|LOCUS_05640 31346 30915 gene locus_tag LOCUS_05650 31346 30915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 31472 32425 gene locus_tag LOCUS_05660 31472 32425 CDS product metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942637.1 protein_id gnl|my_center|LOCUS_05660 32475 32966 gene locus_tag LOCUS_05670 32475 32966 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256436.1 protein_id gnl|my_center|LOCUS_05670 33538 32969 gene locus_tag LOCUS_05680 33538 32969 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143524.1 protein_id gnl|my_center|LOCUS_05680 34917 33553 gene locus_tag LOCUS_05690 gene mocA 34917 33553 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393499.1 protein_id gnl|my_center|LOCUS_05690 35864 34914 gene locus_tag LOCUS_05700 35864 34914 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819234.1 protein_id gnl|my_center|LOCUS_05700 36832 35897 gene locus_tag LOCUS_05710 36832 35897 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819234.1 protein_id gnl|my_center|LOCUS_05710 37659 36829 gene locus_tag LOCUS_05720 gene yqeB 37659 36829 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459388.1 protein_id gnl|my_center|LOCUS_05720 39910 37670 gene locus_tag LOCUS_05730 gene pucD 39910 37670 CDS product xanthine dehydrogenase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243174.1 protein_id gnl|my_center|LOCUS_05730 41360 39903 gene locus_tag LOCUS_05740 41360 39903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 42207 41368 gene locus_tag LOCUS_05750 42207 41368 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940877.1 protein_id gnl|my_center|LOCUS_05750 42719 42321 gene locus_tag LOCUS_05760 42719 42321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 48966 42880 gene locus_tag LOCUS_05770 48966 42880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 49466 50221 gene locus_tag LOCUS_05780 gene tpiA 49466 50221 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231038.1 protein_id gnl|my_center|LOCUS_05780 50320 51087 gene locus_tag LOCUS_05790 50320 51087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 51252 52364 gene locus_tag LOCUS_05800 51252 52364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 52378 52896 gene locus_tag LOCUS_05810 52378 52896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 52939 54237 gene locus_tag LOCUS_05820 52939 54237 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887089.1 protein_id gnl|my_center|LOCUS_05820 54230 54613 gene locus_tag LOCUS_05830 54230 54613 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258556.1 protein_id gnl|my_center|LOCUS_05830 54625 55545 gene locus_tag LOCUS_05840 gene miaA 54625 55545 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256258.1 protein_id gnl|my_center|LOCUS_05840 56388 55609 gene locus_tag LOCUS_05850 56388 55609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 57037 56411 gene locus_tag LOCUS_05860 57037 56411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 58391 57129 gene locus_tag LOCUS_05870 gene ahcY 58391 57129 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258873.1 protein_id gnl|my_center|LOCUS_05870 59428 58433 gene locus_tag LOCUS_05880 59428 58433 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258875.1 protein_id gnl|my_center|LOCUS_05880 60493 59726 gene locus_tag LOCUS_05890 60493 59726 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_05890 61859 60543 gene locus_tag LOCUS_05900 gene rfbH 61859 60543 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126347.1 protein_id gnl|my_center|LOCUS_05900 >Feature sequence010 2845 284 gene locus_tag LOCUS_05910 2845 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 3608 2835 gene locus_tag LOCUS_05920 gene phnC 3608 2835 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078092.1 protein_id gnl|my_center|LOCUS_05920 4596 3697 gene locus_tag LOCUS_05930 4596 3697 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626171.1 protein_id gnl|my_center|LOCUS_05930 5396 4773 gene locus_tag LOCUS_05940 5396 4773 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908882.1 protein_id gnl|my_center|LOCUS_05940 6115 5429 gene locus_tag LOCUS_05950 6115 5429 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938388.1 protein_id gnl|my_center|LOCUS_05950 6523 6143 gene locus_tag LOCUS_05960 6523 6143 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889137.1 protein_id gnl|my_center|LOCUS_05960 7132 6548 gene locus_tag LOCUS_05970 7132 6548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 8279 7137 gene locus_tag LOCUS_05980 8279 7137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941746.1 protein_id gnl|my_center|LOCUS_05980 9097 8285 gene locus_tag LOCUS_05990 9097 8285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 9238 9795 gene locus_tag LOCUS_06000 gene efp 9238 9795 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_06000 9936 10415 gene locus_tag LOCUS_06010 9936 10415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 11150 16675 gene locus_tag LOCUS_06020 11150 16675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 17270 19120 gene locus_tag LOCUS_06030 17270 19120 CDS product lasso peptide isopeptide bond-forming cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528116.1 protein_id gnl|my_center|LOCUS_06030 19127 20044 gene locus_tag LOCUS_06040 19127 20044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 20242 21069 gene locus_tag LOCUS_06050 gene cdaA 20242 21069 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_06050 21053 22456 gene locus_tag LOCUS_06060 21053 22456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 22453 23826 gene locus_tag LOCUS_06070 gene der 22453 23826 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258958.1 protein_id gnl|my_center|LOCUS_06070 25046 23883 gene locus_tag LOCUS_06080 25046 23883 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389970.1 protein_id gnl|my_center|LOCUS_06080 25094 25957 gene locus_tag LOCUS_06090 25094 25957 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892525.1 protein_id gnl|my_center|LOCUS_06090 27053 25917 gene locus_tag LOCUS_06100 gene mutY 27053 25917 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056920.1 protein_id gnl|my_center|LOCUS_06100 27697 27053 gene locus_tag LOCUS_06110 27697 27053 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404252.1 protein_id gnl|my_center|LOCUS_06110 27793 29592 gene locus_tag LOCUS_06120 27793 29592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 29617 31134 gene locus_tag LOCUS_06130 29617 31134 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660401.1 protein_id gnl|my_center|LOCUS_06130 31127 33292 gene locus_tag LOCUS_06140 31127 33292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 33294 34661 gene locus_tag LOCUS_06150 33294 34661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 34704 35216 gene locus_tag LOCUS_06160 34704 35216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 35213 36283 gene locus_tag LOCUS_06170 35213 36283 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658622.1 protein_id gnl|my_center|LOCUS_06170 36295 37479 gene locus_tag LOCUS_06180 36295 37479 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021204.1 protein_id gnl|my_center|LOCUS_06180 37472 38563 gene locus_tag LOCUS_06190 37472 38563 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658622.1 protein_id gnl|my_center|LOCUS_06190 38560 39831 gene locus_tag LOCUS_06200 38560 39831 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257129.1 protein_id gnl|my_center|LOCUS_06200 39845 41122 gene locus_tag LOCUS_06210 39845 41122 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259590.1 protein_id gnl|my_center|LOCUS_06210 41226 42128 gene locus_tag LOCUS_06220 41226 42128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 42207 43736 gene locus_tag LOCUS_06230 42207 43736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 43871 45220 gene locus_tag LOCUS_06240 43871 45220 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258886.1 protein_id gnl|my_center|LOCUS_06240 45248 46057 gene locus_tag LOCUS_06250 45248 46057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 46090 46890 gene locus_tag LOCUS_06260 46090 46890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 47645 47028 gene locus_tag LOCUS_06270 47645 47028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 49231 47771 gene locus_tag LOCUS_06280 49231 47771 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162015861.1 protein_id gnl|my_center|LOCUS_06280 49370 49289 gene locus_tag LOCUS_t00090 49370 49289 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 49581 50984 gene locus_tag LOCUS_06290 49581 50984 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_06290 51502 51023 gene locus_tag LOCUS_06300 gene rlmH 51502 51023 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786211.1 protein_id gnl|my_center|LOCUS_06300 52021 51515 gene locus_tag LOCUS_06310 52021 51515 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930822.1 protein_id gnl|my_center|LOCUS_06310 52126 52923 gene locus_tag LOCUS_06320 52126 52923 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807958.1 protein_id gnl|my_center|LOCUS_06320 53760 52963 gene locus_tag LOCUS_06330 53760 52963 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250628.1 protein_id gnl|my_center|LOCUS_06330 54789 53941 gene locus_tag LOCUS_06340 54789 53941 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266791.1 protein_id gnl|my_center|LOCUS_06340 55071 55673 gene locus_tag LOCUS_06350 55071 55673 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890731.1 protein_id gnl|my_center|LOCUS_06350 56179 55847 gene locus_tag LOCUS_06360 56179 55847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 56387 59254 gene locus_tag LOCUS_06370 56387 59254 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259651.1 protein_id gnl|my_center|LOCUS_06370 61068 59260 gene locus_tag LOCUS_06380 gene ade 61068 59260 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970162.1 protein_id gnl|my_center|LOCUS_06380 >Feature sequence011 439 1563 gene locus_tag LOCUS_06390 439 1563 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867209.1 protein_id gnl|my_center|LOCUS_06390 1631 1960 gene locus_tag LOCUS_06400 gene panD 1631 1960 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490176.1 protein_id gnl|my_center|LOCUS_06400 2176 2709 gene locus_tag LOCUS_06410 gene fldA 2176 2709 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140311.1 protein_id gnl|my_center|LOCUS_06410 2860 3459 gene locus_tag LOCUS_06420 2860 3459 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259451.1 protein_id gnl|my_center|LOCUS_06420 5127 3481 gene locus_tag LOCUS_06430 5127 3481 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_06430 6205 5195 gene locus_tag LOCUS_06440 6205 5195 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174155.1 protein_id gnl|my_center|LOCUS_06440 9640 6425 gene locus_tag LOCUS_06450 9640 6425 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257778.1 protein_id gnl|my_center|LOCUS_06450 10230 10820 gene locus_tag LOCUS_06460 10230 10820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 10941 11738 gene locus_tag LOCUS_06470 10941 11738 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014635952.1 protein_id gnl|my_center|LOCUS_06470 11735 12571 gene locus_tag LOCUS_06480 11735 12571 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922272.1 protein_id gnl|my_center|LOCUS_06480 12568 13368 gene locus_tag LOCUS_06490 12568 13368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 13428 14369 gene locus_tag LOCUS_06500 13428 14369 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869310.1 protein_id gnl|my_center|LOCUS_06500 15239 14409 gene locus_tag LOCUS_06510 15239 14409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 16203 15361 gene locus_tag LOCUS_06520 16203 15361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 17385 16282 gene locus_tag LOCUS_06530 17385 16282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 17906 17427 gene locus_tag LOCUS_06540 17906 17427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 19114 18170 gene locus_tag LOCUS_06550 19114 18170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 20100 19483 gene locus_tag LOCUS_06560 20100 19483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 20359 21210 gene locus_tag LOCUS_06570 20359 21210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 21961 21245 gene locus_tag LOCUS_06580 21961 21245 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977065.1 protein_id gnl|my_center|LOCUS_06580 24614 22041 gene locus_tag LOCUS_06590 gene pheT 24614 22041 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256770.1 protein_id gnl|my_center|LOCUS_06590 25676 24651 gene locus_tag LOCUS_06600 gene pheS 25676 24651 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256292.1 protein_id gnl|my_center|LOCUS_06600 26073 27371 gene locus_tag LOCUS_06610 26073 27371 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931392.1 protein_id gnl|my_center|LOCUS_06610 27373 28524 gene locus_tag LOCUS_06620 27373 28524 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227840.1 protein_id gnl|my_center|LOCUS_06620 28533 29240 gene locus_tag LOCUS_06630 28533 29240 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256010.1 protein_id gnl|my_center|LOCUS_06630 29936 29277 gene locus_tag LOCUS_06640 29936 29277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 30433 30011 gene locus_tag LOCUS_06650 30433 30011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 30818 30414 gene locus_tag LOCUS_06660 30818 30414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 31531 30896 gene locus_tag LOCUS_06670 31531 30896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 31598 31921 gene locus_tag LOCUS_06680 31598 31921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 32208 31909 gene locus_tag LOCUS_06690 32208 31909 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096894563.1 protein_id gnl|my_center|LOCUS_06690 34566 32266 gene locus_tag LOCUS_06700 34566 32266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 37424 34563 gene locus_tag LOCUS_06710 37424 34563 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157913002.1 protein_id gnl|my_center|LOCUS_06710 37938 39302 gene locus_tag LOCUS_06720 37938 39302 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_06720 39348 40376 gene locus_tag LOCUS_06730 gene trpS 39348 40376 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257293.1 protein_id gnl|my_center|LOCUS_06730 40506 41330 gene locus_tag LOCUS_06740 40506 41330 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225044.1 protein_id gnl|my_center|LOCUS_06740 41348 41812 gene locus_tag LOCUS_06750 41348 41812 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090322.1 protein_id gnl|my_center|LOCUS_06750 41861 42694 gene locus_tag LOCUS_06760 41861 42694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 42734 43003 gene locus_tag LOCUS_06770 42734 43003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 43070 43858 gene locus_tag LOCUS_06780 43070 43858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 43868 44647 gene locus_tag LOCUS_06790 43868 44647 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839105.1 protein_id gnl|my_center|LOCUS_06790 44724 46553 gene locus_tag LOCUS_06800 44724 46553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 46557 47870 gene locus_tag LOCUS_06810 46557 47870 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459130.1 protein_id gnl|my_center|LOCUS_06810 48456 47890 gene locus_tag LOCUS_06820 48456 47890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 48685 49044 gene locus_tag LOCUS_06830 48685 49044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 49739 49464 gene locus_tag LOCUS_06840 49739 49464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 49811 50554 gene locus_tag LOCUS_06850 gene ric 49811 50554 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941513.1 protein_id gnl|my_center|LOCUS_06850 51884 50634 gene locus_tag LOCUS_06860 51884 50634 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257055.1 protein_id gnl|my_center|LOCUS_06860 53213 51975 gene locus_tag LOCUS_06870 53213 51975 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257055.1 protein_id gnl|my_center|LOCUS_06870 >Feature sequence012 862 62 gene locus_tag LOCUS_06880 862 62 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256115.1 protein_id gnl|my_center|LOCUS_06880 1797 865 gene locus_tag LOCUS_06890 1797 865 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525137.1 protein_id gnl|my_center|LOCUS_06890 2527 1889 gene locus_tag LOCUS_06900 2527 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 2728 2528 gene locus_tag LOCUS_06910 2728 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 4621 2750 gene locus_tag LOCUS_06920 gene ctaD 4621 2750 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140742.1 protein_id gnl|my_center|LOCUS_06920 5727 4657 gene locus_tag LOCUS_06930 gene coxB 5727 4657 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258007.1 protein_id gnl|my_center|LOCUS_06930 6598 5924 gene locus_tag LOCUS_06940 6598 5924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 7479 6880 gene locus_tag LOCUS_06950 gene sigW 7479 6880 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_06950 7463 7645 gene locus_tag LOCUS_06960 7463 7645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 7800 8114 gene locus_tag LOCUS_06970 gene rplU 7800 8114 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392094.1 protein_id gnl|my_center|LOCUS_06970 8147 8419 gene locus_tag LOCUS_06980 gene rpmA 8147 8419 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140826.1 protein_id gnl|my_center|LOCUS_06980 8423 8869 gene locus_tag LOCUS_06990 8423 8869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 9036 9650 gene locus_tag LOCUS_07000 9036 9650 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966171.1 protein_id gnl|my_center|LOCUS_07000 9679 10239 gene locus_tag LOCUS_07010 gene hpt 9679 10239 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257905.1 protein_id gnl|my_center|LOCUS_07010 10266 11750 gene locus_tag LOCUS_07020 10266 11750 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258188.1 protein_id gnl|my_center|LOCUS_07020 12178 11801 gene locus_tag LOCUS_07030 12178 11801 CDS product DUF2203 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978601.1 protein_id gnl|my_center|LOCUS_07030 12670 12257 gene locus_tag LOCUS_07040 12670 12257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 12863 14029 gene locus_tag LOCUS_07050 12863 14029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 14097 14462 gene locus_tag LOCUS_07060 gene folX 14097 14462 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316983.1 protein_id gnl|my_center|LOCUS_07060 14501 15061 gene locus_tag LOCUS_07070 gene folK 14501 15061 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762823.1 protein_id gnl|my_center|LOCUS_07070 17009 15051 gene locus_tag LOCUS_07080 17009 15051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 17790 17002 gene locus_tag LOCUS_07090 17790 17002 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022068.1 protein_id gnl|my_center|LOCUS_07090 17876 18925 gene locus_tag LOCUS_07100 gene rlmN 17876 18925 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258793.1 protein_id gnl|my_center|LOCUS_07100 19695 18991 gene locus_tag LOCUS_07110 19695 18991 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080883.1 protein_id gnl|my_center|LOCUS_07110 20467 19799 gene locus_tag LOCUS_07120 20467 19799 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258927.1 protein_id gnl|my_center|LOCUS_07120 20635 22491 gene locus_tag LOCUS_07130 gene sppA 20635 22491 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898564.1 protein_id gnl|my_center|LOCUS_07130 23070 22465 gene locus_tag LOCUS_07140 23070 22465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 23395 26040 gene locus_tag LOCUS_07150 23395 26040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 26129 27331 gene locus_tag LOCUS_07160 26129 27331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 27344 27991 gene locus_tag LOCUS_07170 27344 27991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 28047 29228 gene locus_tag LOCUS_07180 28047 29228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 29323 29589 gene locus_tag LOCUS_07190 29323 29589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 29787 30320 gene locus_tag LOCUS_07200 29787 30320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 30295 31560 gene locus_tag LOCUS_07210 30295 31560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 31565 32638 gene locus_tag LOCUS_07220 31565 32638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 32673 33206 gene locus_tag LOCUS_07230 32673 33206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 33246 33776 gene locus_tag LOCUS_07240 33246 33776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 34796 33987 gene locus_tag LOCUS_07250 34796 33987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 36399 35242 gene locus_tag LOCUS_07260 36399 35242 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495359.1 protein_id gnl|my_center|LOCUS_07260 38681 36396 gene locus_tag LOCUS_07270 38681 36396 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227758.1 protein_id gnl|my_center|LOCUS_07270 39766 38678 gene locus_tag LOCUS_07280 39766 38678 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227757.1 protein_id gnl|my_center|LOCUS_07280 41367 39802 gene locus_tag LOCUS_07290 41367 39802 CDS product DUF5691 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029873.1 protein_id gnl|my_center|LOCUS_07290 42695 41364 gene locus_tag LOCUS_07300 42695 41364 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086850841.1 protein_id gnl|my_center|LOCUS_07300 43804 42767 gene locus_tag LOCUS_07310 43804 42767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 44040 44672 gene locus_tag LOCUS_07320 44040 44672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 44862 44935 gene locus_tag LOCUS_t00100 44862 44935 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 45152 45225 gene locus_tag LOCUS_t00110 45152 45225 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 45357 48131 gene locus_tag LOCUS_07330 45357 48131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 48863 48234 gene locus_tag LOCUS_07340 48863 48234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 49673 48942 gene locus_tag LOCUS_07350 gene map 49673 48942 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233851.1 protein_id gnl|my_center|LOCUS_07350 49985 51313 gene locus_tag LOCUS_07360 49985 51313 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459673.1 protein_id gnl|my_center|LOCUS_07360 51738 51358 gene locus_tag LOCUS_07370 51738 51358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 >Feature sequence013 <1 886 gene locus_tag LOCUS_07380 <1 886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889608.1:ABC transporter ATP-binding protein 2742 943 gene locus_tag LOCUS_07390 2742 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 3121 3050 gene locus_tag LOCUS_t00120 3121 3050 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4541 3174 gene locus_tag LOCUS_07400 4541 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 4664 5383 gene locus_tag LOCUS_07410 4664 5383 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056437.1 protein_id gnl|my_center|LOCUS_07410 5793 5497 gene locus_tag LOCUS_07420 5793 5497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 6163 6987 gene locus_tag LOCUS_07430 6163 6987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 7477 6971 gene locus_tag LOCUS_07440 7477 6971 CDS product Rab family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_07440 8496 7498 gene locus_tag LOCUS_07450 8496 7498 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966201.1 protein_id gnl|my_center|LOCUS_07450 10669 8489 gene locus_tag LOCUS_07460 gene glgB 10669 8489 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_07460 10948 12051 gene locus_tag LOCUS_07470 gene xerD 10948 12051 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390088.1 protein_id gnl|my_center|LOCUS_07470 12871 12071 gene locus_tag LOCUS_07480 12871 12071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 15400 13301 gene locus_tag LOCUS_07490 15400 13301 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530885.1 protein_id gnl|my_center|LOCUS_07490 16249 15419 gene locus_tag LOCUS_07500 16249 15419 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085650.1 protein_id gnl|my_center|LOCUS_07500 17688 16369 gene locus_tag LOCUS_07510 17688 16369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 19407 17692 gene locus_tag LOCUS_07520 19407 17692 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532331.1 protein_id gnl|my_center|LOCUS_07520 19731 20297 gene locus_tag LOCUS_07530 19731 20297 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530684.1 protein_id gnl|my_center|LOCUS_07530 20266 21273 gene locus_tag LOCUS_07540 20266 21273 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618875.1 protein_id gnl|my_center|LOCUS_07540 22940 21270 gene locus_tag LOCUS_07550 22940 21270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 23856 23035 gene locus_tag LOCUS_07560 23856 23035 CDS product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_07560 24120 25544 gene locus_tag LOCUS_07570 24120 25544 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_07570 25693 26082 gene locus_tag LOCUS_07580 25693 26082 CDS product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966283.1 protein_id gnl|my_center|LOCUS_07580 26170 26676 gene locus_tag LOCUS_07590 26170 26676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 26711 27937 gene locus_tag LOCUS_07600 26711 27937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 28435 29073 gene locus_tag LOCUS_07610 28435 29073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 29093 29476 gene locus_tag LOCUS_07620 29093 29476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 29804 30760 gene locus_tag LOCUS_07630 29804 30760 CDS product RIO kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223947.1 protein_id gnl|my_center|LOCUS_07630 30798 31397 gene locus_tag LOCUS_07640 30798 31397 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140085.1 protein_id gnl|my_center|LOCUS_07640 32188 31394 gene locus_tag LOCUS_07650 gene tatC 32188 31394 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227900.1 protein_id gnl|my_center|LOCUS_07650 32756 32196 gene locus_tag LOCUS_07660 32756 32196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 32966 32766 gene locus_tag LOCUS_07670 32966 32766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 34794 33124 gene locus_tag LOCUS_07680 34794 33124 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258196.1 protein_id gnl|my_center|LOCUS_07680 35079 34825 gene locus_tag LOCUS_07690 35079 34825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 35294 36172 gene locus_tag LOCUS_07700 35294 36172 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256986.1 protein_id gnl|my_center|LOCUS_07700 36169 36999 gene locus_tag LOCUS_07710 36169 36999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 37419 37018 gene locus_tag LOCUS_07720 37419 37018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 37878 38720 gene locus_tag LOCUS_07730 37878 38720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 38840 40144 gene locus_tag LOCUS_07740 38840 40144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 41422 40169 gene locus_tag LOCUS_07750 41422 40169 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062420975.1 protein_id gnl|my_center|LOCUS_07750 43448 41415 gene locus_tag LOCUS_07760 gene ligA 43448 41415 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256150.1 protein_id gnl|my_center|LOCUS_07760 43869 43501 gene locus_tag LOCUS_07770 43869 43501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 45327 44077 gene locus_tag LOCUS_07780 45327 44077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 47104 45374 gene locus_tag LOCUS_07790 gene polX 47104 45374 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_07790 47318 49126 gene locus_tag LOCUS_07800 47318 49126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 49263 50342 gene locus_tag LOCUS_07810 49263 50342 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887604.1 protein_id gnl|my_center|LOCUS_07810 >Feature sequence014 2507 5317 gene locus_tag LOCUS_07820 2507 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 5453 6985 gene locus_tag LOCUS_07830 5453 6985 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257250.1 protein_id gnl|my_center|LOCUS_07830 7026 7727 gene locus_tag LOCUS_07840 7026 7727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 7753 8709 gene locus_tag LOCUS_07850 7753 8709 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257056.1 protein_id gnl|my_center|LOCUS_07850 8712 9059 gene locus_tag LOCUS_07860 8712 9059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 9206 10180 gene locus_tag LOCUS_07870 gene gmd 9206 10180 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_07870 10194 11618 gene locus_tag LOCUS_07880 10194 11618 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_07880 11665 12159 gene locus_tag LOCUS_07890 11665 12159 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_07890 12156 12995 gene locus_tag LOCUS_07900 12156 12995 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259435.1 protein_id gnl|my_center|LOCUS_07900 13008 13940 gene locus_tag LOCUS_07910 13008 13940 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259392.1 protein_id gnl|my_center|LOCUS_07910 13945 15141 gene locus_tag LOCUS_07920 13945 15141 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257466.1 protein_id gnl|my_center|LOCUS_07920 15203 17605 gene locus_tag LOCUS_07930 15203 17605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 17602 19029 gene locus_tag LOCUS_07940 17602 19029 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259158.1 protein_id gnl|my_center|LOCUS_07940 21212 19170 gene locus_tag LOCUS_07950 21212 19170 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228453.1 protein_id gnl|my_center|LOCUS_07950 21788 21877 gene locus_tag LOCUS_t00130 21788 21877 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 23036 21951 gene locus_tag LOCUS_07960 23036 21951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 23395 23033 gene locus_tag LOCUS_07970 23395 23033 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971062.1 protein_id gnl|my_center|LOCUS_07970 23483 24787 gene locus_tag LOCUS_07980 23483 24787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 24833 25333 gene locus_tag LOCUS_07990 24833 25333 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459677.1 protein_id gnl|my_center|LOCUS_07990 25341 25730 gene locus_tag LOCUS_08000 25341 25730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257336.1 protein_id gnl|my_center|LOCUS_08000 29014 25718 gene locus_tag LOCUS_08010 29014 25718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 29132 29647 gene locus_tag LOCUS_08020 29132 29647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 29659 30774 gene locus_tag LOCUS_08030 29659 30774 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459800.1 protein_id gnl|my_center|LOCUS_08030 30771 31823 gene locus_tag LOCUS_08040 30771 31823 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963539.1 protein_id gnl|my_center|LOCUS_08040 31854 32858 gene locus_tag LOCUS_08050 31854 32858 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811663.1 protein_id gnl|my_center|LOCUS_08050 33822 32875 gene locus_tag LOCUS_08060 33822 32875 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256790.1 protein_id gnl|my_center|LOCUS_08060 34707 33970 gene locus_tag LOCUS_08070 34707 33970 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258224.1 protein_id gnl|my_center|LOCUS_08070 35273 34704 gene locus_tag LOCUS_08080 35273 34704 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114324.1 protein_id gnl|my_center|LOCUS_08080 35508 35281 gene locus_tag LOCUS_08090 35508 35281 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256217.1 protein_id gnl|my_center|LOCUS_08090 36579 35512 gene locus_tag LOCUS_08100 gene ruvB 36579 35512 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258937.1 protein_id gnl|my_center|LOCUS_08100 36709 37329 gene locus_tag LOCUS_08110 gene upp 36709 37329 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257403.1 protein_id gnl|my_center|LOCUS_08110 37339 38394 gene locus_tag LOCUS_08120 37339 38394 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814645.1 protein_id gnl|my_center|LOCUS_08120 39460 38408 gene locus_tag LOCUS_08130 39460 38408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 39917 39483 gene locus_tag LOCUS_08140 39917 39483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 40115 41374 gene locus_tag LOCUS_08150 40115 41374 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144244.1 protein_id gnl|my_center|LOCUS_08150 41707 41426 gene locus_tag LOCUS_08160 41707 41426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 42652 41738 gene locus_tag LOCUS_08170 gene dapA 42652 41738 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036915.1 protein_id gnl|my_center|LOCUS_08170 43994 42654 gene locus_tag LOCUS_08180 43994 42654 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889289.1 protein_id gnl|my_center|LOCUS_08180 44347 44036 gene locus_tag LOCUS_08190 44347 44036 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258468.1 protein_id gnl|my_center|LOCUS_08190 44441 45079 gene locus_tag LOCUS_08200 44441 45079 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404017.1 protein_id gnl|my_center|LOCUS_08200 45118 45750 gene locus_tag LOCUS_08210 45118 45750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 45900 47777 gene locus_tag LOCUS_08220 45900 47777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 >Feature sequence015 <1 2409 gene locus_tag LOCUS_08230 <1 2409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942721.1:penicillin-binding protein 2 2510 3286 gene locus_tag LOCUS_08240 2510 3286 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257526.1 protein_id gnl|my_center|LOCUS_08240 3293 3808 gene locus_tag LOCUS_08250 3293 3808 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257527.1 protein_id gnl|my_center|LOCUS_08250 3857 4633 gene locus_tag LOCUS_08260 3857 4633 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257528.1 protein_id gnl|my_center|LOCUS_08260 4661 5515 gene locus_tag LOCUS_08270 gene cobB2 4661 5515 CDS product NAD-dependent protein deacylase Cob2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877626.1 protein_id gnl|my_center|LOCUS_08270 5614 6546 gene locus_tag LOCUS_08280 gene trxB 5614 6546 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257932.1 protein_id gnl|my_center|LOCUS_08280 7860 6580 gene locus_tag LOCUS_08290 7860 6580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 8192 9877 gene locus_tag LOCUS_08300 8192 9877 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258732.1 protein_id gnl|my_center|LOCUS_08300 10198 10019 gene locus_tag LOCUS_08310 10198 10019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 11233 10460 gene locus_tag LOCUS_08320 11233 10460 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256011.1 protein_id gnl|my_center|LOCUS_08320 12154 11306 gene locus_tag LOCUS_08330 12154 11306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 12282 13496 gene locus_tag LOCUS_08340 12282 13496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 13535 14794 gene locus_tag LOCUS_08350 gene hutI 13535 14794 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256863.1 protein_id gnl|my_center|LOCUS_08350 14916 15812 gene locus_tag LOCUS_08360 14916 15812 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388154.1 protein_id gnl|my_center|LOCUS_08360 16803 15877 gene locus_tag LOCUS_08370 16803 15877 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_08370 17833 16805 gene locus_tag LOCUS_08380 17833 16805 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915065.1 protein_id gnl|my_center|LOCUS_08380 19576 18224 gene locus_tag LOCUS_08390 19576 18224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 20828 19647 gene locus_tag LOCUS_08400 20828 19647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 21488 20865 gene locus_tag LOCUS_08410 gene pgsA 21488 20865 CDS product archaetidylinositol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061121.1 protein_id gnl|my_center|LOCUS_08410 22416 21709 gene locus_tag LOCUS_08420 22416 21709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 22718 22470 gene locus_tag LOCUS_08430 22718 22470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 23954 22815 gene locus_tag LOCUS_08440 gene atpB 23954 22815 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258899.1 protein_id gnl|my_center|LOCUS_08440 24256 23951 gene locus_tag LOCUS_08450 24256 23951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 25805 24312 gene locus_tag LOCUS_08460 25805 24312 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392502.1 protein_id gnl|my_center|LOCUS_08460 27479 25806 gene locus_tag LOCUS_08470 27479 25806 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257846.1 protein_id gnl|my_center|LOCUS_08470 29063 27519 gene locus_tag LOCUS_08480 29063 27519 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258760.1 protein_id gnl|my_center|LOCUS_08480 31358 29097 gene locus_tag LOCUS_08490 gene nuoL 31358 29097 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_08490 31739 31431 gene locus_tag LOCUS_08500 gene nuoK 31739 31431 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257849.1 protein_id gnl|my_center|LOCUS_08500 32287 31736 gene locus_tag LOCUS_08510 32287 31736 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392498.1 protein_id gnl|my_center|LOCUS_08510 33665 32310 gene locus_tag LOCUS_08520 gene nuoH 33665 32310 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_08520 34115 33759 gene locus_tag LOCUS_08530 gene ndhC 34115 33759 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257856.1 protein_id gnl|my_center|LOCUS_08530 34401 35111 gene locus_tag LOCUS_08540 34401 35111 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256823.1 protein_id gnl|my_center|LOCUS_08540 35804 35127 gene locus_tag LOCUS_08550 35804 35127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 37008 35806 gene locus_tag LOCUS_08560 37008 35806 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921229.1 protein_id gnl|my_center|LOCUS_08560 39529 37262 gene locus_tag LOCUS_08570 39529 37262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 39712 42192 gene locus_tag LOCUS_08580 39712 42192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 42323 43144 gene locus_tag LOCUS_08590 42323 43144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 43197 43802 gene locus_tag LOCUS_08600 43197 43802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 43809 45206 gene locus_tag LOCUS_08610 43809 45206 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405217.1 protein_id gnl|my_center|LOCUS_08610 45623 45210 gene locus_tag LOCUS_08620 45623 45210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 45960 45616 gene locus_tag LOCUS_08630 45960 45616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 48356 46716 gene locus_tag LOCUS_08640 48356 46716 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480032.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence016 377 685 gene locus_tag LOCUS_08650 gene rpsJ 377 685 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258230.1 protein_id gnl|my_center|LOCUS_08650 720 1385 gene locus_tag LOCUS_08660 gene rplC 720 1385 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258231.1 protein_id gnl|my_center|LOCUS_08660 1450 2121 gene locus_tag LOCUS_08670 gene rplD 1450 2121 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258232.1 protein_id gnl|my_center|LOCUS_08670 2123 2416 gene locus_tag LOCUS_08680 gene rplW 2123 2416 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_08680 2447 3286 gene locus_tag LOCUS_08690 gene rplB 2447 3286 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258234.1 protein_id gnl|my_center|LOCUS_08690 3346 3627 gene locus_tag LOCUS_08700 gene rpsS 3346 3627 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909214.1 protein_id gnl|my_center|LOCUS_08700 3630 3998 gene locus_tag LOCUS_08710 gene rplV 3630 3998 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810154.1 protein_id gnl|my_center|LOCUS_08710 4073 4705 gene locus_tag LOCUS_08720 gene rpsC 4073 4705 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393931.1 protein_id gnl|my_center|LOCUS_08720 4793 5209 gene locus_tag LOCUS_08730 gene rplP 4793 5209 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258238.1 protein_id gnl|my_center|LOCUS_08730 5209 5625 gene locus_tag LOCUS_08740 5209 5625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 5665 5916 gene locus_tag LOCUS_08750 gene rpsQ 5665 5916 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357552.1 protein_id gnl|my_center|LOCUS_08750 5929 6300 gene locus_tag LOCUS_08760 gene rplN 5929 6300 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055946.1 protein_id gnl|my_center|LOCUS_08760 6334 6657 gene locus_tag LOCUS_08770 gene rplX 6334 6657 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641258.1 protein_id gnl|my_center|LOCUS_08770 6777 7346 gene locus_tag LOCUS_08780 gene rplE 6777 7346 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225809.1 protein_id gnl|my_center|LOCUS_08780 7376 7558 gene locus_tag LOCUS_08790 7376 7558 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583358.1 protein_id gnl|my_center|LOCUS_08790 7571 7978 gene locus_tag LOCUS_08800 gene rpsH 7571 7978 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806920.1 protein_id gnl|my_center|LOCUS_08800 8045 8587 gene locus_tag LOCUS_08810 gene rplF 8045 8587 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399690.1 protein_id gnl|my_center|LOCUS_08810 8621 8983 gene locus_tag LOCUS_08820 gene rplR 8621 8983 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002987751.1 protein_id gnl|my_center|LOCUS_08820 9015 9545 gene locus_tag LOCUS_08830 gene rpsE 9015 9545 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_08830 9545 9727 gene locus_tag LOCUS_08840 gene rpmD 9545 9727 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966394.1 protein_id gnl|my_center|LOCUS_08840 9729 10187 gene locus_tag LOCUS_08850 gene rplO 9729 10187 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225819.1 protein_id gnl|my_center|LOCUS_08850 10249 11622 gene locus_tag LOCUS_08860 gene secY 10249 11622 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258251.1 protein_id gnl|my_center|LOCUS_08860 11619 12191 gene locus_tag LOCUS_08870 11619 12191 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776356.1 protein_id gnl|my_center|LOCUS_08870 12360 12743 gene locus_tag LOCUS_08880 gene rpsM 12360 12743 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888756.1 protein_id gnl|my_center|LOCUS_08880 12817 13212 gene locus_tag LOCUS_08890 gene rpsK 12817 13212 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055956.1 protein_id gnl|my_center|LOCUS_08890 13331 13969 gene locus_tag LOCUS_08900 gene rpsD 13331 13969 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_08900 14082 15047 gene locus_tag LOCUS_08910 14082 15047 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258258.1 protein_id gnl|my_center|LOCUS_08910 15077 15496 gene locus_tag LOCUS_08920 15077 15496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 15509 16291 gene locus_tag LOCUS_08930 gene truA 15509 16291 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918167.1 protein_id gnl|my_center|LOCUS_08930 16333 16764 gene locus_tag LOCUS_08940 gene rplM 16333 16764 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881226.1 protein_id gnl|my_center|LOCUS_08940 16798 17205 gene locus_tag LOCUS_08950 gene rpsI 16798 17205 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402825.1 protein_id gnl|my_center|LOCUS_08950 17269 18720 gene locus_tag LOCUS_08960 gene mazG 17269 18720 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391632.1 protein_id gnl|my_center|LOCUS_08960 18781 19413 gene locus_tag LOCUS_08970 18781 19413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 21279 19465 gene locus_tag LOCUS_08980 21279 19465 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257644.1 protein_id gnl|my_center|LOCUS_08980 22185 21295 gene locus_tag LOCUS_08990 gene rocF 22185 21295 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038039155.1 protein_id gnl|my_center|LOCUS_08990 22340 23362 gene locus_tag LOCUS_09000 gene trmB 22340 23362 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228808.1 protein_id gnl|my_center|LOCUS_09000 23343 24134 gene locus_tag LOCUS_09010 23343 24134 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764971.1 protein_id gnl|my_center|LOCUS_09010 24164 24922 gene locus_tag LOCUS_09020 24164 24922 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088963.1 protein_id gnl|my_center|LOCUS_09020 25131 24937 gene locus_tag LOCUS_09030 25131 24937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 25554 29120 gene locus_tag LOCUS_09040 gene smc 25554 29120 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258775.1 protein_id gnl|my_center|LOCUS_09040 29156 29620 gene locus_tag LOCUS_09050 gene tadA 29156 29620 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295367.1 protein_id gnl|my_center|LOCUS_09050 29679 29768 gene locus_tag LOCUS_t00140 29679 29768 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 29971 33198 gene locus_tag LOCUS_09060 29971 33198 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162015902.1 protein_id gnl|my_center|LOCUS_09060 33347 33553 gene locus_tag LOCUS_09070 33347 33553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 33571 34611 gene locus_tag LOCUS_09080 33571 34611 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545989.1 protein_id gnl|my_center|LOCUS_09080 34618 36165 gene locus_tag LOCUS_09090 34618 36165 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259464.1 protein_id gnl|my_center|LOCUS_09090 36181 37236 gene locus_tag LOCUS_09100 36181 37236 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259465.1 protein_id gnl|my_center|LOCUS_09100 37249 38007 gene locus_tag LOCUS_09110 37249 38007 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259103.1 protein_id gnl|my_center|LOCUS_09110 38056 39627 gene locus_tag LOCUS_09120 38056 39627 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259464.1 protein_id gnl|my_center|LOCUS_09120 39647 40459 gene locus_tag LOCUS_09130 39647 40459 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869263.1 protein_id gnl|my_center|LOCUS_09130 40587 41990 gene locus_tag LOCUS_09140 40587 41990 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259470.1 protein_id gnl|my_center|LOCUS_09140 42099 42878 gene locus_tag LOCUS_09150 42099 42878 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259471.1 protein_id gnl|my_center|LOCUS_09150 42879 43595 gene locus_tag LOCUS_09160 42879 43595 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259472.1 protein_id gnl|my_center|LOCUS_09160 43606 45114 gene locus_tag LOCUS_09170 43606 45114 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259473.1 protein_id gnl|my_center|LOCUS_09170 45153 46259 gene locus_tag LOCUS_09180 45153 46259 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259474.1 protein_id gnl|my_center|LOCUS_09180 46325 46861 gene locus_tag LOCUS_09190 46325 46861 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888029.1 protein_id gnl|my_center|LOCUS_09190 >Feature sequence017 756 187 gene locus_tag LOCUS_09200 756 187 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858163.1 protein_id gnl|my_center|LOCUS_09200 1327 917 gene locus_tag LOCUS_09210 1327 917 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173310.1 protein_id gnl|my_center|LOCUS_09210 1550 2551 gene locus_tag LOCUS_09220 1550 2551 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977679.1 protein_id gnl|my_center|LOCUS_09220 2616 3662 gene locus_tag LOCUS_09230 gene ltaE 2616 3662 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258446.1 protein_id gnl|my_center|LOCUS_09230 3699 7016 gene locus_tag LOCUS_09240 3699 7016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 7098 8336 gene locus_tag LOCUS_09250 7098 8336 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257320.1 protein_id gnl|my_center|LOCUS_09250 9277 8417 gene locus_tag LOCUS_09260 9277 8417 CDS product YhfC family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233198.1 protein_id gnl|my_center|LOCUS_09260 9521 10186 gene locus_tag LOCUS_09270 9521 10186 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255949.1 protein_id gnl|my_center|LOCUS_09270 10269 11948 gene locus_tag LOCUS_09280 10269 11948 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902151.1 protein_id gnl|my_center|LOCUS_09280 12264 14036 gene locus_tag LOCUS_09290 12264 14036 CDS product bifunctional sulfate adenylyltransferase/adenylylsulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257979.1 protein_id gnl|my_center|LOCUS_09290 14067 14630 gene locus_tag LOCUS_09300 gene cysC 14067 14630 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479712.1 protein_id gnl|my_center|LOCUS_09300 14692 15528 gene locus_tag LOCUS_09310 gene prmC 14692 15528 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257490.1 protein_id gnl|my_center|LOCUS_09310 15554 16210 gene locus_tag LOCUS_09320 15554 16210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 16218 16811 gene locus_tag LOCUS_09330 16218 16811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 16894 18015 gene locus_tag LOCUS_09340 16894 18015 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255994.1 protein_id gnl|my_center|LOCUS_09340 18028 19062 gene locus_tag LOCUS_09350 18028 19062 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141484866.1 protein_id gnl|my_center|LOCUS_09350 19533 19066 gene locus_tag LOCUS_09360 19533 19066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 20333 19572 gene locus_tag LOCUS_09370 20333 19572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 21167 20358 gene locus_tag LOCUS_09380 21167 20358 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256283.1 protein_id gnl|my_center|LOCUS_09380 21515 21291 gene locus_tag LOCUS_09390 21515 21291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 21570 21899 gene locus_tag LOCUS_09400 21570 21899 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_09400 22107 21916 gene locus_tag LOCUS_09410 22107 21916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 26812 23861 gene locus_tag LOCUS_09420 gene gcvP 26812 23861 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012166094.1 protein_id gnl|my_center|LOCUS_09420 27299 26907 gene locus_tag LOCUS_09430 gene gcvH 27299 26907 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259335.1 protein_id gnl|my_center|LOCUS_09430 27808 29163 gene locus_tag LOCUS_09440 27808 29163 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729117.1 protein_id gnl|my_center|LOCUS_09440 29192 30337 gene locus_tag LOCUS_09450 gene alr 29192 30337 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_09450 30432 30848 gene locus_tag LOCUS_09460 30432 30848 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257691.1 protein_id gnl|my_center|LOCUS_09460 30917 31375 gene locus_tag LOCUS_09470 30917 31375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 32111 31392 gene locus_tag LOCUS_09480 32111 31392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 32372 33391 gene locus_tag LOCUS_09490 32372 33391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 33411 35642 gene locus_tag LOCUS_09500 33411 35642 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257113.1 protein_id gnl|my_center|LOCUS_09500 35687 36676 gene locus_tag LOCUS_09510 35687 36676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 37507 36794 gene locus_tag LOCUS_09520 37507 36794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 37656 38612 gene locus_tag LOCUS_09530 gene fmt 37656 38612 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_09530 38652 39713 gene locus_tag LOCUS_09540 38652 39713 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257871.1 protein_id gnl|my_center|LOCUS_09540 39710 40450 gene locus_tag LOCUS_09550 39710 40450 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256490.1 protein_id gnl|my_center|LOCUS_09550 40988 40425 gene locus_tag LOCUS_09560 40988 40425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 43203 41788 gene locus_tag LOCUS_09570 43203 41788 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257378.1 protein_id gnl|my_center|LOCUS_09570 43537 44157 gene locus_tag LOCUS_09580 43537 44157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 44951 44166 gene locus_tag LOCUS_09590 44951 44166 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533327.1 protein_id gnl|my_center|LOCUS_09590 45870 45127 gene locus_tag LOCUS_09600 45870 45127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 >Feature sequence018 44 1615 gene locus_tag LOCUS_09610 44 1615 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339387.1 protein_id gnl|my_center|LOCUS_09610 1791 3425 gene locus_tag LOCUS_09620 1791 3425 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840168.1 protein_id gnl|my_center|LOCUS_09620 3704 4861 gene locus_tag LOCUS_09630 3704 4861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258388.1 protein_id gnl|my_center|LOCUS_09630 5009 5830 gene locus_tag LOCUS_09640 5009 5830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 7156 5846 gene locus_tag LOCUS_09650 7156 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 9778 7334 gene locus_tag LOCUS_09660 9778 7334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 10043 10714 gene locus_tag LOCUS_09670 gene minC 10043 10714 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255923.1 protein_id gnl|my_center|LOCUS_09670 10790 11599 gene locus_tag LOCUS_09680 gene minD 10790 11599 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255922.1 protein_id gnl|my_center|LOCUS_09680 11680 11961 gene locus_tag LOCUS_09690 gene minE 11680 11961 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869948.1 protein_id gnl|my_center|LOCUS_09690 12061 13170 gene locus_tag LOCUS_09700 gene rodA 12061 13170 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964563.1 protein_id gnl|my_center|LOCUS_09700 13294 14784 gene locus_tag LOCUS_09710 gene gltX 13294 14784 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257408.1 protein_id gnl|my_center|LOCUS_09710 14831 16492 gene locus_tag LOCUS_09720 14831 16492 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_09720 16915 16502 gene locus_tag LOCUS_09730 16915 16502 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141668.1 protein_id gnl|my_center|LOCUS_09730 17333 16908 gene locus_tag LOCUS_09740 17333 16908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 17683 17396 gene locus_tag LOCUS_09750 17683 17396 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162015947.1 protein_id gnl|my_center|LOCUS_09750 18362 17757 gene locus_tag LOCUS_09760 18362 17757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 18831 18451 gene locus_tag LOCUS_09770 18831 18451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 19034 18828 gene locus_tag LOCUS_09780 19034 18828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 21802 19181 gene locus_tag LOCUS_09790 21802 19181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 22013 22537 gene locus_tag LOCUS_09800 22013 22537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 22814 22602 gene locus_tag LOCUS_09810 22814 22602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 22701 22991 gene locus_tag LOCUS_09820 22701 22991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 22988 24712 gene locus_tag LOCUS_09830 22988 24712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 24735 25571 gene locus_tag LOCUS_09840 24735 25571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 25633 28455 gene locus_tag LOCUS_09850 25633 28455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 28505 29311 gene locus_tag LOCUS_09860 28505 29311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 29333 29494 gene locus_tag LOCUS_09870 29333 29494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 29764 30156 gene locus_tag LOCUS_09880 29764 30156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 30191 31126 gene locus_tag LOCUS_09890 30191 31126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 33222 31276 gene locus_tag LOCUS_09900 33222 31276 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082373898.1 protein_id gnl|my_center|LOCUS_09900 33238 33612 gene locus_tag LOCUS_09910 33238 33612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 34202 33657 gene locus_tag LOCUS_09920 34202 33657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 34691 34203 gene locus_tag LOCUS_09930 34691 34203 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339163.1 protein_id gnl|my_center|LOCUS_09930 35048 34776 gene locus_tag LOCUS_09940 35048 34776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 36237 35215 gene locus_tag LOCUS_09950 36237 35215 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079997.1 protein_id gnl|my_center|LOCUS_09950 37051 36380 gene locus_tag LOCUS_09960 37051 36380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 37733 37533 gene locus_tag LOCUS_09970 37733 37533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 40743 37792 gene locus_tag LOCUS_09980 40743 37792 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003914906.1 protein_id gnl|my_center|LOCUS_09980 41198 40800 gene locus_tag LOCUS_09990 41198 40800 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206942.1 protein_id gnl|my_center|LOCUS_09990 41529 41233 gene locus_tag LOCUS_10000 41529 41233 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258441.1 protein_id gnl|my_center|LOCUS_10000 42641 41526 gene locus_tag LOCUS_10010 42641 41526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258442.1 protein_id gnl|my_center|LOCUS_10010 <43905 42759 gene locus_tag LOCUS_10020 <43905 42759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061109.1:AarF/ABC1/UbiB kinase family protein >Feature sequence019 <1 1141 gene locus_tag LOCUS_10030 <1 1141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121116.1:chorismate synthase 1265 2197 gene locus_tag LOCUS_10040 1265 2197 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810801.1 protein_id gnl|my_center|LOCUS_10040 3350 2190 gene locus_tag LOCUS_10050 3350 2190 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257619.1 protein_id gnl|my_center|LOCUS_10050 6343 3494 gene locus_tag LOCUS_10060 6343 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 6702 7286 gene locus_tag LOCUS_10070 gene aat 6702 7286 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259206.1 protein_id gnl|my_center|LOCUS_10070 7846 7406 gene locus_tag LOCUS_10080 7846 7406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154792142.1 protein_id gnl|my_center|LOCUS_10080 9277 7994 gene locus_tag LOCUS_10090 gene kbaZ 9277 7994 CDS product tagatose-bisphosphate aldolase subunit KbaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098887.1 protein_id gnl|my_center|LOCUS_10090 10264 9302 gene locus_tag LOCUS_10100 10264 9302 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974044.1 protein_id gnl|my_center|LOCUS_10100 11236 10265 gene locus_tag LOCUS_10110 11236 10265 CDS product tagatose 1,6-diphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256958.1 protein_id gnl|my_center|LOCUS_10110 12561 11257 gene locus_tag LOCUS_10120 12561 11257 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978322.1 protein_id gnl|my_center|LOCUS_10120 13654 12590 gene locus_tag LOCUS_10130 13654 12590 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081643.1 protein_id gnl|my_center|LOCUS_10130 14517 13660 gene locus_tag LOCUS_10140 14517 13660 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729785.1 protein_id gnl|my_center|LOCUS_10140 15638 14616 gene locus_tag LOCUS_10150 15638 14616 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_10150 16951 15659 gene locus_tag LOCUS_10160 16951 15659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 18454 17123 gene locus_tag LOCUS_10170 18454 17123 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727005.1 protein_id gnl|my_center|LOCUS_10170 19625 18579 gene locus_tag LOCUS_10180 gene glmD 19625 18579 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147071.1 protein_id gnl|my_center|LOCUS_10180 20653 19622 gene locus_tag LOCUS_10190 20653 19622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 21432 20677 gene locus_tag LOCUS_10200 21432 20677 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392145.1 protein_id gnl|my_center|LOCUS_10200 21793 23487 gene locus_tag LOCUS_10210 21793 23487 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002396652.1 protein_id gnl|my_center|LOCUS_10210 23515 23937 gene locus_tag LOCUS_10220 23515 23937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 24006 25454 gene locus_tag LOCUS_10230 24006 25454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 25459 26034 gene locus_tag LOCUS_10240 25459 26034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 26619 28022 gene locus_tag LOCUS_10250 gene dnaA 26619 28022 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255915.1 protein_id gnl|my_center|LOCUS_10250 28335 31100 gene locus_tag LOCUS_10260 28335 31100 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530065.1 protein_id gnl|my_center|LOCUS_10260 31726 31202 gene locus_tag LOCUS_10270 31726 31202 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869771.1 protein_id gnl|my_center|LOCUS_10270 32267 33592 gene locus_tag LOCUS_10280 32267 33592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 34486 33725 gene locus_tag LOCUS_10290 34486 33725 CDS product PmeII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233708.1 protein_id gnl|my_center|LOCUS_10290 35132 34473 gene locus_tag LOCUS_10300 35132 34473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10300 35019 35255 gene locus_tag LOCUS_10310 35019 35255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 38732 35412 gene locus_tag LOCUS_10320 38732 35412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 38872 39648 gene locus_tag LOCUS_10330 38872 39648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 39695 40144 gene locus_tag LOCUS_10340 39695 40144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 41438 40164 gene locus_tag LOCUS_10350 41438 40164 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257882.1 protein_id gnl|my_center|LOCUS_10350 42570 41653 gene locus_tag LOCUS_10360 gene ppk2 42570 41653 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705561.1 protein_id gnl|my_center|LOCUS_10360 >Feature sequence020 1076 546 gene locus_tag LOCUS_10370 1076 546 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267657.1 protein_id gnl|my_center|LOCUS_10370 1888 1097 gene locus_tag LOCUS_10380 1888 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 2498 1899 gene locus_tag LOCUS_10390 2498 1899 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_10390 4608 2800 gene locus_tag LOCUS_10400 4608 2800 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531013.1 protein_id gnl|my_center|LOCUS_10400 4767 4848 gene locus_tag LOCUS_t00150 4767 4848 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6723 4933 gene locus_tag LOCUS_10410 gene mutL 6723 4933 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257019.1 protein_id gnl|my_center|LOCUS_10410 6807 7661 gene locus_tag LOCUS_10420 6807 7661 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028151.1 protein_id gnl|my_center|LOCUS_10420 7865 8968 gene locus_tag LOCUS_10430 7865 8968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 9094 10212 gene locus_tag LOCUS_10440 9094 10212 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082660.1 protein_id gnl|my_center|LOCUS_10440 10225 11247 gene locus_tag LOCUS_10450 10225 11247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 11340 12884 gene locus_tag LOCUS_10460 11340 12884 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179944194.1 protein_id gnl|my_center|LOCUS_10460 13196 13654 gene locus_tag LOCUS_10470 gene greA 13196 13654 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172708.1 protein_id gnl|my_center|LOCUS_10470 15726 13741 gene locus_tag LOCUS_10480 15726 13741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 19895 15723 gene locus_tag LOCUS_10490 19895 15723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 20527 19892 gene locus_tag LOCUS_10500 20527 19892 CDS product 4-vinyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257557.1 protein_id gnl|my_center|LOCUS_10500 21244 20663 gene locus_tag LOCUS_10510 gene ruvA 21244 20663 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257302.1 protein_id gnl|my_center|LOCUS_10510 21836 21279 gene locus_tag LOCUS_10520 gene ruvC 21836 21279 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256932.1 protein_id gnl|my_center|LOCUS_10520 22598 21849 gene locus_tag LOCUS_10530 22598 21849 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_10530 22825 24138 gene locus_tag LOCUS_10540 22825 24138 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_10540 24194 24976 gene locus_tag LOCUS_10550 24194 24976 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257033.1 protein_id gnl|my_center|LOCUS_10550 24957 25964 gene locus_tag LOCUS_10560 24957 25964 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257103.1 protein_id gnl|my_center|LOCUS_10560 25970 27085 gene locus_tag LOCUS_10570 25970 27085 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_10570 27825 27343 gene locus_tag LOCUS_10580 gene paaJ 27825 27343 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618854.1 protein_id gnl|my_center|LOCUS_10580 28601 27831 gene locus_tag LOCUS_10590 gene paaC 28601 27831 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228337.1 protein_id gnl|my_center|LOCUS_10590 29137 28598 gene locus_tag LOCUS_10600 29137 28598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 30202 29276 gene locus_tag LOCUS_10610 gene paaA 30202 29276 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228339.1 protein_id gnl|my_center|LOCUS_10610 30300 31721 gene locus_tag LOCUS_10620 30300 31721 CDS product coproporphyrinogen-III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011091016.1 protein_id gnl|my_center|LOCUS_10620 31741 32154 gene locus_tag LOCUS_10630 31741 32154 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_10630 32323 33129 gene locus_tag LOCUS_10640 32323 33129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 33135 34538 gene locus_tag LOCUS_10650 gene aroA 33135 34538 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545275.1 protein_id gnl|my_center|LOCUS_10650 34557 35231 gene locus_tag LOCUS_10660 gene rsmI 34557 35231 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166903.1 protein_id gnl|my_center|LOCUS_10660 35313 36023 gene locus_tag LOCUS_10670 35313 36023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 36044 36889 gene locus_tag LOCUS_10680 36044 36889 CDS product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258699.1 protein_id gnl|my_center|LOCUS_10680 40091 36879 gene locus_tag LOCUS_10690 40091 36879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 41698 40088 gene locus_tag LOCUS_10700 gene pgm 41698 40088 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705434.1 protein_id gnl|my_center|LOCUS_10700 >Feature sequence021 1153 230 gene locus_tag LOCUS_10710 1153 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 2358 1990 gene locus_tag LOCUS_10720 2358 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 2588 3877 gene locus_tag LOCUS_10730 2588 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 4911 3937 gene locus_tag LOCUS_10740 4911 3937 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_10740 6423 4921 gene locus_tag LOCUS_10750 6423 4921 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258467.1 protein_id gnl|my_center|LOCUS_10750 7925 6432 gene locus_tag LOCUS_10760 7925 6432 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258467.1 protein_id gnl|my_center|LOCUS_10760 8446 7922 gene locus_tag LOCUS_10770 8446 7922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 8683 9084 gene locus_tag LOCUS_10780 8683 9084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 10648 9149 gene locus_tag LOCUS_10790 10648 9149 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259717.1 protein_id gnl|my_center|LOCUS_10790 11363 10659 gene locus_tag LOCUS_10800 11363 10659 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258365.1 protein_id gnl|my_center|LOCUS_10800 11514 12506 gene locus_tag LOCUS_10810 11514 12506 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031032.1 protein_id gnl|my_center|LOCUS_10810 13465 12530 gene locus_tag LOCUS_10820 13465 12530 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249955.1 protein_id gnl|my_center|LOCUS_10820 14107 13490 gene locus_tag LOCUS_10830 14107 13490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258681.1 protein_id gnl|my_center|LOCUS_10830 14021 14197 gene locus_tag LOCUS_10840 14021 14197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 14397 14993 gene locus_tag LOCUS_10850 14397 14993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 15101 15727 gene locus_tag LOCUS_10860 15101 15727 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008274486.1 protein_id gnl|my_center|LOCUS_10860 15867 16049 gene locus_tag LOCUS_10870 15867 16049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 17595 16036 gene locus_tag LOCUS_10880 17595 16036 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256199.1 protein_id gnl|my_center|LOCUS_10880 18651 17800 gene locus_tag LOCUS_10890 18651 17800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 19997 18987 gene locus_tag LOCUS_10900 19997 18987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 20763 20509 gene locus_tag LOCUS_10910 20763 20509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 21124 20747 gene locus_tag LOCUS_10920 21124 20747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 22506 21313 gene locus_tag LOCUS_10930 22506 21313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 22931 22506 gene locus_tag LOCUS_10940 22931 22506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 23279 23076 gene locus_tag LOCUS_10950 23279 23076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 24040 23333 gene locus_tag LOCUS_10960 24040 23333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 24252 25700 gene locus_tag LOCUS_10970 24252 25700 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392815.1 protein_id gnl|my_center|LOCUS_10970 25731 26696 gene locus_tag LOCUS_10980 25731 26696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 27580 26900 gene locus_tag LOCUS_10990 27580 26900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 27811 28296 gene locus_tag LOCUS_11000 27811 28296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 28495 28626 gene locus_tag LOCUS_11010 28495 28626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 28891 28655 gene locus_tag LOCUS_11020 28891 28655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 29757 28999 gene locus_tag LOCUS_11030 29757 28999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 30333 29800 gene locus_tag LOCUS_11040 30333 29800 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072775378.1 protein_id gnl|my_center|LOCUS_11040 30910 30365 gene locus_tag LOCUS_11050 30910 30365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 32317 30914 gene locus_tag LOCUS_11060 gene rimO 32317 30914 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257724.1 protein_id gnl|my_center|LOCUS_11060 33340 32357 gene locus_tag LOCUS_11070 33340 32357 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941776.1 protein_id gnl|my_center|LOCUS_11070 33915 33364 gene locus_tag LOCUS_11080 gene rplI 33915 33364 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256838.1 protein_id gnl|my_center|LOCUS_11080 34157 34342 gene locus_tag LOCUS_11090 34157 34342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 35800 34430 gene locus_tag LOCUS_11100 35800 34430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255956.1 protein_id gnl|my_center|LOCUS_11100 36806 35880 gene locus_tag LOCUS_11110 36806 35880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255955.1 protein_id gnl|my_center|LOCUS_11110 37602 36883 gene locus_tag LOCUS_11120 37602 36883 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259732.1 protein_id gnl|my_center|LOCUS_11120 38151 37777 gene locus_tag LOCUS_11130 38151 37777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 38436 38155 gene locus_tag LOCUS_11140 38436 38155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957044.1 protein_id gnl|my_center|LOCUS_11140 38828 38469 gene locus_tag LOCUS_11150 38828 38469 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108235.1 protein_id gnl|my_center|LOCUS_11150 <40778 38825 gene locus_tag LOCUS_11160 <40778 38825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928938.1:AAA family ATPase >Feature sequence022 606 908 gene locus_tag LOCUS_11170 606 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 915 1325 gene locus_tag LOCUS_11180 915 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1353 2405 gene locus_tag LOCUS_11190 1353 2405 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404317.1 protein_id gnl|my_center|LOCUS_11190 2402 4024 gene locus_tag LOCUS_11200 2402 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 4033 5538 gene locus_tag LOCUS_11210 4033 5538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 5643 7586 gene locus_tag LOCUS_11220 5643 7586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 7925 7590 gene locus_tag LOCUS_11230 7925 7590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 7990 8706 gene locus_tag LOCUS_11240 7990 8706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 11533 8708 gene locus_tag LOCUS_11250 11533 8708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 14465 11541 gene locus_tag LOCUS_11260 14465 11541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 14610 15761 gene locus_tag LOCUS_11270 gene rpsA 14610 15761 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258334.1 protein_id gnl|my_center|LOCUS_11270 15820 18342 gene locus_tag LOCUS_11280 15820 18342 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258333.1 protein_id gnl|my_center|LOCUS_11280 20374 18455 gene locus_tag LOCUS_11290 20374 18455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 21759 20371 gene locus_tag LOCUS_11300 21759 20371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 23555 21915 gene locus_tag LOCUS_11310 23555 21915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 24517 23552 gene locus_tag LOCUS_11320 24517 23552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 25949 24765 gene locus_tag LOCUS_11330 25949 24765 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259094.1 protein_id gnl|my_center|LOCUS_11330 26503 25949 gene locus_tag LOCUS_11340 26503 25949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 28083 26515 gene locus_tag LOCUS_11350 28083 26515 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259097.1 protein_id gnl|my_center|LOCUS_11350 29024 28080 gene locus_tag LOCUS_11360 29024 28080 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_11360 29165 30232 gene locus_tag LOCUS_11370 gene fni 29165 30232 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259707.1 protein_id gnl|my_center|LOCUS_11370 30272 31309 gene locus_tag LOCUS_11380 30272 31309 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257726.1 protein_id gnl|my_center|LOCUS_11380 35848 31397 gene locus_tag LOCUS_11390 35848 31397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 37114 36149 gene locus_tag LOCUS_11400 gene prfB 37114 36149 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148265477.1 protein_id gnl|my_center|LOCUS_11400 38234 37326 gene locus_tag LOCUS_11410 gene ftsY 38234 37326 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081293.1 protein_id gnl|my_center|LOCUS_11410 38517 38290 gene locus_tag LOCUS_11420 38517 38290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 <40268 38699 gene locus_tag LOCUS_11430 <40268 38699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257190.1:sodium-translocating pyrophosphatase >Feature sequence023 3245 3877 gene locus_tag LOCUS_11440 3245 3877 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257009.1 protein_id gnl|my_center|LOCUS_11440 3910 4212 gene locus_tag LOCUS_11450 3910 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 4457 4209 gene locus_tag LOCUS_11460 4457 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 5786 4674 gene locus_tag LOCUS_11470 gene queA 5786 4674 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393197.1 protein_id gnl|my_center|LOCUS_11470 6816 5776 gene locus_tag LOCUS_11480 6816 5776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 7603 6821 gene locus_tag LOCUS_11490 7603 6821 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640161.1 protein_id gnl|my_center|LOCUS_11490 9249 7693 gene locus_tag LOCUS_11500 9249 7693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 10761 9331 gene locus_tag LOCUS_11510 10761 9331 CDS product CUAEP/CCAEP-tail radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257877.1 protein_id gnl|my_center|LOCUS_11510 11072 10758 gene locus_tag LOCUS_11520 11072 10758 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233591.1 protein_id gnl|my_center|LOCUS_11520 11249 12160 gene locus_tag LOCUS_11530 11249 12160 CDS product formyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257874.1 protein_id gnl|my_center|LOCUS_11530 12165 14573 gene locus_tag LOCUS_11540 12165 14573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 14798 17782 gene locus_tag LOCUS_11550 14798 17782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 18572 17862 gene locus_tag LOCUS_11560 18572 17862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 19050 18643 gene locus_tag LOCUS_11570 19050 18643 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143863.1 protein_id gnl|my_center|LOCUS_11570 19291 19043 gene locus_tag LOCUS_11580 19291 19043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 20054 19599 gene locus_tag LOCUS_11590 gene nrdR 20054 19599 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259262.1 protein_id gnl|my_center|LOCUS_11590 21349 20198 gene locus_tag LOCUS_11600 gene ftsZ 21349 20198 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_11600 22680 21463 gene locus_tag LOCUS_11610 gene ftsA 22680 21463 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256643.1 protein_id gnl|my_center|LOCUS_11610 23671 22700 gene locus_tag LOCUS_11620 23671 22700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 24846 23668 gene locus_tag LOCUS_11630 24846 23668 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256645.1 protein_id gnl|my_center|LOCUS_11630 25807 24857 gene locus_tag LOCUS_11640 gene murB 25807 24857 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256646.1 protein_id gnl|my_center|LOCUS_11640 27258 25816 gene locus_tag LOCUS_11650 gene murC 27258 25816 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403337.1 protein_id gnl|my_center|LOCUS_11650 27858 27265 gene locus_tag LOCUS_11660 27858 27265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 29003 27852 gene locus_tag LOCUS_11670 29003 27852 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256649.1 protein_id gnl|my_center|LOCUS_11670 30202 29024 gene locus_tag LOCUS_11680 gene spoVE 30202 29024 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949037.1 protein_id gnl|my_center|LOCUS_11680 31609 30218 gene locus_tag LOCUS_11690 gene murD 31609 30218 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_11690 32604 31618 gene locus_tag LOCUS_11700 gene mraY 32604 31618 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256653.1 protein_id gnl|my_center|LOCUS_11700 34040 32604 gene locus_tag LOCUS_11710 34040 32604 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256654.1 protein_id gnl|my_center|LOCUS_11710 35744 34050 gene locus_tag LOCUS_11720 35744 34050 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256655.1 protein_id gnl|my_center|LOCUS_11720 36177 35737 gene locus_tag LOCUS_11730 36177 35737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 37194 36244 gene locus_tag LOCUS_11740 gene rsmH 37194 36244 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943702.1 protein_id gnl|my_center|LOCUS_11740 37690 37271 gene locus_tag LOCUS_11750 gene mraZ 37690 37271 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256658.1 protein_id gnl|my_center|LOCUS_11750 38984 38106 gene locus_tag LOCUS_11760 38984 38106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 39132 39575 gene locus_tag LOCUS_11770 39132 39575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 >Feature sequence024 <1 751 gene locus_tag LOCUS_11780 <1 751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015909136.1:glycosyltransferase family 1 protein 802 1926 gene locus_tag LOCUS_11790 gene rfbG 802 1926 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934346.1 protein_id gnl|my_center|LOCUS_11790 1945 3267 gene locus_tag LOCUS_11800 1945 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 4025 3279 gene locus_tag LOCUS_11810 gene pgl 4025 3279 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407433.1 protein_id gnl|my_center|LOCUS_11810 5019 4018 gene locus_tag LOCUS_11820 gene glk 5019 4018 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259043.1 protein_id gnl|my_center|LOCUS_11820 5458 5135 gene locus_tag LOCUS_11830 5458 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 6164 5520 gene locus_tag LOCUS_11840 6164 5520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 6959 6267 gene locus_tag LOCUS_11850 6959 6267 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889063.1 protein_id gnl|my_center|LOCUS_11850 8746 6956 gene locus_tag LOCUS_11860 8746 6956 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907909.1 protein_id gnl|my_center|LOCUS_11860 8806 9276 gene locus_tag LOCUS_11870 8806 9276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 9472 14205 gene locus_tag LOCUS_11880 9472 14205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 15640 14231 gene locus_tag LOCUS_11890 15640 14231 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479718.1 protein_id gnl|my_center|LOCUS_11890 18252 15835 gene locus_tag LOCUS_11900 18252 15835 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927835.1 protein_id gnl|my_center|LOCUS_11900 19493 18333 gene locus_tag LOCUS_11910 19493 18333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 19612 20046 gene locus_tag LOCUS_11920 19612 20046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 20076 21524 gene locus_tag LOCUS_11930 20076 21524 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064301.1 protein_id gnl|my_center|LOCUS_11930 21648 22658 gene locus_tag LOCUS_11940 gene waaF 21648 22658 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958358.1 protein_id gnl|my_center|LOCUS_11940 23299 22655 gene locus_tag LOCUS_11950 23299 22655 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258353.1 protein_id gnl|my_center|LOCUS_11950 23651 23286 gene locus_tag LOCUS_11960 23651 23286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 24539 23685 gene locus_tag LOCUS_11970 24539 23685 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584151.1 protein_id gnl|my_center|LOCUS_11970 25474 24536 gene locus_tag LOCUS_11980 25474 24536 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584152.1 protein_id gnl|my_center|LOCUS_11980 26968 25610 gene locus_tag LOCUS_11990 26968 25610 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584153.1 protein_id gnl|my_center|LOCUS_11990 28400 27345 gene locus_tag LOCUS_12000 28400 27345 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256998.1 protein_id gnl|my_center|LOCUS_12000 30905 28428 gene locus_tag LOCUS_12010 30905 28428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259586.1 protein_id gnl|my_center|LOCUS_12010 32208 31060 gene locus_tag LOCUS_12020 gene nagA 32208 31060 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057928.1 protein_id gnl|my_center|LOCUS_12020 33787 32213 gene locus_tag LOCUS_12030 33787 32213 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256997.1 protein_id gnl|my_center|LOCUS_12030 35339 33984 gene locus_tag LOCUS_12040 35339 33984 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258588.1 protein_id gnl|my_center|LOCUS_12040 36518 35541 gene locus_tag LOCUS_12050 36518 35541 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174053.1 protein_id gnl|my_center|LOCUS_12050 37696 36515 gene locus_tag LOCUS_12060 37696 36515 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256990.1 protein_id gnl|my_center|LOCUS_12060 >Feature sequence025 233 787 gene locus_tag LOCUS_12070 233 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 818 2020 gene locus_tag LOCUS_12080 818 2020 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259615.1 protein_id gnl|my_center|LOCUS_12080 2169 3563 gene locus_tag LOCUS_12090 2169 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 3515 4816 gene locus_tag LOCUS_12100 3515 4816 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259616.1 protein_id gnl|my_center|LOCUS_12100 5019 6527 gene locus_tag LOCUS_12110 5019 6527 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259622.1 protein_id gnl|my_center|LOCUS_12110 6688 8394 gene locus_tag LOCUS_12120 6688 8394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 8513 8415 gene locus_tag LOCUS_t00160 8513 8415 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 8713 8785 gene locus_tag LOCUS_t00170 8713 8785 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 8819 8891 gene locus_tag LOCUS_t00180 8819 8891 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8933 9004 gene locus_tag LOCUS_t00190 8933 9004 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 9184 10905 gene locus_tag LOCUS_12130 9184 10905 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479769.1 protein_id gnl|my_center|LOCUS_12130 10911 11579 gene locus_tag LOCUS_12140 10911 11579 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256010.1 protein_id gnl|my_center|LOCUS_12140 12022 11591 gene locus_tag LOCUS_12150 12022 11591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 12099 12983 gene locus_tag LOCUS_12160 12099 12983 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256060.1 protein_id gnl|my_center|LOCUS_12160 12986 13780 gene locus_tag LOCUS_12170 12986 13780 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_12170 13770 14627 gene locus_tag LOCUS_12180 13770 14627 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546849.1 protein_id gnl|my_center|LOCUS_12180 14847 14635 gene locus_tag LOCUS_12190 14847 14635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 15214 14957 gene locus_tag LOCUS_12200 15214 14957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 15332 17830 gene locus_tag LOCUS_12210 15332 17830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 17933 17862 gene locus_tag LOCUS_t00200 17933 17862 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 18017 17946 gene locus_tag LOCUS_t00210 18017 17946 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 18100 18026 gene locus_tag LOCUS_t00220 18100 18026 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 19570 18128 gene locus_tag LOCUS_12220 gene tilS 19570 18128 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257904.1 protein_id gnl|my_center|LOCUS_12220 19744 19661 gene locus_tag LOCUS_t00230 19744 19661 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 19859 21847 gene locus_tag LOCUS_12230 19859 21847 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207707612.1 protein_id gnl|my_center|LOCUS_12230 22727 21912 gene locus_tag LOCUS_12240 22727 21912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 22859 23467 gene locus_tag LOCUS_12250 22859 23467 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259156.1 protein_id gnl|my_center|LOCUS_12250 24637 23471 gene locus_tag LOCUS_12260 24637 23471 CDS product DUF3524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257632.1 protein_id gnl|my_center|LOCUS_12260 24725 24940 gene locus_tag LOCUS_12270 24725 24940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 24943 25632 gene locus_tag LOCUS_12280 24943 25632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 25675 27495 gene locus_tag LOCUS_12290 25675 27495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 27536 28222 gene locus_tag LOCUS_12300 27536 28222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 28387 29463 gene locus_tag LOCUS_12310 28387 29463 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928792.1 protein_id gnl|my_center|LOCUS_12310 29704 30648 gene locus_tag LOCUS_12320 29704 30648 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221433.1 protein_id gnl|my_center|LOCUS_12320 30641 31246 gene locus_tag LOCUS_12330 30641 31246 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943410.1 protein_id gnl|my_center|LOCUS_12330 31260 32522 gene locus_tag LOCUS_12340 31260 32522 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257970.1 protein_id gnl|my_center|LOCUS_12340 33427 32570 gene locus_tag LOCUS_12350 33427 32570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 >Feature sequence026 6 1298 gene locus_tag LOCUS_12360 6 1298 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_12360 1401 3176 gene locus_tag LOCUS_12370 1401 3176 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 protein_id gnl|my_center|LOCUS_12370 5278 3272 gene locus_tag LOCUS_12380 gene tkt 5278 3272 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142294.1 protein_id gnl|my_center|LOCUS_12380 6705 5320 gene locus_tag LOCUS_12390 gene gndA 6705 5320 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141117.1 protein_id gnl|my_center|LOCUS_12390 8002 6794 gene locus_tag LOCUS_12400 8002 6794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 9543 8041 gene locus_tag LOCUS_12410 9543 8041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 10860 9598 gene locus_tag LOCUS_12420 10860 9598 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_12420 10931 13357 gene locus_tag LOCUS_12430 10931 13357 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660626.1 protein_id gnl|my_center|LOCUS_12430 15464 13377 gene locus_tag LOCUS_12440 gene uvrB 15464 13377 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256952.1 protein_id gnl|my_center|LOCUS_12440 16570 15554 gene locus_tag LOCUS_12450 16570 15554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 17416 16697 gene locus_tag LOCUS_12460 17416 16697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 17934 18122 gene locus_tag LOCUS_12470 17934 18122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 18916 18230 gene locus_tag LOCUS_12480 18916 18230 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085274.1 protein_id gnl|my_center|LOCUS_12480 19885 18938 gene locus_tag LOCUS_12490 19885 18938 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160961434.1 protein_id gnl|my_center|LOCUS_12490 20762 21043 gene locus_tag LOCUS_12500 20762 21043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 21021 21323 gene locus_tag LOCUS_12510 21021 21323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 22528 21335 gene locus_tag LOCUS_12520 22528 21335 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029846.1 protein_id gnl|my_center|LOCUS_12520 23360 22539 gene locus_tag LOCUS_12530 23360 22539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 23516 24661 gene locus_tag LOCUS_12540 23516 24661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 24761 25756 gene locus_tag LOCUS_12550 24761 25756 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897285.1 protein_id gnl|my_center|LOCUS_12550 25784 26425 gene locus_tag LOCUS_12560 25784 26425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 26557 27564 gene locus_tag LOCUS_12570 26557 27564 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257805.1 protein_id gnl|my_center|LOCUS_12570 28059 27580 gene locus_tag LOCUS_12580 28059 27580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 28824 28081 gene locus_tag LOCUS_12590 28824 28081 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082216.1 protein_id gnl|my_center|LOCUS_12590 29199 28855 gene locus_tag LOCUS_12600 29199 28855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 29334 29260 gene locus_tag LOCUS_t00240 29334 29260 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 29527 29438 gene locus_tag LOCUS_t00250 29527 29438 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 29659 29571 gene locus_tag LOCUS_t00260 29659 29571 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 30103 32394 gene locus_tag LOCUS_12610 30103 32394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 >Feature sequence027 <1 1061 gene locus_tag LOCUS_12620 <1 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927834.1:DNA repair protein RadA 1261 1554 gene locus_tag LOCUS_12630 gene rpsF 1261 1554 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_12630 1606 1914 gene locus_tag LOCUS_12640 1606 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 1928 2170 gene locus_tag LOCUS_12650 gene rpsR 1928 2170 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869404.1 protein_id gnl|my_center|LOCUS_12650 2201 3571 gene locus_tag LOCUS_12660 2201 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 3677 4423 gene locus_tag LOCUS_12670 gene rlmB 3677 4423 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036704.1 protein_id gnl|my_center|LOCUS_12670 4603 5760 gene locus_tag LOCUS_12680 gene sucC 4603 5760 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257007.1 protein_id gnl|my_center|LOCUS_12680 5757 6626 gene locus_tag LOCUS_12690 gene sucD 5757 6626 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256597.1 protein_id gnl|my_center|LOCUS_12690 6768 9062 gene locus_tag LOCUS_12700 6768 9062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 9064 9663 gene locus_tag LOCUS_12710 gene rsmD 9064 9663 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986836.1 protein_id gnl|my_center|LOCUS_12710 10429 9647 gene locus_tag LOCUS_12720 10429 9647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 11370 10516 gene locus_tag LOCUS_12730 11370 10516 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016086425.1 protein_id gnl|my_center|LOCUS_12730 12289 11405 gene locus_tag LOCUS_12740 12289 11405 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258346.1 protein_id gnl|my_center|LOCUS_12740 12631 14013 gene locus_tag LOCUS_12750 12631 14013 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_12750 14669 14010 gene locus_tag LOCUS_12760 14669 14010 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256927.1 protein_id gnl|my_center|LOCUS_12760 15440 14673 gene locus_tag LOCUS_12770 15440 14673 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_12770 16492 15512 gene locus_tag LOCUS_12780 16492 15512 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256314.1 protein_id gnl|my_center|LOCUS_12780 17331 16489 gene locus_tag LOCUS_12790 gene rfbD 17331 16489 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256315.1 protein_id gnl|my_center|LOCUS_12790 20353 17387 gene locus_tag LOCUS_12800 20353 17387 CDS product molybdopterin-dependent oxidoreductase Mo/Fe-S-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817476.1 protein_id gnl|my_center|LOCUS_12800 21436 20435 gene locus_tag LOCUS_12810 21436 20435 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_12810 23129 21741 gene locus_tag LOCUS_12820 23129 21741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 24136 23168 gene locus_tag LOCUS_12830 24136 23168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 24255 24389 gene locus_tag LOCUS_12840 24255 24389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 27777 24625 gene locus_tag LOCUS_12850 27777 24625 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258322.1 protein_id gnl|my_center|LOCUS_12850 29520 27787 gene locus_tag LOCUS_12860 29520 27787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 29897 29505 gene locus_tag LOCUS_12870 29897 29505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 30166 30804 gene locus_tag LOCUS_12880 30166 30804 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391626.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence028 2855 1596 gene locus_tag LOCUS_12890 2855 1596 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259610.1 protein_id gnl|my_center|LOCUS_12890 3652 2894 gene locus_tag LOCUS_12900 3652 2894 CDS product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259609.1 protein_id gnl|my_center|LOCUS_12900 4041 4220 gene locus_tag LOCUS_12910 4041 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 4277 4522 gene locus_tag LOCUS_12920 4277 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 4503 4973 gene locus_tag LOCUS_12930 4503 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 4970 6898 gene locus_tag LOCUS_12940 4970 6898 CDS product lasso peptide isopeptide bond-forming cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528116.1 protein_id gnl|my_center|LOCUS_12940 6846 7040 gene locus_tag LOCUS_12950 6846 7040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 7056 8063 gene locus_tag LOCUS_12960 7056 8063 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626495.1 protein_id gnl|my_center|LOCUS_12960 9233 8064 gene locus_tag LOCUS_12970 9233 8064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 9658 9233 gene locus_tag LOCUS_12980 9658 9233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 9968 9672 gene locus_tag LOCUS_12990 9968 9672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 11952 10054 gene locus_tag LOCUS_13000 11952 10054 CDS product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257484.1 protein_id gnl|my_center|LOCUS_13000 12329 13060 gene locus_tag LOCUS_13010 12329 13060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 13067 13825 gene locus_tag LOCUS_13020 13067 13825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 13878 14591 gene locus_tag LOCUS_13030 13878 14591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 15150 16298 gene locus_tag LOCUS_13040 gene ftsZ 15150 16298 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_13040 16835 16410 gene locus_tag LOCUS_13050 16835 16410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 16964 18274 gene locus_tag LOCUS_13060 16964 18274 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249880.1 protein_id gnl|my_center|LOCUS_13060 18314 20128 gene locus_tag LOCUS_13070 18314 20128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 20121 21386 gene locus_tag LOCUS_13080 20121 21386 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119682992.1 protein_id gnl|my_center|LOCUS_13080 21389 21757 gene locus_tag LOCUS_13090 21389 21757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 21861 21785 gene locus_tag LOCUS_t00270 21861 21785 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 21832 22590 gene locus_tag LOCUS_13100 21832 22590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 22838 25279 gene locus_tag LOCUS_13110 22838 25279 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_13110 25334 26596 gene locus_tag LOCUS_13120 25334 26596 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257562.1 protein_id gnl|my_center|LOCUS_13120 27068 26646 gene locus_tag LOCUS_13130 27068 26646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 27958 27074 gene locus_tag LOCUS_13140 27958 27074 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228982.1 protein_id gnl|my_center|LOCUS_13140 30384 27970 gene locus_tag LOCUS_13150 gene lon 30384 27970 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255996.1 protein_id gnl|my_center|LOCUS_13150 31756 30377 gene locus_tag LOCUS_13160 31756 30377 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583125.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence029 1822 839 gene locus_tag LOCUS_13170 1822 839 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258703.1 protein_id gnl|my_center|LOCUS_13170 2641 1931 gene locus_tag LOCUS_13180 2641 1931 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256822.1 protein_id gnl|my_center|LOCUS_13180 3447 2638 gene locus_tag LOCUS_13190 3447 2638 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256821.1 protein_id gnl|my_center|LOCUS_13190 5158 3458 gene locus_tag LOCUS_13200 5158 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 6247 5171 gene locus_tag LOCUS_13210 6247 5171 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938014.1 protein_id gnl|my_center|LOCUS_13210 7710 6415 gene locus_tag LOCUS_13220 7710 6415 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228602.1 protein_id gnl|my_center|LOCUS_13220 8834 8088 gene locus_tag LOCUS_13230 8834 8088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 10119 8839 gene locus_tag LOCUS_13240 gene fabF 10119 8839 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_13240 11217 10213 gene locus_tag LOCUS_13250 gene plsX 11217 10213 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_13250 12494 11313 gene locus_tag LOCUS_13260 12494 11313 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390124.1 protein_id gnl|my_center|LOCUS_13260 12611 15718 gene locus_tag LOCUS_13270 12611 15718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 16311 15715 gene locus_tag LOCUS_13280 16311 15715 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532195.1 protein_id gnl|my_center|LOCUS_13280 18380 16422 gene locus_tag LOCUS_13290 18380 16422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 18652 19062 gene locus_tag LOCUS_13300 18652 19062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 19111 19515 gene locus_tag LOCUS_13310 19111 19515 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871778.1 protein_id gnl|my_center|LOCUS_13310 20325 19588 gene locus_tag LOCUS_13320 20325 19588 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_13320 21195 20407 gene locus_tag LOCUS_13330 gene cofE 21195 20407 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_13330 21878 21222 gene locus_tag LOCUS_13340 gene npdG 21878 21222 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060779.1 protein_id gnl|my_center|LOCUS_13340 23331 21979 gene locus_tag LOCUS_13350 gene ssnA 23331 21979 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393455.1 protein_id gnl|my_center|LOCUS_13350 23577 23915 gene locus_tag LOCUS_13360 gene trxA 23577 23915 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082899.1 protein_id gnl|my_center|LOCUS_13360 24461 23994 gene locus_tag LOCUS_13370 24461 23994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 25378 24587 gene locus_tag LOCUS_13380 25378 24587 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211718.1 protein_id gnl|my_center|LOCUS_13380 26274 25522 gene locus_tag LOCUS_13390 26274 25522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 28514 26628 gene locus_tag LOCUS_13400 28514 26628 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256369.1 protein_id gnl|my_center|LOCUS_13400 29305 28610 gene locus_tag LOCUS_13410 29305 28610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 30055 29357 gene locus_tag LOCUS_13420 30055 29357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 31056 30067 gene locus_tag LOCUS_13430 gene msrP 31056 30067 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257868.1 protein_id gnl|my_center|LOCUS_13430 >Feature sequence030 1316 636 gene locus_tag LOCUS_13440 1316 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 1422 1619 gene locus_tag LOCUS_13450 1422 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 1733 3322 gene locus_tag LOCUS_13460 1733 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 3319 4071 gene locus_tag LOCUS_13470 3319 4071 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259072.1 protein_id gnl|my_center|LOCUS_13470 5377 4079 gene locus_tag LOCUS_13480 5377 4079 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969771.1 protein_id gnl|my_center|LOCUS_13480 6324 5425 gene locus_tag LOCUS_13490 6324 5425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 7106 6339 gene locus_tag LOCUS_13500 7106 6339 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388756.1 protein_id gnl|my_center|LOCUS_13500 7954 7109 gene locus_tag LOCUS_13510 7954 7109 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330131.1 protein_id gnl|my_center|LOCUS_13510 9262 8396 gene locus_tag LOCUS_13520 9262 8396 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970519.1 protein_id gnl|my_center|LOCUS_13520 10117 9461 gene locus_tag LOCUS_13530 10117 9461 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257428.1 protein_id gnl|my_center|LOCUS_13530 10222 10590 gene locus_tag LOCUS_13540 10222 10590 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256377.1 protein_id gnl|my_center|LOCUS_13540 11219 10587 gene locus_tag LOCUS_13550 gene tmk 11219 10587 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258097.1 protein_id gnl|my_center|LOCUS_13550 12970 11252 gene locus_tag LOCUS_13560 12970 11252 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258096.1 protein_id gnl|my_center|LOCUS_13560 14067 12997 gene locus_tag LOCUS_13570 14067 12997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 14132 14596 gene locus_tag LOCUS_13580 gene sdhC 14132 14596 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776147.1 protein_id gnl|my_center|LOCUS_13580 14607 15026 gene locus_tag LOCUS_13590 14607 15026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 15060 16838 gene locus_tag LOCUS_13600 gene sdhA 15060 16838 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228694.1 protein_id gnl|my_center|LOCUS_13600 16851 17573 gene locus_tag LOCUS_13610 16851 17573 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776150.1 protein_id gnl|my_center|LOCUS_13610 19071 17662 gene locus_tag LOCUS_13620 19071 17662 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775783.1 protein_id gnl|my_center|LOCUS_13620 20447 19227 gene locus_tag LOCUS_13630 20447 19227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 21355 20444 gene locus_tag LOCUS_13640 21355 20444 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257625.1 protein_id gnl|my_center|LOCUS_13640 22341 21352 gene locus_tag LOCUS_13650 22341 21352 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258205.1 protein_id gnl|my_center|LOCUS_13650 23417 22347 gene locus_tag LOCUS_13660 23417 22347 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259411.1 protein_id gnl|my_center|LOCUS_13660 24102 25946 gene locus_tag LOCUS_13670 gene glmS 24102 25946 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256373.1 protein_id gnl|my_center|LOCUS_13670 26079 26897 gene locus_tag LOCUS_13680 26079 26897 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206171.1 protein_id gnl|my_center|LOCUS_13680 26923 28761 gene locus_tag LOCUS_13690 26923 28761 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228742.1 protein_id gnl|my_center|LOCUS_13690 >Feature sequence031 186 938 gene locus_tag LOCUS_13700 gene pstB 186 938 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878856.1 protein_id gnl|my_center|LOCUS_13700 1076 1792 gene locus_tag LOCUS_13710 1076 1792 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584159.1 protein_id gnl|my_center|LOCUS_13710 1925 7327 gene locus_tag LOCUS_13720 1925 7327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13720 7380 10091 gene locus_tag LOCUS_13730 7380 10091 CDS product DUF2298 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141612405.1 protein_id gnl|my_center|LOCUS_13730 10088 11842 gene locus_tag LOCUS_13740 10088 11842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 11972 15805 gene locus_tag LOCUS_13750 11972 15805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 16449 15802 gene locus_tag LOCUS_13760 16449 15802 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337754.1 protein_id gnl|my_center|LOCUS_13760 17405 16518 gene locus_tag LOCUS_13770 gene ilvE 17405 16518 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336792.1 protein_id gnl|my_center|LOCUS_13770 17581 17982 gene locus_tag LOCUS_13780 17581 17982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13780 18001 18705 gene locus_tag LOCUS_13790 18001 18705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13790 18791 19609 gene locus_tag LOCUS_13800 18791 19609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 19625 20764 gene locus_tag LOCUS_13810 19625 20764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 20806 22152 gene locus_tag LOCUS_13820 20806 22152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 22149 25100 gene locus_tag LOCUS_13830 22149 25100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 25123 26079 gene locus_tag LOCUS_13840 gene cmr4 25123 26079 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546538.1 protein_id gnl|my_center|LOCUS_13840 26099 26542 gene locus_tag LOCUS_13850 26099 26542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 26554 27405 gene locus_tag LOCUS_13860 26554 27405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545127.1 protein_id gnl|my_center|LOCUS_13860 27395 28540 gene locus_tag LOCUS_13870 27395 28540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 28533 28658 gene locus_tag LOCUS_13880 28533 28658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 28658 28987 gene locus_tag LOCUS_13890 28658 28987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 29049 29372 gene locus_tag LOCUS_13900 29049 29372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 29657 30526 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgacacaaagagaatcccgctagacgggattgaaac 30585 30836 gene locus_tag LOCUS_13910 30585 30836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 >Feature sequence032 263 1093 gene locus_tag LOCUS_13920 gene menB 263 1093 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058289.1 protein_id gnl|my_center|LOCUS_13920 1136 2653 gene locus_tag LOCUS_13930 1136 2653 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449576.1 protein_id gnl|my_center|LOCUS_13930 2650 3477 gene locus_tag LOCUS_13940 gene menH 2650 3477 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103366.1 protein_id gnl|my_center|LOCUS_13940 4342 3461 gene locus_tag LOCUS_13950 gene menA 4342 3461 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703949.1 protein_id gnl|my_center|LOCUS_13950 4474 5307 gene locus_tag LOCUS_13960 gene aroF 4474 5307 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306370.1 protein_id gnl|my_center|LOCUS_13960 5383 6009 gene locus_tag LOCUS_13970 5383 6009 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820605.1 protein_id gnl|my_center|LOCUS_13970 6100 7893 gene locus_tag LOCUS_13980 6100 7893 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038616.1 protein_id gnl|my_center|LOCUS_13980 7880 8470 gene locus_tag LOCUS_13990 7880 8470 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005374107.1 protein_id gnl|my_center|LOCUS_13990 10360 8483 gene locus_tag LOCUS_14000 gene uvrC 10360 8483 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257899.1 protein_id gnl|my_center|LOCUS_14000 11357 10434 gene locus_tag LOCUS_14010 11357 10434 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162890682.1 protein_id gnl|my_center|LOCUS_14010 13821 11335 gene locus_tag LOCUS_14020 13821 11335 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_14020 14965 14024 gene locus_tag LOCUS_14030 14965 14024 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258386.1 protein_id gnl|my_center|LOCUS_14030 15417 14992 gene locus_tag LOCUS_14040 15417 14992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 15906 15709 gene locus_tag LOCUS_14050 15906 15709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 15859 16329 gene locus_tag LOCUS_14060 15859 16329 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228223.1 protein_id gnl|my_center|LOCUS_14060 16597 17058 gene locus_tag LOCUS_14070 16597 17058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 17073 17564 gene locus_tag LOCUS_14080 17073 17564 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258548.1 protein_id gnl|my_center|LOCUS_14080 18021 17545 gene locus_tag LOCUS_14090 18021 17545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 19425 18256 gene locus_tag LOCUS_14100 19425 18256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 20106 19450 gene locus_tag LOCUS_14110 20106 19450 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026924.1 protein_id gnl|my_center|LOCUS_14110 20675 23467 gene locus_tag LOCUS_14120 gene ppdK 20675 23467 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258815.1 protein_id gnl|my_center|LOCUS_14120 23549 27217 gene locus_tag LOCUS_14130 gene nifJ 23549 27217 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870177.1 protein_id gnl|my_center|LOCUS_14130 27298 28302 gene locus_tag LOCUS_14140 27298 28302 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_14140 28674 28450 gene locus_tag LOCUS_14150 28674 28450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 30819 28831 gene locus_tag LOCUS_14160 30819 28831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 >Feature sequence033 2953 1118 gene locus_tag LOCUS_14170 2953 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 4737 3232 gene locus_tag LOCUS_14180 4737 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 7267 4820 gene locus_tag LOCUS_14190 7267 4820 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392112.1 protein_id gnl|my_center|LOCUS_14190 7577 8290 gene locus_tag LOCUS_14200 7577 8290 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_14200 8787 8296 gene locus_tag LOCUS_14210 8787 8296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258265.1 protein_id gnl|my_center|LOCUS_14210 9325 8798 gene locus_tag LOCUS_14220 gene coaD 9325 8798 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393371.1 protein_id gnl|my_center|LOCUS_14220 11932 9371 gene locus_tag LOCUS_14230 gene recG 11932 9371 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141278.1 protein_id gnl|my_center|LOCUS_14230 13623 12019 gene locus_tag LOCUS_14240 13623 12019 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289723.1 protein_id gnl|my_center|LOCUS_14240 14094 13741 gene locus_tag LOCUS_14250 14094 13741 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232054.1 protein_id gnl|my_center|LOCUS_14250 14250 14429 gene locus_tag LOCUS_14260 gene rpmB 14250 14429 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256168.1 protein_id gnl|my_center|LOCUS_14260 15531 14590 gene locus_tag LOCUS_14270 gene mvk 15531 14590 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256769.1 protein_id gnl|my_center|LOCUS_14270 16416 15544 gene locus_tag LOCUS_14280 16416 15544 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256409.1 protein_id gnl|my_center|LOCUS_14280 17379 16603 gene locus_tag LOCUS_14290 17379 16603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 18778 17600 gene locus_tag LOCUS_14300 18778 17600 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257433.1 protein_id gnl|my_center|LOCUS_14300 19528 18836 gene locus_tag LOCUS_14310 19528 18836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 20043 19525 gene locus_tag LOCUS_14320 20043 19525 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838404.1 protein_id gnl|my_center|LOCUS_14320 21588 20065 gene locus_tag LOCUS_14330 gene accC 21588 20065 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_14330 23232 21688 gene locus_tag LOCUS_14340 23232 21688 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_14340 23670 23245 gene locus_tag LOCUS_14350 23670 23245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 23874 24281 gene locus_tag LOCUS_14360 gene msrB 23874 24281 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943090.1 protein_id gnl|my_center|LOCUS_14360 25269 24325 gene locus_tag LOCUS_14370 25269 24325 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926009.1 protein_id gnl|my_center|LOCUS_14370 25921 25451 gene locus_tag LOCUS_14380 25921 25451 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732458.1 protein_id gnl|my_center|LOCUS_14380 26050 27363 gene locus_tag LOCUS_14390 26050 27363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 27538 28992 gene locus_tag LOCUS_14400 gene glgA 27538 28992 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393434.1 protein_id gnl|my_center|LOCUS_14400 >Feature sequence034 265 486 gene locus_tag LOCUS_14410 265 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 590 895 gene locus_tag LOCUS_14420 590 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 892 1101 gene locus_tag LOCUS_14430 gene yidD 892 1101 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256304.1 protein_id gnl|my_center|LOCUS_14430 1114 2262 gene locus_tag LOCUS_14440 1114 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 2281 3162 gene locus_tag LOCUS_14450 2281 3162 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254638.1 protein_id gnl|my_center|LOCUS_14450 3169 4035 gene locus_tag LOCUS_14460 3169 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 5694 4108 gene locus_tag LOCUS_14470 gene serA 5694 4108 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881245.1 protein_id gnl|my_center|LOCUS_14470 6560 5703 gene locus_tag LOCUS_14480 6560 5703 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958400.1 protein_id gnl|my_center|LOCUS_14480 7452 6541 gene locus_tag LOCUS_14490 7452 6541 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920236.1 protein_id gnl|my_center|LOCUS_14490 8444 7449 gene locus_tag LOCUS_14500 8444 7449 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546520.1 protein_id gnl|my_center|LOCUS_14500 9361 8471 gene locus_tag LOCUS_14510 gene folD 9361 8471 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_14510 9647 9450 gene locus_tag LOCUS_14520 9647 9450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 9917 11722 gene locus_tag LOCUS_14530 9917 11722 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257580.1 protein_id gnl|my_center|LOCUS_14530 11735 13624 gene locus_tag LOCUS_14540 11735 13624 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257959.1 protein_id gnl|my_center|LOCUS_14540 13698 14444 gene locus_tag LOCUS_14550 13698 14444 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_14550 14495 14758 gene locus_tag LOCUS_14560 14495 14758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 16017 14851 gene locus_tag LOCUS_14570 16017 14851 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036700.1 protein_id gnl|my_center|LOCUS_14570 16814 16041 gene locus_tag LOCUS_14580 16814 16041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 17707 16850 gene locus_tag LOCUS_14590 gene catE 17707 16850 CDS product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233597.1 protein_id gnl|my_center|LOCUS_14590 18376 17831 gene locus_tag LOCUS_14600 18376 17831 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257692.1 protein_id gnl|my_center|LOCUS_14600 18521 19159 gene locus_tag LOCUS_14610 18521 19159 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226699.1 protein_id gnl|my_center|LOCUS_14610 19251 21077 gene locus_tag LOCUS_14620 19251 21077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 21087 21659 gene locus_tag LOCUS_14630 21087 21659 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068762.1 protein_id gnl|my_center|LOCUS_14630 22553 21681 gene locus_tag LOCUS_14640 22553 21681 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258710.1 protein_id gnl|my_center|LOCUS_14640 22617 23417 gene locus_tag LOCUS_14650 22617 23417 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057996.1 protein_id gnl|my_center|LOCUS_14650 24930 23431 gene locus_tag LOCUS_14660 24930 23431 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257170.1 protein_id gnl|my_center|LOCUS_14660 25076 26905 gene locus_tag LOCUS_14670 25076 26905 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258088.1 protein_id gnl|my_center|LOCUS_14670 27047 27436 gene locus_tag LOCUS_14680 27047 27436 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393656.1 protein_id gnl|my_center|LOCUS_14680 27476 28381 gene locus_tag LOCUS_14690 27476 28381 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052303786.1 protein_id gnl|my_center|LOCUS_14690 28419 29366 gene locus_tag LOCUS_14700 28419 29366 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256256.1 protein_id gnl|my_center|LOCUS_14700 <30582 29462 gene locus_tag LOCUS_14710 <30582 29462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257581.1:ABC transporter ATP-binding protein >Feature sequence035 <1 736 gene locus_tag LOCUS_14720 <1 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615489.1:DUF1592 domain-containing protein 780 2744 gene locus_tag LOCUS_14730 780 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 3030 4742 gene locus_tag LOCUS_14740 3030 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 5951 4809 gene locus_tag LOCUS_14750 5951 4809 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142438.1 protein_id gnl|my_center|LOCUS_14750 5980 6195 gene locus_tag LOCUS_14760 5980 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 6747 6310 gene locus_tag LOCUS_14770 gene dtd 6747 6310 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256355.1 protein_id gnl|my_center|LOCUS_14770 7819 6752 gene locus_tag LOCUS_14780 7819 6752 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_14780 8528 7881 gene locus_tag LOCUS_14790 8528 7881 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256018.1 protein_id gnl|my_center|LOCUS_14790 9242 8592 gene locus_tag LOCUS_14800 9242 8592 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256017.1 protein_id gnl|my_center|LOCUS_14800 9836 9252 gene locus_tag LOCUS_14810 9836 9252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 11035 9899 gene locus_tag LOCUS_14820 11035 9899 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256015.1 protein_id gnl|my_center|LOCUS_14820 11172 11942 gene locus_tag LOCUS_14830 11172 11942 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350585.1 protein_id gnl|my_center|LOCUS_14830 12881 13258 gene locus_tag LOCUS_14840 12881 13258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 13279 14520 gene locus_tag LOCUS_14850 13279 14520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 14928 15503 gene locus_tag LOCUS_14860 14928 15503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 16900 15527 gene locus_tag LOCUS_14870 16900 15527 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404619.1 protein_id gnl|my_center|LOCUS_14870 17060 17554 gene locus_tag LOCUS_14880 gene scpB 17060 17554 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259764.1 protein_id gnl|my_center|LOCUS_14880 17607 18431 gene locus_tag LOCUS_14890 17607 18431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 18444 19154 gene locus_tag LOCUS_14900 gene cmk 18444 19154 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256860.1 protein_id gnl|my_center|LOCUS_14900 19193 20956 gene locus_tag LOCUS_14910 19193 20956 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257645.1 protein_id gnl|my_center|LOCUS_14910 20964 21227 gene locus_tag LOCUS_14920 20964 21227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 23481 21199 gene locus_tag LOCUS_14930 gene relA 23481 21199 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167242.1 protein_id gnl|my_center|LOCUS_14930 24010 23675 gene locus_tag LOCUS_14940 24010 23675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 24505 24044 gene locus_tag LOCUS_14950 24505 24044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 24838 24551 gene locus_tag LOCUS_14960 24838 24551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 25986 24835 gene locus_tag LOCUS_14970 gene mnmA 25986 24835 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393152.1 protein_id gnl|my_center|LOCUS_14970 27188 26001 gene locus_tag LOCUS_14980 gene nifS 27188 26001 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_14980 29289 27205 gene locus_tag LOCUS_14990 29289 27205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 >Feature sequence036 758 1114 gene locus_tag LOCUS_15000 758 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 1269 1457 gene locus_tag LOCUS_15010 1269 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 1454 2173 gene locus_tag LOCUS_15020 1454 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 2170 2490 gene locus_tag LOCUS_15030 2170 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 2494 3495 gene locus_tag LOCUS_15040 2494 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 3492 4193 gene locus_tag LOCUS_15050 3492 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 4259 4795 gene locus_tag LOCUS_15060 4259 4795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 4903 6564 gene locus_tag LOCUS_15070 4903 6564 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120704930.1 protein_id gnl|my_center|LOCUS_15070 6981 7080 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8349 7432 gene locus_tag LOCUS_15080 8349 7432 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060640.1 protein_id gnl|my_center|LOCUS_15080 9509 8460 gene locus_tag LOCUS_15090 9509 8460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 10483 9659 gene locus_tag LOCUS_15100 10483 9659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 10791 10558 gene locus_tag LOCUS_15110 10791 10558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 11103 10903 gene locus_tag LOCUS_15120 11103 10903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 11570 13477 gene locus_tag LOCUS_15130 11570 13477 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035498.1 protein_id gnl|my_center|LOCUS_15130 13580 14320 gene locus_tag LOCUS_15140 13580 14320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 18576 14599 gene locus_tag LOCUS_15150 18576 14599 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258114.1 protein_id gnl|my_center|LOCUS_15150 20602 19028 gene locus_tag LOCUS_15160 20602 19028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 21056 20616 gene locus_tag LOCUS_15170 21056 20616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 21464 21117 gene locus_tag LOCUS_15180 21464 21117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 21661 23733 gene locus_tag LOCUS_15190 gene fusA 21661 23733 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_15190 24156 23926 gene locus_tag LOCUS_15200 24156 23926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 24920 28306 gene locus_tag LOCUS_15210 24920 28306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 >Feature sequence037 3032 861 gene locus_tag LOCUS_15220 gene fdhF 3032 861 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 protein_id gnl|my_center|LOCUS_15220 3220 3029 gene locus_tag LOCUS_15230 3220 3029 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023347.1 protein_id gnl|my_center|LOCUS_15230 3951 3238 gene locus_tag LOCUS_15240 3951 3238 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_15240 4729 4016 gene locus_tag LOCUS_15250 4729 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 5561 4734 gene locus_tag LOCUS_15260 gene fdhD 5561 4734 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227709.1 protein_id gnl|my_center|LOCUS_15260 7315 5558 gene locus_tag LOCUS_15270 7315 5558 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226417.1 protein_id gnl|my_center|LOCUS_15270 8459 7494 gene locus_tag LOCUS_15280 8459 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 9209 8499 gene locus_tag LOCUS_15290 9209 8499 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552750.1 protein_id gnl|my_center|LOCUS_15290 10311 9277 gene locus_tag LOCUS_15300 10311 9277 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402005.1 protein_id gnl|my_center|LOCUS_15300 10406 12157 gene locus_tag LOCUS_15310 10406 12157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 12530 12204 gene locus_tag LOCUS_15320 12530 12204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 12678 14300 gene locus_tag LOCUS_15330 gene murJ 12678 14300 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258283.1 protein_id gnl|my_center|LOCUS_15330 15195 14365 gene locus_tag LOCUS_15340 15195 14365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 16234 15359 gene locus_tag LOCUS_15350 16234 15359 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258710.1 protein_id gnl|my_center|LOCUS_15350 17048 16260 gene locus_tag LOCUS_15360 17048 16260 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037003.1 protein_id gnl|my_center|LOCUS_15360 19073 17169 gene locus_tag LOCUS_15370 gene ftsH 19073 17169 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257906.1 protein_id gnl|my_center|LOCUS_15370 19405 20247 gene locus_tag LOCUS_15380 19405 20247 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_15380 20252 22237 gene locus_tag LOCUS_15390 gene dhaR 20252 22237 CDS product dihydroxyacetone kinase operon transcriptional regulator DhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815505.1 protein_id gnl|my_center|LOCUS_15390 22677 23405 gene locus_tag LOCUS_15400 22677 23405 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259136.1 protein_id gnl|my_center|LOCUS_15400 23581 24648 gene locus_tag LOCUS_15410 gene dhaK 23581 24648 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938278.1 protein_id gnl|my_center|LOCUS_15410 24785 25420 gene locus_tag LOCUS_15420 gene dhaL 24785 25420 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257203.1 protein_id gnl|my_center|LOCUS_15420 25519 27024 gene locus_tag LOCUS_15430 gene glpK 25519 27024 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259133.1 protein_id gnl|my_center|LOCUS_15430 27255 28415 gene locus_tag LOCUS_15440 27255 28415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 >Feature sequence038 1105 533 gene locus_tag LOCUS_15450 1105 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1626 1168 gene locus_tag LOCUS_15460 gene bcp 1626 1168 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257872.1 protein_id gnl|my_center|LOCUS_15460 3126 1699 gene locus_tag LOCUS_15470 3126 1699 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144234.1 protein_id gnl|my_center|LOCUS_15470 3345 5774 gene locus_tag LOCUS_15480 3345 5774 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_15480 6313 5771 gene locus_tag LOCUS_15490 6313 5771 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_15490 6812 6363 gene locus_tag LOCUS_15500 6812 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 7170 7787 gene locus_tag LOCUS_15510 7170 7787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 7898 8896 gene locus_tag LOCUS_15520 gene mer 7898 8896 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878566.1 protein_id gnl|my_center|LOCUS_15520 9364 8915 gene locus_tag LOCUS_15530 9364 8915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 9669 9361 gene locus_tag LOCUS_15540 9669 9361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 10852 9917 gene locus_tag LOCUS_15550 10852 9917 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284395.1 protein_id gnl|my_center|LOCUS_15550 12279 10858 gene locus_tag LOCUS_15560 12279 10858 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257833.1 protein_id gnl|my_center|LOCUS_15560 13696 12404 gene locus_tag LOCUS_15570 13696 12404 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140384.1 protein_id gnl|my_center|LOCUS_15570 13834 16140 gene locus_tag LOCUS_15580 gene pcrA 13834 16140 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836754.1 protein_id gnl|my_center|LOCUS_15580 16147 16764 gene locus_tag LOCUS_15590 16147 16764 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256064.1 protein_id gnl|my_center|LOCUS_15590 18860 16893 gene locus_tag LOCUS_15600 18860 16893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 20170 19118 gene locus_tag LOCUS_15610 gene galT 20170 19118 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367649.1 protein_id gnl|my_center|LOCUS_15610 20308 20637 gene locus_tag LOCUS_15620 20308 20637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 20634 21026 gene locus_tag LOCUS_15630 20634 21026 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140980.1 protein_id gnl|my_center|LOCUS_15630 22983 21190 gene locus_tag LOCUS_15640 22983 21190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 23178 23786 gene locus_tag LOCUS_15650 23178 23786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 25103 23817 gene locus_tag LOCUS_15660 gene tyrS 25103 23817 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229300.1 protein_id gnl|my_center|LOCUS_15660 26989 25604 gene locus_tag LOCUS_15670 26989 25604 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258666.1 protein_id gnl|my_center|LOCUS_15670 27940 27008 gene locus_tag LOCUS_15680 27940 27008 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258665.1 protein_id gnl|my_center|LOCUS_15680 >Feature sequence039 932 1291 gene locus_tag LOCUS_15690 932 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 1549 2001 gene locus_tag LOCUS_15700 1549 2001 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258944.1 protein_id gnl|my_center|LOCUS_15700 4022 2565 gene locus_tag LOCUS_15710 4022 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 4307 4406 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5022 5954 gene locus_tag LOCUS_15720 5022 5954 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932170.1 protein_id gnl|my_center|LOCUS_15720 6626 6090 gene locus_tag LOCUS_15730 6626 6090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 7373 7092 gene locus_tag LOCUS_15740 7373 7092 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838298.1 protein_id gnl|my_center|LOCUS_15740 7776 7378 gene locus_tag LOCUS_15750 7776 7378 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106968.1 protein_id gnl|my_center|LOCUS_15750 7983 9185 gene locus_tag LOCUS_15760 gene rocD 7983 9185 CDS product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242970.1 protein_id gnl|my_center|LOCUS_15760 9428 12154 gene locus_tag LOCUS_15770 9428 12154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 12383 12562 gene locus_tag LOCUS_15780 12383 12562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 12559 14004 gene locus_tag LOCUS_15790 12559 14004 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093950374.1 protein_id gnl|my_center|LOCUS_15790 14791 14018 gene locus_tag LOCUS_15800 14791 14018 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763940.1 protein_id gnl|my_center|LOCUS_15800 20485 15254 gene locus_tag LOCUS_15810 20485 15254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 20791 21795 gene locus_tag LOCUS_15820 20791 21795 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258874.1 protein_id gnl|my_center|LOCUS_15820 21877 23220 gene locus_tag LOCUS_15830 21877 23220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 23259 24044 gene locus_tag LOCUS_15840 23259 24044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 26278 24041 gene locus_tag LOCUS_15850 26278 24041 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_15850 26415 27446 gene locus_tag LOCUS_15860 26415 27446 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256200.1 protein_id gnl|my_center|LOCUS_15860 27507 28121 gene locus_tag LOCUS_15870 27507 28121 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888340.1 protein_id gnl|my_center|LOCUS_15870 >Feature sequence040 1826 3670 gene locus_tag LOCUS_15880 1826 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 3808 5511 gene locus_tag LOCUS_15890 3808 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 5618 8773 gene locus_tag LOCUS_15900 5618 8773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 8869 9846 gene locus_tag LOCUS_15910 8869 9846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 10274 9843 gene locus_tag LOCUS_15920 10274 9843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 14074 10310 gene locus_tag LOCUS_15930 gene mfd 14074 10310 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258948.1 protein_id gnl|my_center|LOCUS_15930 14706 14071 gene locus_tag LOCUS_15940 gene pth 14706 14071 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257532.1 protein_id gnl|my_center|LOCUS_15940 16685 14703 gene locus_tag LOCUS_15950 16685 14703 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258101.1 protein_id gnl|my_center|LOCUS_15950 17003 18922 gene locus_tag LOCUS_15960 17003 18922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 19161 18976 gene locus_tag LOCUS_15970 19161 18976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 19097 20023 gene locus_tag LOCUS_15980 19097 20023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255955.1 protein_id gnl|my_center|LOCUS_15980 20355 22499 gene locus_tag LOCUS_15990 gene glgP 20355 22499 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256629.1 protein_id gnl|my_center|LOCUS_15990 22641 23021 gene locus_tag LOCUS_16000 22641 23021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 23112 24407 gene locus_tag LOCUS_16010 23112 24407 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867389.1 protein_id gnl|my_center|LOCUS_16010 25184 24438 gene locus_tag LOCUS_16020 25184 24438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 <28399 25299 gene locus_tag LOCUS_16030 <28399 25299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144210.1:type I polyketide synthase >Feature sequence041 93 1649 gene locus_tag LOCUS_16040 gene cimA 93 1649 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583555.1 protein_id gnl|my_center|LOCUS_16040 1689 2192 gene locus_tag LOCUS_16050 1689 2192 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975651.1 protein_id gnl|my_center|LOCUS_16050 2293 2595 gene locus_tag LOCUS_16060 2293 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 2567 2899 gene locus_tag LOCUS_16070 2567 2899 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200901620.1 protein_id gnl|my_center|LOCUS_16070 5239 2921 gene locus_tag LOCUS_16080 5239 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 5680 10515 gene locus_tag LOCUS_16090 5680 10515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 10819 11253 gene locus_tag LOCUS_16100 10819 11253 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268889.1 protein_id gnl|my_center|LOCUS_16100 11463 12344 gene locus_tag LOCUS_16110 11463 12344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 12398 13891 gene locus_tag LOCUS_16120 12398 13891 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257763.1 protein_id gnl|my_center|LOCUS_16120 15611 14007 gene locus_tag LOCUS_16130 gene pckA 15611 14007 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227826.1 protein_id gnl|my_center|LOCUS_16130 15992 16402 gene locus_tag LOCUS_16140 15992 16402 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933012.1 protein_id gnl|my_center|LOCUS_16140 16480 16947 gene locus_tag LOCUS_16150 16480 16947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 18232 17042 gene locus_tag LOCUS_16160 18232 17042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 18392 19351 gene locus_tag LOCUS_16170 18392 19351 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939854.1 protein_id gnl|my_center|LOCUS_16170 19368 20336 gene locus_tag LOCUS_16180 19368 20336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 20867 20433 gene locus_tag LOCUS_16190 20867 20433 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141707.1 protein_id gnl|my_center|LOCUS_16190 21143 20871 gene locus_tag LOCUS_16200 21143 20871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 22293 21211 gene locus_tag LOCUS_16210 22293 21211 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786056.1 protein_id gnl|my_center|LOCUS_16210 23469 22555 gene locus_tag LOCUS_16220 23469 22555 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528958.1 protein_id gnl|my_center|LOCUS_16220 24530 23466 gene locus_tag LOCUS_16230 24530 23466 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969639.1 protein_id gnl|my_center|LOCUS_16230 26056 24527 gene locus_tag LOCUS_16240 26056 24527 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964022.1 protein_id gnl|my_center|LOCUS_16240 27155 26133 gene locus_tag LOCUS_16250 27155 26133 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869312.1 protein_id gnl|my_center|LOCUS_16250 >Feature sequence042 812 45 gene locus_tag LOCUS_16260 812 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 1710 928 gene locus_tag LOCUS_16270 1710 928 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_16270 2993 1851 gene locus_tag LOCUS_16280 2993 1851 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257500.1 protein_id gnl|my_center|LOCUS_16280 4056 2983 gene locus_tag LOCUS_16290 4056 2983 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257499.1 protein_id gnl|my_center|LOCUS_16290 4457 4230 gene locus_tag LOCUS_16300 4457 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 5490 4447 gene locus_tag LOCUS_16310 5490 4447 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583424.1 protein_id gnl|my_center|LOCUS_16310 6495 5530 gene locus_tag LOCUS_16320 6495 5530 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583425.1 protein_id gnl|my_center|LOCUS_16320 7862 6501 gene locus_tag LOCUS_16330 7862 6501 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583426.1 protein_id gnl|my_center|LOCUS_16330 9025 7859 gene locus_tag LOCUS_16340 9025 7859 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583427.1 protein_id gnl|my_center|LOCUS_16340 11762 9162 gene locus_tag LOCUS_16350 11762 9162 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583428.1 protein_id gnl|my_center|LOCUS_16350 12671 12257 gene locus_tag LOCUS_tm00010 12671 12257 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 13840 12761 gene locus_tag LOCUS_16360 gene aksF 13840 12761 CDS product homoisocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875823.1 protein_id gnl|my_center|LOCUS_16360 15104 13899 gene locus_tag LOCUS_16370 15104 13899 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462256.1 protein_id gnl|my_center|LOCUS_16370 15195 16280 gene locus_tag LOCUS_16380 gene cax 15195 16280 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_16380 17369 16332 gene locus_tag LOCUS_16390 17369 16332 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462256.1 protein_id gnl|my_center|LOCUS_16390 17563 18261 gene locus_tag LOCUS_16400 17563 18261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 18317 19333 gene locus_tag LOCUS_16410 gene galE 18317 19333 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_16410 20425 19355 gene locus_tag LOCUS_16420 20425 19355 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 protein_id gnl|my_center|LOCUS_16420 20612 21166 gene locus_tag LOCUS_16430 gene msrA 20612 21166 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_16430 22771 21254 gene locus_tag LOCUS_16440 gene lysS 22771 21254 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257111.1 protein_id gnl|my_center|LOCUS_16440 23338 22853 gene locus_tag LOCUS_16450 gene greA 23338 22853 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129554.1 protein_id gnl|my_center|LOCUS_16450 24908 23442 gene locus_tag LOCUS_16460 24908 23442 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527508.1 protein_id gnl|my_center|LOCUS_16460 26482 25139 gene locus_tag LOCUS_16470 26482 25139 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256439.1 protein_id gnl|my_center|LOCUS_16470 27525 26479 gene locus_tag LOCUS_16480 27525 26479 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256438.1 protein_id gnl|my_center|LOCUS_16480 >Feature sequence043 1970 939 gene locus_tag LOCUS_16490 gene rfbB 1970 939 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258175.1 protein_id gnl|my_center|LOCUS_16490 3035 2193 gene locus_tag LOCUS_16500 gene nudC 3035 2193 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021453.1 protein_id gnl|my_center|LOCUS_16500 4022 3045 gene locus_tag LOCUS_16510 4022 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 5953 4046 gene locus_tag LOCUS_16520 5953 4046 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259247.1 protein_id gnl|my_center|LOCUS_16520 6882 5956 gene locus_tag LOCUS_16530 6882 5956 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427744.1 protein_id gnl|my_center|LOCUS_16530 7899 6892 gene locus_tag LOCUS_16540 7899 6892 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259250.1 protein_id gnl|my_center|LOCUS_16540 9591 7951 gene locus_tag LOCUS_16550 gene abc-f 9591 7951 CDS product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602057.1 protein_id gnl|my_center|LOCUS_16550 9839 11173 gene locus_tag LOCUS_16560 9839 11173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 11625 11104 gene locus_tag LOCUS_16570 gene hycI 11625 11104 CDS product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098461.1 protein_id gnl|my_center|LOCUS_16570 12016 11612 gene locus_tag LOCUS_16580 12016 11612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 12981 12028 gene locus_tag LOCUS_16590 12981 12028 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939562.1 protein_id gnl|my_center|LOCUS_16590 14216 12993 gene locus_tag LOCUS_16600 14216 12993 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937737.1 protein_id gnl|my_center|LOCUS_16600 14688 14224 gene locus_tag LOCUS_16610 14688 14224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16610 15229 14657 gene locus_tag LOCUS_16620 15229 14657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 15646 15299 gene locus_tag LOCUS_16630 15646 15299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 17219 15666 gene locus_tag LOCUS_16640 17219 15666 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251037.1 protein_id gnl|my_center|LOCUS_16640 18900 17221 gene locus_tag LOCUS_16650 18900 17221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 19377 19072 gene locus_tag LOCUS_16660 19377 19072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 19877 19374 gene locus_tag LOCUS_16670 19877 19374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 21289 19976 gene locus_tag LOCUS_16680 21289 19976 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257201.1 protein_id gnl|my_center|LOCUS_16680 22304 21303 gene locus_tag LOCUS_16690 22304 21303 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533209.1 protein_id gnl|my_center|LOCUS_16690 22495 23166 gene locus_tag LOCUS_16700 22495 23166 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259190.1 protein_id gnl|my_center|LOCUS_16700 23257 24696 gene locus_tag LOCUS_16710 23257 24696 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257475.1 protein_id gnl|my_center|LOCUS_16710 26545 24698 gene locus_tag LOCUS_16720 26545 24698 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065671.1 protein_id gnl|my_center|LOCUS_16720 26695 27348 gene locus_tag LOCUS_16730 gene folE 26695 27348 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258500.1 protein_id gnl|my_center|LOCUS_16730 >Feature sequence044 3405 2320 gene locus_tag LOCUS_16740 3405 2320 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426511.1 protein_id gnl|my_center|LOCUS_16740 4539 3415 gene locus_tag LOCUS_16750 gene dprA 4539 3415 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259053.1 protein_id gnl|my_center|LOCUS_16750 5222 4608 gene locus_tag LOCUS_16760 gene rimM 5222 4608 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813199.1 protein_id gnl|my_center|LOCUS_16760 5454 5209 gene locus_tag LOCUS_16770 5454 5209 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941305.1 protein_id gnl|my_center|LOCUS_16770 6105 5461 gene locus_tag LOCUS_16780 6105 5461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 7503 6166 gene locus_tag LOCUS_16790 gene ffh 7503 6166 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257918.1 protein_id gnl|my_center|LOCUS_16790 8935 7655 gene locus_tag LOCUS_16800 gene metK 8935 7655 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947992.1 protein_id gnl|my_center|LOCUS_16800 10032 9241 gene locus_tag LOCUS_16810 10032 9241 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941673.1 protein_id gnl|my_center|LOCUS_16810 10316 11290 gene locus_tag LOCUS_16820 10316 11290 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436783.1 protein_id gnl|my_center|LOCUS_16820 11311 11850 gene locus_tag LOCUS_16830 gene rfbC 11311 11850 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870350.1 protein_id gnl|my_center|LOCUS_16830 12253 11852 gene locus_tag LOCUS_16840 12253 11852 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256528.1 protein_id gnl|my_center|LOCUS_16840 12725 12243 gene locus_tag LOCUS_16850 gene ybeY 12725 12243 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392132.1 protein_id gnl|my_center|LOCUS_16850 14926 12746 gene locus_tag LOCUS_16860 14926 12746 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392131.1 protein_id gnl|my_center|LOCUS_16860 15430 14987 gene locus_tag LOCUS_16870 15430 14987 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430905.1 protein_id gnl|my_center|LOCUS_16870 16240 15479 gene locus_tag LOCUS_16880 16240 15479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 16951 16271 gene locus_tag LOCUS_16890 16951 16271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 17567 16929 gene locus_tag LOCUS_16900 17567 16929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 17793 17632 gene locus_tag LOCUS_16910 17793 17632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 18439 17876 gene locus_tag LOCUS_16920 18439 17876 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_16920 20060 18459 gene locus_tag LOCUS_16930 20060 18459 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257530.1 protein_id gnl|my_center|LOCUS_16930 21100 20057 gene locus_tag LOCUS_16940 21100 20057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 21912 21097 gene locus_tag LOCUS_16950 21912 21097 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256891.1 protein_id gnl|my_center|LOCUS_16950 22655 21909 gene locus_tag LOCUS_16960 22655 21909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 23720 22674 gene locus_tag LOCUS_16970 23720 22674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 24898 24323 gene locus_tag LOCUS_16980 24898 24323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 26454 24901 gene locus_tag LOCUS_16990 gene gpmI 26454 24901 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943825.1 protein_id gnl|my_center|LOCUS_16990 26619 26546 gene locus_tag LOCUS_t00280 26619 26546 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 26768 27436 gene locus_tag LOCUS_17000 26768 27436 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227881.1 protein_id gnl|my_center|LOCUS_17000 >Feature sequence045 341 1423 gene locus_tag LOCUS_17010 341 1423 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259167.1 protein_id gnl|my_center|LOCUS_17010 1466 3523 gene locus_tag LOCUS_17020 1466 3523 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223224.1 protein_id gnl|my_center|LOCUS_17020 3677 3949 gene locus_tag LOCUS_17030 3677 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 3946 4386 gene locus_tag LOCUS_17040 3946 4386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 4426 5730 gene locus_tag LOCUS_17050 gene mtaB 4426 5730 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_17050 6461 5826 gene locus_tag LOCUS_17060 6461 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 6687 6394 gene locus_tag LOCUS_17070 6687 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 6783 8588 gene locus_tag LOCUS_17080 6783 8588 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257645.1 protein_id gnl|my_center|LOCUS_17080 8589 10517 gene locus_tag LOCUS_17090 8589 10517 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257644.1 protein_id gnl|my_center|LOCUS_17090 11252 10605 gene locus_tag LOCUS_17100 11252 10605 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222893.1 protein_id gnl|my_center|LOCUS_17100 13420 11249 gene locus_tag LOCUS_17110 13420 11249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 13979 13389 gene locus_tag LOCUS_17120 13979 13389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 15426 14020 gene locus_tag LOCUS_17130 15426 14020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 16469 15474 gene locus_tag LOCUS_17140 16469 15474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 16852 18126 gene locus_tag LOCUS_17150 16852 18126 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921052.1 protein_id gnl|my_center|LOCUS_17150 18483 18040 gene locus_tag LOCUS_17160 18483 18040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 18712 19662 gene locus_tag LOCUS_17170 gene cofD 18712 19662 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_17170 20784 19699 gene locus_tag LOCUS_17180 20784 19699 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944494.1 protein_id gnl|my_center|LOCUS_17180 21012 22181 gene locus_tag LOCUS_17190 21012 22181 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_17190 22178 23605 gene locus_tag LOCUS_17200 22178 23605 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_17200 24069 23647 gene locus_tag LOCUS_17210 24069 23647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 24446 25507 gene locus_tag LOCUS_17220 24446 25507 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301207.1 protein_id gnl|my_center|LOCUS_17220 25542 26396 gene locus_tag LOCUS_17230 gene mreC 25542 26396 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461822.1 protein_id gnl|my_center|LOCUS_17230 26399 26908 gene locus_tag LOCUS_17240 26399 26908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 >Feature sequence046 747 1457 gene locus_tag LOCUS_17250 747 1457 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404773.1 protein_id gnl|my_center|LOCUS_17250 1463 2386 gene locus_tag LOCUS_17260 1463 2386 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671643.1 protein_id gnl|my_center|LOCUS_17260 2498 3319 gene locus_tag LOCUS_17270 2498 3319 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_17270 3300 4442 gene locus_tag LOCUS_17280 3300 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 4439 5545 gene locus_tag LOCUS_17290 4439 5545 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256103.1 protein_id gnl|my_center|LOCUS_17290 5666 6640 gene locus_tag LOCUS_17300 5666 6640 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015940983.1 protein_id gnl|my_center|LOCUS_17300 6637 7206 gene locus_tag LOCUS_17310 6637 7206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 7223 7903 gene locus_tag LOCUS_17320 gene rpe 7223 7903 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837854.1 protein_id gnl|my_center|LOCUS_17320 8313 9176 gene locus_tag LOCUS_17330 8313 9176 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525194.1 protein_id gnl|my_center|LOCUS_17330 9263 10135 gene locus_tag LOCUS_17340 9263 10135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 10132 10905 gene locus_tag LOCUS_17350 10132 10905 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616938.1 protein_id gnl|my_center|LOCUS_17350 11480 10956 gene locus_tag LOCUS_17360 11480 10956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 12882 11656 gene locus_tag LOCUS_17370 12882 11656 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256547.1 protein_id gnl|my_center|LOCUS_17370 13768 12887 gene locus_tag LOCUS_17380 13768 12887 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548260.1 protein_id gnl|my_center|LOCUS_17380 13940 14464 gene locus_tag LOCUS_17390 13940 14464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140870.1 protein_id gnl|my_center|LOCUS_17390 14907 14503 gene locus_tag LOCUS_17400 14907 14503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 17948 14907 gene locus_tag LOCUS_17410 17948 14907 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665250.1 protein_id gnl|my_center|LOCUS_17410 18186 18881 gene locus_tag LOCUS_17420 18186 18881 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257634.1 protein_id gnl|my_center|LOCUS_17420 18969 21791 gene locus_tag LOCUS_17430 18969 21791 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392653.1 protein_id gnl|my_center|LOCUS_17430 21901 22596 gene locus_tag LOCUS_17440 21901 22596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 23482 22619 gene locus_tag LOCUS_17450 23482 22619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 23789 23493 gene locus_tag LOCUS_17460 23789 23493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 23941 24963 gene locus_tag LOCUS_17470 23941 24963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 24960 25961 gene locus_tag LOCUS_17480 24960 25961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 26800 25958 gene locus_tag LOCUS_17490 26800 25958 CDS product AAC(3) family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783346.1 protein_id gnl|my_center|LOCUS_17490 >Feature sequence047 894 2762 gene locus_tag LOCUS_17500 894 2762 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367409.1 protein_id gnl|my_center|LOCUS_17500 2764 3471 gene locus_tag LOCUS_17510 gene rsmG 2764 3471 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258170.1 protein_id gnl|my_center|LOCUS_17510 4766 3468 gene locus_tag LOCUS_17520 gene recF 4766 3468 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259706.1 protein_id gnl|my_center|LOCUS_17520 4955 6565 gene locus_tag LOCUS_17530 4955 6565 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257229.1 protein_id gnl|my_center|LOCUS_17530 6628 7515 gene locus_tag LOCUS_17540 gene lgt 6628 7515 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257228.1 protein_id gnl|my_center|LOCUS_17540 7570 9072 gene locus_tag LOCUS_17550 gene guaB 7570 9072 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881325.1 protein_id gnl|my_center|LOCUS_17550 9144 10040 gene locus_tag LOCUS_17560 gene rarD 9144 10040 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256111.1 protein_id gnl|my_center|LOCUS_17560 10106 11536 gene locus_tag LOCUS_17570 gene purB 10106 11536 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438353.1 protein_id gnl|my_center|LOCUS_17570 12530 11601 gene locus_tag LOCUS_17580 12530 11601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173196.1 protein_id gnl|my_center|LOCUS_17580 13990 12596 gene locus_tag LOCUS_17590 13990 12596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 14166 15548 gene locus_tag LOCUS_17600 14166 15548 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_17600 15545 17962 gene locus_tag LOCUS_17610 15545 17962 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257474.1 protein_id gnl|my_center|LOCUS_17610 19268 17985 gene locus_tag LOCUS_17620 19268 17985 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479723.1 protein_id gnl|my_center|LOCUS_17620 19472 20137 gene locus_tag LOCUS_17630 19472 20137 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_17630 21703 20150 gene locus_tag LOCUS_17640 gene hutH 21703 20150 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256862.1 protein_id gnl|my_center|LOCUS_17640 21764 22786 gene locus_tag LOCUS_17650 gene holB 21764 22786 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257799.1 protein_id gnl|my_center|LOCUS_17650 22804 23622 gene locus_tag LOCUS_17660 22804 23622 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257802.1 protein_id gnl|my_center|LOCUS_17660 23640 25427 gene locus_tag LOCUS_17670 23640 25427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 25566 26279 gene locus_tag LOCUS_17680 25566 26279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 26439 26948 gene locus_tag LOCUS_17690 26439 26948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 >Feature sequence048 295 62 gene locus_tag LOCUS_17700 295 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 224 847 gene locus_tag LOCUS_17710 224 847 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258485.1 protein_id gnl|my_center|LOCUS_17710 890 1054 gene locus_tag LOCUS_17720 890 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 1105 1410 gene locus_tag LOCUS_17730 1105 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 1668 2147 gene locus_tag LOCUS_17740 1668 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 2257 2814 gene locus_tag LOCUS_17750 gene raiA 2257 2814 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671190.1 protein_id gnl|my_center|LOCUS_17750 2828 3319 gene locus_tag LOCUS_17760 2828 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 3863 3402 gene locus_tag LOCUS_17770 3863 3402 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583256.1 protein_id gnl|my_center|LOCUS_17770 4126 5310 gene locus_tag LOCUS_17780 4126 5310 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870375.1 protein_id gnl|my_center|LOCUS_17780 6709 5300 gene locus_tag LOCUS_17790 6709 5300 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_17790 7929 6751 gene locus_tag LOCUS_17800 7929 6751 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 protein_id gnl|my_center|LOCUS_17800 8887 7922 gene locus_tag LOCUS_17810 8887 7922 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259096.1 protein_id gnl|my_center|LOCUS_17810 10644 8884 gene locus_tag LOCUS_17820 gene recJ 10644 8884 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257020.1 protein_id gnl|my_center|LOCUS_17820 10804 11709 gene locus_tag LOCUS_17830 10804 11709 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048320.1 protein_id gnl|my_center|LOCUS_17830 11979 12218 gene locus_tag LOCUS_17840 11979 12218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 12247 12789 gene locus_tag LOCUS_17850 gene cas4 12247 12789 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259413.1 protein_id gnl|my_center|LOCUS_17850 12933 14210 gene locus_tag LOCUS_17860 gene hisS 12933 14210 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393179.1 protein_id gnl|my_center|LOCUS_17860 14272 15141 gene locus_tag LOCUS_17870 14272 15141 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256954.1 protein_id gnl|my_center|LOCUS_17870 15228 16121 gene locus_tag LOCUS_17880 15228 16121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 16135 17919 gene locus_tag LOCUS_17890 gene recN 16135 17919 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256506.1 protein_id gnl|my_center|LOCUS_17890 17923 19347 gene locus_tag LOCUS_17900 17923 19347 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256942.1 protein_id gnl|my_center|LOCUS_17900 19501 20655 gene locus_tag LOCUS_17910 gene hrcA 19501 20655 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257942.1 protein_id gnl|my_center|LOCUS_17910 20630 21187 gene locus_tag LOCUS_17920 gene grpE 20630 21187 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257941.1 protein_id gnl|my_center|LOCUS_17920 21220 23127 gene locus_tag LOCUS_17930 gene dnaK 21220 23127 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257940.1 protein_id gnl|my_center|LOCUS_17930 23190 24350 gene locus_tag LOCUS_17940 gene dnaJ 23190 24350 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257939.1 protein_id gnl|my_center|LOCUS_17940 24355 25278 gene locus_tag LOCUS_17950 24355 25278 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257710.1 protein_id gnl|my_center|LOCUS_17950 25588 25343 gene locus_tag LOCUS_17960 gene infA 25588 25343 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284370.1 protein_id gnl|my_center|LOCUS_17960 <27121 25605 gene locus_tag LOCUS_17970 <27121 25605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258702.1:S1 RNA-binding domain-containing protein >Feature sequence049 288 2318 gene locus_tag LOCUS_17980 288 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 2448 4718 gene locus_tag LOCUS_17990 gene secD 2448 4718 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172795.1 protein_id gnl|my_center|LOCUS_17990 4729 5730 gene locus_tag LOCUS_18000 4729 5730 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_18000 7068 5749 gene locus_tag LOCUS_18010 7068 5749 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810594.1 protein_id gnl|my_center|LOCUS_18010 7945 7175 gene locus_tag LOCUS_18020 7945 7175 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035619.1 protein_id gnl|my_center|LOCUS_18020 8864 7950 gene locus_tag LOCUS_18030 8864 7950 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768681.1 protein_id gnl|my_center|LOCUS_18030 10572 9016 gene locus_tag LOCUS_18040 gene pruA 10572 9016 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234655.1 protein_id gnl|my_center|LOCUS_18040 13018 10955 gene locus_tag LOCUS_18050 13018 10955 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396305.1 protein_id gnl|my_center|LOCUS_18050 13406 18289 gene locus_tag LOCUS_18060 13406 18289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 22403 18360 gene locus_tag LOCUS_18070 22403 18360 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257283.1 protein_id gnl|my_center|LOCUS_18070 22711 22517 gene locus_tag LOCUS_18080 22711 22517 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767912.1 protein_id gnl|my_center|LOCUS_18080 23104 23343 gene locus_tag LOCUS_18090 gene acpP 23104 23343 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154310.1 protein_id gnl|my_center|LOCUS_18090 24049 23414 gene locus_tag LOCUS_18100 24049 23414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 24555 24046 gene locus_tag LOCUS_18110 24555 24046 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937470.1 protein_id gnl|my_center|LOCUS_18110 25306 24521 gene locus_tag LOCUS_18120 gene trmD 25306 24521 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686903.1 protein_id gnl|my_center|LOCUS_18120 26244 25363 gene locus_tag LOCUS_18130 26244 25363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 >Feature sequence050 1192 506 gene locus_tag LOCUS_18140 gene phoU 1192 506 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722627.1 protein_id gnl|my_center|LOCUS_18140 2133 1303 gene locus_tag LOCUS_18150 gene pstB 2133 1303 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_18150 3569 2130 gene locus_tag LOCUS_18160 3569 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 4546 3566 gene locus_tag LOCUS_18170 gene pstC 4546 3566 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256174.1 protein_id gnl|my_center|LOCUS_18170 5725 4670 gene locus_tag LOCUS_18180 5725 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 6913 5915 gene locus_tag LOCUS_18190 6913 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 8404 6980 gene locus_tag LOCUS_18200 8404 6980 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393971.1 protein_id gnl|my_center|LOCUS_18200 9151 8420 gene locus_tag LOCUS_18210 9151 8420 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_18210 9329 12121 gene locus_tag LOCUS_18220 gene ppc 9329 12121 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259010.1 protein_id gnl|my_center|LOCUS_18220 14009 12171 gene locus_tag LOCUS_18230 14009 12171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 14075 15976 gene locus_tag LOCUS_18240 14075 15976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 15991 17439 gene locus_tag LOCUS_18250 15991 17439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 18540 17449 gene locus_tag LOCUS_18260 18540 17449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 20312 18585 gene locus_tag LOCUS_18270 20312 18585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 20962 20324 gene locus_tag LOCUS_18280 20962 20324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 21035 21397 gene locus_tag LOCUS_18290 21035 21397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 21456 22268 gene locus_tag LOCUS_18300 gene mutM 21456 22268 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_18300 26231 22281 gene locus_tag LOCUS_18310 26231 22281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 >Feature sequence051 2218 566 gene locus_tag LOCUS_18320 2218 566 CDS product aspartate:alanine exchanger family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258651.1 protein_id gnl|my_center|LOCUS_18320 2304 2735 gene locus_tag LOCUS_18330 2304 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 2842 4188 gene locus_tag LOCUS_18340 2842 4188 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886935.1 protein_id gnl|my_center|LOCUS_18340 4675 4277 gene locus_tag LOCUS_18350 4675 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 5231 4701 gene locus_tag LOCUS_18360 5231 4701 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036503.1 protein_id gnl|my_center|LOCUS_18360 5952 5527 gene locus_tag LOCUS_18370 5952 5527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 7857 6133 gene locus_tag LOCUS_18380 7857 6133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 8617 7847 gene locus_tag LOCUS_18390 8617 7847 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_18390 8804 9289 gene locus_tag LOCUS_18400 8804 9289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 9393 9854 gene locus_tag LOCUS_18410 9393 9854 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141820.1 protein_id gnl|my_center|LOCUS_18410 9894 10547 gene locus_tag LOCUS_18420 9894 10547 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049924277.1 protein_id gnl|my_center|LOCUS_18420 11030 10569 gene locus_tag LOCUS_18430 11030 10569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 11875 11195 gene locus_tag LOCUS_18440 11875 11195 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_18440 13349 11841 gene locus_tag LOCUS_18450 13349 11841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 15533 13698 gene locus_tag LOCUS_18460 15533 13698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 16045 15722 gene locus_tag LOCUS_18470 16045 15722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 16810 16319 gene locus_tag LOCUS_18480 16810 16319 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537140.1 protein_id gnl|my_center|LOCUS_18480 17378 16818 gene locus_tag LOCUS_18490 17378 16818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 19144 17681 gene locus_tag LOCUS_18500 19144 17681 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210798.1 protein_id gnl|my_center|LOCUS_18500 19288 19767 gene locus_tag LOCUS_18510 19288 19767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 21472 19832 gene locus_tag LOCUS_18520 21472 19832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 >Feature sequence052 1824 577 gene locus_tag LOCUS_18530 1824 577 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257673.1 protein_id gnl|my_center|LOCUS_18530 2054 2821 gene locus_tag LOCUS_18540 2054 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 2974 4155 gene locus_tag LOCUS_18550 2974 4155 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393538.1 protein_id gnl|my_center|LOCUS_18550 4372 5043 gene locus_tag LOCUS_18560 4372 5043 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259017.1 protein_id gnl|my_center|LOCUS_18560 5225 5872 gene locus_tag LOCUS_18570 5225 5872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 5869 6261 gene locus_tag LOCUS_18580 5869 6261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 6276 8516 gene locus_tag LOCUS_18590 gene feoB 6276 8516 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943880.1 protein_id gnl|my_center|LOCUS_18590 8519 8818 gene locus_tag LOCUS_18600 8519 8818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 8818 9666 gene locus_tag LOCUS_18610 8818 9666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 11039 9663 gene locus_tag LOCUS_18620 gene argH 11039 9663 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259187.1 protein_id gnl|my_center|LOCUS_18620 12293 11067 gene locus_tag LOCUS_18630 gene argJ 12293 11067 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259189.1 protein_id gnl|my_center|LOCUS_18630 14177 12360 gene locus_tag LOCUS_18640 14177 12360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 14336 14263 gene locus_tag LOCUS_t00290 14336 14263 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 14783 14451 gene locus_tag LOCUS_18650 14783 14451 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886888.1 protein_id gnl|my_center|LOCUS_18650 15189 16475 gene locus_tag LOCUS_18660 15189 16475 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941843.1 protein_id gnl|my_center|LOCUS_18660 16565 17716 gene locus_tag LOCUS_18670 16565 17716 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391014.1 protein_id gnl|my_center|LOCUS_18670 17713 18369 gene locus_tag LOCUS_18680 gene metW 17713 18369 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529385.1 protein_id gnl|my_center|LOCUS_18680 18477 19352 gene locus_tag LOCUS_18690 gene hslO 18477 19352 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943960.1 protein_id gnl|my_center|LOCUS_18690 19490 19416 gene locus_tag LOCUS_t00300 19490 19416 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 20368 19577 gene locus_tag LOCUS_18700 20368 19577 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660412.1 protein_id gnl|my_center|LOCUS_18700 21310 20390 gene locus_tag LOCUS_18710 21310 20390 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256181.1 protein_id gnl|my_center|LOCUS_18710 21491 24181 gene locus_tag LOCUS_18720 21491 24181 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076003404.1 protein_id gnl|my_center|LOCUS_18720 >Feature sequence053 584 273 gene locus_tag LOCUS_18730 584 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 976 665 gene locus_tag LOCUS_18740 976 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 1477 1911 gene locus_tag LOCUS_18750 1477 1911 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528627.1 protein_id gnl|my_center|LOCUS_18750 2860 1934 gene locus_tag LOCUS_18760 2860 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 3366 2974 gene locus_tag LOCUS_18770 3366 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 4105 3455 gene locus_tag LOCUS_18780 4105 3455 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257688.1 protein_id gnl|my_center|LOCUS_18780 4307 5443 gene locus_tag LOCUS_18790 gene ychF 4307 5443 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256516.1 protein_id gnl|my_center|LOCUS_18790 5511 6554 gene locus_tag LOCUS_18800 5511 6554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 6887 6582 gene locus_tag LOCUS_18810 6887 6582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 7135 6869 gene locus_tag LOCUS_18820 7135 6869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 8042 7230 gene locus_tag LOCUS_18830 8042 7230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 8806 8063 gene locus_tag LOCUS_18840 8806 8063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 9453 8803 gene locus_tag LOCUS_18850 9453 8803 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228871.1 protein_id gnl|my_center|LOCUS_18850 10573 9464 gene locus_tag LOCUS_18860 10573 9464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 11657 10671 gene locus_tag LOCUS_18870 11657 10671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 12415 11714 gene locus_tag LOCUS_18880 12415 11714 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887052.1 protein_id gnl|my_center|LOCUS_18880 13113 12412 gene locus_tag LOCUS_18890 13113 12412 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_18890 13533 13156 gene locus_tag LOCUS_18900 13533 13156 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762871.1 protein_id gnl|my_center|LOCUS_18900 15303 13612 gene locus_tag LOCUS_18910 15303 13612 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257261.1 protein_id gnl|my_center|LOCUS_18910 15707 15375 gene locus_tag LOCUS_18920 15707 15375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 16079 15723 gene locus_tag LOCUS_18930 16079 15723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 17815 16112 gene locus_tag LOCUS_18940 17815 16112 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090623.1 protein_id gnl|my_center|LOCUS_18940 19020 17851 gene locus_tag LOCUS_18950 19020 17851 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082450.1 protein_id gnl|my_center|LOCUS_18950 19967 19041 gene locus_tag LOCUS_18960 19967 19041 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125119.1 protein_id gnl|my_center|LOCUS_18960 20525 20076 gene locus_tag LOCUS_18970 20525 20076 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630611.1 protein_id gnl|my_center|LOCUS_18970 22594 20522 gene locus_tag LOCUS_18980 22594 20522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 22748 23896 gene locus_tag LOCUS_18990 22748 23896 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403232.1 protein_id gnl|my_center|LOCUS_18990 >Feature sequence054 142 672 gene locus_tag LOCUS_19000 142 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 1244 1528 gene locus_tag LOCUS_19010 1244 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 1525 2097 gene locus_tag LOCUS_19020 1525 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 2110 2727 gene locus_tag LOCUS_19030 2110 2727 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037459.1 protein_id gnl|my_center|LOCUS_19030 2760 3233 gene locus_tag LOCUS_19040 2760 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 3285 3890 gene locus_tag LOCUS_19050 3285 3890 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064817.1 protein_id gnl|my_center|LOCUS_19050 4378 3962 gene locus_tag LOCUS_19060 4378 3962 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704723.1 protein_id gnl|my_center|LOCUS_19060 4841 4431 gene locus_tag LOCUS_19070 4841 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 5047 6012 gene locus_tag LOCUS_19080 5047 6012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 6093 6731 gene locus_tag LOCUS_19090 6093 6731 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259489.1 protein_id gnl|my_center|LOCUS_19090 6731 7570 gene locus_tag LOCUS_19100 6731 7570 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057477.1 protein_id gnl|my_center|LOCUS_19100 7735 8016 gene locus_tag LOCUS_19110 7735 8016 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_19110 7994 8209 gene locus_tag LOCUS_19120 7994 8209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 8901 8314 gene locus_tag LOCUS_19130 8901 8314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 10024 9008 gene locus_tag LOCUS_19140 10024 9008 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258891.1 protein_id gnl|my_center|LOCUS_19140 10655 10188 gene locus_tag LOCUS_19150 10655 10188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 12140 10746 gene locus_tag LOCUS_19160 gene atpD 12140 10746 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815475.1 protein_id gnl|my_center|LOCUS_19160 13137 12229 gene locus_tag LOCUS_19170 13137 12229 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258894.1 protein_id gnl|my_center|LOCUS_19170 14887 13211 gene locus_tag LOCUS_19180 gene atpA 14887 13211 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933688.1 protein_id gnl|my_center|LOCUS_19180 16093 15029 gene locus_tag LOCUS_19190 16093 15029 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583847.1 protein_id gnl|my_center|LOCUS_19190 16872 17126 gene locus_tag LOCUS_19200 16872 17126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 17152 17658 gene locus_tag LOCUS_19210 17152 17658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 17753 21298 gene locus_tag LOCUS_19220 17753 21298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 >Feature sequence055 1367 174 gene locus_tag LOCUS_19230 1367 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 1486 4137 gene locus_tag LOCUS_19240 1486 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 4759 5217 gene locus_tag LOCUS_19250 4759 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 5228 6103 gene locus_tag LOCUS_19260 5228 6103 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080738.1 protein_id gnl|my_center|LOCUS_19260 6366 6581 gene locus_tag LOCUS_19270 6366 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 10742 6753 gene locus_tag LOCUS_19280 10742 6753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 11257 11751 gene locus_tag LOCUS_19290 11257 11751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 13149 11746 gene locus_tag LOCUS_19300 13149 11746 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225764.1 protein_id gnl|my_center|LOCUS_19300 13355 15259 gene locus_tag LOCUS_19310 gene acs 13355 15259 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255917.1 protein_id gnl|my_center|LOCUS_19310 15437 16609 gene locus_tag LOCUS_19320 15437 16609 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940010.1 protein_id gnl|my_center|LOCUS_19320 16699 17631 gene locus_tag LOCUS_19330 16699 17631 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940009.1 protein_id gnl|my_center|LOCUS_19330 17635 18669 gene locus_tag LOCUS_19340 17635 18669 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940008.1 protein_id gnl|my_center|LOCUS_19340 18666 19481 gene locus_tag LOCUS_19350 18666 19481 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940007.1 protein_id gnl|my_center|LOCUS_19350 19498 20226 gene locus_tag LOCUS_19360 19498 20226 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940006.1 protein_id gnl|my_center|LOCUS_19360 20709 20969 gene locus_tag LOCUS_19370 20709 20969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 22374 21199 gene locus_tag LOCUS_19380 22374 21199 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102228.1 protein_id gnl|my_center|LOCUS_19380 >Feature sequence056 132 1142 gene locus_tag LOCUS_19390 132 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 1462 3066 gene locus_tag LOCUS_19400 gene treS 1462 3066 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888668.1 protein_id gnl|my_center|LOCUS_19400 3179 4087 gene locus_tag LOCUS_19410 3179 4087 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256476.1 protein_id gnl|my_center|LOCUS_19410 4155 5117 gene locus_tag LOCUS_19420 gene mmuM 4155 5117 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246467.1 protein_id gnl|my_center|LOCUS_19420 5131 6024 gene locus_tag LOCUS_19430 5131 6024 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294680.1 protein_id gnl|my_center|LOCUS_19430 6639 6031 gene locus_tag LOCUS_19440 6639 6031 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272276.1 protein_id gnl|my_center|LOCUS_19440 7564 6764 gene locus_tag LOCUS_19450 7564 6764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 8474 7593 gene locus_tag LOCUS_19460 8474 7593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 8641 11319 gene locus_tag LOCUS_19470 8641 11319 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081021.1 protein_id gnl|my_center|LOCUS_19470 13670 11334 gene locus_tag LOCUS_19480 13670 11334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 16029 13678 gene locus_tag LOCUS_19490 16029 13678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 16192 16539 gene locus_tag LOCUS_19500 gene hinT 16192 16539 CDS product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532068.1 protein_id gnl|my_center|LOCUS_19500 18129 16558 gene locus_tag LOCUS_19510 18129 16558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 19293 18295 gene locus_tag LOCUS_19520 19293 18295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 19552 20256 gene locus_tag LOCUS_19530 gene fadR 19552 20256 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706276.1 protein_id gnl|my_center|LOCUS_19530 >Feature sequence057 2300 222 gene locus_tag LOCUS_19540 gene fusA 2300 222 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_19540 2778 2308 gene locus_tag LOCUS_19550 gene rpsG 2778 2308 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008875664.1 protein_id gnl|my_center|LOCUS_19550 3256 2834 gene locus_tag LOCUS_19560 gene rpsL 3256 2834 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258226.1 protein_id gnl|my_center|LOCUS_19560 7622 3687 gene locus_tag LOCUS_19570 7622 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 8995 7799 gene locus_tag LOCUS_19580 8995 7799 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259083.1 protein_id gnl|my_center|LOCUS_19580 10086 9097 gene locus_tag LOCUS_19590 10086 9097 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258376.1 protein_id gnl|my_center|LOCUS_19590 10626 10099 gene locus_tag LOCUS_19600 10626 10099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 11257 10619 gene locus_tag LOCUS_19610 11257 10619 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811062.1 protein_id gnl|my_center|LOCUS_19610 12426 11344 gene locus_tag LOCUS_19620 12426 11344 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804129.1 protein_id gnl|my_center|LOCUS_19620 14149 12431 gene locus_tag LOCUS_19630 14149 12431 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487169.1 protein_id gnl|my_center|LOCUS_19630 15201 14149 gene locus_tag LOCUS_19640 15201 14149 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228931.1 protein_id gnl|my_center|LOCUS_19640 15456 15530 gene locus_tag LOCUS_t00310 15456 15530 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 15917 17425 gene locus_tag LOCUS_19650 15917 17425 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_19650 17878 17489 gene locus_tag LOCUS_19660 17878 17489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 19396 17963 gene locus_tag LOCUS_19670 19396 17963 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883976.1 protein_id gnl|my_center|LOCUS_19670 20753 19389 gene locus_tag LOCUS_19680 20753 19389 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883977.1 protein_id gnl|my_center|LOCUS_19680 >Feature sequence058 1683 2774 gene locus_tag LOCUS_19690 1683 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 2803 4209 gene locus_tag LOCUS_19700 gene pyk 2803 4209 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584142.1 protein_id gnl|my_center|LOCUS_19700 4228 4962 gene locus_tag LOCUS_19710 4228 4962 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256704.1 protein_id gnl|my_center|LOCUS_19710 5014 5925 gene locus_tag LOCUS_19720 5014 5925 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_19720 6470 6664 gene locus_tag LOCUS_19730 6470 6664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 6860 7057 gene locus_tag LOCUS_19740 6860 7057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 8207 7167 gene locus_tag LOCUS_19750 gene nirK 8207 7167 CDS product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257443.1 protein_id gnl|my_center|LOCUS_19750 8631 8707 gene locus_tag LOCUS_t00320 8631 8707 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8877 9536 gene locus_tag LOCUS_19760 8877 9536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 9609 11294 gene locus_tag LOCUS_19770 9609 11294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 11378 12229 gene locus_tag LOCUS_19780 11378 12229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 13317 12379 gene locus_tag LOCUS_19790 13317 12379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 13679 13380 gene locus_tag LOCUS_19800 13679 13380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 13791 14393 gene locus_tag LOCUS_19810 13791 14393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 16698 14434 gene locus_tag LOCUS_19820 16698 14434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 16813 19041 gene locus_tag LOCUS_19830 16813 19041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 19099 20208 gene locus_tag LOCUS_19840 19099 20208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 >Feature sequence059 1218 2252 gene locus_tag LOCUS_19850 1218 2252 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256249.1 protein_id gnl|my_center|LOCUS_19850 2399 4969 gene locus_tag LOCUS_19860 2399 4969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 5042 5491 gene locus_tag LOCUS_19870 gene ndk 5042 5491 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_19870 5943 5578 gene locus_tag LOCUS_19880 gene rsfS 5943 5578 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257176.1 protein_id gnl|my_center|LOCUS_19880 6054 7277 gene locus_tag LOCUS_19890 gene xseA 6054 7277 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815788.1 protein_id gnl|my_center|LOCUS_19890 8789 7287 gene locus_tag LOCUS_19900 8789 7287 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259226.1 protein_id gnl|my_center|LOCUS_19900 8908 9366 gene locus_tag LOCUS_19910 8908 9366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 10357 9389 gene locus_tag LOCUS_19920 10357 9389 CDS product fructose-bisphosphatase class II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257119.1 protein_id gnl|my_center|LOCUS_19920 12571 10364 gene locus_tag LOCUS_19930 12571 10364 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257118.1 protein_id gnl|my_center|LOCUS_19930 13315 12686 gene locus_tag LOCUS_19940 13315 12686 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259716.1 protein_id gnl|my_center|LOCUS_19940 13617 13312 gene locus_tag LOCUS_19950 13617 13312 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259720.1 protein_id gnl|my_center|LOCUS_19950 14791 13772 gene locus_tag LOCUS_19960 gene gap 14791 13772 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_19960 16191 14953 gene locus_tag LOCUS_19970 16191 14953 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920957.1 protein_id gnl|my_center|LOCUS_19970 16508 17407 gene locus_tag LOCUS_19980 16508 17407 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329334.1 protein_id gnl|my_center|LOCUS_19980 17539 19071 gene locus_tag LOCUS_19990 17539 19071 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947081.1 protein_id gnl|my_center|LOCUS_19990 19714 20460 gene locus_tag LOCUS_20000 19714 20460 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969126.1 protein_id gnl|my_center|LOCUS_20000 >Feature sequence060 1542 427 gene locus_tag LOCUS_20010 1542 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963909.1 protein_id gnl|my_center|LOCUS_20010 2364 1633 gene locus_tag LOCUS_20020 2364 1633 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258474.1 protein_id gnl|my_center|LOCUS_20020 3353 2502 gene locus_tag LOCUS_20030 3353 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 3513 5717 gene locus_tag LOCUS_20040 3513 5717 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582331.1 protein_id gnl|my_center|LOCUS_20040 6099 7238 gene locus_tag LOCUS_20050 6099 7238 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259079.1 protein_id gnl|my_center|LOCUS_20050 7354 8982 gene locus_tag LOCUS_20060 7354 8982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 8984 10504 gene locus_tag LOCUS_20070 8984 10504 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190761.1 protein_id gnl|my_center|LOCUS_20070 10555 11364 gene locus_tag LOCUS_20080 10555 11364 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259082.1 protein_id gnl|my_center|LOCUS_20080 13254 11374 gene locus_tag LOCUS_20090 13254 11374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 14533 13358 gene locus_tag LOCUS_20100 14533 13358 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_20100 14841 15722 gene locus_tag LOCUS_20110 gene pqqB 14841 15722 CDS product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763801.1 protein_id gnl|my_center|LOCUS_20110 16002 15751 gene locus_tag LOCUS_20120 16002 15751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 16033 17616 gene locus_tag LOCUS_20130 16033 17616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 18182 17625 gene locus_tag LOCUS_20140 18182 17625 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926813.1 protein_id gnl|my_center|LOCUS_20140 19217 18213 gene locus_tag LOCUS_20150 19217 18213 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532940.1 protein_id gnl|my_center|LOCUS_20150 >Feature sequence061 1230 178 gene locus_tag LOCUS_20160 1230 178 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_20160 2294 1227 gene locus_tag LOCUS_20170 2294 1227 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_20170 2800 4989 gene locus_tag LOCUS_20180 2800 4989 CDS product serine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259150.1 protein_id gnl|my_center|LOCUS_20180 5065 5910 gene locus_tag LOCUS_20190 gene rsmA 5065 5910 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294004.1 protein_id gnl|my_center|LOCUS_20190 6363 5962 gene locus_tag LOCUS_20200 6363 5962 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980577.1 protein_id gnl|my_center|LOCUS_20200 6697 6353 gene locus_tag LOCUS_20210 6697 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 8256 6736 gene locus_tag LOCUS_20220 8256 6736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 9369 8311 gene locus_tag LOCUS_20230 9369 8311 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531489.1 protein_id gnl|my_center|LOCUS_20230 9484 10272 gene locus_tag LOCUS_20240 9484 10272 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_20240 10360 11949 gene locus_tag LOCUS_20250 10360 11949 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_20250 11954 13342 gene locus_tag LOCUS_20260 11954 13342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 13804 14109 gene locus_tag LOCUS_20270 13804 14109 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 protein_id gnl|my_center|LOCUS_20270 14919 14143 gene locus_tag LOCUS_20280 14919 14143 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258578.1 protein_id gnl|my_center|LOCUS_20280 15257 15030 gene locus_tag LOCUS_20290 15257 15030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 16045 15260 gene locus_tag LOCUS_20300 16045 15260 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258938.1 protein_id gnl|my_center|LOCUS_20300 17474 16053 gene locus_tag LOCUS_20310 17474 16053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 18469 17528 gene locus_tag LOCUS_20320 18469 17528 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258376.1 protein_id gnl|my_center|LOCUS_20320 >Feature sequence062 1107 154 gene locus_tag LOCUS_20330 1107 154 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892121.1 protein_id gnl|my_center|LOCUS_20330 2044 1235 gene locus_tag LOCUS_20340 2044 1235 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869263.1 protein_id gnl|my_center|LOCUS_20340 2215 3822 gene locus_tag LOCUS_20350 2215 3822 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257930.1 protein_id gnl|my_center|LOCUS_20350 3917 5272 gene locus_tag LOCUS_20360 3917 5272 CDS product CpXC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257830.1 protein_id gnl|my_center|LOCUS_20360 5936 5349 gene locus_tag LOCUS_20370 5936 5349 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255966.1 protein_id gnl|my_center|LOCUS_20370 6105 7115 gene locus_tag LOCUS_20380 6105 7115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 7321 7461 gene locus_tag LOCUS_20390 7321 7461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 7678 8778 gene locus_tag LOCUS_20400 7678 8778 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259287.1 protein_id gnl|my_center|LOCUS_20400 8870 9334 gene locus_tag LOCUS_20410 8870 9334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 10629 9331 gene locus_tag LOCUS_20420 10629 9331 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018377.1 protein_id gnl|my_center|LOCUS_20420 11582 10821 gene locus_tag LOCUS_20430 11582 10821 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074690.1 protein_id gnl|my_center|LOCUS_20430 11879 13099 gene locus_tag LOCUS_20440 11879 13099 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230220.1 protein_id gnl|my_center|LOCUS_20440 15402 13096 gene locus_tag LOCUS_20450 15402 13096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 15812 17167 gene locus_tag LOCUS_20460 15812 17167 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393891.1 protein_id gnl|my_center|LOCUS_20460 17174 17821 gene locus_tag LOCUS_20470 17174 17821 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404532.1 protein_id gnl|my_center|LOCUS_20470 17857 18375 gene locus_tag LOCUS_20480 17857 18375 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028072.1 protein_id gnl|my_center|LOCUS_20480 19829 18372 gene locus_tag LOCUS_20490 19829 18372 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063675.1 protein_id gnl|my_center|LOCUS_20490 >Feature sequence063 172 1503 gene locus_tag LOCUS_20500 172 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 1516 2154 gene locus_tag LOCUS_20510 1516 2154 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_20510 2289 3488 gene locus_tag LOCUS_20520 gene lhgO 2289 3488 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839995.1 protein_id gnl|my_center|LOCUS_20520 3648 5267 gene locus_tag LOCUS_20530 gene ilvD 3648 5267 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922486.1 protein_id gnl|my_center|LOCUS_20530 5321 5842 gene locus_tag LOCUS_20540 5321 5842 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_20540 5990 7123 gene locus_tag LOCUS_20550 gene dnaN 5990 7123 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258498.1 protein_id gnl|my_center|LOCUS_20550 7795 7127 gene locus_tag LOCUS_20560 7795 7127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 7775 7960 gene locus_tag LOCUS_20570 7775 7960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 9135 8080 gene locus_tag LOCUS_20580 9135 8080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20580 10832 9264 gene locus_tag LOCUS_20590 10832 9264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365927.1 protein_id gnl|my_center|LOCUS_20590 10955 12853 gene locus_tag LOCUS_20600 10955 12853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 14069 12789 gene locus_tag LOCUS_20610 14069 12789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 15215 14193 gene locus_tag LOCUS_20620 gene aroF 15215 14193 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392848.1 protein_id gnl|my_center|LOCUS_20620 15798 15325 gene locus_tag LOCUS_20630 gene aroH 15798 15325 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258091.1 protein_id gnl|my_center|LOCUS_20630 17597 16065 gene locus_tag LOCUS_20640 17597 16065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 18764 17802 gene locus_tag LOCUS_20650 18764 17802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 >Feature sequence064 1684 1265 gene locus_tag LOCUS_20660 1684 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 1990 1709 gene locus_tag LOCUS_20670 1990 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 2059 2604 gene locus_tag LOCUS_20680 2059 2604 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258966.1 protein_id gnl|my_center|LOCUS_20680 2604 3755 gene locus_tag LOCUS_20690 2604 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 4278 4829 gene locus_tag LOCUS_20700 4278 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 5284 4913 gene locus_tag LOCUS_20710 5284 4913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 5495 6526 gene locus_tag LOCUS_20720 5495 6526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 7251 6502 gene locus_tag LOCUS_20730 7251 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 9535 7238 gene locus_tag LOCUS_20740 9535 7238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 9809 9528 gene locus_tag LOCUS_20750 9809 9528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 10359 9823 gene locus_tag LOCUS_20760 10359 9823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 10913 10506 gene locus_tag LOCUS_20770 10913 10506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 11199 12623 gene locus_tag LOCUS_20780 11199 12623 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405217.1 protein_id gnl|my_center|LOCUS_20780 13990 12686 gene locus_tag LOCUS_20790 13990 12686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 15101 15424 gene locus_tag LOCUS_20800 15101 15424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 15421 15636 gene locus_tag LOCUS_20810 15421 15636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 >Feature sequence065 1079 138 gene locus_tag LOCUS_20820 1079 138 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259441.1 protein_id gnl|my_center|LOCUS_20820 2142 1102 gene locus_tag LOCUS_20830 gene meaB 2142 1102 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_20830 2341 3699 gene locus_tag LOCUS_20840 2341 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 5671 4154 gene locus_tag LOCUS_20850 5671 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 5937 7523 gene locus_tag LOCUS_20860 gene aceB 5937 7523 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258821.1 protein_id gnl|my_center|LOCUS_20860 7616 8920 gene locus_tag LOCUS_20870 gene aceA 7616 8920 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259719.1 protein_id gnl|my_center|LOCUS_20870 10724 9027 gene locus_tag LOCUS_20880 10724 9027 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941195.1 protein_id gnl|my_center|LOCUS_20880 11401 10721 gene locus_tag LOCUS_20890 11401 10721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 12313 11408 gene locus_tag LOCUS_20900 gene pheA 12313 11408 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038038884.1 protein_id gnl|my_center|LOCUS_20900 12592 14310 gene locus_tag LOCUS_20910 12592 14310 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228698.1 protein_id gnl|my_center|LOCUS_20910 15592 14390 gene locus_tag LOCUS_20920 15592 14390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 15909 17915 gene locus_tag LOCUS_20930 15909 17915 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190697803.1 protein_id gnl|my_center|LOCUS_20930 17912 18598 gene locus_tag LOCUS_20940 gene rpiA 17912 18598 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086536.1 protein_id gnl|my_center|LOCUS_20940 >Feature sequence066 249 1262 gene locus_tag LOCUS_20950 249 1262 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838116.1 protein_id gnl|my_center|LOCUS_20950 1392 2300 gene locus_tag LOCUS_20960 1392 2300 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167917.1 protein_id gnl|my_center|LOCUS_20960 5324 2328 gene locus_tag LOCUS_20970 5324 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 5563 6726 gene locus_tag LOCUS_20980 5563 6726 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880484.1 protein_id gnl|my_center|LOCUS_20980 6759 8237 gene locus_tag LOCUS_20990 6759 8237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 8244 8723 gene locus_tag LOCUS_21000 gene smpB 8244 8723 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815658.1 protein_id gnl|my_center|LOCUS_21000 10951 8729 gene locus_tag LOCUS_21010 10951 8729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 11024 12253 gene locus_tag LOCUS_21020 gene coaBC 11024 12253 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259488.1 protein_id gnl|my_center|LOCUS_21020 13282 12275 gene locus_tag LOCUS_21030 gene bmt 13282 12275 CDS product betaine--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337253.1 protein_id gnl|my_center|LOCUS_21030 13980 13279 gene locus_tag LOCUS_21040 13980 13279 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531175.1 protein_id gnl|my_center|LOCUS_21040 16070 14040 gene locus_tag LOCUS_21050 16070 14040 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531166.1 protein_id gnl|my_center|LOCUS_21050 16532 16218 gene locus_tag LOCUS_21060 16532 16218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 18421 16640 gene locus_tag LOCUS_21070 18421 16640 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_21070 19081 18593 gene locus_tag LOCUS_21080 19081 18593 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869337.1 protein_id gnl|my_center|LOCUS_21080 >Feature sequence067 109 2772 gene locus_tag LOCUS_21090 109 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 2881 4275 gene locus_tag LOCUS_21100 gene miaB 2881 4275 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258276.1 protein_id gnl|my_center|LOCUS_21100 5610 4306 gene locus_tag LOCUS_21110 5610 4306 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259028.1 protein_id gnl|my_center|LOCUS_21110 6576 5611 gene locus_tag LOCUS_21120 6576 5611 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_21120 7081 8340 gene locus_tag LOCUS_21130 7081 8340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 8337 9062 gene locus_tag LOCUS_21140 8337 9062 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_21140 9086 10750 gene locus_tag LOCUS_21150 9086 10750 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140483.1 protein_id gnl|my_center|LOCUS_21150 11175 10768 gene locus_tag LOCUS_21160 11175 10768 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257827.1 protein_id gnl|my_center|LOCUS_21160 11609 11178 gene locus_tag LOCUS_21170 11609 11178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257828.1 protein_id gnl|my_center|LOCUS_21170 12972 11761 gene locus_tag LOCUS_21180 12972 11761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 14118 13015 gene locus_tag LOCUS_21190 14118 13015 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259193.1 protein_id gnl|my_center|LOCUS_21190 14615 14115 gene locus_tag LOCUS_21200 14615 14115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 17405 14649 gene locus_tag LOCUS_21210 17405 14649 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404851.1 protein_id gnl|my_center|LOCUS_21210 17579 17433 gene locus_tag LOCUS_21220 17579 17433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 18113 17673 gene locus_tag LOCUS_21230 18113 17673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21230 18872 18273 gene locus_tag LOCUS_21240 gene pyrE 18872 18273 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903560.1 protein_id gnl|my_center|LOCUS_21240 >Feature sequence068 322 2826 gene locus_tag LOCUS_21250 322 2826 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932772.1 protein_id gnl|my_center|LOCUS_21250 2917 3594 gene locus_tag LOCUS_21260 2917 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 3866 3591 gene locus_tag LOCUS_21270 3866 3591 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142092.1 protein_id gnl|my_center|LOCUS_21270 4563 3886 gene locus_tag LOCUS_21280 4563 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888589.1 protein_id gnl|my_center|LOCUS_21280 4888 4622 gene locus_tag LOCUS_21290 4888 4622 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815339.1 protein_id gnl|my_center|LOCUS_21290 5477 4890 gene locus_tag LOCUS_21300 gene pduT 5477 4890 CDS product propanediol utilization microcompartment protein PduT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030730.1 protein_id gnl|my_center|LOCUS_21300 6991 5477 gene locus_tag LOCUS_21310 6991 5477 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075711.1 protein_id gnl|my_center|LOCUS_21310 7330 7031 gene locus_tag LOCUS_21320 7330 7031 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836570.1 protein_id gnl|my_center|LOCUS_21320 7649 7359 gene locus_tag LOCUS_21330 gene eutM 7649 7359 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387713.1 protein_id gnl|my_center|LOCUS_21330 8319 7678 gene locus_tag LOCUS_21340 8319 7678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141518.1 protein_id gnl|my_center|LOCUS_21340 9543 8614 gene locus_tag LOCUS_21350 9543 8614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 10344 9580 gene locus_tag LOCUS_21360 10344 9580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 11073 10474 gene locus_tag LOCUS_21370 gene lepB 11073 10474 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257166.1 protein_id gnl|my_center|LOCUS_21370 11257 12045 gene locus_tag LOCUS_21380 11257 12045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 12463 14901 gene locus_tag LOCUS_21390 12463 14901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 15040 15654 gene locus_tag LOCUS_21400 gene sodA 15040 15654 CDS product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398583.1 protein_id gnl|my_center|LOCUS_21400 15722 16129 gene locus_tag LOCUS_21410 15722 16129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 16253 17692 gene locus_tag LOCUS_21420 16253 17692 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909061.1 protein_id gnl|my_center|LOCUS_21420 17791 18189 gene locus_tag LOCUS_21430 17791 18189 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816173.1 protein_id gnl|my_center|LOCUS_21430 >Feature sequence069 1674 802 gene locus_tag LOCUS_21440 1674 802 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106518184.1 protein_id gnl|my_center|LOCUS_21440 2632 1790 gene locus_tag LOCUS_21450 2632 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 3177 2926 gene locus_tag LOCUS_21460 3177 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 3512 3183 gene locus_tag LOCUS_21470 3512 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 4225 3824 gene locus_tag LOCUS_21480 4225 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 4339 4773 gene locus_tag LOCUS_21490 4339 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21490 4821 5477 gene locus_tag LOCUS_21500 4821 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21500 7023 5629 gene locus_tag LOCUS_21510 7023 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 7170 7036 gene locus_tag LOCUS_21520 7170 7036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 7432 7157 gene locus_tag LOCUS_21530 7432 7157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 8630 7884 gene locus_tag LOCUS_21540 8630 7884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 9249 8686 gene locus_tag LOCUS_21550 9249 8686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 9665 10183 gene locus_tag LOCUS_21560 9665 10183 CDS product DJ-1/PfpI/YhbO family deglycase/protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870481.1 protein_id gnl|my_center|LOCUS_21560 10418 10852 gene locus_tag LOCUS_21570 10418 10852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 11483 11256 gene locus_tag LOCUS_21580 11483 11256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 12032 11547 gene locus_tag LOCUS_21590 12032 11547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 12391 12050 gene locus_tag LOCUS_21600 12391 12050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 12917 12393 gene locus_tag LOCUS_21610 12917 12393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 13678 12914 gene locus_tag LOCUS_21620 13678 12914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 14203 13691 gene locus_tag LOCUS_21630 14203 13691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 14490 15197 gene locus_tag LOCUS_21640 14490 15197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 16320 15925 gene locus_tag LOCUS_21650 16320 15925 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939303.1 protein_id gnl|my_center|LOCUS_21650 16692 17429 gene locus_tag LOCUS_21660 16692 17429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 >Feature sequence070 1338 475 gene locus_tag LOCUS_21670 1338 475 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259682.1 protein_id gnl|my_center|LOCUS_21670 1939 1535 gene locus_tag LOCUS_21680 1939 1535 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895709.1 protein_id gnl|my_center|LOCUS_21680 2205 1936 gene locus_tag LOCUS_21690 2205 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 2486 2256 gene locus_tag LOCUS_21700 2486 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 3229 2528 gene locus_tag LOCUS_21710 3229 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 3715 3296 gene locus_tag LOCUS_21720 3715 3296 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729021.1 protein_id gnl|my_center|LOCUS_21720 3905 4681 gene locus_tag LOCUS_21730 3905 4681 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 protein_id gnl|my_center|LOCUS_21730 4786 6717 gene locus_tag LOCUS_21740 4786 6717 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 protein_id gnl|my_center|LOCUS_21740 6799 7035 gene locus_tag LOCUS_21750 6799 7035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 7097 8032 gene locus_tag LOCUS_21760 7097 8032 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088705.1 protein_id gnl|my_center|LOCUS_21760 8036 9103 gene locus_tag LOCUS_21770 8036 9103 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088706.1 protein_id gnl|my_center|LOCUS_21770 9223 10698 gene locus_tag LOCUS_21780 9223 10698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 10784 11581 gene locus_tag LOCUS_21790 10784 11581 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_21790 11704 12888 gene locus_tag LOCUS_21800 11704 12888 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256967.1 protein_id gnl|my_center|LOCUS_21800 12928 13332 gene locus_tag LOCUS_21810 12928 13332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 13329 13718 gene locus_tag LOCUS_21820 13329 13718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 13778 14011 gene locus_tag LOCUS_21830 13778 14011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 14156 16414 gene locus_tag LOCUS_21840 14156 16414 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083531262.1 protein_id gnl|my_center|LOCUS_21840 16582 16950 gene locus_tag LOCUS_21850 16582 16950 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478297.1 protein_id gnl|my_center|LOCUS_21850 17331 16858 gene locus_tag LOCUS_21860 17331 16858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 >Feature sequence071 2734 1097 gene locus_tag LOCUS_21870 2734 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 3341 2961 gene locus_tag LOCUS_21880 3341 2961 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_21880 3588 3325 gene locus_tag LOCUS_21890 3588 3325 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143545.1 protein_id gnl|my_center|LOCUS_21890 3769 3698 gene locus_tag LOCUS_t00330 3769 3698 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4567 3836 gene locus_tag LOCUS_21900 4567 3836 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970077.1 protein_id gnl|my_center|LOCUS_21900 4824 5828 gene locus_tag LOCUS_21910 gene glsA 4824 5828 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816578.1 protein_id gnl|my_center|LOCUS_21910 7553 5892 gene locus_tag LOCUS_21920 7553 5892 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213976.1 protein_id gnl|my_center|LOCUS_21920 8871 7630 gene locus_tag LOCUS_21930 gene pepT 8871 7630 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384562.1 protein_id gnl|my_center|LOCUS_21930 10572 8932 gene locus_tag LOCUS_21940 10572 8932 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970122.1 protein_id gnl|my_center|LOCUS_21940 12149 10686 gene locus_tag LOCUS_21950 12149 10686 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259178.1 protein_id gnl|my_center|LOCUS_21950 13589 12201 gene locus_tag LOCUS_21960 13589 12201 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404619.1 protein_id gnl|my_center|LOCUS_21960 14147 13650 gene locus_tag LOCUS_21970 14147 13650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 15932 14382 gene locus_tag LOCUS_21980 gene malQ 15932 14382 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259030.1 protein_id gnl|my_center|LOCUS_21980 >Feature sequence072 283 2115 gene locus_tag LOCUS_21990 283 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 2375 3007 gene locus_tag LOCUS_22000 2375 3007 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990775.1 protein_id gnl|my_center|LOCUS_22000 3112 3381 gene locus_tag LOCUS_22010 3112 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 3381 3812 gene locus_tag LOCUS_22020 3381 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 3876 4700 gene locus_tag LOCUS_22030 3876 4700 CDS product sulfotransferase family 2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929312.1 protein_id gnl|my_center|LOCUS_22030 9433 4676 gene locus_tag LOCUS_22040 9433 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 9791 10774 gene locus_tag LOCUS_22050 9791 10774 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 protein_id gnl|my_center|LOCUS_22050 12862 10919 gene locus_tag LOCUS_22060 gene gyrB 12862 10919 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_22060 13863 12865 gene locus_tag LOCUS_22070 13863 12865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 14750 13959 gene locus_tag LOCUS_22080 gene recO 14750 13959 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909322.1 protein_id gnl|my_center|LOCUS_22080 14828 14901 gene locus_tag LOCUS_t00340 14828 14901 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 15238 15026 gene locus_tag LOCUS_22090 15238 15026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 15718 16191 gene locus_tag LOCUS_22100 15718 16191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 >Feature sequence073 1042 428 gene locus_tag LOCUS_22110 1042 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 3689 1218 gene locus_tag LOCUS_22120 3689 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 6325 3770 gene locus_tag LOCUS_22130 6325 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 7007 6495 gene locus_tag LOCUS_22140 7007 6495 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228194.1 protein_id gnl|my_center|LOCUS_22140 9039 7198 gene locus_tag LOCUS_22150 gene typA 9039 7198 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256721.1 protein_id gnl|my_center|LOCUS_22150 9885 9241 gene locus_tag LOCUS_22160 9885 9241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 11789 9966 gene locus_tag LOCUS_22170 11789 9966 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256503.1 protein_id gnl|my_center|LOCUS_22170 13891 11807 gene locus_tag LOCUS_22180 13891 11807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 15148 14060 gene locus_tag LOCUS_22190 15148 14060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 16001 15210 gene locus_tag LOCUS_22200 16001 15210 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227804.1 protein_id gnl|my_center|LOCUS_22200 16512 16099 gene locus_tag LOCUS_22210 16512 16099 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_22210 16750 16496 gene locus_tag LOCUS_22220 16750 16496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 >Feature sequence074 301 786 gene locus_tag LOCUS_22230 301 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 1782 823 gene locus_tag LOCUS_22240 1782 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 2946 1816 gene locus_tag LOCUS_22250 2946 1816 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_22250 3408 4409 gene locus_tag LOCUS_22260 3408 4409 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173675.1 protein_id gnl|my_center|LOCUS_22260 5692 4406 gene locus_tag LOCUS_22270 5692 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 5841 6374 gene locus_tag LOCUS_22280 gene folK 5841 6374 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262835.1 protein_id gnl|my_center|LOCUS_22280 6392 7276 gene locus_tag LOCUS_22290 6392 7276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 7386 8477 gene locus_tag LOCUS_22300 7386 8477 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877291.1 protein_id gnl|my_center|LOCUS_22300 8512 9816 gene locus_tag LOCUS_22310 8512 9816 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229645.1 protein_id gnl|my_center|LOCUS_22310 9930 12320 gene locus_tag LOCUS_22320 9930 12320 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259065.1 protein_id gnl|my_center|LOCUS_22320 12358 13518 gene locus_tag LOCUS_22330 12358 13518 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259064.1 protein_id gnl|my_center|LOCUS_22330 14378 13740 gene locus_tag LOCUS_22340 14378 13740 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886943.1 protein_id gnl|my_center|LOCUS_22340 14563 14877 gene locus_tag LOCUS_22350 14563 14877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 15315 14956 gene locus_tag LOCUS_22360 15315 14956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 15684 15337 gene locus_tag LOCUS_22370 15684 15337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 16570 15719 gene locus_tag LOCUS_22380 16570 15719 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259348.1 protein_id gnl|my_center|LOCUS_22380 >Feature sequence075 742 131 gene locus_tag LOCUS_22390 742 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 1569 739 gene locus_tag LOCUS_22400 1569 739 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527105.1 protein_id gnl|my_center|LOCUS_22400 2486 1623 gene locus_tag LOCUS_22410 2486 1623 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258329.1 protein_id gnl|my_center|LOCUS_22410 3906 2479 gene locus_tag LOCUS_22420 3906 2479 CDS product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550379.1 protein_id gnl|my_center|LOCUS_22420 4655 4008 gene locus_tag LOCUS_22430 4655 4008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808194.1 protein_id gnl|my_center|LOCUS_22430 6812 4773 gene locus_tag LOCUS_22440 gene nosZ 6812 4773 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458974.1 protein_id gnl|my_center|LOCUS_22440 8863 7040 gene locus_tag LOCUS_22450 8863 7040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 10014 9301 gene locus_tag LOCUS_22460 10014 9301 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089821.1 protein_id gnl|my_center|LOCUS_22460 10118 10495 gene locus_tag LOCUS_22470 10118 10495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 10705 12792 gene locus_tag LOCUS_22480 10705 12792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 12831 13505 gene locus_tag LOCUS_22490 gene mtrA 12831 13505 CDS product MtrAB system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929974.1 protein_id gnl|my_center|LOCUS_22490 13722 14702 gene locus_tag LOCUS_22500 13722 14702 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768354.1 protein_id gnl|my_center|LOCUS_22500 14768 15817 gene locus_tag LOCUS_22510 gene pstC 14768 15817 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140449.1 protein_id gnl|my_center|LOCUS_22510 15822 16676 gene locus_tag LOCUS_22520 gene pstA 15822 16676 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432350.1 protein_id gnl|my_center|LOCUS_22520 >Feature sequence076 2329 1274 gene locus_tag LOCUS_22530 gene corA 2329 1274 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838388.1 protein_id gnl|my_center|LOCUS_22530 4027 2366 gene locus_tag LOCUS_22540 gene argS 4027 2366 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393887.1 protein_id gnl|my_center|LOCUS_22540 4838 4071 gene locus_tag LOCUS_22550 4838 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 5698 5009 gene locus_tag LOCUS_22560 5698 5009 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391616.1 protein_id gnl|my_center|LOCUS_22560 6622 5777 gene locus_tag LOCUS_22570 6622 5777 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943338.1 protein_id gnl|my_center|LOCUS_22570 7055 6720 gene locus_tag LOCUS_22580 7055 6720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 7749 7147 gene locus_tag LOCUS_22590 7749 7147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 8870 7746 gene locus_tag LOCUS_22600 8870 7746 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969607.1 protein_id gnl|my_center|LOCUS_22600 9001 9885 gene locus_tag LOCUS_22610 9001 9885 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403764.1 protein_id gnl|my_center|LOCUS_22610 10952 10035 gene locus_tag LOCUS_22620 10952 10035 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_22620 13363 11255 gene locus_tag LOCUS_22630 13363 11255 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986480.1 protein_id gnl|my_center|LOCUS_22630 15339 13372 gene locus_tag LOCUS_22640 15339 13372 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839249.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence077 1714 1415 gene locus_tag LOCUS_22650 gene rplT 1714 1415 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132352.1 protein_id gnl|my_center|LOCUS_22650 2104 1859 gene locus_tag LOCUS_22660 gene rpmI 2104 1859 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057993.1 protein_id gnl|my_center|LOCUS_22660 2788 2201 gene locus_tag LOCUS_22670 2788 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 3282 2986 gene locus_tag LOCUS_22680 3282 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 4968 3355 gene locus_tag LOCUS_22690 4968 3355 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005575582.1 protein_id gnl|my_center|LOCUS_22690 5989 4979 gene locus_tag LOCUS_22700 5989 4979 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941286.1 protein_id gnl|my_center|LOCUS_22700 6317 5997 gene locus_tag LOCUS_22710 6317 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 6574 6314 gene locus_tag LOCUS_22720 6574 6314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 8352 6688 gene locus_tag LOCUS_22730 8352 6688 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005575582.1 protein_id gnl|my_center|LOCUS_22730 9390 8389 gene locus_tag LOCUS_22740 9390 8389 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545040.1 protein_id gnl|my_center|LOCUS_22740 9838 9461 gene locus_tag LOCUS_22750 9838 9461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 10115 10993 gene locus_tag LOCUS_22760 gene tcmP 10115 10993 CDS product three-Cys-motif partner protein TcmP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445522.1 protein_id gnl|my_center|LOCUS_22760 11001 11732 gene locus_tag LOCUS_22770 11001 11732 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102969.1 protein_id gnl|my_center|LOCUS_22770 11756 12835 gene locus_tag LOCUS_22780 11756 12835 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227740.1 protein_id gnl|my_center|LOCUS_22780 13067 13432 gene locus_tag LOCUS_22790 gene rplS 13067 13432 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257535.1 protein_id gnl|my_center|LOCUS_22790 13560 14297 gene locus_tag LOCUS_22800 13560 14297 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256366.1 protein_id gnl|my_center|LOCUS_22800 14306 14788 gene locus_tag LOCUS_22810 14306 14788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 15374 14871 gene locus_tag LOCUS_22820 15374 14871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 15962 15393 gene locus_tag LOCUS_22830 15962 15393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 >Feature sequence078 64 906 gene locus_tag LOCUS_22840 64 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 982 2508 gene locus_tag LOCUS_22850 982 2508 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258554.1 protein_id gnl|my_center|LOCUS_22850 2558 3262 gene locus_tag LOCUS_22860 2558 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 4014 3295 gene locus_tag LOCUS_22870 4014 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 5965 4436 gene locus_tag LOCUS_22880 5965 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 7736 6009 gene locus_tag LOCUS_22890 7736 6009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 9031 7733 gene locus_tag LOCUS_22900 9031 7733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 9978 9034 gene locus_tag LOCUS_22910 9978 9034 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257437.1 protein_id gnl|my_center|LOCUS_22910 10082 10876 gene locus_tag LOCUS_22920 10082 10876 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969714.1 protein_id gnl|my_center|LOCUS_22920 10885 11412 gene locus_tag LOCUS_22930 10885 11412 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064487.1 protein_id gnl|my_center|LOCUS_22930 11479 11847 gene locus_tag LOCUS_22940 11479 11847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 11877 12662 gene locus_tag LOCUS_22950 gene paaG 11877 12662 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046117561.1 protein_id gnl|my_center|LOCUS_22950 14810 12672 gene locus_tag LOCUS_22960 14810 12672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 15998 14895 gene locus_tag LOCUS_22970 gene ald 15998 14895 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227783.1 protein_id gnl|my_center|LOCUS_22970 >Feature sequence079 111 539 gene locus_tag LOCUS_22980 111 539 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038704.1 protein_id gnl|my_center|LOCUS_22980 553 1710 gene locus_tag LOCUS_22990 553 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 1867 2265 gene locus_tag LOCUS_23000 gene hypA 1867 2265 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941042.1 protein_id gnl|my_center|LOCUS_23000 2281 2949 gene locus_tag LOCUS_23010 gene hypB 2281 2949 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940974.1 protein_id gnl|my_center|LOCUS_23010 2968 5358 gene locus_tag LOCUS_23020 gene hypF 2968 5358 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_23020 5401 5661 gene locus_tag LOCUS_23030 5401 5661 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258619.1 protein_id gnl|my_center|LOCUS_23030 5714 6877 gene locus_tag LOCUS_23040 gene hypD 5714 6877 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_23040 6825 7952 gene locus_tag LOCUS_23050 gene hypE 6825 7952 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225638.1 protein_id gnl|my_center|LOCUS_23050 8397 7990 gene locus_tag LOCUS_23060 8397 7990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 9298 8480 gene locus_tag LOCUS_23070 9298 8480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 9466 9750 gene locus_tag LOCUS_23080 9466 9750 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257138.1 protein_id gnl|my_center|LOCUS_23080 9754 11712 gene locus_tag LOCUS_23090 9754 11712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 11716 12696 gene locus_tag LOCUS_23100 11716 12696 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330018.1 protein_id gnl|my_center|LOCUS_23100 12724 13671 gene locus_tag LOCUS_23110 12724 13671 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257907.1 protein_id gnl|my_center|LOCUS_23110 13668 15245 gene locus_tag LOCUS_23120 13668 15245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 >Feature sequence080 433 642 gene locus_tag LOCUS_23130 433 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 657 962 gene locus_tag LOCUS_23140 657 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 2809 1127 gene locus_tag LOCUS_23150 gene ettA 2809 1127 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_23150 4611 2818 gene locus_tag LOCUS_23160 gene metG 4611 2818 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259302.1 protein_id gnl|my_center|LOCUS_23160 5302 4616 gene locus_tag LOCUS_23170 5302 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 5642 7378 gene locus_tag LOCUS_23180 5642 7378 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460410.1 protein_id gnl|my_center|LOCUS_23180 7638 8294 gene locus_tag LOCUS_23190 7638 8294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 8333 8755 gene locus_tag LOCUS_23200 8333 8755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 8786 9796 gene locus_tag LOCUS_23210 8786 9796 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410434.1 protein_id gnl|my_center|LOCUS_23210 9832 10734 gene locus_tag LOCUS_23220 9832 10734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 10758 11252 gene locus_tag LOCUS_23230 10758 11252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 11390 13444 gene locus_tag LOCUS_23240 11390 13444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 13446 14102 gene locus_tag LOCUS_23250 13446 14102 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222893.1 protein_id gnl|my_center|LOCUS_23250 14400 14894 gene locus_tag LOCUS_23260 14400 14894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 >Feature sequence081 2741 147 gene locus_tag LOCUS_23270 gene mutS 2741 147 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_23270 4036 2759 gene locus_tag LOCUS_23280 4036 2759 CDS product PLP-dependent lyase/thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065102.1 protein_id gnl|my_center|LOCUS_23280 4566 4033 gene locus_tag LOCUS_23290 4566 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 5614 4616 gene locus_tag LOCUS_23300 5614 4616 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_23300 5819 8518 gene locus_tag LOCUS_23310 gene acnA 5819 8518 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888355.1 protein_id gnl|my_center|LOCUS_23310 8521 9717 gene locus_tag LOCUS_23320 8521 9717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 9773 9961 gene locus_tag LOCUS_23330 9773 9961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 10033 10749 gene locus_tag LOCUS_23340 gene radC 10033 10749 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259440.1 protein_id gnl|my_center|LOCUS_23340 12030 10759 gene locus_tag LOCUS_23350 12030 10759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 12117 12305 gene locus_tag LOCUS_23360 12117 12305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 13442 12420 gene locus_tag LOCUS_23370 gene pyrD 13442 12420 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458264.1 protein_id gnl|my_center|LOCUS_23370 15291 13462 gene locus_tag LOCUS_23380 15291 13462 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113972.1 protein_id gnl|my_center|LOCUS_23380 >Feature sequence082 1387 791 gene locus_tag LOCUS_23390 1387 791 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_23390 1474 2295 gene locus_tag LOCUS_23400 1474 2295 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889156.1 protein_id gnl|my_center|LOCUS_23400 3578 2307 gene locus_tag LOCUS_23410 3578 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 5055 3697 gene locus_tag LOCUS_23420 5055 3697 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133853294.1 protein_id gnl|my_center|LOCUS_23420 5358 5744 gene locus_tag LOCUS_23430 5358 5744 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434285.1 protein_id gnl|my_center|LOCUS_23430 5934 8519 gene locus_tag LOCUS_23440 5934 8519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 8600 9010 gene locus_tag LOCUS_23450 8600 9010 CDS product DUF2255 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644458.1 protein_id gnl|my_center|LOCUS_23450 9022 9804 gene locus_tag LOCUS_23460 9022 9804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 10806 9946 gene locus_tag LOCUS_23470 10806 9946 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887145.1 protein_id gnl|my_center|LOCUS_23470 10969 11940 gene locus_tag LOCUS_23480 10969 11940 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257482.1 protein_id gnl|my_center|LOCUS_23480 12113 13618 gene locus_tag LOCUS_23490 12113 13618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 14286 13687 gene locus_tag LOCUS_23500 14286 13687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 15239 14424 gene locus_tag LOCUS_23510 15239 14424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 >Feature sequence083 <1 1108 gene locus_tag LOCUS_23520 <1 1108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393450.1:ABC transporter ATP-binding protein 2217 1105 gene locus_tag LOCUS_23530 2217 1105 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929014.1 protein_id gnl|my_center|LOCUS_23530 2652 6275 gene locus_tag LOCUS_23540 2652 6275 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969249.1 protein_id gnl|my_center|LOCUS_23540 7500 6256 gene locus_tag LOCUS_23550 7500 6256 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338923.1 protein_id gnl|my_center|LOCUS_23550 9024 7510 gene locus_tag LOCUS_23560 9024 7510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 9488 9021 gene locus_tag LOCUS_23570 9488 9021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 9593 9850 gene locus_tag LOCUS_23580 9593 9850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 11379 10171 gene locus_tag LOCUS_23590 11379 10171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 12704 11427 gene locus_tag LOCUS_23600 gene lnrM 12704 11427 CDS product linearmycin resistance permease LnrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242483.1 protein_id gnl|my_center|LOCUS_23600 13751 12756 gene locus_tag LOCUS_23610 gene lnrL 13751 12756 CDS product linearmycin resistance ATP-binding protein LnrL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244346.1 protein_id gnl|my_center|LOCUS_23610 14471 13875 gene locus_tag LOCUS_23620 14471 13875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 14688 14921 gene locus_tag LOCUS_23630 14688 14921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 >Feature sequence084 1003 437 gene locus_tag LOCUS_23640 gene kdpC 1003 437 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943119.1 protein_id gnl|my_center|LOCUS_23640 1352 996 gene locus_tag LOCUS_23650 1352 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 3481 1367 gene locus_tag LOCUS_23660 gene kdpB 3481 1367 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078552.1 protein_id gnl|my_center|LOCUS_23660 5197 3506 gene locus_tag LOCUS_23670 gene kdpA 5197 3506 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529643.1 protein_id gnl|my_center|LOCUS_23670 5408 5199 gene locus_tag LOCUS_23680 5408 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 7018 5474 gene locus_tag LOCUS_23690 7018 5474 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228252.1 protein_id gnl|my_center|LOCUS_23690 7640 7083 gene locus_tag LOCUS_23700 7640 7083 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948772.1 protein_id gnl|my_center|LOCUS_23700 7691 8845 gene locus_tag LOCUS_23710 7691 8845 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892385.1 protein_id gnl|my_center|LOCUS_23710 9097 9363 gene locus_tag LOCUS_23720 9097 9363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 9347 9550 gene locus_tag LOCUS_23730 9347 9550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 10724 9654 gene locus_tag LOCUS_23740 gene thrC 10724 9654 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228697.1 protein_id gnl|my_center|LOCUS_23740 11342 10785 gene locus_tag LOCUS_23750 11342 10785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 13188 11617 gene locus_tag LOCUS_23760 gene hutU 13188 11617 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256864.1 protein_id gnl|my_center|LOCUS_23760 14171 14052 gene locus_tag LOCUS_23770 14171 14052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 14275 15042 gene locus_tag LOCUS_23780 14275 15042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 >Feature sequence085 141 743 gene locus_tag LOCUS_23790 141 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 795 1385 gene locus_tag LOCUS_23800 795 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 4010 1434 gene locus_tag LOCUS_23810 4010 1434 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256479.1 protein_id gnl|my_center|LOCUS_23810 4320 4099 gene locus_tag LOCUS_23820 4320 4099 CDS product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256480.1 protein_id gnl|my_center|LOCUS_23820 4673 4395 gene locus_tag LOCUS_23830 4673 4395 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660478.1 protein_id gnl|my_center|LOCUS_23830 4879 7407 gene locus_tag LOCUS_23840 4879 7407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 8632 7421 gene locus_tag LOCUS_23850 8632 7421 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258870.1 protein_id gnl|my_center|LOCUS_23850 9806 8697 gene locus_tag LOCUS_23860 9806 8697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 10834 9812 gene locus_tag LOCUS_23870 gene tsaD 10834 9812 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244138.1 protein_id gnl|my_center|LOCUS_23870 13169 11373 gene locus_tag LOCUS_23880 13169 11373 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_23880 <14804 13193 gene locus_tag LOCUS_23890 <14804 13193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680842.1:ABC transporter ATP-binding protein >Feature sequence086 3005 807 gene locus_tag LOCUS_23900 3005 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 4121 3171 gene locus_tag LOCUS_23910 4121 3171 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_23910 5284 4118 gene locus_tag LOCUS_23920 5284 4118 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975045.1 protein_id gnl|my_center|LOCUS_23920 6283 5309 gene locus_tag LOCUS_23930 6283 5309 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259700.1 protein_id gnl|my_center|LOCUS_23930 7398 6283 gene locus_tag LOCUS_23940 7398 6283 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259701.1 protein_id gnl|my_center|LOCUS_23940 8858 7395 gene locus_tag LOCUS_23950 8858 7395 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259702.1 protein_id gnl|my_center|LOCUS_23950 10153 9029 gene locus_tag LOCUS_23960 10153 9029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 10073 10264 gene locus_tag LOCUS_23970 10073 10264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 10504 12246 gene locus_tag LOCUS_23980 10504 12246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 12243 12818 gene locus_tag LOCUS_23990 gene def 12243 12818 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948295.1 protein_id gnl|my_center|LOCUS_23990 12838 13128 gene locus_tag LOCUS_24000 gene gatC 12838 13128 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893732.1 protein_id gnl|my_center|LOCUS_24000 13130 14593 gene locus_tag LOCUS_24010 gene gatA 13130 14593 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_24010 >Feature sequence087 277 1071 gene locus_tag LOCUS_24020 277 1071 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259383.1 protein_id gnl|my_center|LOCUS_24020 1068 2045 gene locus_tag LOCUS_24030 1068 2045 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072965.1 protein_id gnl|my_center|LOCUS_24030 2052 3059 gene locus_tag LOCUS_24040 gene rsgA 2052 3059 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257131.1 protein_id gnl|my_center|LOCUS_24040 3538 3116 gene locus_tag LOCUS_24050 3538 3116 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816436.1 protein_id gnl|my_center|LOCUS_24050 4547 3540 gene locus_tag LOCUS_24060 4547 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 5136 4675 gene locus_tag LOCUS_24070 5136 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 5678 5310 gene locus_tag LOCUS_24080 5678 5310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 5750 6706 gene locus_tag LOCUS_24090 5750 6706 CDS product DUF92 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257179.1 protein_id gnl|my_center|LOCUS_24090 6810 7568 gene locus_tag LOCUS_24100 6810 7568 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256714.1 protein_id gnl|my_center|LOCUS_24100 7595 10009 gene locus_tag LOCUS_24110 7595 10009 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927835.1 protein_id gnl|my_center|LOCUS_24110 12228 10183 gene locus_tag LOCUS_24120 12228 10183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 12878 12306 gene locus_tag LOCUS_24130 12878 12306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 13245 12961 gene locus_tag LOCUS_24140 13245 12961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 14223 13297 gene locus_tag LOCUS_24150 14223 13297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 >Feature sequence088 2435 1005 gene locus_tag LOCUS_24160 gene crtI 2435 1005 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134752840.1 protein_id gnl|my_center|LOCUS_24160 3469 2588 gene locus_tag LOCUS_24170 3469 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 8480 3708 gene locus_tag LOCUS_24180 8480 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 9822 8572 gene locus_tag LOCUS_24190 9822 8572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 10213 12345 gene locus_tag LOCUS_24200 10213 12345 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258368.1 protein_id gnl|my_center|LOCUS_24200 12391 12696 gene locus_tag LOCUS_24210 12391 12696 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_24210 >Feature sequence089 <1 560 gene locus_tag LOCUS_24220 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707170.1:pseudouridine-5'-phosphate glycosidase 848 2275 gene locus_tag LOCUS_24230 gene serS 848 2275 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256350.1 protein_id gnl|my_center|LOCUS_24230 3102 2365 gene locus_tag LOCUS_24240 3102 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 4153 3197 gene locus_tag LOCUS_24250 4153 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 4461 4378 gene locus_tag LOCUS_t00350 4461 4378 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5399 4521 gene locus_tag LOCUS_24260 5399 4521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 6818 5421 gene locus_tag LOCUS_24270 6818 5421 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257411.1 protein_id gnl|my_center|LOCUS_24270 7260 6823 gene locus_tag LOCUS_24280 7260 6823 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088299.1 protein_id gnl|my_center|LOCUS_24280 8785 7388 gene locus_tag LOCUS_24290 8785 7388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 8961 10394 gene locus_tag LOCUS_24300 8961 10394 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421588.1 protein_id gnl|my_center|LOCUS_24300 12108 10450 gene locus_tag LOCUS_24310 12108 10450 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257008.1 protein_id gnl|my_center|LOCUS_24310 12346 13125 gene locus_tag LOCUS_24320 gene fabG 12346 13125 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402833.1 protein_id gnl|my_center|LOCUS_24320 <14066 13164 gene locus_tag LOCUS_24330 <14066 13164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004538553.1:DMT family transporter >Feature sequence090 <1 708 gene locus_tag LOCUS_24340 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258223.1:acyl-CoA carboxylase subunit beta 752 2251 gene locus_tag LOCUS_24350 gene accC 752 2251 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393033.1 protein_id gnl|my_center|LOCUS_24350 2268 2765 gene locus_tag LOCUS_24360 2268 2765 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259271.1 protein_id gnl|my_center|LOCUS_24360 4740 2773 gene locus_tag LOCUS_24370 4740 2773 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258686.1 protein_id gnl|my_center|LOCUS_24370 5071 4721 gene locus_tag LOCUS_24380 5071 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 5429 5088 gene locus_tag LOCUS_24390 5429 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 6655 5501 gene locus_tag LOCUS_24400 6655 5501 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207707.1 protein_id gnl|my_center|LOCUS_24400 7718 6693 gene locus_tag LOCUS_24410 7718 6693 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256339.1 protein_id gnl|my_center|LOCUS_24410 7876 7751 gene locus_tag LOCUS_24420 7876 7751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 9567 7954 gene locus_tag LOCUS_24430 9567 7954 CDS product propionyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061466.1 protein_id gnl|my_center|LOCUS_24430 10066 9620 gene locus_tag LOCUS_24440 10066 9620 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_24440 10514 10017 gene locus_tag LOCUS_24450 10514 10017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 10826 10524 gene locus_tag LOCUS_24460 10826 10524 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939018.1 protein_id gnl|my_center|LOCUS_24460 11142 10852 gene locus_tag LOCUS_24470 11142 10852 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010201208.1 protein_id gnl|my_center|LOCUS_24470 11446 11135 gene locus_tag LOCUS_24480 11446 11135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099360.1 protein_id gnl|my_center|LOCUS_24480 12381 11512 gene locus_tag LOCUS_24490 12381 11512 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525204.1 protein_id gnl|my_center|LOCUS_24490 12500 12988 gene locus_tag LOCUS_24500 12500 12988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 13316 13020 gene locus_tag LOCUS_24510 13316 13020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 >Feature sequence091 312 1493 gene locus_tag LOCUS_24520 312 1493 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975518.1 protein_id gnl|my_center|LOCUS_24520 1763 2032 gene locus_tag LOCUS_24530 gene rpsO 1763 2032 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814361.1 protein_id gnl|my_center|LOCUS_24530 2322 4556 gene locus_tag LOCUS_24540 gene pnp 2322 4556 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257913.1 protein_id gnl|my_center|LOCUS_24540 4637 5938 gene locus_tag LOCUS_24550 4637 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 5999 7504 gene locus_tag LOCUS_24560 5999 7504 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202555.1 protein_id gnl|my_center|LOCUS_24560 7541 8323 gene locus_tag LOCUS_24570 7541 8323 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275354.1 protein_id gnl|my_center|LOCUS_24570 8331 9332 gene locus_tag LOCUS_24580 8331 9332 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256245.1 protein_id gnl|my_center|LOCUS_24580 10325 9345 gene locus_tag LOCUS_24590 gene moaA 10325 9345 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257065.1 protein_id gnl|my_center|LOCUS_24590 10585 11643 gene locus_tag LOCUS_24600 10585 11643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 11757 13646 gene locus_tag LOCUS_24610 11757 13646 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_24610 >Feature sequence092 226 795 gene locus_tag LOCUS_24620 226 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 885 2201 gene locus_tag LOCUS_24630 885 2201 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361893.1 protein_id gnl|my_center|LOCUS_24630 2332 3360 gene locus_tag LOCUS_24640 2332 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 3624 3376 gene locus_tag LOCUS_24650 3624 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 3731 4636 gene locus_tag LOCUS_24660 3731 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 6369 4690 gene locus_tag LOCUS_24670 6369 4690 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257697.1 protein_id gnl|my_center|LOCUS_24670 6632 6560 gene locus_tag LOCUS_t00360 6632 6560 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 7741 6764 gene locus_tag LOCUS_24680 7741 6764 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921611.1 protein_id gnl|my_center|LOCUS_24680 8316 7882 gene locus_tag LOCUS_24690 8316 7882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 8605 8396 gene locus_tag LOCUS_24700 8605 8396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 8837 11884 gene locus_tag LOCUS_24710 8837 11884 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259651.1 protein_id gnl|my_center|LOCUS_24710 11894 12109 gene locus_tag LOCUS_24720 11894 12109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 12530 12147 gene locus_tag LOCUS_24730 12530 12147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 12774 12559 gene locus_tag LOCUS_24740 12774 12559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 >Feature sequence093 216 629 gene locus_tag LOCUS_24750 216 629 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922377.1 protein_id gnl|my_center|LOCUS_24750 795 1142 gene locus_tag LOCUS_24760 795 1142 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814298.1 protein_id gnl|my_center|LOCUS_24760 1135 2121 gene locus_tag LOCUS_24770 1135 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 2599 2180 gene locus_tag LOCUS_24780 2599 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 2756 2592 gene locus_tag LOCUS_24790 2756 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 3060 7175 gene locus_tag LOCUS_24800 3060 7175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 7708 8040 gene locus_tag LOCUS_24810 7708 8040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 8103 9554 gene locus_tag LOCUS_24820 8103 9554 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141660.1 protein_id gnl|my_center|LOCUS_24820 9584 11704 gene locus_tag LOCUS_24830 gene glgX 9584 11704 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122228.1 protein_id gnl|my_center|LOCUS_24830 11701 12126 gene locus_tag LOCUS_24840 11701 12126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 >Feature sequence094 2177 3058 gene locus_tag LOCUS_24850 2177 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 3136 3714 gene locus_tag LOCUS_24860 3136 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 3775 4464 gene locus_tag LOCUS_24870 3775 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 4493 4879 gene locus_tag LOCUS_24880 4493 4879 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233882.1 protein_id gnl|my_center|LOCUS_24880 5179 5391 gene locus_tag LOCUS_24890 5179 5391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 5555 7165 gene locus_tag LOCUS_24900 5555 7165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 7213 7875 gene locus_tag LOCUS_24910 7213 7875 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_24910 8984 7872 gene locus_tag LOCUS_24920 8984 7872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 9398 9877 gene locus_tag LOCUS_24930 9398 9877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 9874 11670 gene locus_tag LOCUS_24940 9874 11670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 12195 13262 gene locus_tag LOCUS_24950 12195 13262 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941317.1 protein_id gnl|my_center|LOCUS_24950 >Feature sequence095 207 851 gene locus_tag LOCUS_24960 207 851 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922255.1 protein_id gnl|my_center|LOCUS_24960 1199 3034 gene locus_tag LOCUS_24970 1199 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 3071 3721 gene locus_tag LOCUS_24980 3071 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 5984 3774 gene locus_tag LOCUS_24990 5984 3774 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083633.1 protein_id gnl|my_center|LOCUS_24990 6203 7354 gene locus_tag LOCUS_25000 6203 7354 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_25000 7434 7883 gene locus_tag LOCUS_25010 7434 7883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 8682 7909 gene locus_tag LOCUS_25020 8682 7909 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057760.1 protein_id gnl|my_center|LOCUS_25020 11189 8682 gene locus_tag LOCUS_25030 gene ptsP 11189 8682 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938280.1 protein_id gnl|my_center|LOCUS_25030 11742 11161 gene locus_tag LOCUS_25040 11742 11161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 11992 11753 gene locus_tag LOCUS_25050 11992 11753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 12434 12033 gene locus_tag LOCUS_25060 12434 12033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 12861 12457 gene locus_tag LOCUS_25070 12861 12457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 >Feature sequence096 431 1780 gene locus_tag LOCUS_25080 gene mgtE 431 1780 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228410.1 protein_id gnl|my_center|LOCUS_25080 1990 2214 gene locus_tag LOCUS_25090 1990 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 3646 2234 gene locus_tag LOCUS_25100 3646 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 5058 3643 gene locus_tag LOCUS_25110 5058 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 6871 5084 gene locus_tag LOCUS_25120 6871 5084 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776685.1 protein_id gnl|my_center|LOCUS_25120 7415 7603 gene locus_tag LOCUS_25130 7415 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25130 7658 8221 gene locus_tag LOCUS_25140 7658 8221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25140 8405 8202 gene locus_tag LOCUS_25150 8405 8202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 8621 11722 gene locus_tag LOCUS_25160 8621 11722 CDS product DUF499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228376.1 protein_id gnl|my_center|LOCUS_25160 11719 12621 gene locus_tag LOCUS_25170 11719 12621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 >Feature sequence097 1703 852 gene locus_tag LOCUS_25180 gene proC 1703 852 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258104.1 protein_id gnl|my_center|LOCUS_25180 2840 1704 gene locus_tag LOCUS_25190 gene menC 2840 1704 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256750.1 protein_id gnl|my_center|LOCUS_25190 3720 2830 gene locus_tag LOCUS_25200 3720 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257044.1 protein_id gnl|my_center|LOCUS_25200 4029 6551 gene locus_tag LOCUS_25210 4029 6551 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 protein_id gnl|my_center|LOCUS_25210 6554 7939 gene locus_tag LOCUS_25220 6554 7939 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408499.1 protein_id gnl|my_center|LOCUS_25220 8460 8011 gene locus_tag LOCUS_25230 8460 8011 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 protein_id gnl|my_center|LOCUS_25230 9656 8544 gene locus_tag LOCUS_25240 gene galK 9656 8544 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707767.1 protein_id gnl|my_center|LOCUS_25240 10717 9740 gene locus_tag LOCUS_25250 10717 9740 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815232.1 protein_id gnl|my_center|LOCUS_25250 11781 10945 gene locus_tag LOCUS_25260 11781 10945 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393323.1 protein_id gnl|my_center|LOCUS_25260 12689 11781 gene locus_tag LOCUS_25270 gene modA 12689 11781 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393324.1 protein_id gnl|my_center|LOCUS_25270 >Feature sequence098 <1 1034 gene locus_tag LOCUS_25280 <1 1034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582502.1:Ni/Fe hydrogenase subunit alpha 1071 1550 gene locus_tag LOCUS_25290 1071 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 2789 1686 gene locus_tag LOCUS_25300 2789 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 3351 2812 gene locus_tag LOCUS_25310 3351 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248978.1 protein_id gnl|my_center|LOCUS_25310 4001 3480 gene locus_tag LOCUS_25320 4001 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 5977 4037 gene locus_tag LOCUS_25330 5977 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 6870 6058 gene locus_tag LOCUS_25340 6870 6058 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081258.1 protein_id gnl|my_center|LOCUS_25340 7975 6857 gene locus_tag LOCUS_25350 7975 6857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258216.1 protein_id gnl|my_center|LOCUS_25350 8122 9075 gene locus_tag LOCUS_25360 8122 9075 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_25360 9083 9859 gene locus_tag LOCUS_25370 9083 9859 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259513.1 protein_id gnl|my_center|LOCUS_25370 9961 11766 gene locus_tag LOCUS_25380 gene lepA 9961 11766 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258913.1 protein_id gnl|my_center|LOCUS_25380 >Feature sequence099 598 1305 gene locus_tag LOCUS_25390 gene alaXM 598 1305 CDS product alanyl-tRNA editing protein AlaXM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762783.1 protein_id gnl|my_center|LOCUS_25390 1339 2001 gene locus_tag LOCUS_25400 1339 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 2032 5424 gene locus_tag LOCUS_25410 gene ileS 2032 5424 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966319.1 protein_id gnl|my_center|LOCUS_25410 5514 7535 gene locus_tag LOCUS_25420 5514 7535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 7620 8903 gene locus_tag LOCUS_25430 7620 8903 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909096.1 protein_id gnl|my_center|LOCUS_25430 8900 11902 gene locus_tag LOCUS_25440 8900 11902 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142856.1 protein_id gnl|my_center|LOCUS_25440 12506 11949 gene locus_tag LOCUS_25450 12506 11949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 >Feature sequence100 1618 914 gene locus_tag LOCUS_25460 1618 914 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720869.1 protein_id gnl|my_center|LOCUS_25460 1762 2853 gene locus_tag LOCUS_25470 1762 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 3230 2925 gene locus_tag LOCUS_25480 3230 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 4387 3242 gene locus_tag LOCUS_25490 4387 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 4930 4610 gene locus_tag LOCUS_25500 4930 4610 CDS product bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080101.1 protein_id gnl|my_center|LOCUS_25500 5324 4923 gene locus_tag LOCUS_25510 5324 4923 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903848.1 protein_id gnl|my_center|LOCUS_25510 6589 5360 gene locus_tag LOCUS_25520 6589 5360 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259320.1 protein_id gnl|my_center|LOCUS_25520 8046 6739 gene locus_tag LOCUS_25530 gene sufD 8046 6739 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922298.1 protein_id gnl|my_center|LOCUS_25530 9475 8039 gene locus_tag LOCUS_25540 gene sufB 9475 8039 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976894.1 protein_id gnl|my_center|LOCUS_25540 10258 9476 gene locus_tag LOCUS_25550 gene sufC 10258 9476 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259318.1 protein_id gnl|my_center|LOCUS_25550 10520 11170 gene locus_tag LOCUS_25560 10520 11170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 11222 11527 gene locus_tag LOCUS_25570 11222 11527 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258652.1 protein_id gnl|my_center|LOCUS_25570 12039 11524 gene locus_tag LOCUS_25580 12039 11524 CDS product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259311.1 protein_id gnl|my_center|LOCUS_25580 >Feature sequence101 645 3197 gene locus_tag LOCUS_25590 645 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 3334 4542 gene locus_tag LOCUS_25600 3334 4542 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258522.1 protein_id gnl|my_center|LOCUS_25600 7202 4599 gene locus_tag LOCUS_25610 7202 4599 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257770.1 protein_id gnl|my_center|LOCUS_25610 7324 8154 gene locus_tag LOCUS_25620 7324 8154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 8211 8408 gene locus_tag LOCUS_25630 8211 8408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 9115 8495 gene locus_tag LOCUS_25640 9115 8495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 9402 10556 gene locus_tag LOCUS_25650 9402 10556 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227919.1 protein_id gnl|my_center|LOCUS_25650 >Feature sequence102 894 1397 gene locus_tag LOCUS_25660 894 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 1398 1604 gene locus_tag LOCUS_25670 1398 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 2822 3523 gene locus_tag LOCUS_25680 2822 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 3698 4825 gene locus_tag LOCUS_25690 3698 4825 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257445.1 protein_id gnl|my_center|LOCUS_25690 4907 5992 gene locus_tag LOCUS_25700 gene leuB 4907 5992 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255951.1 protein_id gnl|my_center|LOCUS_25700 7625 5976 gene locus_tag LOCUS_25710 7625 5976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 7887 8438 gene locus_tag LOCUS_25720 7887 8438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 8441 10336 gene locus_tag LOCUS_25730 8441 10336 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257580.1 protein_id gnl|my_center|LOCUS_25730 >Feature sequence103 <1 885 gene locus_tag LOCUS_25740 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256475.1:tyrosine phenol-lyase 2524 980 gene locus_tag LOCUS_25750 2524 980 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405139.1 protein_id gnl|my_center|LOCUS_25750 3893 2724 gene locus_tag LOCUS_25760 3893 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 5199 4141 gene locus_tag LOCUS_25770 5199 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 6257 5313 gene locus_tag LOCUS_25780 gene era 6257 5313 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288753.1 protein_id gnl|my_center|LOCUS_25780 7690 6257 gene locus_tag LOCUS_25790 7690 6257 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174796.1 protein_id gnl|my_center|LOCUS_25790 8595 7732 gene locus_tag LOCUS_25800 8595 7732 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941312.1 protein_id gnl|my_center|LOCUS_25800 <10950 9084 gene locus_tag LOCUS_25810 <10950 9084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256318.1:SdrD B-like domain-containing protein >Feature sequence104 1842 1372 gene locus_tag LOCUS_25820 1842 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 2668 1994 gene locus_tag LOCUS_25830 2668 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 2909 3820 gene locus_tag LOCUS_25840 gene pdxS 2909 3820 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391558.1 protein_id gnl|my_center|LOCUS_25840 4115 4567 gene locus_tag LOCUS_25850 4115 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 5840 4584 gene locus_tag LOCUS_25860 5840 4584 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393494.1 protein_id gnl|my_center|LOCUS_25860 6790 5843 gene locus_tag LOCUS_25870 gene arcC 6790 5843 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393607.1 protein_id gnl|my_center|LOCUS_25870 7888 6914 gene locus_tag LOCUS_25880 gene argF 7888 6914 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393492.1 protein_id gnl|my_center|LOCUS_25880 9147 7942 gene locus_tag LOCUS_25890 9147 7942 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393148.1 protein_id gnl|my_center|LOCUS_25890 9985 9245 gene locus_tag LOCUS_25900 9985 9245 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360115.1 protein_id gnl|my_center|LOCUS_25900 10244 10318 gene locus_tag LOCUS_t00370 10244 10318 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence105 2913 442 gene locus_tag LOCUS_25910 2913 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 4070 2922 gene locus_tag LOCUS_25920 4070 2922 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_25920 5013 4201 gene locus_tag LOCUS_25930 gene cutB 5013 4201 CDS product glyceraldehyde dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979850.1 protein_id gnl|my_center|LOCUS_25930 5347 5925 gene locus_tag LOCUS_25940 5347 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 6044 6643 gene locus_tag LOCUS_25950 6044 6643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 7188 6730 gene locus_tag LOCUS_25960 7188 6730 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027944.1 protein_id gnl|my_center|LOCUS_25960 8917 7193 gene locus_tag LOCUS_25970 8917 7193 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256851.1 protein_id gnl|my_center|LOCUS_25970 9059 9958 gene locus_tag LOCUS_25980 9059 9958 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408112.1 protein_id gnl|my_center|LOCUS_25980 10101 10493 gene locus_tag LOCUS_25990 10101 10493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 >Feature sequence106 1330 308 gene locus_tag LOCUS_26000 1330 308 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256438.1 protein_id gnl|my_center|LOCUS_26000 2254 1400 gene locus_tag LOCUS_26010 2254 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 3916 2384 gene locus_tag LOCUS_26020 gene rny 3916 2384 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258580.1 protein_id gnl|my_center|LOCUS_26020 4558 3929 gene locus_tag LOCUS_26030 4558 3929 CDS product RecX family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257010.1 protein_id gnl|my_center|LOCUS_26030 6033 5023 gene locus_tag LOCUS_26040 gene recA 6033 5023 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965121.1 protein_id gnl|my_center|LOCUS_26040 6128 7072 gene locus_tag LOCUS_26050 6128 7072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 7160 7456 gene locus_tag LOCUS_26060 7160 7456 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124644.1 protein_id gnl|my_center|LOCUS_26060 7460 8461 gene locus_tag LOCUS_26070 gene argF 7460 8461 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095369.1 protein_id gnl|my_center|LOCUS_26070 10305 8539 gene locus_tag LOCUS_26080 10305 8539 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942518.1 protein_id gnl|my_center|LOCUS_26080 >Feature sequence107 1512 508 gene locus_tag LOCUS_26090 1512 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 1645 2910 gene locus_tag LOCUS_26100 1645 2910 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366378.1 protein_id gnl|my_center|LOCUS_26100 3696 3118 gene locus_tag LOCUS_26110 3696 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 8920 3926 gene locus_tag LOCUS_26120 8920 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 9234 9950 gene locus_tag LOCUS_26130 9234 9950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 10170 10535 gene locus_tag LOCUS_26140 10170 10535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 >Feature sequence108 2600 1071 gene locus_tag LOCUS_26150 2600 1071 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_26150 3255 2620 gene locus_tag LOCUS_26160 3255 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 3767 4195 gene locus_tag LOCUS_26170 3767 4195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 5868 4234 gene locus_tag LOCUS_26180 5868 4234 CDS product propionyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257900.1 protein_id gnl|my_center|LOCUS_26180 6927 5890 gene locus_tag LOCUS_26190 6927 5890 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_26190 7450 6938 gene locus_tag LOCUS_26200 7450 6938 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722787.1 protein_id gnl|my_center|LOCUS_26200 7678 8208 gene locus_tag LOCUS_26210 7678 8208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 8252 10003 gene locus_tag LOCUS_26220 8252 10003 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870103.1 protein_id gnl|my_center|LOCUS_26220 >Feature sequence109 802 158 gene locus_tag LOCUS_26230 802 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 1466 2596 gene locus_tag LOCUS_26240 1466 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065474.1 protein_id gnl|my_center|LOCUS_26240 2721 3875 gene locus_tag LOCUS_26250 2721 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 4659 4039 gene locus_tag LOCUS_26260 4659 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 5048 4677 gene locus_tag LOCUS_26270 5048 4677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 5853 5275 gene locus_tag LOCUS_26280 5853 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 5816 6043 gene locus_tag LOCUS_26290 5816 6043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 6040 6237 gene locus_tag LOCUS_26300 6040 6237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 6410 6583 gene locus_tag LOCUS_26310 6410 6583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 7104 6715 gene locus_tag LOCUS_26320 7104 6715 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258443.1 protein_id gnl|my_center|LOCUS_26320 7317 7793 gene locus_tag LOCUS_26330 7317 7793 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246360.1 protein_id gnl|my_center|LOCUS_26330 7933 7790 gene locus_tag LOCUS_26340 7933 7790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 8357 7974 gene locus_tag LOCUS_26350 8357 7974 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_26350 8581 8354 gene locus_tag LOCUS_26360 8581 8354 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143545.1 protein_id gnl|my_center|LOCUS_26360 9585 8656 gene locus_tag LOCUS_26370 9585 8656 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228215.1 protein_id gnl|my_center|LOCUS_26370 >Feature sequence110 633 361 gene locus_tag LOCUS_26380 633 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 1683 661 gene locus_tag LOCUS_26390 1683 661 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533466.1 protein_id gnl|my_center|LOCUS_26390 2315 1935 gene locus_tag LOCUS_26400 2315 1935 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603272.1 protein_id gnl|my_center|LOCUS_26400 6391 2444 gene locus_tag LOCUS_26410 6391 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 8402 6381 gene locus_tag LOCUS_26420 8402 6381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 9925 8468 gene locus_tag LOCUS_26430 gene gatB 9925 8468 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_26430 >Feature sequence111 1339 125 gene locus_tag LOCUS_26440 1339 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 1739 1344 gene locus_tag LOCUS_26450 1739 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 2208 1741 gene locus_tag LOCUS_26460 2208 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 4944 2305 gene locus_tag LOCUS_26470 gene xdh 4944 2305 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393495.1 protein_id gnl|my_center|LOCUS_26470 5767 5081 gene locus_tag LOCUS_26480 5767 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 7354 5957 gene locus_tag LOCUS_26490 7354 5957 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728048.1 protein_id gnl|my_center|LOCUS_26490 8145 7678 gene locus_tag LOCUS_26500 8145 7678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 8532 8287 gene locus_tag LOCUS_26510 8532 8287 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390667.1 protein_id gnl|my_center|LOCUS_26510 9193 8789 gene locus_tag LOCUS_26520 9193 8789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 9860 9222 gene locus_tag LOCUS_26530 9860 9222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 >Feature sequence112 1500 205 gene locus_tag LOCUS_26540 gene murA 1500 205 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257774.1 protein_id gnl|my_center|LOCUS_26540 1594 2355 gene locus_tag LOCUS_26550 1594 2355 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460483.1 protein_id gnl|my_center|LOCUS_26550 3028 2405 gene locus_tag LOCUS_26560 gene rdgB 3028 2405 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256394.1 protein_id gnl|my_center|LOCUS_26560 3112 3636 gene locus_tag LOCUS_26570 3112 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 3661 4929 gene locus_tag LOCUS_26580 gene obgE 3661 4929 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392098.1 protein_id gnl|my_center|LOCUS_26580 4963 6174 gene locus_tag LOCUS_26590 4963 6174 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016645.1 protein_id gnl|my_center|LOCUS_26590 6207 7808 gene locus_tag LOCUS_26600 6207 7808 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258461.1 protein_id gnl|my_center|LOCUS_26600 9028 7868 gene locus_tag LOCUS_26610 9028 7868 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259418.1 protein_id gnl|my_center|LOCUS_26610 <10017 9160 gene locus_tag LOCUS_26620 <10017 9160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259178.1:leucyl aminopeptidase >Feature sequence113 751 1272 gene locus_tag LOCUS_26630 751 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 2890 2333 gene locus_tag LOCUS_26640 2890 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 3302 2946 gene locus_tag LOCUS_26650 3302 2946 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967147.1 protein_id gnl|my_center|LOCUS_26650 3710 3414 gene locus_tag LOCUS_26660 3710 3414 CDS product DUF4287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225328.1 protein_id gnl|my_center|LOCUS_26660 4096 4896 gene locus_tag LOCUS_26670 gene dapB 4096 4896 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257160.1 protein_id gnl|my_center|LOCUS_26670 4965 5195 gene locus_tag LOCUS_26680 4965 5195 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_26680 5568 6278 gene locus_tag LOCUS_26690 5568 6278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679004.1 protein_id gnl|my_center|LOCUS_26690 6333 7547 gene locus_tag LOCUS_26700 6333 7547 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027385545.1 protein_id gnl|my_center|LOCUS_26700 8871 7651 gene locus_tag LOCUS_26710 8871 7651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 9098 9304 gene locus_tag LOCUS_26720 9098 9304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 9672 9268 gene locus_tag LOCUS_26730 9672 9268 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249134.1 protein_id gnl|my_center|LOCUS_26730 >Feature sequence114 1887 2558 gene locus_tag LOCUS_26740 1887 2558 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964265.1 protein_id gnl|my_center|LOCUS_26740 3179 2577 gene locus_tag LOCUS_26750 3179 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 3297 4115 gene locus_tag LOCUS_26760 gene pyrF 3297 4115 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 protein_id gnl|my_center|LOCUS_26760 4199 4885 gene locus_tag LOCUS_26770 4199 4885 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257571.1 protein_id gnl|my_center|LOCUS_26770 7314 4999 gene locus_tag LOCUS_26780 7314 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 8954 7437 gene locus_tag LOCUS_26790 8954 7437 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660465.1 protein_id gnl|my_center|LOCUS_26790 8965 9291 gene locus_tag LOCUS_26800 8965 9291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 >Feature sequence115 2569 1403 gene locus_tag LOCUS_26810 2569 1403 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931942.1 protein_id gnl|my_center|LOCUS_26810 4859 2622 gene locus_tag LOCUS_26820 4859 2622 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256758.1 protein_id gnl|my_center|LOCUS_26820 5163 5234 gene locus_tag LOCUS_t00380 5163 5234 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8310 5290 gene locus_tag LOCUS_26830 8310 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 8388 9254 gene locus_tag LOCUS_26840 8388 9254 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064968.1 protein_id gnl|my_center|LOCUS_26840 >Feature sequence116 56 1636 gene locus_tag LOCUS_26850 56 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 1678 2436 gene locus_tag LOCUS_26860 1678 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 3044 2412 gene locus_tag LOCUS_26870 3044 2412 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942571.1 protein_id gnl|my_center|LOCUS_26870 3046 3747 gene locus_tag LOCUS_26880 3046 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 4886 3750 gene locus_tag LOCUS_26890 4886 3750 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_26890 5080 6990 gene locus_tag LOCUS_26900 5080 6990 CDS product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257484.1 protein_id gnl|my_center|LOCUS_26900 7221 7012 gene locus_tag LOCUS_26910 7221 7012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 9434 7650 gene locus_tag LOCUS_26920 gene aspS 9434 7650 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258183.1 protein_id gnl|my_center|LOCUS_26920 >Feature sequence117 80 1987 gene locus_tag LOCUS_26930 80 1987 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222688.1 protein_id gnl|my_center|LOCUS_26930 1995 3626 gene locus_tag LOCUS_26940 1995 3626 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098467.1 protein_id gnl|my_center|LOCUS_26940 3804 4472 gene locus_tag LOCUS_26950 3804 4472 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393557.1 protein_id gnl|my_center|LOCUS_26950 5484 4813 gene locus_tag LOCUS_26960 5484 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 6981 5560 gene locus_tag LOCUS_26970 6981 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 7294 8166 gene locus_tag LOCUS_26980 7294 8166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 8156 8440 gene locus_tag LOCUS_26990 8156 8440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 >Feature sequence118 1158 2114 gene locus_tag LOCUS_27000 gene selD 1158 2114 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301201.1 protein_id gnl|my_center|LOCUS_27000 2135 3208 gene locus_tag LOCUS_27010 gene pepQ 2135 3208 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411056.1 protein_id gnl|my_center|LOCUS_27010 4415 3210 gene locus_tag LOCUS_27020 4415 3210 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259387.1 protein_id gnl|my_center|LOCUS_27020 5533 4412 gene locus_tag LOCUS_27030 5533 4412 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257269.1 protein_id gnl|my_center|LOCUS_27030 5702 6967 gene locus_tag LOCUS_27040 5702 6967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 6996 8870 gene locus_tag LOCUS_27050 gene selB 6996 8870 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256152.1 protein_id gnl|my_center|LOCUS_27050 >Feature sequence119 <1 696 gene locus_tag LOCUS_27060 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257949.1:MFS transporter 1526 759 gene locus_tag LOCUS_27070 gene surE 1526 759 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258539.1 protein_id gnl|my_center|LOCUS_27070 1809 1543 gene locus_tag LOCUS_27080 1809 1543 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870423.1 protein_id gnl|my_center|LOCUS_27080 2021 1806 gene locus_tag LOCUS_27090 2021 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 2441 2169 gene locus_tag LOCUS_27100 2441 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 2746 2474 gene locus_tag LOCUS_27110 2746 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 3649 2771 gene locus_tag LOCUS_27120 3649 2771 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727285.1 protein_id gnl|my_center|LOCUS_27120 4176 3757 gene locus_tag LOCUS_27130 4176 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 6343 4253 gene locus_tag LOCUS_27140 6343 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 6692 7984 gene locus_tag LOCUS_27150 6692 7984 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_27150 8031 9182 gene locus_tag LOCUS_27160 gene meaB 8031 9182 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258366.1 protein_id gnl|my_center|LOCUS_27160 >Feature sequence120 793 2265 gene locus_tag LOCUS_27170 793 2265 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_27170 2277 3065 gene locus_tag LOCUS_27180 2277 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 3242 3889 gene locus_tag LOCUS_27190 3242 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 4315 3911 gene locus_tag LOCUS_27200 4315 3911 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679941.1 protein_id gnl|my_center|LOCUS_27200 4556 4320 gene locus_tag LOCUS_27210 4556 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 4690 6075 gene locus_tag LOCUS_27220 4690 6075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 6747 6064 gene locus_tag LOCUS_27230 6747 6064 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943121.1 protein_id gnl|my_center|LOCUS_27230 9155 6744 gene locus_tag LOCUS_27240 9155 6744 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943120.1 protein_id gnl|my_center|LOCUS_27240 >Feature sequence121 835 3438 gene locus_tag LOCUS_27250 gene clpB 835 3438 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459822.1 protein_id gnl|my_center|LOCUS_27250 3541 3786 gene locus_tag LOCUS_27260 3541 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 3786 3998 gene locus_tag LOCUS_27270 3786 3998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 4009 4698 gene locus_tag LOCUS_27280 4009 4698 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929061.1 protein_id gnl|my_center|LOCUS_27280 5230 4700 gene locus_tag LOCUS_27290 5230 4700 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258997.1 protein_id gnl|my_center|LOCUS_27290 5558 5995 gene locus_tag LOCUS_27300 5558 5995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 6452 6084 gene locus_tag LOCUS_27310 6452 6084 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990749.1 protein_id gnl|my_center|LOCUS_27310 6672 8072 gene locus_tag LOCUS_27320 gene hydA 6672 8072 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228420.1 protein_id gnl|my_center|LOCUS_27320 >Feature sequence122 1 1395 gene locus_tag LOCUS_27330 1 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 1432 1680 gene locus_tag LOCUS_27340 1432 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888728.1 protein_id gnl|my_center|LOCUS_27340 3217 1814 gene locus_tag LOCUS_27350 gene glnA 3217 1814 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257332.1 protein_id gnl|my_center|LOCUS_27350 4012 3461 gene locus_tag LOCUS_27360 4012 3461 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964725.1 protein_id gnl|my_center|LOCUS_27360 5690 4041 gene locus_tag LOCUS_27370 5690 4041 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020870.1 protein_id gnl|my_center|LOCUS_27370 6721 5693 gene locus_tag LOCUS_27380 6721 5693 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226472.1 protein_id gnl|my_center|LOCUS_27380 7147 6725 gene locus_tag LOCUS_27390 7147 6725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 7367 7140 gene locus_tag LOCUS_27400 7367 7140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 7890 7498 gene locus_tag LOCUS_27410 7890 7498 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413174.1 protein_id gnl|my_center|LOCUS_27410 8138 7881 gene locus_tag LOCUS_27420 8138 7881 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770787.1 protein_id gnl|my_center|LOCUS_27420 8313 8240 gene locus_tag LOCUS_t00390 8313 8240 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence123 1407 736 gene locus_tag LOCUS_27430 1407 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 1601 2272 gene locus_tag LOCUS_27440 1601 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 2984 2316 gene locus_tag LOCUS_27450 2984 2316 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143139.1 protein_id gnl|my_center|LOCUS_27450 3976 3047 gene locus_tag LOCUS_27460 3976 3047 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480088.1 protein_id gnl|my_center|LOCUS_27460 5224 3995 gene locus_tag LOCUS_27470 5224 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 6640 5252 gene locus_tag LOCUS_27480 6640 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 7928 6645 gene locus_tag LOCUS_27490 7928 6645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 >Feature sequence124 934 221 gene locus_tag LOCUS_27500 934 221 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909121.1 protein_id gnl|my_center|LOCUS_27500 3309 985 gene locus_tag LOCUS_27510 3309 985 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028552.1 protein_id gnl|my_center|LOCUS_27510 3382 4149 gene locus_tag LOCUS_27520 3382 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 4224 4856 gene locus_tag LOCUS_27530 4224 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 4861 6066 gene locus_tag LOCUS_27540 gene moeB 4861 6066 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_27540 6210 6989 gene locus_tag LOCUS_27550 6210 6989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 8475 7012 gene locus_tag LOCUS_27560 8475 7012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 >Feature sequence125 13 657 gene locus_tag LOCUS_27570 13 657 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258296.1 protein_id gnl|my_center|LOCUS_27570 730 1404 gene locus_tag LOCUS_27580 730 1404 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839424.1 protein_id gnl|my_center|LOCUS_27580 2334 1456 gene locus_tag LOCUS_27590 2334 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 4660 2366 gene locus_tag LOCUS_27600 4660 2366 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256757.1 protein_id gnl|my_center|LOCUS_27600 5512 4763 gene locus_tag LOCUS_27610 5512 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 5588 6832 gene locus_tag LOCUS_27620 gene fabF 5588 6832 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_27620 6949 7770 gene locus_tag LOCUS_27630 6949 7770 CDS product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258699.1 protein_id gnl|my_center|LOCUS_27630 >Feature sequence126 2204 108 gene locus_tag LOCUS_27640 2204 108 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256059.1 protein_id gnl|my_center|LOCUS_27640 2413 2916 gene locus_tag LOCUS_27650 2413 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 2925 4346 gene locus_tag LOCUS_27660 gene selA 2925 4346 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256909.1 protein_id gnl|my_center|LOCUS_27660 5576 4404 gene locus_tag LOCUS_27670 5576 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257446.1 protein_id gnl|my_center|LOCUS_27670 5923 5573 gene locus_tag LOCUS_27680 5923 5573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 6471 6094 gene locus_tag LOCUS_27690 6471 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 6754 6473 gene locus_tag LOCUS_27700 6754 6473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 7821 6793 gene locus_tag LOCUS_27710 7821 6793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 8273 7905 gene locus_tag LOCUS_27720 8273 7905 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384190.1 protein_id gnl|my_center|LOCUS_27720 >Feature sequence127 1080 304 gene locus_tag LOCUS_27730 gene cbiQ 1080 304 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259516.1 protein_id gnl|my_center|LOCUS_27730 2085 1144 gene locus_tag LOCUS_27740 2085 1144 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259515.1 protein_id gnl|my_center|LOCUS_27740 2540 4048 gene locus_tag LOCUS_27750 2540 4048 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093950374.1 protein_id gnl|my_center|LOCUS_27750 4211 5608 gene locus_tag LOCUS_27760 4211 5608 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897264.1 protein_id gnl|my_center|LOCUS_27760 5711 6289 gene locus_tag LOCUS_27770 5711 6289 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258858.1 protein_id gnl|my_center|LOCUS_27770 6328 7221 gene locus_tag LOCUS_27780 6328 7221 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258911.1 protein_id gnl|my_center|LOCUS_27780 7238 8062 gene locus_tag LOCUS_27790 7238 8062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 >Feature sequence128 204 1067 gene locus_tag LOCUS_27800 204 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 1272 3038 gene locus_tag LOCUS_27810 1272 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 5284 3035 gene locus_tag LOCUS_27820 5284 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 6931 5402 gene locus_tag LOCUS_27830 6931 5402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 7426 6995 gene locus_tag LOCUS_27840 7426 6995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 >Feature sequence129 44 1090 gene locus_tag LOCUS_27850 44 1090 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256159.1 protein_id gnl|my_center|LOCUS_27850 2355 1153 gene locus_tag LOCUS_27860 2355 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 2630 4885 gene locus_tag LOCUS_27870 2630 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 4875 7205 gene locus_tag LOCUS_27880 4875 7205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 <7954 7247 gene locus_tag LOCUS_27890 <7954 7247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031788.1:PQQ-dependent sugar dehydrogenase >Feature sequence130 306 1676 gene locus_tag LOCUS_27900 306 1676 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256515.1 protein_id gnl|my_center|LOCUS_27900 1721 3151 gene locus_tag LOCUS_27910 1721 3151 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_27910 4753 3374 gene locus_tag LOCUS_27920 4753 3374 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256756.1 protein_id gnl|my_center|LOCUS_27920 4897 6444 gene locus_tag LOCUS_27930 gene murJ 4897 6444 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403539.1 protein_id gnl|my_center|LOCUS_27930 6578 7657 gene locus_tag LOCUS_27940 gene recA 6578 7657 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257243.1 protein_id gnl|my_center|LOCUS_27940 >Feature sequence131 3256 1877 gene locus_tag LOCUS_27950 3256 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 3508 3308 gene locus_tag LOCUS_27960 3508 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 3769 4290 gene locus_tag LOCUS_27970 3769 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 4874 5146 gene locus_tag LOCUS_27980 4874 5146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 6186 5329 gene locus_tag LOCUS_27990 6186 5329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 6714 6538 gene locus_tag LOCUS_28000 6714 6538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 6695 7282 gene locus_tag LOCUS_28010 6695 7282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 >Feature sequence132 2079 1997 gene locus_tag LOCUS_t00400 2079 1997 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2642 2151 gene locus_tag LOCUS_28020 2642 2151 CDS product nitroreductase/quinone reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257463.1 protein_id gnl|my_center|LOCUS_28020 3005 4696 gene locus_tag LOCUS_28030 3005 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 5770 4748 gene locus_tag LOCUS_28040 gene coxFIC1 5770 4748 CDS product Dot/Icm type IV secretion system effector CoxFIC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769896.1 protein_id gnl|my_center|LOCUS_28040 5897 7282 gene locus_tag LOCUS_28050 5897 7282 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259710.1 protein_id gnl|my_center|LOCUS_28050 >Feature sequence133 1036 3102 gene locus_tag LOCUS_28060 1036 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 3152 5551 gene locus_tag LOCUS_28070 3152 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 5841 6089 gene locus_tag LOCUS_28080 5841 6089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256705.1 protein_id gnl|my_center|LOCUS_28080 6185 6505 gene locus_tag LOCUS_28090 6185 6505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 6502 7137 gene locus_tag LOCUS_28100 6502 7137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 >Feature sequence134 193 426 gene locus_tag LOCUS_28110 193 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 440 1063 gene locus_tag LOCUS_28120 gene nusG 440 1063 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258049.1 protein_id gnl|my_center|LOCUS_28120 1151 1576 gene locus_tag LOCUS_28130 gene rplK 1151 1576 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056150.1 protein_id gnl|my_center|LOCUS_28130 1737 2438 gene locus_tag LOCUS_28140 gene rplA 1737 2438 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258051.1 protein_id gnl|my_center|LOCUS_28140 2666 3211 gene locus_tag LOCUS_28150 gene rplJ 2666 3211 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536192.1 protein_id gnl|my_center|LOCUS_28150 3256 3645 gene locus_tag LOCUS_28160 gene rplL 3256 3645 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536194.1 protein_id gnl|my_center|LOCUS_28160 3730 4410 gene locus_tag LOCUS_28170 3730 4410 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937833.1 protein_id gnl|my_center|LOCUS_28170 4439 5173 gene locus_tag LOCUS_28180 4439 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 5217 5489 gene locus_tag LOCUS_28190 5217 5489 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927120.1 protein_id gnl|my_center|LOCUS_28190 6637 5549 gene locus_tag LOCUS_28200 6637 5549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 7043 6690 gene locus_tag LOCUS_28210 7043 6690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 7288 7040 gene locus_tag LOCUS_28220 7288 7040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 >Feature sequence135 <1 1424 gene locus_tag LOCUS_28230 <1 1424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256544.1:PA14 domain-containing protein 1697 2251 gene locus_tag LOCUS_28240 1697 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 2264 2503 gene locus_tag LOCUS_28250 2264 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 2558 3427 gene locus_tag LOCUS_28260 gene panB 2558 3427 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_28260 3474 4463 gene locus_tag LOCUS_28270 3474 4463 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258713.1 protein_id gnl|my_center|LOCUS_28270 4468 5334 gene locus_tag LOCUS_28280 gene panC 4468 5334 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258070.1 protein_id gnl|my_center|LOCUS_28280 5331 6092 gene locus_tag LOCUS_28290 5331 6092 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405283.1 protein_id gnl|my_center|LOCUS_28290 6268 6525 gene locus_tag LOCUS_28300 6268 6525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 6543 6908 gene locus_tag LOCUS_28310 6543 6908 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544974.1 protein_id gnl|my_center|LOCUS_28310 >Feature sequence136 3164 1500 gene locus_tag LOCUS_28320 3164 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 4882 3296 gene locus_tag LOCUS_28330 4882 3296 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225853.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28330 4808 4981 gene locus_tag LOCUS_28340 4808 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 5183 6139 gene locus_tag LOCUS_28350 5183 6139 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088662.1 protein_id gnl|my_center|LOCUS_28350 <7270 6156 gene locus_tag LOCUS_28360 <7270 6156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258790.1:ArsA family ATPase >Feature sequence137 400 167 gene locus_tag LOCUS_28370 400 167 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963400.1 protein_id gnl|my_center|LOCUS_28370 692 468 gene locus_tag LOCUS_28380 692 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 2046 805 gene locus_tag LOCUS_28390 2046 805 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582790.1 protein_id gnl|my_center|LOCUS_28390 3141 2089 gene locus_tag LOCUS_28400 gene dinB 3141 2089 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_28400 3849 3241 gene locus_tag LOCUS_28410 3849 3241 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228074.1 protein_id gnl|my_center|LOCUS_28410 5176 3833 gene locus_tag LOCUS_28420 5176 3833 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_28420 6746 5400 gene locus_tag LOCUS_28430 6746 5400 CDS product BCD family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055995.1 protein_id gnl|my_center|LOCUS_28430 >Feature sequence138 548 276 gene locus_tag LOCUS_28440 548 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 571 1512 gene locus_tag LOCUS_28450 571 1512 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480366.1 protein_id gnl|my_center|LOCUS_28450 1601 2776 gene locus_tag LOCUS_28460 1601 2776 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897686.1 protein_id gnl|my_center|LOCUS_28460 2881 5403 gene locus_tag LOCUS_28470 gene gyrA 2881 5403 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257126.1 protein_id gnl|my_center|LOCUS_28470 5400 5921 gene locus_tag LOCUS_28480 5400 5921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 6978 5986 gene locus_tag LOCUS_28490 6978 5986 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 protein_id gnl|my_center|LOCUS_28490 >Feature sequence139 269 2539 gene locus_tag LOCUS_28500 269 2539 CDS product transglutaminaseTgpA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259434.1 protein_id gnl|my_center|LOCUS_28500 2699 4441 gene locus_tag LOCUS_28510 2699 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 5611 4364 gene locus_tag LOCUS_28520 5611 4364 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480158.1 protein_id gnl|my_center|LOCUS_28520 6958 5684 gene locus_tag LOCUS_28530 6958 5684 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259312.1 protein_id gnl|my_center|LOCUS_28530 >Feature sequence140 2024 966 gene locus_tag LOCUS_28540 2024 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 2904 2065 gene locus_tag LOCUS_28550 2904 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 4471 3071 gene locus_tag LOCUS_28560 4471 3071 CDS product kelch repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257786.1 protein_id gnl|my_center|LOCUS_28560 5498 4479 gene locus_tag LOCUS_28570 5498 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 6706 5591 gene locus_tag LOCUS_28580 6706 5591 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 protein_id gnl|my_center|LOCUS_28580 >Feature sequence141 510 1880 gene locus_tag LOCUS_28590 510 1880 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_28590 1945 3030 gene locus_tag LOCUS_28600 1945 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 3060 4070 gene locus_tag LOCUS_28610 3060 4070 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393875.1 protein_id gnl|my_center|LOCUS_28610 4089 5069 gene locus_tag LOCUS_28620 gene thrB 4089 5069 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392818.1 protein_id gnl|my_center|LOCUS_28620 5138 6097 gene locus_tag LOCUS_28630 gene pdhA 5138 6097 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389634.1 protein_id gnl|my_center|LOCUS_28630 >Feature sequence142 677 57 gene locus_tag LOCUS_28640 gene leuD 677 57 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256079.1 protein_id gnl|my_center|LOCUS_28640 2126 714 gene locus_tag LOCUS_28650 gene leuC 2126 714 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256078.1 protein_id gnl|my_center|LOCUS_28650 3868 2228 gene locus_tag LOCUS_28660 3868 2228 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256076.1 protein_id gnl|my_center|LOCUS_28660 4869 3868 gene locus_tag LOCUS_28670 gene ilvC 4869 3868 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256075.1 protein_id gnl|my_center|LOCUS_28670 5480 4899 gene locus_tag LOCUS_28680 gene ilvN 5480 4899 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_28680 <6577 5492 gene locus_tag LOCUS_28690 <6577 5492 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256073.1:biosynthetic-type acetolactate synthase large subunit >Feature sequence143 1248 2609 gene locus_tag LOCUS_28700 1248 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 3027 2773 gene locus_tag LOCUS_28710 3027 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 4166 3081 gene locus_tag LOCUS_28720 4166 3081 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083752.1 protein_id gnl|my_center|LOCUS_28720 6326 4239 gene locus_tag LOCUS_28730 6326 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 >Feature sequence144 3060 1009 gene locus_tag LOCUS_28740 3060 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 4726 3257 gene locus_tag LOCUS_28750 4726 3257 CDS product alpha-(1->6)-mannopyranosyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856557.1 protein_id gnl|my_center|LOCUS_28750 5999 4704 gene locus_tag LOCUS_28760 5999 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 5961 6218 gene locus_tag LOCUS_28770 5961 6218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 >Feature sequence145 252 2141 gene locus_tag LOCUS_28780 252 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 2751 4784 gene locus_tag LOCUS_28790 2751 4784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 4800 5678 gene locus_tag LOCUS_28800 4800 5678 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257972.1 protein_id gnl|my_center|LOCUS_28800 >Feature sequence146 3486 1288 gene locus_tag LOCUS_28810 3486 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 4192 3479 gene locus_tag LOCUS_28820 4192 3479 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357427.1 protein_id gnl|my_center|LOCUS_28820 5665 4397 gene locus_tag LOCUS_28830 5665 4397 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404704.1 protein_id gnl|my_center|LOCUS_28830 <6214 5665 gene locus_tag LOCUS_28840 <6214 5665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257842.1:pyruvate dehydrogenase complex E1 component subunit beta >Feature sequence147 886 89 gene locus_tag LOCUS_28850 886 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 1781 1056 gene locus_tag LOCUS_28860 1781 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 2252 1824 gene locus_tag LOCUS_28870 2252 1824 CDS product DUF6326 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021642.1 protein_id gnl|my_center|LOCUS_28870 2588 2418 gene locus_tag LOCUS_28880 2588 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 2842 2597 gene locus_tag LOCUS_28890 2842 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 5603 2916 gene locus_tag LOCUS_28900 5603 2916 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076003404.1 protein_id gnl|my_center|LOCUS_28900 5746 6009 gene locus_tag LOCUS_28910 5746 6009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 >Feature sequence148 1213 200 gene locus_tag LOCUS_28920 gene fbp 1213 200 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705872.1 protein_id gnl|my_center|LOCUS_28920 2127 1303 gene locus_tag LOCUS_28930 2127 1303 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141396.1 protein_id gnl|my_center|LOCUS_28930 2878 2141 gene locus_tag LOCUS_28940 2878 2141 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259406.1 protein_id gnl|my_center|LOCUS_28940 3438 2881 gene locus_tag LOCUS_28950 gene frr 3438 2881 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259405.1 protein_id gnl|my_center|LOCUS_28950 4232 3516 gene locus_tag LOCUS_28960 gene pyrH 4232 3516 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583562.1 protein_id gnl|my_center|LOCUS_28960 4909 4304 gene locus_tag LOCUS_28970 gene tsf 4909 4304 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583563.1 protein_id gnl|my_center|LOCUS_28970 5846 4932 gene locus_tag LOCUS_28980 5846 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 >Feature sequence149 321 249 gene locus_tag LOCUS_t00410 321 249 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 479 396 gene locus_tag LOCUS_t00420 479 396 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 609 535 gene locus_tag LOCUS_t00430 609 535 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 799 984 gene locus_tag LOCUS_28990 799 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 938 2152 gene locus_tag LOCUS_29000 938 2152 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027385545.1 protein_id gnl|my_center|LOCUS_29000 >Feature sequence150 4842 208 gene locus_tag LOCUS_29010 4842 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 4950 5049 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence151 342 1046 gene locus_tag LOCUS_29020 342 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 1162 1566 gene locus_tag LOCUS_29030 1162 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 2852 1692 gene locus_tag LOCUS_29040 2852 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019540657.1 protein_id gnl|my_center|LOCUS_29040 4808 2892 gene locus_tag LOCUS_29050 4808 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 >Feature sequence152 202 528 gene locus_tag LOCUS_29060 202 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 538 1335 gene locus_tag LOCUS_29070 538 1335 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256410.1 protein_id gnl|my_center|LOCUS_29070 1564 2082 gene locus_tag LOCUS_29080 gene hoxE 1564 2082 CDS product bidirectional hydrogenase complex protein HoxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257070.1 protein_id gnl|my_center|LOCUS_29080 2066 3715 gene locus_tag LOCUS_29090 2066 3715 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257071.1 protein_id gnl|my_center|LOCUS_29090 3712 4440 gene locus_tag LOCUS_29100 gene hoxU 3712 4440 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257072.1 protein_id gnl|my_center|LOCUS_29100 4433 4969 gene locus_tag LOCUS_29110 4433 4969 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257073.1 protein_id gnl|my_center|LOCUS_29110 >Feature sequence153 <1 1996 gene locus_tag LOCUS_29120 <1 1996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223708.1:glycine cleavage system aminomethyltransferase GcvT 2077 2577 gene locus_tag LOCUS_29130 2077 2577 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228008.1 protein_id gnl|my_center|LOCUS_29130 2944 4287 gene locus_tag LOCUS_29140 2944 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 4475 5482 gene locus_tag LOCUS_29150 4475 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 >Feature sequence154 759 1928 gene locus_tag LOCUS_29160 759 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 2252 1971 gene locus_tag LOCUS_29170 2252 1971 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 protein_id gnl|my_center|LOCUS_29170 2488 2246 gene locus_tag LOCUS_29180 2488 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 3596 2565 gene locus_tag LOCUS_29190 3596 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 4690 3653 gene locus_tag LOCUS_29200 4690 3653 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123092.1 protein_id gnl|my_center|LOCUS_29200 >Feature sequence155 3770 1713 gene locus_tag LOCUS_29210 3770 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 4743 3877 gene locus_tag LOCUS_29220 4743 3877 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405001.1 protein_id gnl|my_center|LOCUS_29220 >Feature sequence156 594 193 gene locus_tag LOCUS_29230 594 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 849 595 gene locus_tag LOCUS_29240 849 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 1100 1026 gene locus_tag LOCUS_t00440 1100 1026 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1208 1135 gene locus_tag LOCUS_t00450 1208 1135 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1506 1321 gene locus_tag LOCUS_29250 1506 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 2395 1658 gene locus_tag LOCUS_29260 2395 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 <4910 2439 gene locus_tag LOCUS_29270 <4910 2439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967237.1:AAA family ATPase >Feature sequence157 937 1191 gene locus_tag LOCUS_29280 937 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 1188 1574 gene locus_tag LOCUS_29290 1188 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 1641 2201 gene locus_tag LOCUS_29300 1641 2201 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730391.1 protein_id gnl|my_center|LOCUS_29300 2206 2685 gene locus_tag LOCUS_29310 2206 2685 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889092.1 protein_id gnl|my_center|LOCUS_29310 2911 3309 gene locus_tag LOCUS_29320 2911 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 4521 3358 gene locus_tag LOCUS_29330 gene queG 4521 3358 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528621.1 protein_id gnl|my_center|LOCUS_29330 >Feature sequence158 <1 804 gene locus_tag LOCUS_29340 <1 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003896022.1:2-oxoacid:acceptor oxidoreductase subunit alpha 889 2442 gene locus_tag LOCUS_29350 889 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 2544 4547 gene locus_tag LOCUS_29360 2544 4547 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256158.1 protein_id gnl|my_center|LOCUS_29360 >Feature sequence159 1451 480 gene locus_tag LOCUS_29370 1451 480 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724996.1 protein_id gnl|my_center|LOCUS_29370 2869 1712 gene locus_tag LOCUS_29380 2869 1712 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_29380 4397 2880 gene locus_tag LOCUS_29390 4397 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 >Feature sequence160 181 600 gene locus_tag LOCUS_29400 181 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 691 927 gene locus_tag LOCUS_29410 691 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 995 1315 gene locus_tag LOCUS_29420 995 1315 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256234.1 protein_id gnl|my_center|LOCUS_29420 2139 1336 gene locus_tag LOCUS_29430 2139 1336 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932021.1 protein_id gnl|my_center|LOCUS_29430 3366 2233 gene locus_tag LOCUS_29440 gene tgt 3366 2233 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_29440 <4674 3407 gene locus_tag LOCUS_29450 <4674 3407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962880.1:endonuclease >Feature sequence161 122 3265 gene locus_tag LOCUS_29460 122 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 3269 3439 gene locus_tag LOCUS_29470 3269 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 >Feature sequence162 <1 1687 gene locus_tag LOCUS_29480 <1 1687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582463.1:phosphoglycerate dehydrogenase 1708 2334 gene locus_tag LOCUS_29490 1708 2334 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481262.1 protein_id gnl|my_center|LOCUS_29490 3862 2363 gene locus_tag LOCUS_29500 3862 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 <4603 4072 gene locus_tag LOCUS_29510 <4603 4072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002357484.1:type I DNA topoisomerase >Feature sequence163 264 19 gene locus_tag LOCUS_29520 264 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 1534 392 gene locus_tag LOCUS_29530 1534 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 3101 1689 gene locus_tag LOCUS_29540 3101 1689 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546190.1 protein_id gnl|my_center|LOCUS_29540 3857 3297 gene locus_tag LOCUS_29550 3857 3297 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973688.1 protein_id gnl|my_center|LOCUS_29550 >Feature sequence164 216 695 gene locus_tag LOCUS_29560 216 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 861 2264 gene locus_tag LOCUS_29570 861 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 3521 2274 gene locus_tag LOCUS_29580 3521 2274 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257464.1 protein_id gnl|my_center|LOCUS_29580 4426 3593 gene locus_tag LOCUS_29590 4426 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 >Feature sequence165 1370 1801 gene locus_tag LOCUS_29600 1370 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 2032 2793 gene locus_tag LOCUS_29610 2032 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 3669 2866 gene locus_tag LOCUS_29620 3669 2866 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890817.1 protein_id gnl|my_center|LOCUS_29620 4055 3816 gene locus_tag LOCUS_29630 4055 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 >Feature sequence166 <1 724 gene locus_tag LOCUS_29640 <1 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007335201.1:glucose-6-phosphate dehydrogenase 3102 742 gene locus_tag LOCUS_29650 3102 742 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143631.1 protein_id gnl|my_center|LOCUS_29650 >Feature sequence167 134 1447 gene locus_tag LOCUS_29660 134 1447 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256145.1 protein_id gnl|my_center|LOCUS_29660 1502 2578 gene locus_tag LOCUS_29670 1502 2578 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868484.1 protein_id gnl|my_center|LOCUS_29670 2604 3755 gene locus_tag LOCUS_29680 2604 3755 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868485.1 protein_id gnl|my_center|LOCUS_29680 >Feature sequence168 1853 930 gene locus_tag LOCUS_29690 1853 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 3813 1876 gene locus_tag LOCUS_29700 3813 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 >Feature sequence169 <1 903 gene locus_tag LOCUS_29710 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256328.1:FAD-binding oxidoreductase 1127 3511 gene locus_tag LOCUS_29720 1127 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 >Feature sequence170 <1 1076 gene locus_tag LOCUS_29730 <1 1076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918088.1:ubiquitin-activating E1 FCCH domain-containing protein 1245 1682 gene locus_tag LOCUS_29740 1245 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 1703 1936 gene locus_tag LOCUS_29750 1703 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 >Feature sequence171 1695 388 gene locus_tag LOCUS_29760 1695 388 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249141.1 protein_id gnl|my_center|LOCUS_29760 2573 1758 gene locus_tag LOCUS_29770 2573 1758 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_29770 <3679 2554 gene locus_tag LOCUS_29780 <3679 2554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082297.1:3-methyl-2-oxobutanoate dehydrogenase subunit VorB >Feature sequence172 672 172 gene locus_tag LOCUS_29790 672 172 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393622.1 protein_id gnl|my_center|LOCUS_29790 2411 669 gene locus_tag LOCUS_29800 2411 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 2749 2537 gene locus_tag LOCUS_29810 2749 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 3419 2793 gene locus_tag LOCUS_29820 3419 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 >Feature sequence173 1359 1114 gene locus_tag LOCUS_29830 1359 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 >Feature sequence174 613 131 gene locus_tag LOCUS_29840 613 131 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258387.1 protein_id gnl|my_center|LOCUS_29840 858 1517 gene locus_tag LOCUS_29850 858 1517 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487065.1 protein_id gnl|my_center|LOCUS_29850 2530 1514 gene locus_tag LOCUS_29860 2530 1514 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142872.1 protein_id gnl|my_center|LOCUS_29860 >Feature sequence175 >Feature sequence176 1377 322 gene locus_tag LOCUS_29870 1377 322 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081440.1 protein_id gnl|my_center|LOCUS_29870 2462 1398 gene locus_tag LOCUS_29880 2462 1398 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081437.1 protein_id gnl|my_center|LOCUS_29880 >Feature sequence177 1829 978 gene locus_tag LOCUS_29890 1829 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 2285 1887 gene locus_tag LOCUS_29900 2285 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 3169 2339 gene locus_tag LOCUS_29910 3169 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256034.1 protein_id gnl|my_center|LOCUS_29910 >Feature sequence178 778 365 gene locus_tag LOCUS_29920 778 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 1102 824 gene locus_tag LOCUS_29930 1102 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 1376 1143 gene locus_tag LOCUS_29940 1376 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 1657 1382 gene locus_tag LOCUS_29950 1657 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 2935 1928 gene locus_tag LOCUS_29960 gene pyrB 2935 1928 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868442.1 protein_id gnl|my_center|LOCUS_29960 >Feature sequence179 1433 177 gene locus_tag LOCUS_29970 1433 177 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393028.1 protein_id gnl|my_center|LOCUS_29970 2164 1430 gene locus_tag LOCUS_29980 2164 1430 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_29980 >Feature sequence180 1647 2483 gene locus_tag LOCUS_29990 1647 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 >Feature sequence181 1884 2240 gene locus_tag LOCUS_30000 1884 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 3128 2310 gene locus_tag LOCUS_30010 3128 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 >Feature sequence182 219 49 gene locus_tag LOCUS_30020 219 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 1384 221 gene locus_tag LOCUS_30030 1384 221 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258587.1 protein_id gnl|my_center|LOCUS_30030 <3070 1465 gene locus_tag LOCUS_30040 <3070 1465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257715.1:methylmalonyl-CoA mutase family protein >Feature sequence183 50 1114 gene locus_tag LOCUS_30050 50 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 2364 1141 gene locus_tag LOCUS_30060 2364 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 >Feature sequence184 <1 1207 gene locus_tag LOCUS_30070 <1 1207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257194.1:proline--tRNA ligase 2418 1342 gene locus_tag LOCUS_30080 gene mtnA 2418 1342 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_30080 >Feature sequence185 <1 1823 gene locus_tag LOCUS_30090 <1 1823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_194931144.1:methionine synthase