>Feature sequence01 2808 733 gene locus_tag LOCUS_00010 2808 733 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036147.1 protein_id gnl|my_center|LOCUS_00010 2929 4032 gene locus_tag LOCUS_00020 2929 4032 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036149.1 protein_id gnl|my_center|LOCUS_00020 4169 4564 gene locus_tag LOCUS_00030 4169 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 5585 4554 gene locus_tag LOCUS_00040 5585 4554 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036518.1 protein_id gnl|my_center|LOCUS_00040 6387 5593 gene locus_tag LOCUS_00050 6387 5593 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036519.1 protein_id gnl|my_center|LOCUS_00050 6932 6384 gene locus_tag LOCUS_00060 6932 6384 CDS product DUF2878 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036520.1 protein_id gnl|my_center|LOCUS_00060 8212 6932 gene locus_tag LOCUS_00070 8212 6932 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036521.1 protein_id gnl|my_center|LOCUS_00070 8985 8218 gene locus_tag LOCUS_00080 8985 8218 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275405.1 protein_id gnl|my_center|LOCUS_00080 10251 8992 gene locus_tag LOCUS_00090 10251 8992 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036523.1 protein_id gnl|my_center|LOCUS_00090 11146 10277 gene locus_tag LOCUS_00100 11146 10277 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036524.1 protein_id gnl|my_center|LOCUS_00100 11185 11517 gene locus_tag LOCUS_00110 11185 11517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11619 12422 gene locus_tag LOCUS_00120 11619 12422 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941223.1 protein_id gnl|my_center|LOCUS_00120 12579 12430 gene locus_tag LOCUS_00130 12579 12430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 13085 12636 gene locus_tag LOCUS_00140 13085 12636 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401653.1 protein_id gnl|my_center|LOCUS_00140 13150 13872 gene locus_tag LOCUS_00150 13150 13872 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036151.1 protein_id gnl|my_center|LOCUS_00150 15117 13909 gene locus_tag LOCUS_00160 gene kbl 15117 13909 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036153.1 protein_id gnl|my_center|LOCUS_00160 15232 15978 gene locus_tag LOCUS_00170 15232 15978 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806896.1 protein_id gnl|my_center|LOCUS_00170 17391 15994 gene locus_tag LOCUS_00180 17391 15994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 17825 17391 gene locus_tag LOCUS_00190 17825 17391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 18849 17827 gene locus_tag LOCUS_00200 gene tdh 18849 17827 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172666275.1 protein_id gnl|my_center|LOCUS_00200 19041 21200 gene locus_tag LOCUS_00210 19041 21200 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 protein_id gnl|my_center|LOCUS_00210 21208 22602 gene locus_tag LOCUS_00220 21208 22602 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932285.1 protein_id gnl|my_center|LOCUS_00220 23314 22613 gene locus_tag LOCUS_00230 23314 22613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 24497 23388 gene locus_tag LOCUS_00240 gene pyrC 24497 23388 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_00240 24839 24570 gene locus_tag LOCUS_00250 gene rpsT 24839 24570 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002807888.1 protein_id gnl|my_center|LOCUS_00250 24956 26512 gene locus_tag LOCUS_00260 gene murJ 24956 26512 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036351.1 protein_id gnl|my_center|LOCUS_00260 26568 27539 gene locus_tag LOCUS_00270 26568 27539 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036352.1 protein_id gnl|my_center|LOCUS_00270 27583 30465 gene locus_tag LOCUS_00280 gene ileS 27583 30465 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036353.1 protein_id gnl|my_center|LOCUS_00280 30485 31006 gene locus_tag LOCUS_00290 gene lspA 30485 31006 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036354.1 protein_id gnl|my_center|LOCUS_00290 31003 31995 gene locus_tag LOCUS_00300 gene ispH 31003 31995 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036355.1 protein_id gnl|my_center|LOCUS_00300 32015 32090 gene locus_tag LOCUS_t00010 32015 32090 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 32203 33819 gene locus_tag LOCUS_00310 32203 33819 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140493.1 protein_id gnl|my_center|LOCUS_00310 33831 35222 gene locus_tag LOCUS_00320 gene radA 33831 35222 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438953.1 protein_id gnl|my_center|LOCUS_00320 36029 35235 gene locus_tag LOCUS_00330 gene ccsA 36029 35235 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036390.1 protein_id gnl|my_center|LOCUS_00330 36109 37398 gene locus_tag LOCUS_00340 36109 37398 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093492.1 protein_id gnl|my_center|LOCUS_00340 37492 37704 gene locus_tag LOCUS_00350 37492 37704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 37764 37949 gene locus_tag LOCUS_00360 37764 37949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 38036 40141 gene locus_tag LOCUS_00370 38036 40141 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545619.1 protein_id gnl|my_center|LOCUS_00370 40228 41616 gene locus_tag LOCUS_00380 gene ffh 40228 41616 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036391.1 protein_id gnl|my_center|LOCUS_00380 41748 41999 gene locus_tag LOCUS_00390 gene rpsP 41748 41999 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036396.1 protein_id gnl|my_center|LOCUS_00390 42042 42548 gene locus_tag LOCUS_00400 gene rimM 42042 42548 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036397.1 protein_id gnl|my_center|LOCUS_00400 42580 43332 gene locus_tag LOCUS_00410 gene trmD 42580 43332 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036398.1 protein_id gnl|my_center|LOCUS_00410 43426 43803 gene locus_tag LOCUS_00420 gene rplS 43426 43803 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036399.1 protein_id gnl|my_center|LOCUS_00420 43902 44357 gene locus_tag LOCUS_00430 43902 44357 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036401.1 protein_id gnl|my_center|LOCUS_00430 44710 44507 gene locus_tag LOCUS_00440 44710 44507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 46076 45195 gene locus_tag LOCUS_00450 46076 45195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 48863 46275 gene locus_tag LOCUS_00460 gene mutS 48863 46275 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095574877.1 protein_id gnl|my_center|LOCUS_00460 48916 49425 gene locus_tag LOCUS_00470 48916 49425 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016945236.1 protein_id gnl|my_center|LOCUS_00470 49465 50124 gene locus_tag LOCUS_00480 gene lexA 49465 50124 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036898.1 protein_id gnl|my_center|LOCUS_00480 50295 51338 gene locus_tag LOCUS_00490 gene recA 50295 51338 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036899.1 protein_id gnl|my_center|LOCUS_00490 51335 51901 gene locus_tag LOCUS_00500 gene recX 51335 51901 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036900.1 protein_id gnl|my_center|LOCUS_00500 52053 54707 gene locus_tag LOCUS_00510 gene alaS 52053 54707 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036901.1 protein_id gnl|my_center|LOCUS_00510 54905 55117 gene locus_tag LOCUS_00520 gene csrA 54905 55117 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036902.1 protein_id gnl|my_center|LOCUS_00520 55160 55252 gene locus_tag LOCUS_t00020 55160 55252 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 55370 55446 gene locus_tag LOCUS_t00030 55370 55446 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 55473 55549 gene locus_tag LOCUS_t00040 55473 55549 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 55626 55702 gene locus_tag LOCUS_t00050 55626 55702 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 55714 55790 gene locus_tag LOCUS_t00060 55714 55790 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 55845 55920 gene locus_tag LOCUS_t00070 55845 55920 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 55953 56037 gene locus_tag LOCUS_t00080 55953 56037 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 56138 57436 gene locus_tag LOCUS_00530 gene tig 56138 57436 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036183.1 protein_id gnl|my_center|LOCUS_00530 57455 58078 gene locus_tag LOCUS_00540 gene clpP 57455 58078 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036184.1 protein_id gnl|my_center|LOCUS_00540 58181 59470 gene locus_tag LOCUS_00550 gene clpX 58181 59470 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036185.1 protein_id gnl|my_center|LOCUS_00550 59513 61978 gene locus_tag LOCUS_00560 gene lon 59513 61978 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036186.1 protein_id gnl|my_center|LOCUS_00560 61994 62434 gene locus_tag LOCUS_00570 61994 62434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 62453 62527 gene locus_tag LOCUS_t00090 62453 62527 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 62537 62613 gene locus_tag LOCUS_t00100 62537 62613 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 62680 64659 gene locus_tag LOCUS_00580 62680 64659 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036187.1 protein_id gnl|my_center|LOCUS_00580 65525 64728 gene locus_tag LOCUS_00590 gene fabI 65525 64728 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506501.1 protein_id gnl|my_center|LOCUS_00590 66461 65631 gene locus_tag LOCUS_00600 66461 65631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 67216 66458 gene locus_tag LOCUS_00610 gene gloB 67216 66458 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036190.1 protein_id gnl|my_center|LOCUS_00610 67372 67941 gene locus_tag LOCUS_00620 67372 67941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 67973 68422 gene locus_tag LOCUS_00630 gene rnhA 67973 68422 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036192.1 protein_id gnl|my_center|LOCUS_00630 68419 69117 gene locus_tag LOCUS_00640 gene dnaQ 68419 69117 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036193.1 protein_id gnl|my_center|LOCUS_00640 69841 69137 gene locus_tag LOCUS_00650 69841 69137 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036194.1 protein_id gnl|my_center|LOCUS_00650 69967 70057 gene locus_tag LOCUS_t00110 69967 70057 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 70142 70561 gene locus_tag LOCUS_00660 70142 70561 CDS product DUF6165 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036195.1 protein_id gnl|my_center|LOCUS_00660 72099 71023 gene locus_tag LOCUS_00670 72099 71023 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036196.1 protein_id gnl|my_center|LOCUS_00670 72098 72826 gene locus_tag LOCUS_00680 72098 72826 CDS product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813264.1 protein_id gnl|my_center|LOCUS_00680 72823 73584 gene locus_tag LOCUS_00690 72823 73584 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036198.1 protein_id gnl|my_center|LOCUS_00690 73854 73762 gene locus_tag LOCUS_t00120 73854 73762 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 74007 75770 gene locus_tag LOCUS_00700 gene dnaX 74007 75770 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036204.1 protein_id gnl|my_center|LOCUS_00700 75774 76103 gene locus_tag LOCUS_00710 75774 76103 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036205.1 protein_id gnl|my_center|LOCUS_00710 76136 76699 gene locus_tag LOCUS_00720 gene recR 76136 76699 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036206.1 protein_id gnl|my_center|LOCUS_00720 76720 77064 gene locus_tag LOCUS_00730 76720 77064 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_00730 77624 77097 gene locus_tag LOCUS_00740 77624 77097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 79617 77641 gene locus_tag LOCUS_00750 79617 77641 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036209.1 protein_id gnl|my_center|LOCUS_00750 80591 79614 gene locus_tag LOCUS_00760 80591 79614 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036210.1 protein_id gnl|my_center|LOCUS_00760 81547 80594 gene locus_tag LOCUS_00770 81547 80594 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036211.1 protein_id gnl|my_center|LOCUS_00770 81562 83136 gene locus_tag LOCUS_00780 81562 83136 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275429.1 protein_id gnl|my_center|LOCUS_00780 83604 83119 gene locus_tag LOCUS_00790 83604 83119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 83780 84274 gene locus_tag LOCUS_00800 83780 84274 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036217.1 protein_id gnl|my_center|LOCUS_00800 84278 84472 gene locus_tag LOCUS_00810 gene rpmF 84278 84472 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010368401.1 protein_id gnl|my_center|LOCUS_00810 84603 85577 gene locus_tag LOCUS_00820 84603 85577 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 protein_id gnl|my_center|LOCUS_00820 85665 86612 gene locus_tag LOCUS_00830 gene fabD 85665 86612 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036219.1 protein_id gnl|my_center|LOCUS_00830 86685 87428 gene locus_tag LOCUS_00840 gene fabG 86685 87428 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036220.1 protein_id gnl|my_center|LOCUS_00840 87570 87809 gene locus_tag LOCUS_00850 gene acpP 87570 87809 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002814322.1 protein_id gnl|my_center|LOCUS_00850 87875 89113 gene locus_tag LOCUS_00860 gene fabF 87875 89113 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036221.1 protein_id gnl|my_center|LOCUS_00860 89110 90498 gene locus_tag LOCUS_00870 89110 90498 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036222.1 protein_id gnl|my_center|LOCUS_00870 90488 91330 gene locus_tag LOCUS_00880 gene pabC 90488 91330 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267151.1 protein_id gnl|my_center|LOCUS_00880 91330 92349 gene locus_tag LOCUS_00890 gene mltG 91330 92349 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036223.1 protein_id gnl|my_center|LOCUS_00890 92352 93020 gene locus_tag LOCUS_00900 gene tmk 92352 93020 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267153.1 protein_id gnl|my_center|LOCUS_00900 93017 94009 gene locus_tag LOCUS_00910 93017 94009 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036224.1 protein_id gnl|my_center|LOCUS_00910 94006 94362 gene locus_tag LOCUS_00920 94006 94362 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036225.1 protein_id gnl|my_center|LOCUS_00920 94770 94372 gene locus_tag LOCUS_00930 94770 94372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 95642 94770 gene locus_tag LOCUS_00940 gene tesB 95642 94770 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036345.1 protein_id gnl|my_center|LOCUS_00940 96365 95757 gene locus_tag LOCUS_00950 96365 95757 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036723.1 protein_id gnl|my_center|LOCUS_00950 96813 97352 gene locus_tag LOCUS_00960 96813 97352 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036725.1 protein_id gnl|my_center|LOCUS_00960 97352 99511 gene locus_tag LOCUS_00970 gene rlmKL 97352 99511 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036729.1 protein_id gnl|my_center|LOCUS_00970 99590 100231 gene locus_tag LOCUS_00980 99590 100231 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090887.1 protein_id gnl|my_center|LOCUS_00980 100255 102099 gene locus_tag LOCUS_00990 100255 102099 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529979.1 protein_id gnl|my_center|LOCUS_00990 102921 102115 gene locus_tag LOCUS_01000 102921 102115 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388770.1 protein_id gnl|my_center|LOCUS_01000 103907 102918 gene locus_tag LOCUS_01010 103907 102918 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388771.1 protein_id gnl|my_center|LOCUS_01010 105053 103911 gene locus_tag LOCUS_01020 105053 103911 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530249.1 protein_id gnl|my_center|LOCUS_01020 106190 105060 gene locus_tag LOCUS_01030 gene spuE 106190 105060 CDS product spermidine-binding protein SpuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084301.1 protein_id gnl|my_center|LOCUS_01030 108394 106304 gene locus_tag LOCUS_01040 108394 106304 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036460.1 protein_id gnl|my_center|LOCUS_01040 108535 109110 gene locus_tag LOCUS_01050 gene rpoE 108535 109110 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036461.1 protein_id gnl|my_center|LOCUS_01050 109107 109736 gene locus_tag LOCUS_01060 109107 109736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 109840 111282 gene locus_tag LOCUS_01070 109840 111282 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036463.1 protein_id gnl|my_center|LOCUS_01070 111391 113190 gene locus_tag LOCUS_01080 gene lepA 111391 113190 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275537.1 protein_id gnl|my_center|LOCUS_01080 113201 114031 gene locus_tag LOCUS_01090 gene lepB 113201 114031 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036465.1 protein_id gnl|my_center|LOCUS_01090 114049 114411 gene locus_tag LOCUS_01100 114049 114411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 114415 115113 gene locus_tag LOCUS_01110 gene rnc 114415 115113 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036467.1 protein_id gnl|my_center|LOCUS_01110 115148 116062 gene locus_tag LOCUS_01120 gene era 115148 116062 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036468.1 protein_id gnl|my_center|LOCUS_01120 116082 116816 gene locus_tag LOCUS_01130 gene recO 116082 116816 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036469.1 protein_id gnl|my_center|LOCUS_01130 118627 117959 gene locus_tag LOCUS_01140 118627 117959 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036470.1 protein_id gnl|my_center|LOCUS_01140 118659 120680 gene locus_tag LOCUS_01150 118659 120680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 120750 121370 gene locus_tag LOCUS_01160 120750 121370 CDS product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943752.1 protein_id gnl|my_center|LOCUS_01160 121367 122770 gene locus_tag LOCUS_01170 gene rlmD 121367 122770 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036471.1 protein_id gnl|my_center|LOCUS_01170 122770 123297 gene locus_tag LOCUS_01180 122770 123297 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 protein_id gnl|my_center|LOCUS_01180 123995 123336 gene locus_tag LOCUS_01190 123995 123336 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975298.1 protein_id gnl|my_center|LOCUS_01190 124750 123992 gene locus_tag LOCUS_01200 124750 123992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 127908 124747 gene locus_tag LOCUS_01210 127908 124747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 128768 127905 gene locus_tag LOCUS_01220 128768 127905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 129652 128822 gene locus_tag LOCUS_01230 129652 128822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 129866 132367 gene locus_tag LOCUS_01240 129866 132367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 134252 132462 gene locus_tag LOCUS_01250 134252 132462 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037573.1 protein_id gnl|my_center|LOCUS_01250 134810 134343 gene locus_tag LOCUS_01260 134810 134343 CDS product LEA type 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037572.1 protein_id gnl|my_center|LOCUS_01260 135292 134903 gene locus_tag LOCUS_01270 135292 134903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 135418 138192 gene locus_tag LOCUS_01280 135418 138192 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939279.1 protein_id gnl|my_center|LOCUS_01280 138503 138428 gene locus_tag LOCUS_t00130 138503 138428 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 138692 139108 gene locus_tag LOCUS_01290 138692 139108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 139362 139090 gene locus_tag LOCUS_01300 139362 139090 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037561.1 protein_id gnl|my_center|LOCUS_01300 140408 139359 gene locus_tag LOCUS_01310 gene mutY 140408 139359 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037560.1 protein_id gnl|my_center|LOCUS_01310 141487 140405 gene locus_tag LOCUS_01320 141487 140405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 142449 141484 gene locus_tag LOCUS_01330 142449 141484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 142518 143135 gene locus_tag LOCUS_01340 gene rsmD 142518 143135 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037534.1 protein_id gnl|my_center|LOCUS_01340 143178 143672 gene locus_tag LOCUS_01350 gene coaD 143178 143672 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037533.1 protein_id gnl|my_center|LOCUS_01350 143699 144205 gene locus_tag LOCUS_01360 143699 144205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 144247 144501 gene locus_tag LOCUS_01370 144247 144501 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037531.1 protein_id gnl|my_center|LOCUS_01370 144501 146279 gene locus_tag LOCUS_01380 gene ggt 144501 146279 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037530.1 protein_id gnl|my_center|LOCUS_01380 146276 147157 gene locus_tag LOCUS_01390 146276 147157 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114721.1 protein_id gnl|my_center|LOCUS_01390 147182 147574 gene locus_tag LOCUS_01400 147182 147574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 148961 147621 gene locus_tag LOCUS_01410 gene thrC 148961 147621 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036973.1 protein_id gnl|my_center|LOCUS_01410 149917 148958 gene locus_tag LOCUS_01420 149917 148958 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036971.1 protein_id gnl|my_center|LOCUS_01420 151428 149926 gene locus_tag LOCUS_01430 151428 149926 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037523.1 protein_id gnl|my_center|LOCUS_01430 152599 151586 gene locus_tag LOCUS_01440 152599 151586 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207999.1 protein_id gnl|my_center|LOCUS_01440 152758 153825 gene locus_tag LOCUS_01450 gene queA 152758 153825 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037521.1 protein_id gnl|my_center|LOCUS_01450 153822 154958 gene locus_tag LOCUS_01460 gene tgt 153822 154958 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037520.1 protein_id gnl|my_center|LOCUS_01460 155043 155384 gene locus_tag LOCUS_01470 gene yajC 155043 155384 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037519.1 protein_id gnl|my_center|LOCUS_01470 155452 157329 gene locus_tag LOCUS_01480 gene secD 155452 157329 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074057269.1 protein_id gnl|my_center|LOCUS_01480 157344 158306 gene locus_tag LOCUS_01490 gene secF 157344 158306 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006448912.1 protein_id gnl|my_center|LOCUS_01490 159216 158383 gene locus_tag LOCUS_01500 159216 158383 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037421.1 protein_id gnl|my_center|LOCUS_01500 159312 160070 gene locus_tag LOCUS_01510 159312 160070 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037420.1 protein_id gnl|my_center|LOCUS_01510 160119 161030 gene locus_tag LOCUS_01520 160119 161030 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037419.1 protein_id gnl|my_center|LOCUS_01520 161027 163153 gene locus_tag LOCUS_01530 161027 163153 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037418.1 protein_id gnl|my_center|LOCUS_01530 163763 163164 gene locus_tag LOCUS_01540 163763 163164 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438572.1 protein_id gnl|my_center|LOCUS_01540 165102 163792 gene locus_tag LOCUS_01550 165102 163792 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036866.1 protein_id gnl|my_center|LOCUS_01550 165513 165106 gene locus_tag LOCUS_01560 165513 165106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 165628 166254 gene locus_tag LOCUS_01570 165628 166254 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216918.1 protein_id gnl|my_center|LOCUS_01570 169101 166264 gene locus_tag LOCUS_01580 gene rapA 169101 166264 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704808.1 protein_id gnl|my_center|LOCUS_01580 170921 169101 gene locus_tag LOCUS_01590 170921 169101 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037706.1 protein_id gnl|my_center|LOCUS_01590 170805 171017 gene locus_tag LOCUS_01600 170805 171017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 171051 171602 gene locus_tag LOCUS_01610 171051 171602 CDS product GbsR/MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815169.1 protein_id gnl|my_center|LOCUS_01610 171595 172977 gene locus_tag LOCUS_01620 171595 172977 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528682.1 protein_id gnl|my_center|LOCUS_01620 172979 174070 gene locus_tag LOCUS_01630 172979 174070 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528683.1 protein_id gnl|my_center|LOCUS_01630 174125 174718 gene locus_tag LOCUS_01640 174125 174718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 174830 177778 gene locus_tag LOCUS_01650 174830 177778 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038525.1 protein_id gnl|my_center|LOCUS_01650 178090 179652 gene locus_tag LOCUS_01660 gene serA 178090 179652 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310291.1 protein_id gnl|my_center|LOCUS_01660 179652 180302 gene locus_tag LOCUS_01670 179652 180302 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036162.1 protein_id gnl|my_center|LOCUS_01670 181346 182293 gene locus_tag LOCUS_01680 181346 182293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 182298 183548 gene locus_tag LOCUS_01690 gene folC 182298 183548 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036164.1 protein_id gnl|my_center|LOCUS_01690 183621 184625 gene locus_tag LOCUS_01700 183621 184625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 184651 185184 gene locus_tag LOCUS_01710 184651 185184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 185188 186651 gene locus_tag LOCUS_01720 gene purF 185188 186651 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036167.1 protein_id gnl|my_center|LOCUS_01720 186673 187524 gene locus_tag LOCUS_01730 186673 187524 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043921634.1 protein_id gnl|my_center|LOCUS_01730 188254 187535 gene locus_tag LOCUS_01740 gene lpxH 188254 187535 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036171.1 protein_id gnl|my_center|LOCUS_01740 188919 188251 gene locus_tag LOCUS_01750 188919 188251 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943932.1 protein_id gnl|my_center|LOCUS_01750 189022 190431 gene locus_tag LOCUS_01760 gene gltX 189022 190431 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037816.1 protein_id gnl|my_center|LOCUS_01760 190442 190975 gene locus_tag LOCUS_01770 190442 190975 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037815.1 protein_id gnl|my_center|LOCUS_01770 190972 192204 gene locus_tag LOCUS_01780 190972 192204 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455969.1 protein_id gnl|my_center|LOCUS_01780 194326 192221 gene locus_tag LOCUS_01790 194326 192221 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037788.1 protein_id gnl|my_center|LOCUS_01790 194413 194865 gene locus_tag LOCUS_01800 194413 194865 CDS product MerC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037787.1 protein_id gnl|my_center|LOCUS_01800 194935 195111 gene locus_tag LOCUS_01810 194935 195111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 197474 196251 gene locus_tag LOCUS_01820 gene hutI 197474 196251 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068174090.1 protein_id gnl|my_center|LOCUS_01820 197538 198893 gene locus_tag LOCUS_01830 197538 198893 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765557.1 protein_id gnl|my_center|LOCUS_01830 198969 200132 gene locus_tag LOCUS_01840 198969 200132 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390215.1 protein_id gnl|my_center|LOCUS_01840 200486 200148 gene locus_tag LOCUS_01850 200486 200148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 200764 200483 gene locus_tag LOCUS_01860 200764 200483 CDS product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721312.1 protein_id gnl|my_center|LOCUS_01860 201120 200761 gene locus_tag LOCUS_01870 201120 200761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 202586 201117 gene locus_tag LOCUS_01880 202586 201117 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125097.1 protein_id gnl|my_center|LOCUS_01880 202973 202590 gene locus_tag LOCUS_01890 202973 202590 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887527.1 protein_id gnl|my_center|LOCUS_01890 203398 202970 gene locus_tag LOCUS_01900 203398 202970 CDS product Na+/H+ antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404439.1 protein_id gnl|my_center|LOCUS_01900 205668 203395 gene locus_tag LOCUS_01910 205668 203395 CDS product putative monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942980.1 protein_id gnl|my_center|LOCUS_01910 205861 207534 gene locus_tag LOCUS_01920 gene hutU 205861 207534 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895695.1 protein_id gnl|my_center|LOCUS_01920 208429 207545 gene locus_tag LOCUS_01930 208429 207545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 209034 208483 gene locus_tag LOCUS_01940 209034 208483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 209647 209114 gene locus_tag LOCUS_01950 gene bcp 209647 209114 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_01950 209848 211149 gene locus_tag LOCUS_01960 209848 211149 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065115.1 protein_id gnl|my_center|LOCUS_01960 211146 212381 gene locus_tag LOCUS_01970 211146 212381 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036313.1 protein_id gnl|my_center|LOCUS_01970 213054 212797 gene locus_tag LOCUS_01980 gene minE 213054 212797 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036323.1 protein_id gnl|my_center|LOCUS_01980 213867 213058 gene locus_tag LOCUS_01990 gene minD 213867 213058 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036324.1 protein_id gnl|my_center|LOCUS_01990 214684 213908 gene locus_tag LOCUS_02000 gene minC 214684 213908 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036325.1 protein_id gnl|my_center|LOCUS_02000 215283 214687 gene locus_tag LOCUS_02010 215283 214687 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036326.1 protein_id gnl|my_center|LOCUS_02010 215388 216551 gene locus_tag LOCUS_02020 215388 216551 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036327.1 protein_id gnl|my_center|LOCUS_02020 216548 217189 gene locus_tag LOCUS_02030 216548 217189 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036328.1 protein_id gnl|my_center|LOCUS_02030 217322 218440 gene locus_tag LOCUS_02040 217322 218440 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036329.1 protein_id gnl|my_center|LOCUS_02040 218484 219416 gene locus_tag LOCUS_02050 218484 219416 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_02050 219413 220147 gene locus_tag LOCUS_02060 219413 220147 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109792089.1 protein_id gnl|my_center|LOCUS_02060 220150 221991 gene locus_tag LOCUS_02070 220150 221991 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_02070 221978 222871 gene locus_tag LOCUS_02080 221978 222871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 222895 223521 gene locus_tag LOCUS_02090 222895 223521 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275419.1 protein_id gnl|my_center|LOCUS_02090 224347 223529 gene locus_tag LOCUS_02100 224347 223529 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139327997.1 protein_id gnl|my_center|LOCUS_02100 225264 224353 gene locus_tag LOCUS_02110 225264 224353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140563.1 protein_id gnl|my_center|LOCUS_02110 225370 226560 gene locus_tag LOCUS_02120 gene purT 225370 226560 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036337.1 protein_id gnl|my_center|LOCUS_02120 227340 226633 gene locus_tag LOCUS_02130 227340 226633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 228584 227337 gene locus_tag LOCUS_02140 228584 227337 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036340.1 protein_id gnl|my_center|LOCUS_02140 229300 228581 gene locus_tag LOCUS_02150 229300 228581 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275418.1 protein_id gnl|my_center|LOCUS_02150 230198 229356 gene locus_tag LOCUS_02160 gene asd 230198 229356 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037685.1 protein_id gnl|my_center|LOCUS_02160 230866 230195 gene locus_tag LOCUS_02170 230866 230195 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037684.1 protein_id gnl|my_center|LOCUS_02170 230960 231892 gene locus_tag LOCUS_02180 gene prmB 230960 231892 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037683.1 protein_id gnl|my_center|LOCUS_02180 231912 233024 gene locus_tag LOCUS_02190 gene aroC 231912 233024 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037681.1 protein_id gnl|my_center|LOCUS_02190 233072 234091 gene locus_tag LOCUS_02200 233072 234091 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037679.1 protein_id gnl|my_center|LOCUS_02200 234225 236576 gene locus_tag LOCUS_02210 234225 236576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 236616 237446 gene locus_tag LOCUS_02220 gene truA 236616 237446 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037676.1 protein_id gnl|my_center|LOCUS_02220 237439 238122 gene locus_tag LOCUS_02230 237439 238122 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037675.1 protein_id gnl|my_center|LOCUS_02230 238100 239329 gene locus_tag LOCUS_02240 gene trpB 238100 239329 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037673.1 protein_id gnl|my_center|LOCUS_02240 239431 240222 gene locus_tag LOCUS_02250 gene trpA 239431 240222 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037671.1 protein_id gnl|my_center|LOCUS_02250 241137 242009 gene locus_tag LOCUS_02260 gene accD 241137 242009 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037670.1 protein_id gnl|my_center|LOCUS_02260 242010 243362 gene locus_tag LOCUS_02270 gene glmM 242010 243362 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037669.1 protein_id gnl|my_center|LOCUS_02270 243430 244380 gene locus_tag LOCUS_02280 243430 244380 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037668.1 protein_id gnl|my_center|LOCUS_02280 244439 245188 gene locus_tag LOCUS_02290 gene tpiA 244439 245188 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037661.1 protein_id gnl|my_center|LOCUS_02290 245199 245615 gene locus_tag LOCUS_02300 245199 245615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 245667 245751 gene locus_tag LOCUS_t00140 245667 245751 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 245830 246186 gene locus_tag LOCUS_02310 245830 246186 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958235.1 protein_id gnl|my_center|LOCUS_02310 246177 246731 gene locus_tag LOCUS_02320 246177 246731 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944318.1 protein_id gnl|my_center|LOCUS_02320 246732 247502 gene locus_tag LOCUS_02330 246732 247502 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037657.1 protein_id gnl|my_center|LOCUS_02330 247507 248778 gene locus_tag LOCUS_02340 247507 248778 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037656.1 protein_id gnl|my_center|LOCUS_02340 248775 249302 gene locus_tag LOCUS_02350 gene nuoE 248775 249302 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037655.1 protein_id gnl|my_center|LOCUS_02350 249311 250675 gene locus_tag LOCUS_02360 gene nuoF 249311 250675 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037654.1 protein_id gnl|my_center|LOCUS_02360 250672 252981 gene locus_tag LOCUS_02370 gene nuoG 250672 252981 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037653.1 protein_id gnl|my_center|LOCUS_02370 252981 254048 gene locus_tag LOCUS_02380 gene nuoH 252981 254048 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037652.1 protein_id gnl|my_center|LOCUS_02380 254070 254558 gene locus_tag LOCUS_02390 gene nuoI 254070 254558 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508211.1 protein_id gnl|my_center|LOCUS_02390 254572 255192 gene locus_tag LOCUS_02400 254572 255192 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944316.1 protein_id gnl|my_center|LOCUS_02400 255189 255494 gene locus_tag LOCUS_02410 gene nuoK 255189 255494 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005914274.1 protein_id gnl|my_center|LOCUS_02410 255496 257691 gene locus_tag LOCUS_02420 gene nuoL 255496 257691 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037649.1 protein_id gnl|my_center|LOCUS_02420 257710 259239 gene locus_tag LOCUS_02430 257710 259239 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037648.1 protein_id gnl|my_center|LOCUS_02430 259256 260698 gene locus_tag LOCUS_02440 gene nuoN 259256 260698 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037647.1 protein_id gnl|my_center|LOCUS_02440 262637 260733 gene locus_tag LOCUS_02450 gene recD 262637 260733 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775991.1 protein_id gnl|my_center|LOCUS_02450 266329 262634 gene locus_tag LOCUS_02460 gene recB 266329 262634 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193148.1 protein_id gnl|my_center|LOCUS_02460 269973 266326 gene locus_tag LOCUS_02470 gene recC 269973 266326 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942180.1 protein_id gnl|my_center|LOCUS_02470 271044 270037 gene locus_tag LOCUS_02480 271044 270037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 271901 271059 gene locus_tag LOCUS_02490 gene rlmJ 271901 271059 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037826.1 protein_id gnl|my_center|LOCUS_02490 272474 271932 gene locus_tag LOCUS_02500 272474 271932 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036172.1 protein_id gnl|my_center|LOCUS_02500 273622 272474 gene locus_tag LOCUS_02510 273622 272474 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036173.1 protein_id gnl|my_center|LOCUS_02510 273773 276013 gene locus_tag LOCUS_02520 273773 276013 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036160.1 protein_id gnl|my_center|LOCUS_02520 276013 277161 gene locus_tag LOCUS_02530 276013 277161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 278679 277165 gene locus_tag LOCUS_02540 gene ppx 278679 277165 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944807.1 protein_id gnl|my_center|LOCUS_02540 280788 278686 gene locus_tag LOCUS_02550 gene ppk1 280788 278686 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036175.1 protein_id gnl|my_center|LOCUS_02550 282171 280849 gene locus_tag LOCUS_02560 gene phoR 282171 280849 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506859.1 protein_id gnl|my_center|LOCUS_02560 282877 282188 gene locus_tag LOCUS_02570 gene phoB 282877 282188 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036177.1 protein_id gnl|my_center|LOCUS_02570 284605 282968 gene locus_tag LOCUS_02580 284605 282968 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036178.1 protein_id gnl|my_center|LOCUS_02580 284729 284995 gene locus_tag LOCUS_02590 gene grxC 284729 284995 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506861.1 protein_id gnl|my_center|LOCUS_02590 284992 285348 gene locus_tag LOCUS_02600 284992 285348 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036180.1 protein_id gnl|my_center|LOCUS_02600 285397 286407 gene locus_tag LOCUS_02610 285397 286407 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036181.1 protein_id gnl|my_center|LOCUS_02610 >Feature sequence02 444 1922 gene locus_tag LOCUS_02620 444 1922 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039725284.1 protein_id gnl|my_center|LOCUS_02620 2886 1972 gene locus_tag LOCUS_02630 gene htpX 2886 1972 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037436.1 protein_id gnl|my_center|LOCUS_02630 2975 3913 gene locus_tag LOCUS_02640 gene gluQRS 2975 3913 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037437.1 protein_id gnl|my_center|LOCUS_02640 3954 4493 gene locus_tag LOCUS_02650 3954 4493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 6351 4510 gene locus_tag LOCUS_02660 6351 4510 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275348.1 protein_id gnl|my_center|LOCUS_02660 6423 7502 gene locus_tag LOCUS_02670 gene rnd 6423 7502 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037450.1 protein_id gnl|my_center|LOCUS_02670 7575 7650 gene locus_tag LOCUS_t00150 7575 7650 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 8288 9760 gene locus_tag LOCUS_02680 8288 9760 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892661.1 protein_id gnl|my_center|LOCUS_02680 9788 10507 gene locus_tag LOCUS_02690 9788 10507 CDS product DUF4194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727561.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02690 10500 13913 gene locus_tag LOCUS_02700 10500 13913 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039227.1 protein_id gnl|my_center|LOCUS_02700 13910 15118 gene locus_tag LOCUS_02710 13910 15118 CDS product DUF3322 and DUF2220 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727563.1 protein_id gnl|my_center|LOCUS_02710 15333 15626 gene locus_tag LOCUS_02720 15333 15626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 15623 15907 gene locus_tag LOCUS_02730 15623 15907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 16085 16161 gene locus_tag LOCUS_t00160 16085 16161 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 16191 17723 gene locus_tag LOCUS_02740 16191 17723 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036964.1 protein_id gnl|my_center|LOCUS_02740 17772 18353 gene locus_tag LOCUS_02750 17772 18353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 18350 18646 gene locus_tag LOCUS_02760 18350 18646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 18672 19721 gene locus_tag LOCUS_02770 18672 19721 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036961.1 protein_id gnl|my_center|LOCUS_02770 19718 20794 gene locus_tag LOCUS_02780 gene murB 19718 20794 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036960.1 protein_id gnl|my_center|LOCUS_02780 20791 21705 gene locus_tag LOCUS_02790 20791 21705 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 protein_id gnl|my_center|LOCUS_02790 21827 23869 gene locus_tag LOCUS_02800 21827 23869 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819543.1 protein_id gnl|my_center|LOCUS_02800 25093 23870 gene locus_tag LOCUS_02810 gene ispG 25093 23870 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036954.1 protein_id gnl|my_center|LOCUS_02810 26739 25114 gene locus_tag LOCUS_02820 26739 25114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 26815 28050 gene locus_tag LOCUS_02830 gene xseA 26815 28050 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037447.1 protein_id gnl|my_center|LOCUS_02830 28047 28973 gene locus_tag LOCUS_02840 28047 28973 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_02840 29970 28999 gene locus_tag LOCUS_02850 29970 28999 CDS product CorA family divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256358.1 protein_id gnl|my_center|LOCUS_02850 30387 29995 gene locus_tag LOCUS_02860 30387 29995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 30699 32528 gene locus_tag LOCUS_02870 30699 32528 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036668.1 protein_id gnl|my_center|LOCUS_02870 33286 32531 gene locus_tag LOCUS_02880 33286 32531 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036479.1 protein_id gnl|my_center|LOCUS_02880 33693 33283 gene locus_tag LOCUS_02890 33693 33283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 34847 33837 gene locus_tag LOCUS_02900 gene nagZ 34847 33837 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036477.1 protein_id gnl|my_center|LOCUS_02900 34974 34898 gene locus_tag LOCUS_t00170 34974 34898 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 35449 35054 gene locus_tag LOCUS_02910 35449 35054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 35729 35430 gene locus_tag LOCUS_02920 35729 35430 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002811076.1 protein_id gnl|my_center|LOCUS_02920 38168 35742 gene locus_tag LOCUS_02930 gene pheT 38168 35742 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037596.1 protein_id gnl|my_center|LOCUS_02930 39160 38165 gene locus_tag LOCUS_02940 gene pheS 39160 38165 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037597.1 protein_id gnl|my_center|LOCUS_02940 39664 39305 gene locus_tag LOCUS_02950 gene rplT 39664 39305 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037598.1 protein_id gnl|my_center|LOCUS_02950 39875 39678 gene locus_tag LOCUS_02960 gene rpmI 39875 39678 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002811096.1 protein_id gnl|my_center|LOCUS_02960 40626 40147 gene locus_tag LOCUS_02970 gene infC 40626 40147 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070690874.1 protein_id gnl|my_center|LOCUS_02970 42609 40702 gene locus_tag LOCUS_02980 gene thrS 42609 40702 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944299.1 protein_id gnl|my_center|LOCUS_02980 42836 42762 gene locus_tag LOCUS_t00180 42836 42762 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 44981 42948 gene locus_tag LOCUS_02990 gene uvrB 44981 42948 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037621.1 protein_id gnl|my_center|LOCUS_02990 45131 45682 gene locus_tag LOCUS_03000 45131 45682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 45717 45793 gene locus_tag LOCUS_t00190 45717 45793 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 46270 45836 gene locus_tag LOCUS_03010 46270 45836 CDS product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103296.1 protein_id gnl|my_center|LOCUS_03010 49986 46267 gene locus_tag LOCUS_03020 49986 46267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 50631 50008 gene locus_tag LOCUS_03030 50631 50008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 51803 50628 gene locus_tag LOCUS_03040 51803 50628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 52252 51800 gene locus_tag LOCUS_03050 52252 51800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 52814 52257 gene locus_tag LOCUS_03060 52814 52257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 52910 53617 gene locus_tag LOCUS_03070 52910 53617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 53586 53894 gene locus_tag LOCUS_03080 53586 53894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 55300 53876 gene locus_tag LOCUS_03090 gene ppnN 55300 53876 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054702.1 protein_id gnl|my_center|LOCUS_03090 58747 55394 gene locus_tag LOCUS_03100 58747 55394 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037631.1 protein_id gnl|my_center|LOCUS_03100 59661 58903 gene locus_tag LOCUS_03110 59661 58903 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037632.1 protein_id gnl|my_center|LOCUS_03110 59978 59658 gene locus_tag LOCUS_03120 gene grxD 59978 59658 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037633.1 protein_id gnl|my_center|LOCUS_03120 60089 60667 gene locus_tag LOCUS_03130 gene sodB 60089 60667 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185841.1 protein_id gnl|my_center|LOCUS_03130 60683 61747 gene locus_tag LOCUS_03140 60683 61747 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405435.1 protein_id gnl|my_center|LOCUS_03140 62937 61789 gene locus_tag LOCUS_03150 62937 61789 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037635.1 protein_id gnl|my_center|LOCUS_03150 63419 62934 gene locus_tag LOCUS_03160 gene purE 63419 62934 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037636.1 protein_id gnl|my_center|LOCUS_03160 63303 63806 gene locus_tag LOCUS_03170 63303 63806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 63806 64672 gene locus_tag LOCUS_03180 gene nadC 63806 64672 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037638.1 protein_id gnl|my_center|LOCUS_03180 64782 65126 gene locus_tag LOCUS_03190 64782 65126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 65561 65136 gene locus_tag LOCUS_03200 65561 65136 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037463.1 protein_id gnl|my_center|LOCUS_03200 66196 65558 gene locus_tag LOCUS_03210 66196 65558 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037464.1 protein_id gnl|my_center|LOCUS_03210 67047 66289 gene locus_tag LOCUS_03220 67047 66289 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994029.1 protein_id gnl|my_center|LOCUS_03220 68284 67040 gene locus_tag LOCUS_03230 68284 67040 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037466.1 protein_id gnl|my_center|LOCUS_03230 68895 68284 gene locus_tag LOCUS_03240 gene petA 68895 68284 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037467.1 protein_id gnl|my_center|LOCUS_03240 70015 69011 gene locus_tag LOCUS_03250 70015 69011 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037468.1 protein_id gnl|my_center|LOCUS_03250 70040 71383 gene locus_tag LOCUS_03260 gene miaB 70040 71383 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037471.1 protein_id gnl|my_center|LOCUS_03260 71418 72401 gene locus_tag LOCUS_03270 71418 72401 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037472.1 protein_id gnl|my_center|LOCUS_03270 72411 72884 gene locus_tag LOCUS_03280 gene ybeY 72411 72884 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037474.1 protein_id gnl|my_center|LOCUS_03280 72958 73809 gene locus_tag LOCUS_03290 72958 73809 CDS product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037476.1 protein_id gnl|my_center|LOCUS_03290 73814 75016 gene locus_tag LOCUS_03300 73814 75016 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037477.1 protein_id gnl|my_center|LOCUS_03300 75024 76037 gene locus_tag LOCUS_03310 75024 76037 CDS product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037478.1 protein_id gnl|my_center|LOCUS_03310 78017 76050 gene locus_tag LOCUS_03320 78017 76050 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919966.1 protein_id gnl|my_center|LOCUS_03320 78661 78110 gene locus_tag LOCUS_03330 gene sufT 78661 78110 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_03330 80168 78714 gene locus_tag LOCUS_03340 80168 78714 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227779.1 protein_id gnl|my_center|LOCUS_03340 80455 80168 gene locus_tag LOCUS_03350 80455 80168 CDS product proton-translocating transhydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227778.1 protein_id gnl|my_center|LOCUS_03350 80643 81236 gene locus_tag LOCUS_03360 80643 81236 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040016.1 protein_id gnl|my_center|LOCUS_03360 82331 81246 gene locus_tag LOCUS_03370 82331 81246 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726703.1 protein_id gnl|my_center|LOCUS_03370 82452 83018 gene locus_tag LOCUS_03380 82452 83018 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036076.1 protein_id gnl|my_center|LOCUS_03380 83021 83995 gene locus_tag LOCUS_03390 83021 83995 CDS product 5'-3' exonuclease H3TH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036075.1 protein_id gnl|my_center|LOCUS_03390 83992 84555 gene locus_tag LOCUS_03400 83992 84555 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439149.1 protein_id gnl|my_center|LOCUS_03400 85513 84569 gene locus_tag LOCUS_03410 gene pip 85513 84569 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036072.1 protein_id gnl|my_center|LOCUS_03410 85605 86258 gene locus_tag LOCUS_03420 85605 86258 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037574.1 protein_id gnl|my_center|LOCUS_03420 86334 88235 gene locus_tag LOCUS_03430 gene dxs 86334 88235 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037575.1 protein_id gnl|my_center|LOCUS_03430 89062 88232 gene locus_tag LOCUS_03440 gene prmC 89062 88232 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036071.1 protein_id gnl|my_center|LOCUS_03440 90672 89089 gene locus_tag LOCUS_03450 gene ahpF 90672 89089 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315309.1 protein_id gnl|my_center|LOCUS_03450 91336 90773 gene locus_tag LOCUS_03460 gene ahpC 91336 90773 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036070.1 protein_id gnl|my_center|LOCUS_03460 91535 92443 gene locus_tag LOCUS_03470 91535 92443 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036068.1 protein_id gnl|my_center|LOCUS_03470 93355 92459 gene locus_tag LOCUS_03480 93355 92459 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940028.1 protein_id gnl|my_center|LOCUS_03480 95549 93363 gene locus_tag LOCUS_03490 95549 93363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 95680 97425 gene locus_tag LOCUS_03500 95680 97425 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036057.1 protein_id gnl|my_center|LOCUS_03500 97427 97912 gene locus_tag LOCUS_03510 97427 97912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 97912 98469 gene locus_tag LOCUS_03520 97912 98469 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036053.1 protein_id gnl|my_center|LOCUS_03520 98475 99581 gene locus_tag LOCUS_03530 gene rlmM 98475 99581 CDS product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036052.1 protein_id gnl|my_center|LOCUS_03530 100743 99559 gene locus_tag LOCUS_03540 100743 99559 CDS product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036035.1 protein_id gnl|my_center|LOCUS_03540 101951 100740 gene locus_tag LOCUS_03550 gene ubiH 101951 100740 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036034.1 protein_id gnl|my_center|LOCUS_03550 102064 102645 gene locus_tag LOCUS_03560 102064 102645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036033.1 protein_id gnl|my_center|LOCUS_03560 102593 103234 gene locus_tag LOCUS_03570 102593 103234 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036032.1 protein_id gnl|my_center|LOCUS_03570 103308 105542 gene locus_tag LOCUS_03580 gene lptD 103308 105542 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036030.1 protein_id gnl|my_center|LOCUS_03580 104868 104781 gene locus_tag LOCUS_t00200 104868 104781 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 105581 106888 gene locus_tag LOCUS_03590 105581 106888 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036029.1 protein_id gnl|my_center|LOCUS_03590 106893 107876 gene locus_tag LOCUS_03600 gene pdxA 106893 107876 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036028.1 protein_id gnl|my_center|LOCUS_03600 107873 108682 gene locus_tag LOCUS_03610 gene rsmA 107873 108682 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036027.1 protein_id gnl|my_center|LOCUS_03610 108692 109072 gene locus_tag LOCUS_03620 gene apaG 108692 109072 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036026.1 protein_id gnl|my_center|LOCUS_03620 109072 109914 gene locus_tag LOCUS_03630 109072 109914 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036025.1 protein_id gnl|my_center|LOCUS_03630 110472 109921 gene locus_tag LOCUS_03640 110472 109921 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036024.1 protein_id gnl|my_center|LOCUS_03640 111263 110469 gene locus_tag LOCUS_03650 111263 110469 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110588.1 protein_id gnl|my_center|LOCUS_03650 112181 111312 gene locus_tag LOCUS_03660 gene lgt 112181 111312 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036022.1 protein_id gnl|my_center|LOCUS_03660 113412 112192 gene locus_tag LOCUS_03670 113412 112192 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084438.1 protein_id gnl|my_center|LOCUS_03670 113803 113420 gene locus_tag LOCUS_03680 113803 113420 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036018.1 protein_id gnl|my_center|LOCUS_03680 113934 114719 gene locus_tag LOCUS_03690 113934 114719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 114767 115768 gene locus_tag LOCUS_03700 114767 115768 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035417.1 protein_id gnl|my_center|LOCUS_03700 116227 115799 gene locus_tag LOCUS_03710 116227 115799 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037987.1 protein_id gnl|my_center|LOCUS_03710 117226 116279 gene locus_tag LOCUS_03720 117226 116279 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057335.1 protein_id gnl|my_center|LOCUS_03720 117290 117613 gene locus_tag LOCUS_03730 117290 117613 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198701.1 protein_id gnl|my_center|LOCUS_03730 117650 118033 gene locus_tag LOCUS_03740 117650 118033 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222673.1 protein_id gnl|my_center|LOCUS_03740 118051 118806 gene locus_tag LOCUS_03750 gene aqpS 118051 118806 CDS product aquaglyceroporin AqpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969025.1 protein_id gnl|my_center|LOCUS_03750 119519 118755 gene locus_tag LOCUS_03760 gene mtgA 119519 118755 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037989.1 protein_id gnl|my_center|LOCUS_03760 119518 120471 gene locus_tag LOCUS_03770 119518 120471 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037990.1 protein_id gnl|my_center|LOCUS_03770 120528 121493 gene locus_tag LOCUS_03780 120528 121493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037991.1 protein_id gnl|my_center|LOCUS_03780 122738 121509 gene locus_tag LOCUS_03790 122738 121509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 123748 122735 gene locus_tag LOCUS_03800 123748 122735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 126551 123849 gene locus_tag LOCUS_03810 126551 123849 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458992.1 protein_id gnl|my_center|LOCUS_03810 128569 126716 gene locus_tag LOCUS_03820 128569 126716 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_03820 129185 128595 gene locus_tag LOCUS_03830 129185 128595 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037993.1 protein_id gnl|my_center|LOCUS_03830 129294 130181 gene locus_tag LOCUS_03840 129294 130181 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275307.1 protein_id gnl|my_center|LOCUS_03840 130195 132669 gene locus_tag LOCUS_03850 130195 132669 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037995.1 protein_id gnl|my_center|LOCUS_03850 132666 133148 gene locus_tag LOCUS_03860 132666 133148 CDS product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038810.1 protein_id gnl|my_center|LOCUS_03860 134475 133153 gene locus_tag LOCUS_03870 134475 133153 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037997.1 protein_id gnl|my_center|LOCUS_03870 134598 136199 gene locus_tag LOCUS_03880 134598 136199 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920494.1 protein_id gnl|my_center|LOCUS_03880 138101 136209 gene locus_tag LOCUS_03890 138101 136209 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198677105.1 protein_id gnl|my_center|LOCUS_03890 138704 138108 gene locus_tag LOCUS_03900 138704 138108 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_03900 138775 139977 gene locus_tag LOCUS_03910 138775 139977 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994167.1 protein_id gnl|my_center|LOCUS_03910 140451 140092 gene locus_tag LOCUS_03920 140451 140092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 141507 141121 gene locus_tag LOCUS_03930 gene gcvH 141507 141121 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038001.1 protein_id gnl|my_center|LOCUS_03930 142673 141552 gene locus_tag LOCUS_03940 gene gcvT 142673 141552 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038002.1 protein_id gnl|my_center|LOCUS_03940 144330 142747 gene locus_tag LOCUS_03950 144330 142747 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099178.1 protein_id gnl|my_center|LOCUS_03950 145409 144351 gene locus_tag LOCUS_03960 145409 144351 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096289.1 protein_id gnl|my_center|LOCUS_03960 145947 145504 gene locus_tag LOCUS_03970 145947 145504 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038003.1 protein_id gnl|my_center|LOCUS_03970 146925 145951 gene locus_tag LOCUS_03980 146925 145951 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038004.1 protein_id gnl|my_center|LOCUS_03980 147813 146995 gene locus_tag LOCUS_03990 147813 146995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036006.1 protein_id gnl|my_center|LOCUS_03990 148252 148052 gene locus_tag LOCUS_04000 148252 148052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 149083 148310 gene locus_tag LOCUS_04010 149083 148310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 149151 149720 gene locus_tag LOCUS_04020 149151 149720 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768799.1 protein_id gnl|my_center|LOCUS_04020 149836 151182 gene locus_tag LOCUS_04030 149836 151182 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_04030 151191 152201 gene locus_tag LOCUS_04040 151191 152201 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036000.1 protein_id gnl|my_center|LOCUS_04040 152238 152639 gene locus_tag LOCUS_04050 152238 152639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04050 152588 153100 gene locus_tag LOCUS_04060 152588 153100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04060 153128 154153 gene locus_tag LOCUS_04070 gene motB 153128 154153 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038737.1 protein_id gnl|my_center|LOCUS_04070 155266 154421 gene locus_tag LOCUS_04080 155266 154421 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921173.1 protein_id gnl|my_center|LOCUS_04080 156492 155263 gene locus_tag LOCUS_04090 156492 155263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 158441 156573 gene locus_tag LOCUS_04100 158441 156573 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705506.1 protein_id gnl|my_center|LOCUS_04100 158616 159860 gene locus_tag LOCUS_04110 gene metK 158616 159860 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035997.1 protein_id gnl|my_center|LOCUS_04110 160971 159958 gene locus_tag LOCUS_04120 gene gap 160971 159958 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522067.1 protein_id gnl|my_center|LOCUS_04120 161160 161768 gene locus_tag LOCUS_04130 161160 161768 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038301.1 protein_id gnl|my_center|LOCUS_04130 163398 161863 gene locus_tag LOCUS_04140 163398 161863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 163753 163385 gene locus_tag LOCUS_04150 163753 163385 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640294.1 protein_id gnl|my_center|LOCUS_04150 165910 163907 gene locus_tag LOCUS_04160 gene tkt 165910 163907 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038323.1 protein_id gnl|my_center|LOCUS_04160 167244 165907 gene locus_tag LOCUS_04170 167244 165907 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176993997.1 protein_id gnl|my_center|LOCUS_04170 168819 167257 gene locus_tag LOCUS_04180 168819 167257 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189099273.1 protein_id gnl|my_center|LOCUS_04180 171151 168896 gene locus_tag LOCUS_04190 171151 168896 CDS product type IV pilus secretin PilQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038331.1 protein_id gnl|my_center|LOCUS_04190 171651 171151 gene locus_tag LOCUS_04200 171651 171151 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038332.1 protein_id gnl|my_center|LOCUS_04200 172343 171648 gene locus_tag LOCUS_04210 172343 171648 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038333.1 protein_id gnl|my_center|LOCUS_04210 172983 172354 gene locus_tag LOCUS_04220 172983 172354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 174041 172983 gene locus_tag LOCUS_04230 174041 172983 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038335.1 protein_id gnl|my_center|LOCUS_04230 174214 176703 gene locus_tag LOCUS_04240 174214 176703 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095522231.1 protein_id gnl|my_center|LOCUS_04240 177997 176708 gene locus_tag LOCUS_04250 177997 176708 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038338.1 protein_id gnl|my_center|LOCUS_04250 178463 178218 gene locus_tag LOCUS_04260 178463 178218 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038339.1 protein_id gnl|my_center|LOCUS_04260 179490 178552 gene locus_tag LOCUS_04270 179490 178552 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038340.1 protein_id gnl|my_center|LOCUS_04270 181664 179556 gene locus_tag LOCUS_04280 gene recG 181664 179556 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038341.1 protein_id gnl|my_center|LOCUS_04280 182052 181669 gene locus_tag LOCUS_04290 182052 181669 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038342.1 protein_id gnl|my_center|LOCUS_04290 184285 182117 gene locus_tag LOCUS_04300 184285 182117 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038350.1 protein_id gnl|my_center|LOCUS_04300 184672 184376 gene locus_tag LOCUS_04310 gene rpoZ 184672 184376 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002812428.1 protein_id gnl|my_center|LOCUS_04310 185394 184747 gene locus_tag LOCUS_04320 gene gmk 185394 184747 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038351.1 protein_id gnl|my_center|LOCUS_04320 186277 185414 gene locus_tag LOCUS_04330 186277 185414 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038352.1 protein_id gnl|my_center|LOCUS_04330 186352 187068 gene locus_tag LOCUS_04340 gene rph 186352 187068 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038353.1 protein_id gnl|my_center|LOCUS_04340 187078 187680 gene locus_tag LOCUS_04350 gene rdgB 187078 187680 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043877719.1 protein_id gnl|my_center|LOCUS_04350 187691 188857 gene locus_tag LOCUS_04360 gene hemW 187691 188857 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038356.1 protein_id gnl|my_center|LOCUS_04360 189196 191022 gene locus_tag LOCUS_04370 gene btuB 189196 191022 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_04370 191109 192407 gene locus_tag LOCUS_04380 gene pepQ 191109 192407 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038359.1 protein_id gnl|my_center|LOCUS_04380 193748 196696 gene locus_tag LOCUS_04390 193748 196696 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035888.1 protein_id gnl|my_center|LOCUS_04390 196733 197389 gene locus_tag LOCUS_04400 196733 197389 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037985.1 protein_id gnl|my_center|LOCUS_04400 197888 197394 gene locus_tag LOCUS_04410 gene rimI 197888 197394 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 protein_id gnl|my_center|LOCUS_04410 198120 197869 gene locus_tag LOCUS_04420 198120 197869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 198878 198117 gene locus_tag LOCUS_04430 gene pssA 198878 198117 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035883.1 protein_id gnl|my_center|LOCUS_04430 198957 199376 gene locus_tag LOCUS_04440 198957 199376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 >Feature sequence03 1594 317 gene locus_tag LOCUS_04450 1594 317 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093492.1 protein_id gnl|my_center|LOCUS_04450 2521 1709 gene locus_tag LOCUS_04460 2521 1709 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205929.1 protein_id gnl|my_center|LOCUS_04460 2520 4508 gene locus_tag LOCUS_04470 2520 4508 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176993987.1 protein_id gnl|my_center|LOCUS_04470 4519 5454 gene locus_tag LOCUS_04480 4519 5454 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927008.1 protein_id gnl|my_center|LOCUS_04480 5426 6718 gene locus_tag LOCUS_04490 5426 6718 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038505.1 protein_id gnl|my_center|LOCUS_04490 7070 6678 gene locus_tag LOCUS_04500 7070 6678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 8266 7082 gene locus_tag LOCUS_04510 8266 7082 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508984.1 protein_id gnl|my_center|LOCUS_04510 8607 9341 gene locus_tag LOCUS_04520 8607 9341 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_04520 9839 9327 gene locus_tag LOCUS_04530 9839 9327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 10307 9885 gene locus_tag LOCUS_04540 10307 9885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 10670 10317 gene locus_tag LOCUS_04550 gene folB 10670 10317 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038896.1 protein_id gnl|my_center|LOCUS_04550 11801 10737 gene locus_tag LOCUS_04560 gene tsaD 11801 10737 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038897.1 protein_id gnl|my_center|LOCUS_04560 11914 12129 gene locus_tag LOCUS_04570 gene rpsU 11914 12129 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808376.1 protein_id gnl|my_center|LOCUS_04570 12181 12486 gene locus_tag LOCUS_04580 12181 12486 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242138.1 protein_id gnl|my_center|LOCUS_04580 12486 12863 gene locus_tag LOCUS_04590 12486 12863 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252024.1 protein_id gnl|my_center|LOCUS_04590 12965 13414 gene locus_tag LOCUS_04600 12965 13414 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038898.1 protein_id gnl|my_center|LOCUS_04600 13442 15262 gene locus_tag LOCUS_04610 gene dnaG 13442 15262 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038900.1 protein_id gnl|my_center|LOCUS_04610 15928 15284 gene locus_tag LOCUS_04620 gene pdxH 15928 15284 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037965.1 protein_id gnl|my_center|LOCUS_04620 16051 16539 gene locus_tag LOCUS_04630 16051 16539 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037309.1 protein_id gnl|my_center|LOCUS_04630 17774 16494 gene locus_tag LOCUS_04640 17774 16494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037383.1 protein_id gnl|my_center|LOCUS_04640 18485 17778 gene locus_tag LOCUS_04650 18485 17778 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038877.1 protein_id gnl|my_center|LOCUS_04650 18532 20004 gene locus_tag LOCUS_04660 18532 20004 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107859.1 protein_id gnl|my_center|LOCUS_04660 20165 20470 gene locus_tag LOCUS_04670 20165 20470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 20664 21629 gene locus_tag LOCUS_04680 20664 21629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 21632 23206 gene locus_tag LOCUS_04690 21632 23206 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256724.1 protein_id gnl|my_center|LOCUS_04690 23344 23667 gene locus_tag LOCUS_04700 23344 23667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041065645.1 protein_id gnl|my_center|LOCUS_04700 24645 24385 gene locus_tag LOCUS_04710 24645 24385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 25800 24868 gene locus_tag LOCUS_04720 25800 24868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 27198 25912 gene locus_tag LOCUS_04730 27198 25912 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970031.1 protein_id gnl|my_center|LOCUS_04730 27320 27832 gene locus_tag LOCUS_04740 27320 27832 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967076.1 protein_id gnl|my_center|LOCUS_04740 27991 28542 gene locus_tag LOCUS_04750 27991 28542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 29395 28646 gene locus_tag LOCUS_04760 29395 28646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096987.1 protein_id gnl|my_center|LOCUS_04760 30165 29518 gene locus_tag LOCUS_04770 30165 29518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 33455 30180 gene locus_tag LOCUS_04780 33455 30180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 33633 35033 gene locus_tag LOCUS_04790 33633 35033 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038973.1 protein_id gnl|my_center|LOCUS_04790 35069 35815 gene locus_tag LOCUS_04800 35069 35815 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038978.1 protein_id gnl|my_center|LOCUS_04800 35861 37249 gene locus_tag LOCUS_04810 35861 37249 CDS product leucyl aminopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038979.1 protein_id gnl|my_center|LOCUS_04810 37947 37369 gene locus_tag LOCUS_04820 37947 37369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 39185 37944 gene locus_tag LOCUS_04830 39185 37944 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036096.1 protein_id gnl|my_center|LOCUS_04830 39272 39874 gene locus_tag LOCUS_04840 gene wrbA 39272 39874 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036095.1 protein_id gnl|my_center|LOCUS_04840 39874 40245 gene locus_tag LOCUS_04850 39874 40245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 40392 40760 gene locus_tag LOCUS_04860 40392 40760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 42576 40804 gene locus_tag LOCUS_04870 42576 40804 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139328002.1 protein_id gnl|my_center|LOCUS_04870 43012 44466 gene locus_tag LOCUS_04880 gene ccoN 43012 44466 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072351.1 protein_id gnl|my_center|LOCUS_04880 44477 45082 gene locus_tag LOCUS_04890 gene ccoO 44477 45082 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810383.1 protein_id gnl|my_center|LOCUS_04890 45226 46200 gene locus_tag LOCUS_04900 gene ccoP 45226 46200 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477628.1 protein_id gnl|my_center|LOCUS_04900 46208 46501 gene locus_tag LOCUS_04910 46208 46501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 46507 48057 gene locus_tag LOCUS_04920 gene ccoG 46507 48057 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818562.1 protein_id gnl|my_center|LOCUS_04920 49341 48070 gene locus_tag LOCUS_04930 49341 48070 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035604.1 protein_id gnl|my_center|LOCUS_04930 49470 49994 gene locus_tag LOCUS_04940 49470 49994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 49995 52349 gene locus_tag LOCUS_04950 49995 52349 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_04950 52346 52495 gene locus_tag LOCUS_04960 52346 52495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 52485 53216 gene locus_tag LOCUS_04970 52485 53216 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706150.1 protein_id gnl|my_center|LOCUS_04970 53976 53218 gene locus_tag LOCUS_04980 gene fnr 53976 53218 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070077129.1 protein_id gnl|my_center|LOCUS_04980 55966 54002 gene locus_tag LOCUS_04990 55966 54002 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640383.1 protein_id gnl|my_center|LOCUS_04990 55919 56113 gene locus_tag LOCUS_05000 55919 56113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 56221 57231 gene locus_tag LOCUS_05010 56221 57231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 59323 57299 gene locus_tag LOCUS_05020 59323 57299 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073927.1 protein_id gnl|my_center|LOCUS_05020 59975 59451 gene locus_tag LOCUS_05030 59975 59451 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037865.1 protein_id gnl|my_center|LOCUS_05030 60126 61130 gene locus_tag LOCUS_05040 60126 61130 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037866.1 protein_id gnl|my_center|LOCUS_05040 62534 61146 gene locus_tag LOCUS_05050 gene murD 62534 61146 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037868.1 protein_id gnl|my_center|LOCUS_05050 63951 62515 gene locus_tag LOCUS_05060 gene murL 63951 62515 CDS product UDP-N-acetyl-alpha-D-muramoyl-L-alanyl-L-glutamate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037869.1 protein_id gnl|my_center|LOCUS_05060 66554 63948 gene locus_tag LOCUS_05070 66554 63948 CDS product bifunctional aspartate kinase/diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037871.1 protein_id gnl|my_center|LOCUS_05070 66687 67607 gene locus_tag LOCUS_05080 66687 67607 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037872.1 protein_id gnl|my_center|LOCUS_05080 67679 68533 gene locus_tag LOCUS_05090 67679 68533 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037873.1 protein_id gnl|my_center|LOCUS_05090 69190 68549 gene locus_tag LOCUS_05100 69190 68549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 69430 71478 gene locus_tag LOCUS_05110 gene fusA 69430 71478 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479820.1 protein_id gnl|my_center|LOCUS_05110 71537 72904 gene locus_tag LOCUS_05120 71537 72904 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639931.1 protein_id gnl|my_center|LOCUS_05120 72931 73344 gene locus_tag LOCUS_05130 72931 73344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 73843 73355 gene locus_tag LOCUS_05140 73843 73355 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944109.1 protein_id gnl|my_center|LOCUS_05140 73906 74628 gene locus_tag LOCUS_05150 73906 74628 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976789.1 protein_id gnl|my_center|LOCUS_05150 74758 75228 gene locus_tag LOCUS_05160 74758 75228 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037893.1 protein_id gnl|my_center|LOCUS_05160 75249 76733 gene locus_tag LOCUS_05170 gene sufB 75249 76733 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037894.1 protein_id gnl|my_center|LOCUS_05170 76781 77545 gene locus_tag LOCUS_05180 gene sufC 76781 77545 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037895.1 protein_id gnl|my_center|LOCUS_05180 77542 78930 gene locus_tag LOCUS_05190 gene sufD 77542 78930 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037896.1 protein_id gnl|my_center|LOCUS_05190 78927 80186 gene locus_tag LOCUS_05200 78927 80186 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037897.1 protein_id gnl|my_center|LOCUS_05200 80237 80809 gene locus_tag LOCUS_05210 80237 80809 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037898.1 protein_id gnl|my_center|LOCUS_05210 80806 81123 gene locus_tag LOCUS_05220 80806 81123 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037899.1 protein_id gnl|my_center|LOCUS_05220 81257 81775 gene locus_tag LOCUS_05230 81257 81775 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940308.1 protein_id gnl|my_center|LOCUS_05230 82349 81780 gene locus_tag LOCUS_05240 82349 81780 CDS product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216841.1 protein_id gnl|my_center|LOCUS_05240 82922 82554 gene locus_tag LOCUS_05250 82922 82554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 83140 84663 gene locus_tag LOCUS_05260 83140 84663 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037909.1 protein_id gnl|my_center|LOCUS_05260 84698 84964 gene locus_tag LOCUS_05270 84698 84964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 84968 86011 gene locus_tag LOCUS_05280 84968 86011 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037911.1 protein_id gnl|my_center|LOCUS_05280 86033 86797 gene locus_tag LOCUS_05290 86033 86797 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037912.1 protein_id gnl|my_center|LOCUS_05290 87526 86837 gene locus_tag LOCUS_05300 gene hda 87526 86837 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037913.1 protein_id gnl|my_center|LOCUS_05300 88695 87523 gene locus_tag LOCUS_05310 88695 87523 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037914.1 protein_id gnl|my_center|LOCUS_05310 89801 88707 gene locus_tag LOCUS_05320 89801 88707 CDS product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042598094.1 protein_id gnl|my_center|LOCUS_05320 89930 91003 gene locus_tag LOCUS_05330 gene purM 89930 91003 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628894.1 protein_id gnl|my_center|LOCUS_05330 91032 91718 gene locus_tag LOCUS_05340 gene purN 91032 91718 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037918.1 protein_id gnl|my_center|LOCUS_05340 91715 92440 gene locus_tag LOCUS_05350 91715 92440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 93125 92451 gene locus_tag LOCUS_05360 93125 92451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 94388 93129 gene locus_tag LOCUS_05370 gene murA 94388 93129 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037922.1 protein_id gnl|my_center|LOCUS_05370 94624 94388 gene locus_tag LOCUS_05380 94624 94388 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037923.1 protein_id gnl|my_center|LOCUS_05380 94693 95691 gene locus_tag LOCUS_05390 94693 95691 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037924.1 protein_id gnl|my_center|LOCUS_05390 95695 96240 gene locus_tag LOCUS_05400 95695 96240 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037925.1 protein_id gnl|my_center|LOCUS_05400 96237 96824 gene locus_tag LOCUS_05410 96237 96824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 96790 97263 gene locus_tag LOCUS_05420 gene lptA 96790 97263 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216438.1 protein_id gnl|my_center|LOCUS_05420 97263 97982 gene locus_tag LOCUS_05430 gene lptB 97263 97982 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037928.1 protein_id gnl|my_center|LOCUS_05430 97985 99364 gene locus_tag LOCUS_05440 97985 99364 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037929.1 protein_id gnl|my_center|LOCUS_05440 99484 99810 gene locus_tag LOCUS_05450 gene raiA 99484 99810 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037930.1 protein_id gnl|my_center|LOCUS_05450 99823 100290 gene locus_tag LOCUS_05460 99823 100290 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037931.1 protein_id gnl|my_center|LOCUS_05460 100301 101254 gene locus_tag LOCUS_05470 gene hprK 100301 101254 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005993219.1 protein_id gnl|my_center|LOCUS_05470 101251 102105 gene locus_tag LOCUS_05480 gene rapZ 101251 102105 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508477.1 protein_id gnl|my_center|LOCUS_05480 102154 102546 gene locus_tag LOCUS_05490 102154 102546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037933.1 protein_id gnl|my_center|LOCUS_05490 102539 102808 gene locus_tag LOCUS_05500 102539 102808 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037934.1 protein_id gnl|my_center|LOCUS_05500 102808 104532 gene locus_tag LOCUS_05510 gene ptsP 102808 104532 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037935.1 protein_id gnl|my_center|LOCUS_05510 105057 104779 gene locus_tag LOCUS_05520 105057 104779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 105805 105422 gene locus_tag LOCUS_05530 105805 105422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 105930 106355 gene locus_tag LOCUS_05540 105930 106355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05540 106319 107290 gene locus_tag LOCUS_05550 106319 107290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05550 108257 107310 gene locus_tag LOCUS_05560 108257 107310 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037876.1 protein_id gnl|my_center|LOCUS_05560 114183 109015 gene locus_tag LOCUS_05570 114183 109015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 114813 114343 gene locus_tag LOCUS_05580 gene ruvX 114813 114343 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037877.1 protein_id gnl|my_center|LOCUS_05580 115376 114816 gene locus_tag LOCUS_05590 115376 114816 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037878.1 protein_id gnl|my_center|LOCUS_05590 115447 116025 gene locus_tag LOCUS_05600 115447 116025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 117161 116031 gene locus_tag LOCUS_05610 117161 116031 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005990431.1 protein_id gnl|my_center|LOCUS_05610 118242 117205 gene locus_tag LOCUS_05620 118242 117205 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003489919.1 protein_id gnl|my_center|LOCUS_05620 118331 119008 gene locus_tag LOCUS_05630 118331 119008 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037884.1 protein_id gnl|my_center|LOCUS_05630 119079 119915 gene locus_tag LOCUS_05640 gene proC 119079 119915 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275316.1 protein_id gnl|my_center|LOCUS_05640 119930 120613 gene locus_tag LOCUS_05650 119930 120613 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190271.1 protein_id gnl|my_center|LOCUS_05650 121079 120633 gene locus_tag LOCUS_05660 121079 120633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 121238 121591 gene locus_tag LOCUS_05670 121238 121591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 121675 123744 gene locus_tag LOCUS_05680 121675 123744 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035498.1 protein_id gnl|my_center|LOCUS_05680 124637 123756 gene locus_tag LOCUS_05690 124637 123756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 124744 125403 gene locus_tag LOCUS_05700 gene lexA 124744 125403 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036898.1 protein_id gnl|my_center|LOCUS_05700 126713 125376 gene locus_tag LOCUS_05710 126713 125376 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275102.1 protein_id gnl|my_center|LOCUS_05710 127891 126722 gene locus_tag LOCUS_05720 127891 126722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 129423 127888 gene locus_tag LOCUS_05730 gene gpmI 129423 127888 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114478.1 protein_id gnl|my_center|LOCUS_05730 129537 130277 gene locus_tag LOCUS_05740 129537 130277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035281.1 protein_id gnl|my_center|LOCUS_05740 131247 130291 gene locus_tag LOCUS_05750 131247 130291 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_05750 133096 131231 gene locus_tag LOCUS_05760 133096 131231 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994158.1 protein_id gnl|my_center|LOCUS_05760 133932 133168 gene locus_tag LOCUS_05770 gene ubiE 133932 133168 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014509029.1 protein_id gnl|my_center|LOCUS_05770 135265 133940 gene locus_tag LOCUS_05780 gene hslU 135265 133940 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038587.1 protein_id gnl|my_center|LOCUS_05780 135801 135262 gene locus_tag LOCUS_05790 gene hslV 135801 135262 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038588.1 protein_id gnl|my_center|LOCUS_05790 135706 135921 gene locus_tag LOCUS_05800 135706 135921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 135981 136559 gene locus_tag LOCUS_05810 135981 136559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 137492 136566 gene locus_tag LOCUS_05820 gene xerC 137492 136566 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275252.1 protein_id gnl|my_center|LOCUS_05820 138205 137498 gene locus_tag LOCUS_05830 138205 137498 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944790.1 protein_id gnl|my_center|LOCUS_05830 139047 138202 gene locus_tag LOCUS_05840 gene dapF 139047 138202 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038591.1 protein_id gnl|my_center|LOCUS_05840 139196 139044 gene locus_tag LOCUS_05850 139196 139044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 141462 139300 gene locus_tag LOCUS_05860 141462 139300 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275248.1 protein_id gnl|my_center|LOCUS_05860 143601 141466 gene locus_tag LOCUS_05870 143601 141466 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038598.1 protein_id gnl|my_center|LOCUS_05870 145334 144363 gene locus_tag LOCUS_05880 145334 144363 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038601.1 protein_id gnl|my_center|LOCUS_05880 146326 145415 gene locus_tag LOCUS_05890 gene hemC 146326 145415 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038603.1 protein_id gnl|my_center|LOCUS_05890 147101 146367 gene locus_tag LOCUS_05900 147101 146367 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068574319.1 protein_id gnl|my_center|LOCUS_05900 148302 147199 gene locus_tag LOCUS_05910 148302 147199 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038953.1 protein_id gnl|my_center|LOCUS_05910 149394 148333 gene locus_tag LOCUS_05920 149394 148333 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204243849.1 protein_id gnl|my_center|LOCUS_05920 149519 150187 gene locus_tag LOCUS_05930 gene fabR 149519 150187 CDS product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038955.1 protein_id gnl|my_center|LOCUS_05930 150858 150193 gene locus_tag LOCUS_05940 150858 150193 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014509047.1 protein_id gnl|my_center|LOCUS_05940 150954 151697 gene locus_tag LOCUS_05950 150954 151697 CDS product 2OG-Fe dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640646.1 protein_id gnl|my_center|LOCUS_05950 151753 152193 gene locus_tag LOCUS_05960 151753 152193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 152204 153577 gene locus_tag LOCUS_05970 gene hemN 152204 153577 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037247.1 protein_id gnl|my_center|LOCUS_05970 153596 154225 gene locus_tag LOCUS_05980 153596 154225 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813020.1 protein_id gnl|my_center|LOCUS_05980 154227 156143 gene locus_tag LOCUS_05990 154227 156143 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035742.1 protein_id gnl|my_center|LOCUS_05990 157031 156156 gene locus_tag LOCUS_06000 157031 156156 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035739.1 protein_id gnl|my_center|LOCUS_06000 157474 157082 gene locus_tag LOCUS_06010 gene erpA 157474 157082 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035737.1 protein_id gnl|my_center|LOCUS_06010 157908 157471 gene locus_tag LOCUS_06020 157908 157471 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035736.1 protein_id gnl|my_center|LOCUS_06020 158642 157920 gene locus_tag LOCUS_06030 158642 157920 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035735.1 protein_id gnl|my_center|LOCUS_06030 158748 159335 gene locus_tag LOCUS_06040 158748 159335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 159355 161982 gene locus_tag LOCUS_06050 159355 161982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 161984 163405 gene locus_tag LOCUS_06060 161984 163405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06060 163342 164484 gene locus_tag LOCUS_06070 163342 164484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06070 165013 164540 gene locus_tag LOCUS_06080 gene bfr 165013 164540 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035731.1 protein_id gnl|my_center|LOCUS_06080 165302 165111 gene locus_tag LOCUS_06090 165302 165111 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035730.1 protein_id gnl|my_center|LOCUS_06090 165935 165381 gene locus_tag LOCUS_06100 165935 165381 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035729.1 protein_id gnl|my_center|LOCUS_06100 167205 166000 gene locus_tag LOCUS_06110 gene prpF 167205 166000 CDS product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036236.1 protein_id gnl|my_center|LOCUS_06110 167223 168140 gene locus_tag LOCUS_06120 gene prmA 167223 168140 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035761.1 protein_id gnl|my_center|LOCUS_06120 168161 168685 gene locus_tag LOCUS_06130 168161 168685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06130 168797 169069 gene locus_tag LOCUS_06140 gene fis 168797 169069 CDS product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035757.1 protein_id gnl|my_center|LOCUS_06140 169512 169177 gene locus_tag LOCUS_06150 169512 169177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 169511 171082 gene locus_tag LOCUS_06160 gene purH 169511 171082 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941271.1 protein_id gnl|my_center|LOCUS_06160 171112 172425 gene locus_tag LOCUS_06170 gene purD 171112 172425 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035746.1 protein_id gnl|my_center|LOCUS_06170 173317 172463 gene locus_tag LOCUS_06180 173317 172463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 175524 173404 gene locus_tag LOCUS_06190 175524 173404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 175672 178053 gene locus_tag LOCUS_06200 175672 178053 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918342.1 protein_id gnl|my_center|LOCUS_06200 178486 178061 gene locus_tag LOCUS_06210 178486 178061 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035519.1 protein_id gnl|my_center|LOCUS_06210 178559 179437 gene locus_tag LOCUS_06220 gene poxA 178559 179437 CDS product alpha/beta hydrolase PoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114132.1 protein_id gnl|my_center|LOCUS_06220 179494 179868 gene locus_tag LOCUS_06230 gene queD 179494 179868 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391049.1 protein_id gnl|my_center|LOCUS_06230 180610 179891 gene locus_tag LOCUS_06240 gene bioD 180610 179891 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035832.1 protein_id gnl|my_center|LOCUS_06240 180660 181145 gene locus_tag LOCUS_06250 180660 181145 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016945126.1 protein_id gnl|my_center|LOCUS_06250 181739 181161 gene locus_tag LOCUS_06260 181739 181161 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767456.1 protein_id gnl|my_center|LOCUS_06260 >Feature sequence04 1125 142 gene locus_tag LOCUS_06270 1125 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 1649 1125 gene locus_tag LOCUS_06280 1649 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 2536 1772 gene locus_tag LOCUS_06290 gene tatC 2536 1772 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039160.1 protein_id gnl|my_center|LOCUS_06290 2895 2533 gene locus_tag LOCUS_06300 2895 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 3186 2923 gene locus_tag LOCUS_06310 3186 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 3937 3251 gene locus_tag LOCUS_06320 3937 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 4057 5070 gene locus_tag LOCUS_06330 gene hemH 4057 5070 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059263.1 protein_id gnl|my_center|LOCUS_06330 5902 5090 gene locus_tag LOCUS_06340 5902 5090 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275488.1 protein_id gnl|my_center|LOCUS_06340 6821 5913 gene locus_tag LOCUS_06350 6821 5913 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039167.1 protein_id gnl|my_center|LOCUS_06350 7723 6821 gene locus_tag LOCUS_06360 gene ttcA 7723 6821 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039168.1 protein_id gnl|my_center|LOCUS_06360 7812 8042 gene locus_tag LOCUS_06370 7812 8042 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388803.1 protein_id gnl|my_center|LOCUS_06370 10580 8052 gene locus_tag LOCUS_06380 gene plsB 10580 8052 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039197.1 protein_id gnl|my_center|LOCUS_06380 10631 10725 gene locus_tag LOCUS_t00210 10631 10725 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 12274 11651 gene locus_tag LOCUS_06390 12274 11651 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039212.1 protein_id gnl|my_center|LOCUS_06390 12360 14366 gene locus_tag LOCUS_06400 12360 14366 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039208.1 protein_id gnl|my_center|LOCUS_06400 14503 15201 gene locus_tag LOCUS_06410 14503 15201 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768488.1 protein_id gnl|my_center|LOCUS_06410 15314 18874 gene locus_tag LOCUS_06420 15314 18874 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035427.1 protein_id gnl|my_center|LOCUS_06420 18941 20386 gene locus_tag LOCUS_06430 gene cls 18941 20386 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035272.1 protein_id gnl|my_center|LOCUS_06430 20423 20668 gene locus_tag LOCUS_06440 20423 20668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 22891 20765 gene locus_tag LOCUS_06450 22891 20765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 23638 22904 gene locus_tag LOCUS_06460 23638 22904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 23749 24495 gene locus_tag LOCUS_06470 23749 24495 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035270.1 protein_id gnl|my_center|LOCUS_06470 25023 24586 gene locus_tag LOCUS_06480 25023 24586 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035269.1 protein_id gnl|my_center|LOCUS_06480 25443 25027 gene locus_tag LOCUS_06490 25443 25027 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035268.1 protein_id gnl|my_center|LOCUS_06490 26273 25476 gene locus_tag LOCUS_06500 gene exbB 26273 25476 CDS product TonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035267.1 protein_id gnl|my_center|LOCUS_06500 26967 26299 gene locus_tag LOCUS_06510 26967 26299 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033836101.1 protein_id gnl|my_center|LOCUS_06510 28345 27071 gene locus_tag LOCUS_06520 28345 27071 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035265.1 protein_id gnl|my_center|LOCUS_06520 29453 28482 gene locus_tag LOCUS_06530 29453 28482 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161797774.1 protein_id gnl|my_center|LOCUS_06530 31089 29458 gene locus_tag LOCUS_06540 31089 29458 CDS product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945845.1 protein_id gnl|my_center|LOCUS_06540 33582 31117 gene locus_tag LOCUS_06550 gene gyrB 33582 31117 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035262.1 protein_id gnl|my_center|LOCUS_06550 34723 33611 gene locus_tag LOCUS_06560 gene recF 34723 33611 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035261.1 protein_id gnl|my_center|LOCUS_06560 35897 34797 gene locus_tag LOCUS_06570 gene dnaN 35897 34797 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035260.1 protein_id gnl|my_center|LOCUS_06570 37471 36131 gene locus_tag LOCUS_06580 gene dnaA 37471 36131 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035259.1 protein_id gnl|my_center|LOCUS_06580 37653 37793 gene locus_tag LOCUS_06590 37653 37793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 37827 38294 gene locus_tag LOCUS_06600 gene rnpA 37827 38294 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039302.1 protein_id gnl|my_center|LOCUS_06600 38291 40078 gene locus_tag LOCUS_06610 gene yidC 38291 40078 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039301.1 protein_id gnl|my_center|LOCUS_06610 40104 41501 gene locus_tag LOCUS_06620 gene mnmE 40104 41501 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039299.1 protein_id gnl|my_center|LOCUS_06620 41746 44541 gene locus_tag LOCUS_06630 41746 44541 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613294.1 protein_id gnl|my_center|LOCUS_06630 44957 45262 gene locus_tag LOCUS_06640 44957 45262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 45263 45709 gene locus_tag LOCUS_06650 45263 45709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 46660 45770 gene locus_tag LOCUS_06660 gene phhA 46660 45770 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035413.1 protein_id gnl|my_center|LOCUS_06660 46823 47269 gene locus_tag LOCUS_06670 46823 47269 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035414.1 protein_id gnl|my_center|LOCUS_06670 48053 47235 gene locus_tag LOCUS_06680 48053 47235 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039294.1 protein_id gnl|my_center|LOCUS_06680 48096 49274 gene locus_tag LOCUS_06690 48096 49274 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039292.1 protein_id gnl|my_center|LOCUS_06690 49694 49305 gene locus_tag LOCUS_06700 49694 49305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 49805 50539 gene locus_tag LOCUS_06710 49805 50539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 50540 51307 gene locus_tag LOCUS_06720 50540 51307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 51300 51641 gene locus_tag LOCUS_06730 51300 51641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 53670 51661 gene locus_tag LOCUS_06740 53670 51661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 54224 53670 gene locus_tag LOCUS_06750 54224 53670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 55024 54221 gene locus_tag LOCUS_06760 55024 54221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 56460 54946 gene locus_tag LOCUS_06770 56460 54946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06770 57607 56582 gene locus_tag LOCUS_06780 57607 56582 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035354.1 protein_id gnl|my_center|LOCUS_06780 59054 57639 gene locus_tag LOCUS_06790 gene oprN 59054 57639 CDS product multidrug efflux RND transporter outer membrane subunit OprN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113303.1 protein_id gnl|my_center|LOCUS_06790 62304 59047 gene locus_tag LOCUS_06800 62304 59047 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036630.1 protein_id gnl|my_center|LOCUS_06800 63531 62308 gene locus_tag LOCUS_06810 63531 62308 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036629.1 protein_id gnl|my_center|LOCUS_06810 64158 63535 gene locus_tag LOCUS_06820 64158 63535 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084031.1 protein_id gnl|my_center|LOCUS_06820 64296 64814 gene locus_tag LOCUS_06830 64296 64814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 64811 66553 gene locus_tag LOCUS_06840 64811 66553 CDS product ExeM/NucH family extracellular endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053209.1 protein_id gnl|my_center|LOCUS_06840 66591 67265 gene locus_tag LOCUS_06850 66591 67265 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035515.1 protein_id gnl|my_center|LOCUS_06850 67262 68362 gene locus_tag LOCUS_06860 gene zapE 67262 68362 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035516.1 protein_id gnl|my_center|LOCUS_06860 68569 69396 gene locus_tag LOCUS_06870 gene queF 68569 69396 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930727.1 protein_id gnl|my_center|LOCUS_06870 69411 69908 gene locus_tag LOCUS_06880 69411 69908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 71255 69918 gene locus_tag LOCUS_06890 71255 69918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 72308 71331 gene locus_tag LOCUS_06900 72308 71331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 73552 72374 gene locus_tag LOCUS_06910 gene iadA 73552 72374 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868956.1 protein_id gnl|my_center|LOCUS_06910 74511 73549 gene locus_tag LOCUS_06920 74511 73549 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039510.1 protein_id gnl|my_center|LOCUS_06920 76586 74520 gene locus_tag LOCUS_06930 gene prlC 76586 74520 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157382.1 protein_id gnl|my_center|LOCUS_06930 76936 76634 gene locus_tag LOCUS_06940 76936 76634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 77253 76933 gene locus_tag LOCUS_06950 77253 76933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 78747 77320 gene locus_tag LOCUS_06960 78747 77320 CDS product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102868.1 protein_id gnl|my_center|LOCUS_06960 78834 80675 gene locus_tag LOCUS_06970 78834 80675 CDS product cyclic nucleotide-binding/CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114809.1 protein_id gnl|my_center|LOCUS_06970 80672 81271 gene locus_tag LOCUS_06980 80672 81271 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086891.1 protein_id gnl|my_center|LOCUS_06980 81327 84794 gene locus_tag LOCUS_06990 81327 84794 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039145.1 protein_id gnl|my_center|LOCUS_06990 84820 86028 gene locus_tag LOCUS_07000 84820 86028 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390122.1 protein_id gnl|my_center|LOCUS_07000 86699 86043 gene locus_tag LOCUS_07010 86699 86043 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039130.1 protein_id gnl|my_center|LOCUS_07010 87500 86712 gene locus_tag LOCUS_07020 87500 86712 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074197.1 protein_id gnl|my_center|LOCUS_07020 87609 88796 gene locus_tag LOCUS_07030 87609 88796 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494103.1 protein_id gnl|my_center|LOCUS_07030 88798 90024 gene locus_tag LOCUS_07040 88798 90024 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963567.1 protein_id gnl|my_center|LOCUS_07040 90014 90739 gene locus_tag LOCUS_07050 gene lolD 90014 90739 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195923.1 protein_id gnl|my_center|LOCUS_07050 91000 92139 gene locus_tag LOCUS_07060 91000 92139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 94153 92186 gene locus_tag LOCUS_07070 gene acs 94153 92186 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039129.1 protein_id gnl|my_center|LOCUS_07070 94324 95688 gene locus_tag LOCUS_07080 94324 95688 CDS product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042595882.1 protein_id gnl|my_center|LOCUS_07080 95700 95969 gene locus_tag LOCUS_07090 95700 95969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 95972 97591 gene locus_tag LOCUS_07100 95972 97591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 99751 97655 gene locus_tag LOCUS_07110 99751 97655 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258483.1 protein_id gnl|my_center|LOCUS_07110 99920 101245 gene locus_tag LOCUS_07120 99920 101245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 102803 101229 gene locus_tag LOCUS_07130 102803 101229 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111731521.1 protein_id gnl|my_center|LOCUS_07130 103791 102796 gene locus_tag LOCUS_07140 103791 102796 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338207.1 protein_id gnl|my_center|LOCUS_07140 104316 103870 gene locus_tag LOCUS_07150 104316 103870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07150 104294 104893 gene locus_tag LOCUS_07160 104294 104893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 105598 104984 gene locus_tag LOCUS_07170 105598 104984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07170 105860 105504 gene locus_tag LOCUS_07180 105860 105504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07180 105997 106806 gene locus_tag LOCUS_07190 105997 106806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 107767 106751 gene locus_tag LOCUS_07200 107767 106751 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275143.1 protein_id gnl|my_center|LOCUS_07200 109507 107798 gene locus_tag LOCUS_07210 gene oleC 109507 107798 CDS product olefin beta-lactone synthetase OleC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035474.1 protein_id gnl|my_center|LOCUS_07210 110420 109524 gene locus_tag LOCUS_07220 110420 109524 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035472.1 protein_id gnl|my_center|LOCUS_07220 111119 110427 gene locus_tag LOCUS_07230 111119 110427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 112289 111273 gene locus_tag LOCUS_07240 112289 111273 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035468.1 protein_id gnl|my_center|LOCUS_07240 112742 112341 gene locus_tag LOCUS_07250 112742 112341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 112874 113584 gene locus_tag LOCUS_07260 112874 113584 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389698.1 protein_id gnl|my_center|LOCUS_07260 113578 114366 gene locus_tag LOCUS_07270 113578 114366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 115672 114413 gene locus_tag LOCUS_07280 115672 114413 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037434.1 protein_id gnl|my_center|LOCUS_07280 116249 115704 gene locus_tag LOCUS_07290 116249 115704 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037433.1 protein_id gnl|my_center|LOCUS_07290 117651 116311 gene locus_tag LOCUS_07300 117651 116311 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065247.1 protein_id gnl|my_center|LOCUS_07300 117893 118432 gene locus_tag LOCUS_07310 117893 118432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 121275 118489 gene locus_tag LOCUS_07320 121275 118489 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613294.1 protein_id gnl|my_center|LOCUS_07320 121366 121869 gene locus_tag LOCUS_07330 121366 121869 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407330.1 protein_id gnl|my_center|LOCUS_07330 121972 122517 gene locus_tag LOCUS_07340 121972 122517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 123557 122556 gene locus_tag LOCUS_07350 123557 122556 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035460.1 protein_id gnl|my_center|LOCUS_07350 124099 123590 gene locus_tag LOCUS_07360 gene secB 124099 123590 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035459.1 protein_id gnl|my_center|LOCUS_07360 124646 124209 gene locus_tag LOCUS_07370 124646 124209 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437015.1 protein_id gnl|my_center|LOCUS_07370 125199 124720 gene locus_tag LOCUS_07380 125199 124720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035457.1 protein_id gnl|my_center|LOCUS_07380 125641 125177 gene locus_tag LOCUS_07390 125641 125177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 125695 126408 gene locus_tag LOCUS_07400 125695 126408 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035454.1 protein_id gnl|my_center|LOCUS_07400 126444 127418 gene locus_tag LOCUS_07410 126444 127418 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035453.1 protein_id gnl|my_center|LOCUS_07410 127415 128668 gene locus_tag LOCUS_07420 127415 128668 CDS product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035452.1 protein_id gnl|my_center|LOCUS_07420 128683 129120 gene locus_tag LOCUS_07430 gene arfB 128683 129120 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035482.1 protein_id gnl|my_center|LOCUS_07430 129117 129740 gene locus_tag LOCUS_07440 129117 129740 CDS product lysophosphatidylcholine acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035483.1 protein_id gnl|my_center|LOCUS_07440 129821 130750 gene locus_tag LOCUS_07450 129821 130750 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037847.1 protein_id gnl|my_center|LOCUS_07450 131012 131506 gene locus_tag LOCUS_07460 131012 131506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 132330 131632 gene locus_tag LOCUS_07470 132330 131632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 132950 132345 gene locus_tag LOCUS_07480 132950 132345 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037773.1 protein_id gnl|my_center|LOCUS_07480 133299 132967 gene locus_tag LOCUS_07490 133299 132967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 133717 133322 gene locus_tag LOCUS_07500 gene rnk 133717 133322 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036067.1 protein_id gnl|my_center|LOCUS_07500 134839 133829 gene locus_tag LOCUS_07510 134839 133829 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035491.1 protein_id gnl|my_center|LOCUS_07510 134926 136605 gene locus_tag LOCUS_07520 gene aceB 134926 136605 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035492.1 protein_id gnl|my_center|LOCUS_07520 136716 138029 gene locus_tag LOCUS_07530 gene aceA 136716 138029 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019237144.1 protein_id gnl|my_center|LOCUS_07530 141376 138149 gene locus_tag LOCUS_07540 141376 138149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 141384 141599 gene locus_tag LOCUS_07550 141384 141599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 143402 141651 gene locus_tag LOCUS_07560 143402 141651 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114562.1 protein_id gnl|my_center|LOCUS_07560 144992 143496 gene locus_tag LOCUS_07570 144992 143496 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038949.1 protein_id gnl|my_center|LOCUS_07570 145262 145002 gene locus_tag LOCUS_07580 145262 145002 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038948.1 protein_id gnl|my_center|LOCUS_07580 145422 145760 gene locus_tag LOCUS_07590 145422 145760 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038947.1 protein_id gnl|my_center|LOCUS_07590 146663 145806 gene locus_tag LOCUS_07600 gene speE 146663 145806 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038944.1 protein_id gnl|my_center|LOCUS_07600 146908 148821 gene locus_tag LOCUS_07610 gene speA 146908 148821 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038943.1 protein_id gnl|my_center|LOCUS_07610 148824 149777 gene locus_tag LOCUS_07620 148824 149777 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028000663.1 protein_id gnl|my_center|LOCUS_07620 150737 150135 gene locus_tag LOCUS_07630 150737 150135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 152500 150737 gene locus_tag LOCUS_07640 gene argS 152500 150737 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947747.1 protein_id gnl|my_center|LOCUS_07640 152621 154492 gene locus_tag LOCUS_07650 152621 154492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 155277 154603 gene locus_tag LOCUS_07660 gene radC 155277 154603 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038935.1 protein_id gnl|my_center|LOCUS_07660 155370 156572 gene locus_tag LOCUS_07670 gene coaBC 155370 156572 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038934.1 protein_id gnl|my_center|LOCUS_07670 156569 157036 gene locus_tag LOCUS_07680 gene dut 156569 157036 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038933.1 protein_id gnl|my_center|LOCUS_07680 158801 156939 gene locus_tag LOCUS_07690 158801 156939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 158683 159195 gene locus_tag LOCUS_07700 158683 159195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 159874 159206 gene locus_tag LOCUS_07710 159874 159206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 160534 159884 gene locus_tag LOCUS_07720 gene pyrE 160534 159884 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038922.1 protein_id gnl|my_center|LOCUS_07720 160647 161417 gene locus_tag LOCUS_07730 160647 161417 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038921.1 protein_id gnl|my_center|LOCUS_07730 161407 162729 gene locus_tag LOCUS_07740 161407 162729 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073584.1 protein_id gnl|my_center|LOCUS_07740 162755 163042 gene locus_tag LOCUS_07750 162755 163042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 164154 163009 gene locus_tag LOCUS_07760 164154 163009 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038918.1 protein_id gnl|my_center|LOCUS_07760 165440 164160 gene locus_tag LOCUS_07770 165440 164160 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038917.1 protein_id gnl|my_center|LOCUS_07770 165597 166808 gene locus_tag LOCUS_07780 gene tyrS 165597 166808 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038916.1 protein_id gnl|my_center|LOCUS_07780 >Feature sequence05 1255 419 gene locus_tag LOCUS_07790 gene thiD 1255 419 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275371.1 protein_id gnl|my_center|LOCUS_07790 2656 1259 gene locus_tag LOCUS_07800 2656 1259 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036911.1 protein_id gnl|my_center|LOCUS_07800 2756 2842 gene locus_tag LOCUS_t00220 2756 2842 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2915 4267 gene locus_tag LOCUS_07810 2915 4267 CDS product DUF3391 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349264.1 protein_id gnl|my_center|LOCUS_07810 4260 6683 gene locus_tag LOCUS_07820 4260 6683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 6708 6977 gene locus_tag LOCUS_07830 6708 6977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 6987 7733 gene locus_tag LOCUS_07840 6987 7733 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036732.1 protein_id gnl|my_center|LOCUS_07840 7773 8576 gene locus_tag LOCUS_07850 7773 8576 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970721.1 protein_id gnl|my_center|LOCUS_07850 9321 8590 gene locus_tag LOCUS_07860 gene tesA 9321 8590 CDS product esterase TesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114753.1 protein_id gnl|my_center|LOCUS_07860 9365 10081 gene locus_tag LOCUS_07870 9365 10081 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928863.1 protein_id gnl|my_center|LOCUS_07870 10078 12591 gene locus_tag LOCUS_07880 10078 12591 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813269.1 protein_id gnl|my_center|LOCUS_07880 13155 12598 gene locus_tag LOCUS_07890 13155 12598 CDS product DUF456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943276.1 protein_id gnl|my_center|LOCUS_07890 15386 13218 gene locus_tag LOCUS_07900 15386 13218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 15557 16372 gene locus_tag LOCUS_07910 15557 16372 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036908.1 protein_id gnl|my_center|LOCUS_07910 16760 16362 gene locus_tag LOCUS_07920 16760 16362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036614.1 protein_id gnl|my_center|LOCUS_07920 17175 16777 gene locus_tag LOCUS_07930 17175 16777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 17274 18137 gene locus_tag LOCUS_07940 17274 18137 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036615.1 protein_id gnl|my_center|LOCUS_07940 18946 18185 gene locus_tag LOCUS_07950 18946 18185 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036616.1 protein_id gnl|my_center|LOCUS_07950 19207 18947 gene locus_tag LOCUS_07960 19207 18947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 19348 20037 gene locus_tag LOCUS_07970 19348 20037 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036618.1 protein_id gnl|my_center|LOCUS_07970 20157 21320 gene locus_tag LOCUS_07980 20157 21320 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036619.1 protein_id gnl|my_center|LOCUS_07980 22638 21322 gene locus_tag LOCUS_07990 22638 21322 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109228.1 protein_id gnl|my_center|LOCUS_07990 22758 25052 gene locus_tag LOCUS_08000 22758 25052 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728359.1 protein_id gnl|my_center|LOCUS_08000 25956 25072 gene locus_tag LOCUS_08010 25956 25072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 27813 26044 gene locus_tag LOCUS_08020 27813 26044 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258395.1 protein_id gnl|my_center|LOCUS_08020 28854 27958 gene locus_tag LOCUS_08030 28854 27958 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037285.1 protein_id gnl|my_center|LOCUS_08030 28861 29031 gene locus_tag LOCUS_08040 28861 29031 CDS product DUF1674 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391325.1 protein_id gnl|my_center|LOCUS_08040 29074 29469 gene locus_tag LOCUS_08050 gene sdhC 29074 29469 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330061.1 protein_id gnl|my_center|LOCUS_08050 29466 29849 gene locus_tag LOCUS_08060 gene sdhD 29466 29849 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037282.1 protein_id gnl|my_center|LOCUS_08060 29857 31650 gene locus_tag LOCUS_08070 gene sdhA 29857 31650 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037281.1 protein_id gnl|my_center|LOCUS_08070 31652 32020 gene locus_tag LOCUS_08080 31652 32020 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101677.1 protein_id gnl|my_center|LOCUS_08080 32036 32824 gene locus_tag LOCUS_08090 32036 32824 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037280.1 protein_id gnl|my_center|LOCUS_08090 32824 33252 gene locus_tag LOCUS_08100 32824 33252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 33298 33552 gene locus_tag LOCUS_08110 33298 33552 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507842.1 protein_id gnl|my_center|LOCUS_08110 33512 33979 gene locus_tag LOCUS_08120 33512 33979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 33982 35226 gene locus_tag LOCUS_08130 33982 35226 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507840.1 protein_id gnl|my_center|LOCUS_08130 35231 35917 gene locus_tag LOCUS_08140 gene lolD 35231 35917 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161961949.1 protein_id gnl|my_center|LOCUS_08140 35924 38197 gene locus_tag LOCUS_08150 35924 38197 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 protein_id gnl|my_center|LOCUS_08150 38219 38857 gene locus_tag LOCUS_08160 38219 38857 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037273.1 protein_id gnl|my_center|LOCUS_08160 38854 39273 gene locus_tag LOCUS_08170 38854 39273 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037272.1 protein_id gnl|my_center|LOCUS_08170 39270 41048 gene locus_tag LOCUS_08180 gene msbA 39270 41048 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037271.1 protein_id gnl|my_center|LOCUS_08180 41053 42045 gene locus_tag LOCUS_08190 gene lpxK 41053 42045 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037270.1 protein_id gnl|my_center|LOCUS_08190 42032 42796 gene locus_tag LOCUS_08200 gene kdsB 42032 42796 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057672371.1 protein_id gnl|my_center|LOCUS_08200 42828 44234 gene locus_tag LOCUS_08210 42828 44234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275359.1 protein_id gnl|my_center|LOCUS_08210 44227 46104 gene locus_tag LOCUS_08220 gene uvrC 44227 46104 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037266.1 protein_id gnl|my_center|LOCUS_08220 46101 46664 gene locus_tag LOCUS_08230 gene pgsA 46101 46664 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037265.1 protein_id gnl|my_center|LOCUS_08230 46728 46803 gene locus_tag LOCUS_t00230 46728 46803 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 46848 46921 gene locus_tag LOCUS_t00240 46848 46921 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 48070 46973 gene locus_tag LOCUS_08240 48070 46973 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035824.1 protein_id gnl|my_center|LOCUS_08240 48740 48123 gene locus_tag LOCUS_08250 48740 48123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 49741 48776 gene locus_tag LOCUS_08260 49741 48776 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036684.1 protein_id gnl|my_center|LOCUS_08260 50598 49738 gene locus_tag LOCUS_08270 50598 49738 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036685.1 protein_id gnl|my_center|LOCUS_08270 50969 50595 gene locus_tag LOCUS_08280 50969 50595 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036686.1 protein_id gnl|my_center|LOCUS_08280 51159 51731 gene locus_tag LOCUS_08290 51159 51731 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036687.1 protein_id gnl|my_center|LOCUS_08290 51728 52249 gene locus_tag LOCUS_08300 51728 52249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 52336 53127 gene locus_tag LOCUS_08310 52336 53127 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212827.1 protein_id gnl|my_center|LOCUS_08310 53159 54514 gene locus_tag LOCUS_08320 53159 54514 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036689.1 protein_id gnl|my_center|LOCUS_08320 54501 54731 gene locus_tag LOCUS_08330 54501 54731 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036690.1 protein_id gnl|my_center|LOCUS_08330 54751 55344 gene locus_tag LOCUS_08340 54751 55344 CDS product DUF2058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036691.1 protein_id gnl|my_center|LOCUS_08340 57565 55400 gene locus_tag LOCUS_08350 57565 55400 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090481.1 protein_id gnl|my_center|LOCUS_08350 61552 57728 gene locus_tag LOCUS_08360 gene metH 61552 57728 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729624.1 protein_id gnl|my_center|LOCUS_08360 62496 61549 gene locus_tag LOCUS_08370 62496 61549 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507354.1 protein_id gnl|my_center|LOCUS_08370 62657 63817 gene locus_tag LOCUS_08380 62657 63817 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036700.1 protein_id gnl|my_center|LOCUS_08380 63831 64844 gene locus_tag LOCUS_08390 63831 64844 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114698.1 protein_id gnl|my_center|LOCUS_08390 66918 64837 gene locus_tag LOCUS_08400 66918 64837 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037435.1 protein_id gnl|my_center|LOCUS_08400 68008 66992 gene locus_tag LOCUS_08410 gene epmB 68008 66992 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037417.1 protein_id gnl|my_center|LOCUS_08410 68033 68599 gene locus_tag LOCUS_08420 gene efp 68033 68599 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037416.1 protein_id gnl|my_center|LOCUS_08420 68639 69979 gene locus_tag LOCUS_08430 68639 69979 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507955.1 protein_id gnl|my_center|LOCUS_08430 69976 70713 gene locus_tag LOCUS_08440 69976 70713 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037413.1 protein_id gnl|my_center|LOCUS_08440 70710 71405 gene locus_tag LOCUS_08450 70710 71405 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037412.1 protein_id gnl|my_center|LOCUS_08450 71402 72214 gene locus_tag LOCUS_08460 71402 72214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 72272 73222 gene locus_tag LOCUS_08470 gene folE2 72272 73222 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099665.1 protein_id gnl|my_center|LOCUS_08470 73462 73238 gene locus_tag LOCUS_08480 gene yidD 73462 73238 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869455.1 protein_id gnl|my_center|LOCUS_08480 73542 74705 gene locus_tag LOCUS_08490 73542 74705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 76526 74727 gene locus_tag LOCUS_08500 76526 74727 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405524.1 protein_id gnl|my_center|LOCUS_08500 76990 76523 gene locus_tag LOCUS_08510 76990 76523 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055037.1 protein_id gnl|my_center|LOCUS_08510 78399 76987 gene locus_tag LOCUS_08520 gene cysS 78399 76987 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275351.1 protein_id gnl|my_center|LOCUS_08520 78491 79072 gene locus_tag LOCUS_08530 78491 79072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 79324 80334 gene locus_tag LOCUS_08540 79324 80334 CDS product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037393.1 protein_id gnl|my_center|LOCUS_08540 80428 81618 gene locus_tag LOCUS_08550 80428 81618 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037391.1 protein_id gnl|my_center|LOCUS_08550 81615 82712 gene locus_tag LOCUS_08560 81615 82712 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037390.1 protein_id gnl|my_center|LOCUS_08560 82709 84028 gene locus_tag LOCUS_08570 82709 84028 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055042.1 protein_id gnl|my_center|LOCUS_08570 84025 84981 gene locus_tag LOCUS_08580 gene argC 84025 84981 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037387.1 protein_id gnl|my_center|LOCUS_08580 84978 86273 gene locus_tag LOCUS_08590 84978 86273 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037386.1 protein_id gnl|my_center|LOCUS_08590 86715 86284 gene locus_tag LOCUS_08600 86715 86284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 86914 86838 gene locus_tag LOCUS_t00250 86914 86838 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 87052 88431 gene locus_tag LOCUS_08610 gene hisS 87052 88431 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036976.1 protein_id gnl|my_center|LOCUS_08610 88433 90307 gene locus_tag LOCUS_08620 gene hutH 88433 90307 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143059.1 protein_id gnl|my_center|LOCUS_08620 91493 90360 gene locus_tag LOCUS_08630 91493 90360 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_08630 92830 91547 gene locus_tag LOCUS_08640 92830 91547 CDS product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037245.1 protein_id gnl|my_center|LOCUS_08640 93285 92839 gene locus_tag LOCUS_08650 93285 92839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 95217 93304 gene locus_tag LOCUS_08660 95217 93304 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037772.1 protein_id gnl|my_center|LOCUS_08660 95344 97263 gene locus_tag LOCUS_08670 95344 97263 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037425.1 protein_id gnl|my_center|LOCUS_08670 97335 102122 gene locus_tag LOCUS_08680 97335 102122 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_08680 102134 102898 gene locus_tag LOCUS_08690 102134 102898 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036730.1 protein_id gnl|my_center|LOCUS_08690 102898 103791 gene locus_tag LOCUS_08700 102898 103791 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036731.1 protein_id gnl|my_center|LOCUS_08700 103964 104608 gene locus_tag LOCUS_08710 103964 104608 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037241.1 protein_id gnl|my_center|LOCUS_08710 107470 104630 gene locus_tag LOCUS_08720 107470 104630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 107825 108814 gene locus_tag LOCUS_08730 107825 108814 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037239.1 protein_id gnl|my_center|LOCUS_08730 109158 108811 gene locus_tag LOCUS_08740 109158 108811 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037236.1 protein_id gnl|my_center|LOCUS_08740 109248 109832 gene locus_tag LOCUS_08750 109248 109832 CDS product NfuA family Fe-S biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037235.1 protein_id gnl|my_center|LOCUS_08750 110256 109867 gene locus_tag LOCUS_08760 110256 109867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08760 110615 110253 gene locus_tag LOCUS_08770 110615 110253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 110787 111956 gene locus_tag LOCUS_08780 110787 111956 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275358.1 protein_id gnl|my_center|LOCUS_08780 111969 115424 gene locus_tag LOCUS_08790 111969 115424 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037293.1 protein_id gnl|my_center|LOCUS_08790 115421 118510 gene locus_tag LOCUS_08800 115421 118510 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037292.1 protein_id gnl|my_center|LOCUS_08800 119764 118538 gene locus_tag LOCUS_08810 119764 118538 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994037.1 protein_id gnl|my_center|LOCUS_08810 120718 119804 gene locus_tag LOCUS_08820 120718 119804 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037344.1 protein_id gnl|my_center|LOCUS_08820 121740 120715 gene locus_tag LOCUS_08830 121740 120715 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275355.1 protein_id gnl|my_center|LOCUS_08830 122088 121756 gene locus_tag LOCUS_08840 122088 121756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037342.1 protein_id gnl|my_center|LOCUS_08840 123460 122453 gene locus_tag LOCUS_08850 123460 122453 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057042.1 protein_id gnl|my_center|LOCUS_08850 124749 123469 gene locus_tag LOCUS_08860 gene tviB 124749 123469 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172607932.1 protein_id gnl|my_center|LOCUS_08860 125603 124746 gene locus_tag LOCUS_08870 125603 124746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706124.1 protein_id gnl|my_center|LOCUS_08870 126253 125627 gene locus_tag LOCUS_08880 126253 125627 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706125.1 protein_id gnl|my_center|LOCUS_08880 126524 126267 gene locus_tag LOCUS_08890 126524 126267 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191359.1 protein_id gnl|my_center|LOCUS_08890 126693 128681 gene locus_tag LOCUS_08900 126693 128681 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029300896.1 protein_id gnl|my_center|LOCUS_08900 129692 128709 gene locus_tag LOCUS_08910 129692 128709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 130430 129780 gene locus_tag LOCUS_08920 130430 129780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 131777 130521 gene locus_tag LOCUS_08930 131777 130521 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706126.1 protein_id gnl|my_center|LOCUS_08930 131872 132585 gene locus_tag LOCUS_08940 131872 132585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706121.1 protein_id gnl|my_center|LOCUS_08940 132870 132595 gene locus_tag LOCUS_08950 132870 132595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 132961 133755 gene locus_tag LOCUS_08960 132961 133755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 133870 134955 gene locus_tag LOCUS_08970 gene serC 133870 134955 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036771.1 protein_id gnl|my_center|LOCUS_08970 134959 136047 gene locus_tag LOCUS_08980 gene pheA 134959 136047 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275386.1 protein_id gnl|my_center|LOCUS_08980 136047 137234 gene locus_tag LOCUS_08990 gene hisC 136047 137234 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_08990 137231 138601 gene locus_tag LOCUS_09000 gene aroA 137231 138601 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036773.1 protein_id gnl|my_center|LOCUS_09000 138615 139352 gene locus_tag LOCUS_09010 gene cmk 138615 139352 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037341.1 protein_id gnl|my_center|LOCUS_09010 139475 141160 gene locus_tag LOCUS_09020 gene rpsA 139475 141160 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037340.1 protein_id gnl|my_center|LOCUS_09020 141229 141525 gene locus_tag LOCUS_09030 141229 141525 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037339.1 protein_id gnl|my_center|LOCUS_09030 141568 141831 gene locus_tag LOCUS_09040 141568 141831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 141828 143000 gene locus_tag LOCUS_09050 gene lapB 141828 143000 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037337.1 protein_id gnl|my_center|LOCUS_09050 142997 144043 gene locus_tag LOCUS_09060 142997 144043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 144040 145929 gene locus_tag LOCUS_09070 144040 145929 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275356.1 protein_id gnl|my_center|LOCUS_09070 145926 146807 gene locus_tag LOCUS_09080 gene galU 145926 146807 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037334.1 protein_id gnl|my_center|LOCUS_09080 146800 148101 gene locus_tag LOCUS_09090 146800 148101 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525369.1 protein_id gnl|my_center|LOCUS_09090 149097 148159 gene locus_tag LOCUS_09100 149097 148159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 149244 149459 gene locus_tag LOCUS_09110 149244 149459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 149914 150153 gene locus_tag LOCUS_09120 149914 150153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 152594 151905 gene locus_tag LOCUS_09130 152594 151905 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786909.1 protein_id gnl|my_center|LOCUS_09130 153787 152606 gene locus_tag LOCUS_09140 153787 152606 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787749.1 protein_id gnl|my_center|LOCUS_09140 >Feature sequence06 2134 791 gene locus_tag LOCUS_09150 2134 791 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038361.1 protein_id gnl|my_center|LOCUS_09150 2670 2134 gene locus_tag LOCUS_09160 2670 2134 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038362.1 protein_id gnl|my_center|LOCUS_09160 2782 3006 gene locus_tag LOCUS_09170 2782 3006 CDS product TIGR02449 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038363.1 protein_id gnl|my_center|LOCUS_09170 3003 3299 gene locus_tag LOCUS_09180 3003 3299 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038364.1 protein_id gnl|my_center|LOCUS_09180 3587 4210 gene locus_tag LOCUS_09190 3587 4210 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038365.1 protein_id gnl|my_center|LOCUS_09190 4212 4694 gene locus_tag LOCUS_09200 4212 4694 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161960933.1 protein_id gnl|my_center|LOCUS_09200 4691 5344 gene locus_tag LOCUS_09210 gene rpiA 4691 5344 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038367.1 protein_id gnl|my_center|LOCUS_09210 5557 5483 gene locus_tag LOCUS_t00260 5557 5483 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5997 5605 gene locus_tag LOCUS_09220 gene rpsI 5997 5605 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035728.1 protein_id gnl|my_center|LOCUS_09220 6442 6008 gene locus_tag LOCUS_09230 gene rplM 6442 6008 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483082.1 protein_id gnl|my_center|LOCUS_09230 6610 7260 gene locus_tag LOCUS_09240 gene coq7 6610 7260 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035727.1 protein_id gnl|my_center|LOCUS_09240 8128 7271 gene locus_tag LOCUS_09250 gene speD 8128 7271 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005990692.1 protein_id gnl|my_center|LOCUS_09250 8242 8940 gene locus_tag LOCUS_09260 gene crp 8242 8940 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035725.1 protein_id gnl|my_center|LOCUS_09260 9806 9018 gene locus_tag LOCUS_09270 gene trpC 9806 9018 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437196.1 protein_id gnl|my_center|LOCUS_09270 10861 9803 gene locus_tag LOCUS_09280 gene trpD 10861 9803 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035722.1 protein_id gnl|my_center|LOCUS_09280 11217 10864 gene locus_tag LOCUS_09290 11217 10864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 11798 11214 gene locus_tag LOCUS_09300 11798 11214 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035720.1 protein_id gnl|my_center|LOCUS_09300 14946 11851 gene locus_tag LOCUS_09310 14946 11851 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_09310 16511 14958 gene locus_tag LOCUS_09320 16511 14958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 16816 16535 gene locus_tag LOCUS_09330 16816 16535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 18093 16855 gene locus_tag LOCUS_09340 18093 16855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 18565 18164 gene locus_tag LOCUS_09350 18565 18164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 18983 18639 gene locus_tag LOCUS_09360 18983 18639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227996.1 protein_id gnl|my_center|LOCUS_09360 19959 18970 gene locus_tag LOCUS_09370 19959 18970 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 protein_id gnl|my_center|LOCUS_09370 21459 19987 gene locus_tag LOCUS_09380 gene trpE 21459 19987 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035712.1 protein_id gnl|my_center|LOCUS_09380 22275 21607 gene locus_tag LOCUS_09390 gene rpe 22275 21607 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019237199.1 protein_id gnl|my_center|LOCUS_09390 22646 22320 gene locus_tag LOCUS_09400 22646 22320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 23002 22646 gene locus_tag LOCUS_09410 23002 22646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 23777 24685 gene locus_tag LOCUS_09420 23777 24685 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050911213.1 protein_id gnl|my_center|LOCUS_09420 24744 25619 gene locus_tag LOCUS_09430 24744 25619 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491181.1 protein_id gnl|my_center|LOCUS_09430 28130 25668 gene locus_tag LOCUS_09440 28130 25668 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 protein_id gnl|my_center|LOCUS_09440 29232 28144 gene locus_tag LOCUS_09450 29232 28144 CDS product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237280.1 protein_id gnl|my_center|LOCUS_09450 30688 29321 gene locus_tag LOCUS_09460 30688 29321 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_09460 32738 30720 gene locus_tag LOCUS_09470 32738 30720 CDS product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093045.1 protein_id gnl|my_center|LOCUS_09470 33752 32922 gene locus_tag LOCUS_09480 33752 32922 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035700.1 protein_id gnl|my_center|LOCUS_09480 35235 33772 gene locus_tag LOCUS_09490 gene lpdA 35235 33772 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035792.1 protein_id gnl|my_center|LOCUS_09490 36668 35244 gene locus_tag LOCUS_09500 gene aceF 36668 35244 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035790.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09500 36779 38335 gene locus_tag LOCUS_09510 36779 38335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 39480 38251 gene locus_tag LOCUS_09520 39480 38251 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921105.1 protein_id gnl|my_center|LOCUS_09520 39514 40578 gene locus_tag LOCUS_09530 gene dinB 39514 40578 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035828.1 protein_id gnl|my_center|LOCUS_09530 40635 42620 gene locus_tag LOCUS_09540 40635 42620 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928481.1 protein_id gnl|my_center|LOCUS_09540 43604 42657 gene locus_tag LOCUS_09550 gene cyoE 43604 42657 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506322.1 protein_id gnl|my_center|LOCUS_09550 44751 43621 gene locus_tag LOCUS_09560 44751 43621 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038905.1 protein_id gnl|my_center|LOCUS_09560 45302 44748 gene locus_tag LOCUS_09570 45302 44748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038906.1 protein_id gnl|my_center|LOCUS_09570 46036 45299 gene locus_tag LOCUS_09580 46036 45299 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038907.1 protein_id gnl|my_center|LOCUS_09580 46094 46300 gene locus_tag LOCUS_09590 46094 46300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 47264 46386 gene locus_tag LOCUS_09600 47264 46386 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038909.1 protein_id gnl|my_center|LOCUS_09600 47888 47292 gene locus_tag LOCUS_09610 47888 47292 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038910.1 protein_id gnl|my_center|LOCUS_09610 48068 47892 gene locus_tag LOCUS_09620 48068 47892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 49674 48049 gene locus_tag LOCUS_09630 gene ctaD 49674 48049 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038912.1 protein_id gnl|my_center|LOCUS_09630 50564 49692 gene locus_tag LOCUS_09640 gene coxB 50564 49692 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038913.1 protein_id gnl|my_center|LOCUS_09640 51079 50579 gene locus_tag LOCUS_09650 51079 50579 CDS product DUF2244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506314.1 protein_id gnl|my_center|LOCUS_09650 51216 54434 gene locus_tag LOCUS_09660 gene putA 51216 54434 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038915.1 protein_id gnl|my_center|LOCUS_09660 54508 56112 gene locus_tag LOCUS_09670 54508 56112 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818860.1 protein_id gnl|my_center|LOCUS_09670 56120 56821 gene locus_tag LOCUS_09680 56120 56821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 56821 57501 gene locus_tag LOCUS_09690 56821 57501 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035276.1 protein_id gnl|my_center|LOCUS_09690 57544 59532 gene locus_tag LOCUS_09700 57544 59532 CDS product bifunctional DedA family/phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038389.1 protein_id gnl|my_center|LOCUS_09700 60130 59534 gene locus_tag LOCUS_09710 60130 59534 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038391.1 protein_id gnl|my_center|LOCUS_09710 61703 60300 gene locus_tag LOCUS_09720 gene mpl 61703 60300 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038392.1 protein_id gnl|my_center|LOCUS_09720 62275 61709 gene locus_tag LOCUS_09730 62275 61709 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038393.1 protein_id gnl|my_center|LOCUS_09730 62436 63689 gene locus_tag LOCUS_09740 62436 63689 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038394.1 protein_id gnl|my_center|LOCUS_09740 63784 65253 gene locus_tag LOCUS_09750 63784 65253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 66001 68034 gene locus_tag LOCUS_09760 66001 68034 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038412.1 protein_id gnl|my_center|LOCUS_09760 68224 68892 gene locus_tag LOCUS_09770 68224 68892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 69020 69574 gene locus_tag LOCUS_09780 gene ppa 69020 69574 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002804918.1 protein_id gnl|my_center|LOCUS_09780 69609 70685 gene locus_tag LOCUS_09790 69609 70685 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038414.1 protein_id gnl|my_center|LOCUS_09790 71234 70707 gene locus_tag LOCUS_09800 71234 70707 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038968086.1 protein_id gnl|my_center|LOCUS_09800 71378 73561 gene locus_tag LOCUS_09810 71378 73561 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265516.1 protein_id gnl|my_center|LOCUS_09810 75481 73583 gene locus_tag LOCUS_09820 gene thiC 75481 73583 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038418.1 protein_id gnl|my_center|LOCUS_09820 78856 75689 gene locus_tag LOCUS_09830 78856 75689 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698545.1 protein_id gnl|my_center|LOCUS_09830 79993 78857 gene locus_tag LOCUS_09840 gene mexJ 79993 78857 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MexJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113855.1 protein_id gnl|my_center|LOCUS_09840 80066 80716 gene locus_tag LOCUS_09850 gene mexL 80066 80716 CDS product efflux system transcriptional repressor MexL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092468.1 protein_id gnl|my_center|LOCUS_09850 80817 81470 gene locus_tag LOCUS_09860 80817 81470 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038434.1 protein_id gnl|my_center|LOCUS_09860 81436 82920 gene locus_tag LOCUS_09870 81436 82920 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038435.1 protein_id gnl|my_center|LOCUS_09870 84228 82933 gene locus_tag LOCUS_09880 gene waaA 84228 82933 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038436.1 protein_id gnl|my_center|LOCUS_09880 84301 85236 gene locus_tag LOCUS_09890 84301 85236 CDS product LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038437.1 protein_id gnl|my_center|LOCUS_09890 86081 85242 gene locus_tag LOCUS_09900 86081 85242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 86986 86078 gene locus_tag LOCUS_09910 86986 86078 CDS product LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038437.1 protein_id gnl|my_center|LOCUS_09910 88236 86983 gene locus_tag LOCUS_09920 88236 86983 CDS product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038438.1 protein_id gnl|my_center|LOCUS_09920 89317 88217 gene locus_tag LOCUS_09930 89317 88217 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038439.1 protein_id gnl|my_center|LOCUS_09930 89535 89332 gene locus_tag LOCUS_09940 89535 89332 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038440.1 protein_id gnl|my_center|LOCUS_09940 90584 89634 gene locus_tag LOCUS_09950 90584 89634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 91301 90600 gene locus_tag LOCUS_09960 91301 90600 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707660.1 protein_id gnl|my_center|LOCUS_09960 91930 91346 gene locus_tag LOCUS_09970 91930 91346 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391428.1 protein_id gnl|my_center|LOCUS_09970 92579 91989 gene locus_tag LOCUS_09980 92579 91989 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195469.1 protein_id gnl|my_center|LOCUS_09980 92699 93721 gene locus_tag LOCUS_09990 92699 93721 CDS product ELM1/GtrOC1 family putative glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038688.1 protein_id gnl|my_center|LOCUS_09990 96453 93658 gene locus_tag LOCUS_10000 gene glnE 96453 93658 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038683.1 protein_id gnl|my_center|LOCUS_10000 98615 96546 gene locus_tag LOCUS_10010 98615 96546 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074150.1 protein_id gnl|my_center|LOCUS_10010 100196 98667 gene locus_tag LOCUS_10020 100196 98667 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903217.1 protein_id gnl|my_center|LOCUS_10020 100391 101071 gene locus_tag LOCUS_10030 100391 101071 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036158.1 protein_id gnl|my_center|LOCUS_10030 101854 101153 gene locus_tag LOCUS_10040 101854 101153 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141078.1 protein_id gnl|my_center|LOCUS_10040 103077 101851 gene locus_tag LOCUS_10050 103077 101851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 105260 103083 gene locus_tag LOCUS_10060 105260 103083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 105762 105268 gene locus_tag LOCUS_10070 105762 105268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 106233 106760 gene locus_tag LOCUS_10080 106233 106760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 107371 106766 gene locus_tag LOCUS_10090 gene trmY 107371 106766 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459965.1 protein_id gnl|my_center|LOCUS_10090 107600 107442 gene locus_tag LOCUS_10100 107600 107442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 107941 107597 gene locus_tag LOCUS_10110 107941 107597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 108249 107908 gene locus_tag LOCUS_10120 108249 107908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 108545 108246 gene locus_tag LOCUS_10130 108545 108246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 109988 108861 gene locus_tag LOCUS_10140 109988 108861 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532708.1 protein_id gnl|my_center|LOCUS_10140 110968 109985 gene locus_tag LOCUS_10150 110968 109985 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529902.1 protein_id gnl|my_center|LOCUS_10150 111332 111769 gene locus_tag LOCUS_10160 111332 111769 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192748.1 protein_id gnl|my_center|LOCUS_10160 111788 112201 gene locus_tag LOCUS_10170 111788 112201 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194251.1 protein_id gnl|my_center|LOCUS_10170 113144 112326 gene locus_tag LOCUS_10180 113144 112326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 115022 113379 gene locus_tag LOCUS_10190 gene groL 115022 113379 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035771.1 protein_id gnl|my_center|LOCUS_10190 115379 115095 gene locus_tag LOCUS_10200 gene groES 115379 115095 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946424.1 protein_id gnl|my_center|LOCUS_10200 115578 115913 gene locus_tag LOCUS_10210 115578 115913 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035769.1 protein_id gnl|my_center|LOCUS_10210 116564 115932 gene locus_tag LOCUS_10220 116564 115932 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473863.1 protein_id gnl|my_center|LOCUS_10220 116705 118465 gene locus_tag LOCUS_10230 116705 118465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 118462 119031 gene locus_tag LOCUS_10240 118462 119031 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194069.1 protein_id gnl|my_center|LOCUS_10240 120571 121035 gene locus_tag LOCUS_10250 gene aroQ 120571 121035 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035767.1 protein_id gnl|my_center|LOCUS_10250 121094 121579 gene locus_tag LOCUS_10260 gene accB 121094 121579 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035766.1 protein_id gnl|my_center|LOCUS_10260 121590 122957 gene locus_tag LOCUS_10270 gene accC 121590 122957 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035764.1 protein_id gnl|my_center|LOCUS_10270 123028 124401 gene locus_tag LOCUS_10280 gene dbpA 123028 124401 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037426.1 protein_id gnl|my_center|LOCUS_10280 124854 124411 gene locus_tag LOCUS_10290 124854 124411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 127632 124999 gene locus_tag LOCUS_10300 127632 124999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 128690 127629 gene locus_tag LOCUS_10310 gene rhuM 128690 127629 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280585.1 protein_id gnl|my_center|LOCUS_10310 130354 128687 gene locus_tag LOCUS_10320 130354 128687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 133196 130569 gene locus_tag LOCUS_10330 gene acnD 133196 130569 CDS product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115200.1 protein_id gnl|my_center|LOCUS_10330 133305 133381 gene locus_tag LOCUS_t00270 133305 133381 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 133821 133657 gene locus_tag LOCUS_10340 gene rpmG 133821 133657 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051801.1 protein_id gnl|my_center|LOCUS_10340 134070 133834 gene locus_tag LOCUS_10350 gene rpmB 134070 133834 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002809459.1 protein_id gnl|my_center|LOCUS_10350 134349 135104 gene locus_tag LOCUS_10360 134349 135104 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009041028.1 protein_id gnl|my_center|LOCUS_10360 135489 135112 gene locus_tag LOCUS_10370 135489 135112 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038930.1 protein_id gnl|my_center|LOCUS_10370 136229 135486 gene locus_tag LOCUS_10380 136229 135486 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 protein_id gnl|my_center|LOCUS_10380 137148 136255 gene locus_tag LOCUS_10390 137148 136255 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038925.1 protein_id gnl|my_center|LOCUS_10390 137930 137145 gene locus_tag LOCUS_10400 137930 137145 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038924.1 protein_id gnl|my_center|LOCUS_10400 138720 138028 gene locus_tag LOCUS_10410 gene rsmG 138720 138028 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039110.1 protein_id gnl|my_center|LOCUS_10410 141603 138754 gene locus_tag LOCUS_10420 141603 138754 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052103386.1 protein_id gnl|my_center|LOCUS_10420 141704 142693 gene locus_tag LOCUS_10430 gene hemB 141704 142693 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039028.1 protein_id gnl|my_center|LOCUS_10430 142728 143570 gene locus_tag LOCUS_10440 gene aroE 142728 143570 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039025.1 protein_id gnl|my_center|LOCUS_10440 144131 143589 gene locus_tag LOCUS_10450 144131 143589 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035602.1 protein_id gnl|my_center|LOCUS_10450 >Feature sequence07 851 543 gene locus_tag LOCUS_10460 gene bamE 851 543 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036655.1 protein_id gnl|my_center|LOCUS_10460 1034 1447 gene locus_tag LOCUS_10470 gene fur 1034 1447 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005988392.1 protein_id gnl|my_center|LOCUS_10470 3129 1462 gene locus_tag LOCUS_10480 gene recN 3129 1462 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036657.1 protein_id gnl|my_center|LOCUS_10480 3200 4318 gene locus_tag LOCUS_10490 gene hrcA 3200 4318 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628994.1 protein_id gnl|my_center|LOCUS_10490 4369 4893 gene locus_tag LOCUS_10500 gene grpE 4369 4893 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507314.1 protein_id gnl|my_center|LOCUS_10500 4959 6944 gene locus_tag LOCUS_10510 gene dnaK 4959 6944 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036660.1 protein_id gnl|my_center|LOCUS_10510 6941 8074 gene locus_tag LOCUS_10520 gene dnaJ 6941 8074 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036661.1 protein_id gnl|my_center|LOCUS_10520 8127 8855 gene locus_tag LOCUS_10530 gene dapB 8127 8855 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037010.1 protein_id gnl|my_center|LOCUS_10530 8955 10073 gene locus_tag LOCUS_10540 gene carA 8955 10073 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037011.1 protein_id gnl|my_center|LOCUS_10540 10106 12010 gene locus_tag LOCUS_10550 10106 12010 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038419.1 protein_id gnl|my_center|LOCUS_10550 12010 15240 gene locus_tag LOCUS_10560 gene carB 12010 15240 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037013.1 protein_id gnl|my_center|LOCUS_10560 15237 15713 gene locus_tag LOCUS_10570 gene greA 15237 15713 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507602.1 protein_id gnl|my_center|LOCUS_10570 15716 16651 gene locus_tag LOCUS_10580 15716 16651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037015.1 protein_id gnl|my_center|LOCUS_10580 16648 18366 gene locus_tag LOCUS_10590 gene recJ 16648 18366 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027068825.1 protein_id gnl|my_center|LOCUS_10590 18731 21337 gene locus_tag LOCUS_10600 18731 21337 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229117.1 protein_id gnl|my_center|LOCUS_10600 21467 22993 gene locus_tag LOCUS_10610 gene casA 21467 22993 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229116.1 protein_id gnl|my_center|LOCUS_10610 22990 23541 gene locus_tag LOCUS_10620 22990 23541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 23569 24753 gene locus_tag LOCUS_10630 gene cas7e 23569 24753 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229114.1 protein_id gnl|my_center|LOCUS_10630 24760 25431 gene locus_tag LOCUS_10640 gene cas5e 24760 25431 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229113.1 protein_id gnl|my_center|LOCUS_10640 25406 26017 gene locus_tag LOCUS_10650 gene cas6e 25406 26017 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229112.1 protein_id gnl|my_center|LOCUS_10650 26058 27065 gene locus_tag LOCUS_10660 gene cas1e 26058 27065 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229111.1 protein_id gnl|my_center|LOCUS_10660 27070 27405 gene locus_tag LOCUS_10670 gene cas2e 27070 27405 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926117.1 protein_id gnl|my_center|LOCUS_10670 27425 28495 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgtccccacacgcgtgggggtgaaccg 29012 28725 gene locus_tag LOCUS_10680 29012 28725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 28950 29813 gene locus_tag LOCUS_10690 gene prfB 28950 29813 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100097357.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10690 29866 31395 gene locus_tag LOCUS_10700 gene lysS 29866 31395 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037023.1 protein_id gnl|my_center|LOCUS_10700 33244 31412 gene locus_tag LOCUS_10710 33244 31412 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037028.1 protein_id gnl|my_center|LOCUS_10710 35989 33308 gene locus_tag LOCUS_10720 gene acnA 35989 33308 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037030.1 protein_id gnl|my_center|LOCUS_10720 36698 36090 gene locus_tag LOCUS_10730 gene hflD 36698 36090 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029217215.1 protein_id gnl|my_center|LOCUS_10730 37810 36695 gene locus_tag LOCUS_10740 gene mnmA 37810 36695 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037128.1 protein_id gnl|my_center|LOCUS_10740 38268 37807 gene locus_tag LOCUS_10750 38268 37807 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037129.1 protein_id gnl|my_center|LOCUS_10750 38384 38710 gene locus_tag LOCUS_10760 gene clpS 38384 38710 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037130.1 protein_id gnl|my_center|LOCUS_10760 38749 41037 gene locus_tag LOCUS_10770 gene clpA 38749 41037 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037131.1 protein_id gnl|my_center|LOCUS_10770 41275 41057 gene locus_tag LOCUS_10780 gene infA 41275 41057 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037132.1 protein_id gnl|my_center|LOCUS_10780 42148 41372 gene locus_tag LOCUS_10790 gene aat 42148 41372 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037133.1 protein_id gnl|my_center|LOCUS_10790 43299 42145 gene locus_tag LOCUS_10800 43299 42145 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037134.1 protein_id gnl|my_center|LOCUS_10800 44270 43317 gene locus_tag LOCUS_10810 gene trxB 44270 43317 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037135.1 protein_id gnl|my_center|LOCUS_10810 44453 45520 gene locus_tag LOCUS_10820 gene ald 44453 45520 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107857.1 protein_id gnl|my_center|LOCUS_10820 45570 47882 gene locus_tag LOCUS_10830 45570 47882 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037136.1 protein_id gnl|my_center|LOCUS_10830 48007 48675 gene locus_tag LOCUS_10840 gene lolA 48007 48675 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162301084.1 protein_id gnl|my_center|LOCUS_10840 48672 49964 gene locus_tag LOCUS_10850 48672 49964 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037140.1 protein_id gnl|my_center|LOCUS_10850 50078 51355 gene locus_tag LOCUS_10860 gene serS 50078 51355 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036776.1 protein_id gnl|my_center|LOCUS_10860 51366 52292 gene locus_tag LOCUS_10870 51366 52292 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036777.1 protein_id gnl|my_center|LOCUS_10870 52306 52395 gene locus_tag LOCUS_t00280 52306 52395 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 52983 52420 gene locus_tag LOCUS_10880 52983 52420 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036914.1 protein_id gnl|my_center|LOCUS_10880 53094 53999 gene locus_tag LOCUS_10890 gene dapA 53094 53999 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036915.1 protein_id gnl|my_center|LOCUS_10890 54017 54532 gene locus_tag LOCUS_10900 54017 54532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036916.1 protein_id gnl|my_center|LOCUS_10900 54860 54537 gene locus_tag LOCUS_10910 54860 54537 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036917.1 protein_id gnl|my_center|LOCUS_10910 55036 54961 gene locus_tag LOCUS_t00290 55036 54961 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 55138 56382 gene locus_tag LOCUS_10920 gene pcnB 55138 56382 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036939.1 protein_id gnl|my_center|LOCUS_10920 56660 56343 gene locus_tag LOCUS_10930 56660 56343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 56619 56903 gene locus_tag LOCUS_10940 56619 56903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 56929 57750 gene locus_tag LOCUS_10950 gene panB 56929 57750 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036941.1 protein_id gnl|my_center|LOCUS_10950 57747 58610 gene locus_tag LOCUS_10960 gene panC 57747 58610 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036942.1 protein_id gnl|my_center|LOCUS_10960 58651 59088 gene locus_tag LOCUS_10970 58651 59088 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036943.1 protein_id gnl|my_center|LOCUS_10970 59103 60617 gene locus_tag LOCUS_10980 gene pgi 59103 60617 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036944.1 protein_id gnl|my_center|LOCUS_10980 61742 60681 gene locus_tag LOCUS_10990 gene queG 61742 60681 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037446.1 protein_id gnl|my_center|LOCUS_10990 61766 63232 gene locus_tag LOCUS_11000 61766 63232 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037445.1 protein_id gnl|my_center|LOCUS_11000 63229 63705 gene locus_tag LOCUS_11010 gene tsaE 63229 63705 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037444.1 protein_id gnl|my_center|LOCUS_11010 65060 66454 gene locus_tag LOCUS_11020 65060 66454 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763015.1 protein_id gnl|my_center|LOCUS_11020 66516 68318 gene locus_tag LOCUS_11030 gene mutL 66516 68318 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037442.1 protein_id gnl|my_center|LOCUS_11030 68329 69324 gene locus_tag LOCUS_11040 68329 69324 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037441.1 protein_id gnl|my_center|LOCUS_11040 69855 69334 gene locus_tag LOCUS_11050 69855 69334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 70412 69861 gene locus_tag LOCUS_11060 70412 69861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 72592 70442 gene locus_tag LOCUS_11070 gene metG 72592 70442 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036531.1 protein_id gnl|my_center|LOCUS_11070 75856 72722 gene locus_tag LOCUS_11080 75856 72722 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036532.1 protein_id gnl|my_center|LOCUS_11080 76010 77092 gene locus_tag LOCUS_11090 gene apbC 76010 77092 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193796.1 protein_id gnl|my_center|LOCUS_11090 77173 77745 gene locus_tag LOCUS_11100 gene dcd 77173 77745 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037700.1 protein_id gnl|my_center|LOCUS_11100 78191 77754 gene locus_tag LOCUS_11110 78191 77754 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037697.1 protein_id gnl|my_center|LOCUS_11110 78544 78188 gene locus_tag LOCUS_11120 78544 78188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 78634 80058 gene locus_tag LOCUS_11130 gene rimO 78634 80058 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037694.1 protein_id gnl|my_center|LOCUS_11130 80079 80582 gene locus_tag LOCUS_11140 80079 80582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 80624 80890 gene locus_tag LOCUS_11150 80624 80890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 81016 81951 gene locus_tag LOCUS_11160 81016 81951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 81948 82586 gene locus_tag LOCUS_11170 81948 82586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 82583 83281 gene locus_tag LOCUS_11180 82583 83281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 83301 83630 gene locus_tag LOCUS_11190 83301 83630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 83630 85315 gene locus_tag LOCUS_11200 gene mshL 83630 85315 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073814.1 protein_id gnl|my_center|LOCUS_11200 85336 86268 gene locus_tag LOCUS_11210 gene mshM 85336 86268 CDS product MSHA fimbrial biogenesis protein MshM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704366.1 protein_id gnl|my_center|LOCUS_11210 86265 87062 gene locus_tag LOCUS_11220 86265 87062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 87067 88794 gene locus_tag LOCUS_11230 87067 88794 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073811.1 protein_id gnl|my_center|LOCUS_11230 88797 90020 gene locus_tag LOCUS_11240 88797 90020 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456304.1 protein_id gnl|my_center|LOCUS_11240 90024 90548 gene locus_tag LOCUS_11250 90024 90548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 90711 91178 gene locus_tag LOCUS_11260 90711 91178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 91213 91614 gene locus_tag LOCUS_11270 91213 91614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 91702 92214 gene locus_tag LOCUS_11280 91702 92214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 92204 92662 gene locus_tag LOCUS_11290 92204 92662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 92662 93486 gene locus_tag LOCUS_11300 92662 93486 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073804.1 protein_id gnl|my_center|LOCUS_11300 93483 93872 gene locus_tag LOCUS_11310 93483 93872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 93869 97285 gene locus_tag LOCUS_11320 93869 97285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045819.1 protein_id gnl|my_center|LOCUS_11320 97808 97305 gene locus_tag LOCUS_11330 gene greB 97808 97305 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037693.1 protein_id gnl|my_center|LOCUS_11330 99417 97822 gene locus_tag LOCUS_11340 99417 97822 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 protein_id gnl|my_center|LOCUS_11340 99512 100951 gene locus_tag LOCUS_11350 99512 100951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 100948 101766 gene locus_tag LOCUS_11360 100948 101766 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906792.1 protein_id gnl|my_center|LOCUS_11360 101929 102543 gene locus_tag LOCUS_11370 101929 102543 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037565.1 protein_id gnl|my_center|LOCUS_11370 102612 102869 gene locus_tag LOCUS_11380 102612 102869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 102866 103069 gene locus_tag LOCUS_11390 102866 103069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 103107 103964 gene locus_tag LOCUS_11400 103107 103964 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035628.1 protein_id gnl|my_center|LOCUS_11400 103989 104300 gene locus_tag LOCUS_11410 103989 104300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 104390 104758 gene locus_tag LOCUS_11420 104390 104758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 104724 105014 gene locus_tag LOCUS_11430 104724 105014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 105078 105995 gene locus_tag LOCUS_11440 105078 105995 CDS product M14 family metallocarboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037185.1 protein_id gnl|my_center|LOCUS_11440 107286 106003 gene locus_tag LOCUS_11450 107286 106003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 108255 107449 gene locus_tag LOCUS_11460 108255 107449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 108398 108312 gene locus_tag LOCUS_t00300 108398 108312 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 109562 108420 gene locus_tag LOCUS_11470 109562 108420 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037373.1 protein_id gnl|my_center|LOCUS_11470 110623 109559 gene locus_tag LOCUS_11480 110623 109559 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275352.1 protein_id gnl|my_center|LOCUS_11480 111068 110628 gene locus_tag LOCUS_11490 111068 110628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 111607 111065 gene locus_tag LOCUS_11500 111607 111065 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037370.1 protein_id gnl|my_center|LOCUS_11500 113565 111604 gene locus_tag LOCUS_11510 113565 111604 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037369.1 protein_id gnl|my_center|LOCUS_11510 114062 113565 gene locus_tag LOCUS_11520 gene ccmE 114062 113565 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037368.1 protein_id gnl|my_center|LOCUS_11520 114972 114220 gene locus_tag LOCUS_11530 114972 114220 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037366.1 protein_id gnl|my_center|LOCUS_11530 115652 114969 gene locus_tag LOCUS_11540 gene ccmB 115652 114969 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037365.1 protein_id gnl|my_center|LOCUS_11540 116290 115649 gene locus_tag LOCUS_11550 gene ccmA 116290 115649 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037364.1 protein_id gnl|my_center|LOCUS_11550 116422 120501 gene locus_tag LOCUS_11560 116422 120501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 120568 121719 gene locus_tag LOCUS_11570 120568 121719 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037363.1 protein_id gnl|my_center|LOCUS_11570 121716 122555 gene locus_tag LOCUS_11580 121716 122555 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037362.1 protein_id gnl|my_center|LOCUS_11580 122727 123401 gene locus_tag LOCUS_11590 122727 123401 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036626.1 protein_id gnl|my_center|LOCUS_11590 123952 123707 gene locus_tag LOCUS_11600 123952 123707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 125038 124121 gene locus_tag LOCUS_11610 125038 124121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 >Feature sequence08 2120 318 gene locus_tag LOCUS_11620 2120 318 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681239.1 protein_id gnl|my_center|LOCUS_11620 5732 2247 gene locus_tag LOCUS_11630 5732 2247 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143960588.1 protein_id gnl|my_center|LOCUS_11630 5881 6978 gene locus_tag LOCUS_11640 5881 6978 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036492.1 protein_id gnl|my_center|LOCUS_11640 6980 8137 gene locus_tag LOCUS_11650 6980 8137 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035501.1 protein_id gnl|my_center|LOCUS_11650 8213 9388 gene locus_tag LOCUS_11660 8213 9388 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036490.1 protein_id gnl|my_center|LOCUS_11660 9520 9864 gene locus_tag LOCUS_11670 9520 9864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 10003 11625 gene locus_tag LOCUS_11680 10003 11625 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815953.1 protein_id gnl|my_center|LOCUS_11680 11670 12461 gene locus_tag LOCUS_11690 11670 12461 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037003.1 protein_id gnl|my_center|LOCUS_11690 12461 14503 gene locus_tag LOCUS_11700 12461 14503 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035499.1 protein_id gnl|my_center|LOCUS_11700 14500 15417 gene locus_tag LOCUS_11710 14500 15417 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037002.1 protein_id gnl|my_center|LOCUS_11710 15404 16270 gene locus_tag LOCUS_11720 15404 16270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 17326 16301 gene locus_tag LOCUS_11730 17326 16301 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461085.1 protein_id gnl|my_center|LOCUS_11730 17443 18213 gene locus_tag LOCUS_11740 17443 18213 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037001.1 protein_id gnl|my_center|LOCUS_11740 18222 18785 gene locus_tag LOCUS_11750 gene yeiP 18222 18785 CDS product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037000.1 protein_id gnl|my_center|LOCUS_11750 18891 20369 gene locus_tag LOCUS_11760 gene nhaC 18891 20369 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426252.1 protein_id gnl|my_center|LOCUS_11760 20382 22130 gene locus_tag LOCUS_11770 20382 22130 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142253.1 protein_id gnl|my_center|LOCUS_11770 23520 22150 gene locus_tag LOCUS_11780 23520 22150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 23918 23607 gene locus_tag LOCUS_11790 23918 23607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 24056 24691 gene locus_tag LOCUS_11800 24056 24691 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036990.1 protein_id gnl|my_center|LOCUS_11800 24688 25251 gene locus_tag LOCUS_11810 24688 25251 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036989.1 protein_id gnl|my_center|LOCUS_11810 25248 25943 gene locus_tag LOCUS_11820 gene mtnC 25248 25943 CDS product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036988.1 protein_id gnl|my_center|LOCUS_11820 26647 25994 gene locus_tag LOCUS_11830 gene hisIE 26647 25994 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036985.1 protein_id gnl|my_center|LOCUS_11830 27413 26640 gene locus_tag LOCUS_11840 gene hisF 27413 26640 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036984.1 protein_id gnl|my_center|LOCUS_11840 28165 27413 gene locus_tag LOCUS_11850 gene hisA 28165 27413 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036983.1 protein_id gnl|my_center|LOCUS_11850 28797 28174 gene locus_tag LOCUS_11860 gene hisH 28797 28174 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036982.1 protein_id gnl|my_center|LOCUS_11860 29990 28848 gene locus_tag LOCUS_11870 gene hisB 29990 28848 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036981.1 protein_id gnl|my_center|LOCUS_11870 31121 29994 gene locus_tag LOCUS_11880 gene hisC 31121 29994 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036980.1 protein_id gnl|my_center|LOCUS_11880 32416 31118 gene locus_tag LOCUS_11890 gene hisD 32416 31118 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036979.1 protein_id gnl|my_center|LOCUS_11890 33355 32456 gene locus_tag LOCUS_11900 gene hisG 33355 32456 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036978.1 protein_id gnl|my_center|LOCUS_11900 33761 33393 gene locus_tag LOCUS_11910 33761 33393 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036977.1 protein_id gnl|my_center|LOCUS_11910 33838 37287 gene locus_tag LOCUS_11920 gene mfd 33838 37287 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123086488.1 protein_id gnl|my_center|LOCUS_11920 38102 37299 gene locus_tag LOCUS_11930 38102 37299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 38169 40328 gene locus_tag LOCUS_11940 38169 40328 CDS product TonB-dependent receptor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918028.1 protein_id gnl|my_center|LOCUS_11940 41589 40339 gene locus_tag LOCUS_11950 41589 40339 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928952.1 protein_id gnl|my_center|LOCUS_11950 43145 41622 gene locus_tag LOCUS_11960 43145 41622 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036607.1 protein_id gnl|my_center|LOCUS_11960 43482 43273 gene locus_tag LOCUS_11970 43482 43273 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115568.1 protein_id gnl|my_center|LOCUS_11970 43699 44484 gene locus_tag LOCUS_11980 43699 44484 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036605.1 protein_id gnl|my_center|LOCUS_11980 44481 45014 gene locus_tag LOCUS_11990 44481 45014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 45515 45027 gene locus_tag LOCUS_12000 45515 45027 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036604.1 protein_id gnl|my_center|LOCUS_12000 45671 48502 gene locus_tag LOCUS_12010 45671 48502 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640599.1 protein_id gnl|my_center|LOCUS_12010 50876 48570 gene locus_tag LOCUS_12020 50876 48570 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036237.1 protein_id gnl|my_center|LOCUS_12020 51585 50926 gene locus_tag LOCUS_12030 51585 50926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 51703 51629 gene locus_tag LOCUS_t00310 51703 51629 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 53320 51767 gene locus_tag LOCUS_12040 53320 51767 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405217.1 protein_id gnl|my_center|LOCUS_12040 54951 53641 gene locus_tag LOCUS_12050 54951 53641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 55107 55466 gene locus_tag LOCUS_12060 55107 55466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 55484 56383 gene locus_tag LOCUS_12070 55484 56383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 56497 57636 gene locus_tag LOCUS_12080 gene alr 56497 57636 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_12080 59067 57664 gene locus_tag LOCUS_12090 59067 57664 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036624.1 protein_id gnl|my_center|LOCUS_12090 59730 59284 gene locus_tag LOCUS_12100 gene rplI 59730 59284 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005991240.1 protein_id gnl|my_center|LOCUS_12100 60020 59748 gene locus_tag LOCUS_12110 gene rpsR 60020 59748 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005991243.1 protein_id gnl|my_center|LOCUS_12110 60436 60020 gene locus_tag LOCUS_12120 gene rpsF 60436 60020 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036747.1 protein_id gnl|my_center|LOCUS_12120 60967 60626 gene locus_tag LOCUS_12130 60967 60626 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507399.1 protein_id gnl|my_center|LOCUS_12130 61263 61054 gene locus_tag LOCUS_12140 61263 61054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 61175 62500 gene locus_tag LOCUS_12150 gene asnS 61175 62500 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036745.1 protein_id gnl|my_center|LOCUS_12150 62511 62792 gene locus_tag LOCUS_12160 62511 62792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 62822 63178 gene locus_tag LOCUS_12170 62822 63178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 63210 63521 gene locus_tag LOCUS_12180 63210 63521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 63602 64114 gene locus_tag LOCUS_12190 63602 64114 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036739.1 protein_id gnl|my_center|LOCUS_12190 64118 65404 gene locus_tag LOCUS_12200 gene kynU 64118 65404 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057429.1 protein_id gnl|my_center|LOCUS_12200 65401 66762 gene locus_tag LOCUS_12210 65401 66762 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036736.1 protein_id gnl|my_center|LOCUS_12210 66778 68214 gene locus_tag LOCUS_12220 gene sbcB 66778 68214 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036735.1 protein_id gnl|my_center|LOCUS_12220 69042 68224 gene locus_tag LOCUS_12230 69042 68224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 71030 69039 gene locus_tag LOCUS_12240 71030 69039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 73778 71175 gene locus_tag LOCUS_12250 gene gyrA 73778 71175 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036756.1 protein_id gnl|my_center|LOCUS_12250 74928 73873 gene locus_tag LOCUS_12260 gene mtnA 74928 73873 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036755.1 protein_id gnl|my_center|LOCUS_12260 75868 76236 gene locus_tag LOCUS_12270 75868 76236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 76223 76888 gene locus_tag LOCUS_12280 76223 76888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 77471 76851 gene locus_tag LOCUS_12290 77471 76851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 78496 77546 gene locus_tag LOCUS_12300 gene epmA 78496 77546 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036753.1 protein_id gnl|my_center|LOCUS_12300 80619 78511 gene locus_tag LOCUS_12310 gene ligA 80619 78511 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192539.1 protein_id gnl|my_center|LOCUS_12310 81385 80630 gene locus_tag LOCUS_12320 gene zipA 81385 80630 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036750.1 protein_id gnl|my_center|LOCUS_12320 84983 81426 gene locus_tag LOCUS_12330 gene smc 84983 81426 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036749.1 protein_id gnl|my_center|LOCUS_12330 85260 84967 gene locus_tag LOCUS_12340 85260 84967 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037355.1 protein_id gnl|my_center|LOCUS_12340 85352 85990 gene locus_tag LOCUS_12350 85352 85990 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210628.1 protein_id gnl|my_center|LOCUS_12350 86086 86955 gene locus_tag LOCUS_12360 86086 86955 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037357.1 protein_id gnl|my_center|LOCUS_12360 86952 87632 gene locus_tag LOCUS_12370 86952 87632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 87629 89239 gene locus_tag LOCUS_12380 87629 89239 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037359.1 protein_id gnl|my_center|LOCUS_12380 89130 89555 gene locus_tag LOCUS_12390 89130 89555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 90133 90324 gene locus_tag LOCUS_12400 90133 90324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 90778 90413 gene locus_tag LOCUS_12410 90778 90413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 90836 92446 gene locus_tag LOCUS_12420 90836 92446 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889497.1 protein_id gnl|my_center|LOCUS_12420 92457 93614 gene locus_tag LOCUS_12430 gene lldD 92457 93614 CDS product FMN-dependent L-lactate dehydrogenase LldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919035.1 protein_id gnl|my_center|LOCUS_12430 93636 95294 gene locus_tag LOCUS_12440 93636 95294 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229626.1 protein_id gnl|my_center|LOCUS_12440 95453 95378 gene locus_tag LOCUS_t00320 95453 95378 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 95552 95477 gene locus_tag LOCUS_t00330 95552 95477 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 96100 95597 gene locus_tag LOCUS_12450 96100 95597 CDS product DUF1249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037310.1 protein_id gnl|my_center|LOCUS_12450 96926 96105 gene locus_tag LOCUS_12460 96926 96105 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037311.1 protein_id gnl|my_center|LOCUS_12460 97035 99455 gene locus_tag LOCUS_12470 gene ppsA 97035 99455 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037312.1 protein_id gnl|my_center|LOCUS_12470 99458 100408 gene locus_tag LOCUS_12480 99458 100408 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037313.1 protein_id gnl|my_center|LOCUS_12480 101006 100437 gene locus_tag LOCUS_12490 gene orn 101006 100437 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037314.1 protein_id gnl|my_center|LOCUS_12490 101534 101049 gene locus_tag LOCUS_12500 gene tadA 101534 101049 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037315.1 protein_id gnl|my_center|LOCUS_12500 103108 101525 gene locus_tag LOCUS_12510 gene guaA 103108 101525 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037329.1 protein_id gnl|my_center|LOCUS_12510 104566 103112 gene locus_tag LOCUS_12520 gene guaB 104566 103112 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037330.1 protein_id gnl|my_center|LOCUS_12520 105907 104624 gene locus_tag LOCUS_12530 105907 104624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 106398 105904 gene locus_tag LOCUS_12540 106398 105904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 107414 106395 gene locus_tag LOCUS_12550 107414 106395 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099147.1 protein_id gnl|my_center|LOCUS_12550 108298 107426 gene locus_tag LOCUS_12560 108298 107426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 109207 108317 gene locus_tag LOCUS_12570 gene folD 109207 108317 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037331.1 protein_id gnl|my_center|LOCUS_12570 110431 109283 gene locus_tag LOCUS_12580 gene moeB 110431 109283 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057412.1 protein_id gnl|my_center|LOCUS_12580 111837 110440 gene locus_tag LOCUS_12590 gene der 111837 110440 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037150.1 protein_id gnl|my_center|LOCUS_12590 113061 111844 gene locus_tag LOCUS_12600 gene bamB 113061 111844 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507731.1 protein_id gnl|my_center|LOCUS_12600 113722 113066 gene locus_tag LOCUS_12610 113722 113066 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037148.1 protein_id gnl|my_center|LOCUS_12610 114630 113779 gene locus_tag LOCUS_12620 114630 113779 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037147.1 protein_id gnl|my_center|LOCUS_12620 115400 114636 gene locus_tag LOCUS_12630 gene pilW 115400 114636 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037146.1 protein_id gnl|my_center|LOCUS_12630 116574 115387 gene locus_tag LOCUS_12640 gene rlmN 116574 115387 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065467767.1 protein_id gnl|my_center|LOCUS_12640 117007 116582 gene locus_tag LOCUS_12650 gene ndk 117007 116582 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002812972.1 protein_id gnl|my_center|LOCUS_12650 117209 117835 gene locus_tag LOCUS_12660 117209 117835 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037144.1 protein_id gnl|my_center|LOCUS_12660 117961 120330 gene locus_tag LOCUS_12670 117961 120330 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037143.1 protein_id gnl|my_center|LOCUS_12670 120341 121537 gene locus_tag LOCUS_12680 120341 121537 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037142.1 protein_id gnl|my_center|LOCUS_12680 122381 122722 gene locus_tag LOCUS_12690 122381 122722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 123250 122696 gene locus_tag LOCUS_12700 123250 122696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 >Feature sequence09 235 160 gene locus_tag LOCUS_t00340 235 160 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 334 261 gene locus_tag LOCUS_t00350 334 261 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 469 384 gene locus_tag LOCUS_t00360 469 384 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1639 548 gene locus_tag LOCUS_12710 gene ychF 1639 548 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687306.1 protein_id gnl|my_center|LOCUS_12710 2260 1676 gene locus_tag LOCUS_12720 gene pth 2260 1676 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036110.1 protein_id gnl|my_center|LOCUS_12720 3014 2322 gene locus_tag LOCUS_12730 3014 2322 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036109.1 protein_id gnl|my_center|LOCUS_12730 4046 3090 gene locus_tag LOCUS_12740 4046 3090 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036108.1 protein_id gnl|my_center|LOCUS_12740 4163 4087 gene locus_tag LOCUS_t00370 4163 4087 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5106 4162 gene locus_tag LOCUS_12750 gene ispE 5106 4162 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036107.1 protein_id gnl|my_center|LOCUS_12750 5732 5103 gene locus_tag LOCUS_12760 gene lolB 5732 5103 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036106.1 protein_id gnl|my_center|LOCUS_12760 7303 5729 gene locus_tag LOCUS_12770 7303 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 7361 8647 gene locus_tag LOCUS_12780 gene hemA 7361 8647 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036104.1 protein_id gnl|my_center|LOCUS_12780 8644 9729 gene locus_tag LOCUS_12790 gene prfA 8644 9729 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036103.1 protein_id gnl|my_center|LOCUS_12790 9734 10552 gene locus_tag LOCUS_12800 gene ppk2 9734 10552 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036100.1 protein_id gnl|my_center|LOCUS_12800 11708 10530 gene locus_tag LOCUS_12810 11708 10530 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439496.1 protein_id gnl|my_center|LOCUS_12810 12874 11705 gene locus_tag LOCUS_12820 12874 11705 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038987.1 protein_id gnl|my_center|LOCUS_12820 13557 12871 gene locus_tag LOCUS_12830 13557 12871 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038986.1 protein_id gnl|my_center|LOCUS_12830 14802 13567 gene locus_tag LOCUS_12840 14802 13567 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275499.1 protein_id gnl|my_center|LOCUS_12840 15793 14909 gene locus_tag LOCUS_12850 gene yedA 15793 14909 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038991.1 protein_id gnl|my_center|LOCUS_12850 18015 15790 gene locus_tag LOCUS_12860 18015 15790 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038548.1 protein_id gnl|my_center|LOCUS_12860 19159 18095 gene locus_tag LOCUS_12870 gene lipA 19159 18095 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038549.1 protein_id gnl|my_center|LOCUS_12870 19811 19119 gene locus_tag LOCUS_12880 gene lipB 19811 19119 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038550.1 protein_id gnl|my_center|LOCUS_12880 20077 19799 gene locus_tag LOCUS_12890 20077 19799 CDS product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038551.1 protein_id gnl|my_center|LOCUS_12890 21323 20091 gene locus_tag LOCUS_12900 21323 20091 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038554.1 protein_id gnl|my_center|LOCUS_12900 22341 21394 gene locus_tag LOCUS_12910 22341 21394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 23408 22350 gene locus_tag LOCUS_12920 gene mltB 23408 22350 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038556.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12920 24688 23579 gene locus_tag LOCUS_12930 gene rodA 24688 23579 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038563.1 protein_id gnl|my_center|LOCUS_12930 26571 24685 gene locus_tag LOCUS_12940 gene mrdA 26571 24685 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038564.1 protein_id gnl|my_center|LOCUS_12940 27062 26568 gene locus_tag LOCUS_12950 gene mreD 27062 26568 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038565.1 protein_id gnl|my_center|LOCUS_12950 27934 27059 gene locus_tag LOCUS_12960 gene mreC 27934 27059 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123307.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12960 29014 27968 gene locus_tag LOCUS_12970 29014 27968 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003482734.1 protein_id gnl|my_center|LOCUS_12970 29166 30101 gene locus_tag LOCUS_12980 29166 30101 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_12980 30942 30157 gene locus_tag LOCUS_12990 30942 30157 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038721.1 protein_id gnl|my_center|LOCUS_12990 32006 30918 gene locus_tag LOCUS_13000 32006 30918 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038722.1 protein_id gnl|my_center|LOCUS_13000 32427 32071 gene locus_tag LOCUS_13010 32427 32071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 35507 32499 gene locus_tag LOCUS_13020 35507 32499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 35902 35507 gene locus_tag LOCUS_13030 35902 35507 CDS product HI0074 family nucleotidyltransferase substrate-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118912.1 protein_id gnl|my_center|LOCUS_13030 37818 35905 gene locus_tag LOCUS_13040 37818 35905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 40504 37820 gene locus_tag LOCUS_13050 gene aceE 40504 37820 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038709.1 protein_id gnl|my_center|LOCUS_13050 42176 41196 gene locus_tag LOCUS_13060 42176 41196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 44476 42197 gene locus_tag LOCUS_13070 44476 42197 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038443.1 protein_id gnl|my_center|LOCUS_13070 46359 45052 gene locus_tag LOCUS_13080 46359 45052 CDS product flavohemoglobin expression-modulating QEGLA motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038459.1 protein_id gnl|my_center|LOCUS_13080 47556 46468 gene locus_tag LOCUS_13090 gene rsgA 47556 46468 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038460.1 protein_id gnl|my_center|LOCUS_13090 47616 48008 gene locus_tag LOCUS_13100 47616 48008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 48097 49341 gene locus_tag LOCUS_13110 48097 49341 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038462.1 protein_id gnl|my_center|LOCUS_13110 49358 50038 gene locus_tag LOCUS_13120 49358 50038 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_13120 50040 50702 gene locus_tag LOCUS_13130 50040 50702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 50720 51040 gene locus_tag LOCUS_13140 50720 51040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 51830 51057 gene locus_tag LOCUS_13150 51830 51057 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761555.1 protein_id gnl|my_center|LOCUS_13150 51970 53334 gene locus_tag LOCUS_13160 51970 53334 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437413.1 protein_id gnl|my_center|LOCUS_13160 53334 54674 gene locus_tag LOCUS_13170 53334 54674 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275272.1 protein_id gnl|my_center|LOCUS_13170 56280 54787 gene locus_tag LOCUS_13180 56280 54787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13180 57014 56277 gene locus_tag LOCUS_13190 57014 56277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13190 58069 57011 gene locus_tag LOCUS_13200 58069 57011 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143858.1 protein_id gnl|my_center|LOCUS_13200 60814 58223 gene locus_tag LOCUS_13210 gene clpB 60814 58223 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038185.1 protein_id gnl|my_center|LOCUS_13210 62418 60913 gene locus_tag LOCUS_13220 62418 60913 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368514.1 protein_id gnl|my_center|LOCUS_13220 63309 62476 gene locus_tag LOCUS_13230 gene pgeF 63309 62476 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038202.1 protein_id gnl|my_center|LOCUS_13230 64381 63359 gene locus_tag LOCUS_13240 gene rluD 64381 63359 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038203.1 protein_id gnl|my_center|LOCUS_13240 64455 65297 gene locus_tag LOCUS_13250 64455 65297 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038204.1 protein_id gnl|my_center|LOCUS_13250 65387 68398 gene locus_tag LOCUS_13260 65387 68398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 70032 68395 gene locus_tag LOCUS_13270 70032 68395 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054176.1 protein_id gnl|my_center|LOCUS_13270 70959 70084 gene locus_tag LOCUS_13280 gene sucD 70959 70084 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038208.1 protein_id gnl|my_center|LOCUS_13280 72180 71020 gene locus_tag LOCUS_13290 gene sucC 72180 71020 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038209.1 protein_id gnl|my_center|LOCUS_13290 72323 73927 gene locus_tag LOCUS_13300 72323 73927 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038210.1 protein_id gnl|my_center|LOCUS_13300 73966 75360 gene locus_tag LOCUS_13310 73966 75360 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183947609.1 protein_id gnl|my_center|LOCUS_13310 76313 76507 gene locus_tag LOCUS_13320 76313 76507 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545607.1 protein_id gnl|my_center|LOCUS_13320 76504 76905 gene locus_tag LOCUS_13330 76504 76905 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971327.1 protein_id gnl|my_center|LOCUS_13330 77457 77789 gene locus_tag LOCUS_13340 77457 77789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 77786 79042 gene locus_tag LOCUS_13350 77786 79042 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202285.1 protein_id gnl|my_center|LOCUS_13350 79585 80040 gene locus_tag LOCUS_13360 79585 80040 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479693.1 protein_id gnl|my_center|LOCUS_13360 80152 80556 gene locus_tag LOCUS_13370 gene pilA 80152 80556 CDS product type 4a pilus biogenesis protein PilA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112842.1 protein_id gnl|my_center|LOCUS_13370 80553 82274 gene locus_tag LOCUS_13380 gene pilB 80553 82274 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038212.1 protein_id gnl|my_center|LOCUS_13380 82278 83525 gene locus_tag LOCUS_13390 82278 83525 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038215.1 protein_id gnl|my_center|LOCUS_13390 83522 84406 gene locus_tag LOCUS_13400 83522 84406 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038216.1 protein_id gnl|my_center|LOCUS_13400 84438 85064 gene locus_tag LOCUS_13410 gene coaE 84438 85064 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038217.1 protein_id gnl|my_center|LOCUS_13410 >Feature sequence10 615 148 gene locus_tag LOCUS_13420 615 148 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036547.1 protein_id gnl|my_center|LOCUS_13420 713 1171 gene locus_tag LOCUS_13430 gene trxC 713 1171 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070806.1 protein_id gnl|my_center|LOCUS_13430 1256 3505 gene locus_tag LOCUS_13440 gene parC 1256 3505 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036587.1 protein_id gnl|my_center|LOCUS_13440 4359 3514 gene locus_tag LOCUS_13450 4359 3514 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035264.1 protein_id gnl|my_center|LOCUS_13450 4447 6867 gene locus_tag LOCUS_13460 4447 6867 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275396.1 protein_id gnl|my_center|LOCUS_13460 6949 7518 gene locus_tag LOCUS_13470 6949 7518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 7538 8329 gene locus_tag LOCUS_13480 7538 8329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 10042 8351 gene locus_tag LOCUS_13490 gene asnB 10042 8351 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036581.1 protein_id gnl|my_center|LOCUS_13490 12514 10253 gene locus_tag LOCUS_13500 12514 10253 CDS product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036004.1 protein_id gnl|my_center|LOCUS_13500 12842 13933 gene locus_tag LOCUS_13510 12842 13933 CDS product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187023.1 protein_id gnl|my_center|LOCUS_13510 13930 14832 gene locus_tag LOCUS_13520 13930 14832 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531490.1 protein_id gnl|my_center|LOCUS_13520 14829 15929 gene locus_tag LOCUS_13530 14829 15929 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405433.1 protein_id gnl|my_center|LOCUS_13530 15931 16743 gene locus_tag LOCUS_13540 15931 16743 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188492.1 protein_id gnl|my_center|LOCUS_13540 17930 16773 gene locus_tag LOCUS_13550 gene dapE 17930 16773 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040941552.1 protein_id gnl|my_center|LOCUS_13550 18301 17927 gene locus_tag LOCUS_13560 18301 17927 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036578.1 protein_id gnl|my_center|LOCUS_13560 19174 18323 gene locus_tag LOCUS_13570 19174 18323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13570 21797 19143 gene locus_tag LOCUS_13580 21797 19143 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036575.1 protein_id gnl|my_center|LOCUS_13580 22570 21794 gene locus_tag LOCUS_13590 gene map 22570 21794 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036574.1 protein_id gnl|my_center|LOCUS_13590 22870 23748 gene locus_tag LOCUS_13600 gene rpsB 22870 23748 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036567.1 protein_id gnl|my_center|LOCUS_13600 23899 24771 gene locus_tag LOCUS_13610 gene tsf 23899 24771 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036566.1 protein_id gnl|my_center|LOCUS_13610 24970 25695 gene locus_tag LOCUS_13620 gene pyrH 24970 25695 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036563.1 protein_id gnl|my_center|LOCUS_13620 25767 26324 gene locus_tag LOCUS_13630 gene frr 25767 26324 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947438.1 protein_id gnl|my_center|LOCUS_13630 26337 27083 gene locus_tag LOCUS_13640 gene uppS 26337 27083 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043921694.1 protein_id gnl|my_center|LOCUS_13640 27080 27904 gene locus_tag LOCUS_13650 27080 27904 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036560.1 protein_id gnl|my_center|LOCUS_13650 27901 29073 gene locus_tag LOCUS_13660 27901 29073 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036559.1 protein_id gnl|my_center|LOCUS_13660 29070 30416 gene locus_tag LOCUS_13670 gene rseP 29070 30416 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036558.1 protein_id gnl|my_center|LOCUS_13670 30461 32869 gene locus_tag LOCUS_13680 gene bamA 30461 32869 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019237827.1 protein_id gnl|my_center|LOCUS_13680 32876 33910 gene locus_tag LOCUS_13690 gene lpxD 32876 33910 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036555.1 protein_id gnl|my_center|LOCUS_13690 33903 34370 gene locus_tag LOCUS_13700 gene fabZ 33903 34370 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036554.1 protein_id gnl|my_center|LOCUS_13700 34367 35140 gene locus_tag LOCUS_13710 gene lpxA 34367 35140 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036553.1 protein_id gnl|my_center|LOCUS_13710 35151 36323 gene locus_tag LOCUS_13720 gene lpxB 35151 36323 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029629001.1 protein_id gnl|my_center|LOCUS_13720 36320 36997 gene locus_tag LOCUS_13730 36320 36997 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036551.1 protein_id gnl|my_center|LOCUS_13730 37025 40513 gene locus_tag LOCUS_13740 gene dnaE 37025 40513 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036550.1 protein_id gnl|my_center|LOCUS_13740 40590 41549 gene locus_tag LOCUS_13750 40590 41549 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036549.1 protein_id gnl|my_center|LOCUS_13750 41582 42901 gene locus_tag LOCUS_13760 gene tilS 41582 42901 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994173.1 protein_id gnl|my_center|LOCUS_13760 42911 43153 gene locus_tag LOCUS_13770 42911 43153 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037729.1 protein_id gnl|my_center|LOCUS_13770 43143 44069 gene locus_tag LOCUS_13780 43143 44069 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037730.1 protein_id gnl|my_center|LOCUS_13780 44492 44070 gene locus_tag LOCUS_13790 44492 44070 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266257.1 protein_id gnl|my_center|LOCUS_13790 45764 44559 gene locus_tag LOCUS_13800 gene pmbA 45764 44559 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037734.1 protein_id gnl|my_center|LOCUS_13800 45684 46049 gene locus_tag LOCUS_13810 45684 46049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 45968 46546 gene locus_tag LOCUS_13820 gene yjgA 45968 46546 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037735.1 protein_id gnl|my_center|LOCUS_13820 48027 46588 gene locus_tag LOCUS_13830 gene tldD 48027 46588 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037736.1 protein_id gnl|my_center|LOCUS_13830 51917 48024 gene locus_tag LOCUS_13840 51917 48024 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037738.1 protein_id gnl|my_center|LOCUS_13840 53463 51982 gene locus_tag LOCUS_13850 gene rng 53463 51982 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037739.1 protein_id gnl|my_center|LOCUS_13850 54029 53460 gene locus_tag LOCUS_13860 54029 53460 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037740.1 protein_id gnl|my_center|LOCUS_13860 54067 57096 gene locus_tag LOCUS_13870 54067 57096 CDS product ligand-binding sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038432.1 protein_id gnl|my_center|LOCUS_13870 57554 57084 gene locus_tag LOCUS_13880 gene rlmH 57554 57084 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037743.1 protein_id gnl|my_center|LOCUS_13880 57987 57598 gene locus_tag LOCUS_13890 gene rsfS 57987 57598 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037745.1 protein_id gnl|my_center|LOCUS_13890 58751 58038 gene locus_tag LOCUS_13900 58751 58038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 59796 58759 gene locus_tag LOCUS_13910 gene holA 59796 58759 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037747.1 protein_id gnl|my_center|LOCUS_13910 60345 59803 gene locus_tag LOCUS_13920 60345 59803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 63014 60351 gene locus_tag LOCUS_13930 gene leuS 63014 60351 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057355.1 protein_id gnl|my_center|LOCUS_13930 63225 63473 gene locus_tag LOCUS_13940 63225 63473 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533689.1 protein_id gnl|my_center|LOCUS_13940 63470 63865 gene locus_tag LOCUS_13950 63470 63865 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209605909.1 protein_id gnl|my_center|LOCUS_13950 63946 65241 gene locus_tag LOCUS_13960 63946 65241 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_13960 65238 66146 gene locus_tag LOCUS_13970 gene trxA 65238 66146 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037752.1 protein_id gnl|my_center|LOCUS_13970 66150 66611 gene locus_tag LOCUS_13980 66150 66611 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037753.1 protein_id gnl|my_center|LOCUS_13980 66724 69144 gene locus_tag LOCUS_13990 66724 69144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13990 69144 69818 gene locus_tag LOCUS_14000 69144 69818 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036539.1 protein_id gnl|my_center|LOCUS_14000 69815 70369 gene locus_tag LOCUS_14010 69815 70369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 70855 70373 gene locus_tag LOCUS_14020 70855 70373 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207342.1 protein_id gnl|my_center|LOCUS_14020 71137 70928 gene locus_tag LOCUS_14030 71137 70928 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115568.1 protein_id gnl|my_center|LOCUS_14030 71366 71755 gene locus_tag LOCUS_14040 71366 71755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 71831 73123 gene locus_tag LOCUS_14050 71831 73123 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946753.1 protein_id gnl|my_center|LOCUS_14050 73120 74703 gene locus_tag LOCUS_14060 73120 74703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 74743 77919 gene locus_tag LOCUS_14070 74743 77919 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244431.1 protein_id gnl|my_center|LOCUS_14070 77988 78332 gene locus_tag LOCUS_14080 77988 78332 CDS product copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188983.1 protein_id gnl|my_center|LOCUS_14080 78335 78694 gene locus_tag LOCUS_14090 78335 78694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 78731 79663 gene locus_tag LOCUS_14100 78731 79663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 79758 80171 gene locus_tag LOCUS_14110 79758 80171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 80257 80904 gene locus_tag LOCUS_14120 80257 80904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 80940 81278 gene locus_tag LOCUS_14130 80940 81278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 81271 81681 gene locus_tag LOCUS_14140 81271 81681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 82485 81766 gene locus_tag LOCUS_14150 82485 81766 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037770.1 protein_id gnl|my_center|LOCUS_14150 82543 84687 gene locus_tag LOCUS_14160 82543 84687 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074150.1 protein_id gnl|my_center|LOCUS_14160 84753 85169 gene locus_tag LOCUS_14170 84753 85169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 >Feature sequence11 135 629 gene locus_tag LOCUS_14180 135 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 626 1531 gene locus_tag LOCUS_14190 gene rmd 626 1531 CDS product GDP-6-deoxy-D-mannose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114107.1 protein_id gnl|my_center|LOCUS_14190 1532 2548 gene locus_tag LOCUS_14200 gene gmd 1532 2548 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096890.1 protein_id gnl|my_center|LOCUS_14200 3705 2635 gene locus_tag LOCUS_14210 gene alkB2 3705 2635 CDS product alkane 1-monooxygenase AlkB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083349.1 protein_id gnl|my_center|LOCUS_14210 3851 4804 gene locus_tag LOCUS_14220 gene miaA 3851 4804 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036892.1 protein_id gnl|my_center|LOCUS_14220 4844 5125 gene locus_tag LOCUS_14230 gene hfq 4844 5125 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036893.1 protein_id gnl|my_center|LOCUS_14230 5158 6426 gene locus_tag LOCUS_14240 gene hflX 5158 6426 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036894.1 protein_id gnl|my_center|LOCUS_14240 6428 7594 gene locus_tag LOCUS_14250 gene hflK 6428 7594 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036250.1 protein_id gnl|my_center|LOCUS_14250 7594 8487 gene locus_tag LOCUS_14260 7594 8487 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036251.1 protein_id gnl|my_center|LOCUS_14260 8497 8688 gene locus_tag LOCUS_14270 8497 8688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 8736 10076 gene locus_tag LOCUS_14280 8736 10076 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036253.1 protein_id gnl|my_center|LOCUS_14280 10250 10606 gene locus_tag LOCUS_14290 10250 10606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 10611 10967 gene locus_tag LOCUS_14300 10611 10967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 11129 12382 gene locus_tag LOCUS_14310 11129 12382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 15312 12421 gene locus_tag LOCUS_14320 gene gcvP 15312 12421 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036312.1 protein_id gnl|my_center|LOCUS_14320 18920 15732 gene locus_tag LOCUS_14330 18920 15732 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037631.1 protein_id gnl|my_center|LOCUS_14330 19158 19074 gene locus_tag LOCUS_t00380 19158 19074 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 19257 21686 gene locus_tag LOCUS_14340 gene rnr 19257 21686 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116922455.1 protein_id gnl|my_center|LOCUS_14340 21711 22457 gene locus_tag LOCUS_14350 gene rlmB 21711 22457 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036704.1 protein_id gnl|my_center|LOCUS_14350 22454 22741 gene locus_tag LOCUS_14360 22454 22741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 23431 22742 gene locus_tag LOCUS_14370 gene rnt 23431 22742 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036706.1 protein_id gnl|my_center|LOCUS_14370 24126 23428 gene locus_tag LOCUS_14380 gene phoU 24126 23428 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036708.1 protein_id gnl|my_center|LOCUS_14380 24956 24147 gene locus_tag LOCUS_14390 gene pstB 24956 24147 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036709.1 protein_id gnl|my_center|LOCUS_14390 25908 24949 gene locus_tag LOCUS_14400 gene pstA 25908 24949 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036710.1 protein_id gnl|my_center|LOCUS_14400 26867 25908 gene locus_tag LOCUS_14410 gene pstC 26867 25908 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371940.1 protein_id gnl|my_center|LOCUS_14410 28001 26934 gene locus_tag LOCUS_14420 gene pstS 28001 26934 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036712.1 protein_id gnl|my_center|LOCUS_14420 28277 28843 gene locus_tag LOCUS_14430 28277 28843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265691.1 protein_id gnl|my_center|LOCUS_14430 28862 30424 gene locus_tag LOCUS_14440 28862 30424 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265692.1 protein_id gnl|my_center|LOCUS_14440 30421 31107 gene locus_tag LOCUS_14450 30421 31107 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919170.1 protein_id gnl|my_center|LOCUS_14450 31166 32437 gene locus_tag LOCUS_14460 31166 32437 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038451.1 protein_id gnl|my_center|LOCUS_14460 32482 34206 gene locus_tag LOCUS_14470 32482 34206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 34856 34215 gene locus_tag LOCUS_14480 gene nth 34856 34215 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036717.1 protein_id gnl|my_center|LOCUS_14480 35692 34853 gene locus_tag LOCUS_14490 35692 34853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 36024 35689 gene locus_tag LOCUS_14500 36024 35689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 36880 36098 gene locus_tag LOCUS_14510 36880 36098 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036719.1 protein_id gnl|my_center|LOCUS_14510 37042 37791 gene locus_tag LOCUS_14520 37042 37791 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004429231.1 protein_id gnl|my_center|LOCUS_14520 37804 38016 gene locus_tag LOCUS_14530 37804 38016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14530 38016 38621 gene locus_tag LOCUS_14540 38016 38621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14540 38698 40080 gene locus_tag LOCUS_14550 38698 40080 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895625.1 protein_id gnl|my_center|LOCUS_14550 40810 40061 gene locus_tag LOCUS_14560 40810 40061 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036346.1 protein_id gnl|my_center|LOCUS_14560 42131 40818 gene locus_tag LOCUS_14570 42131 40818 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943931.1 protein_id gnl|my_center|LOCUS_14570 42105 42323 gene locus_tag LOCUS_14580 42105 42323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 42757 42353 gene locus_tag LOCUS_14590 42757 42353 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036347.1 protein_id gnl|my_center|LOCUS_14590 45624 42754 gene locus_tag LOCUS_14600 gene uvrA 45624 42754 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036348.1 protein_id gnl|my_center|LOCUS_14600 45834 46193 gene locus_tag LOCUS_14610 gene rplU 45834 46193 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271409.1 protein_id gnl|my_center|LOCUS_14610 46220 46480 gene locus_tag LOCUS_14620 gene rpmA 46220 46480 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036349.1 protein_id gnl|my_center|LOCUS_14620 46613 47674 gene locus_tag LOCUS_14630 gene obgE 46613 47674 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036350.1 protein_id gnl|my_center|LOCUS_14630 47684 48550 gene locus_tag LOCUS_14640 47684 48550 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036248.1 protein_id gnl|my_center|LOCUS_14640 48922 48557 gene locus_tag LOCUS_14650 gene pilH 48922 48557 CDS product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036249.1 protein_id gnl|my_center|LOCUS_14650 50938 49949 gene locus_tag LOCUS_14660 50938 49949 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941435.1 protein_id gnl|my_center|LOCUS_14660 51135 50938 gene locus_tag LOCUS_14670 51135 50938 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523495.1 protein_id gnl|my_center|LOCUS_14670 52561 51137 gene locus_tag LOCUS_14680 gene lpdA 52561 51137 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036671.1 protein_id gnl|my_center|LOCUS_14680 53850 52657 gene locus_tag LOCUS_14690 gene sucB 53850 52657 CDS product dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036672.1 protein_id gnl|my_center|LOCUS_14690 56718 53893 gene locus_tag LOCUS_14700 56718 53893 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994072.1 protein_id gnl|my_center|LOCUS_14700 56855 57286 gene locus_tag LOCUS_14710 56855 57286 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070485.1 protein_id gnl|my_center|LOCUS_14710 58223 57258 gene locus_tag LOCUS_14720 58223 57258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 59544 58276 gene locus_tag LOCUS_14730 59544 58276 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036675.1 protein_id gnl|my_center|LOCUS_14730 60944 59580 gene locus_tag LOCUS_14740 gene purB 60944 59580 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036678.1 protein_id gnl|my_center|LOCUS_14740 61262 61008 gene locus_tag LOCUS_14750 61262 61008 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964533.1 protein_id gnl|my_center|LOCUS_14750 61510 61259 gene locus_tag LOCUS_14760 gene yefM 61510 61259 CDS product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259256.1 protein_id gnl|my_center|LOCUS_14760 61618 63000 gene locus_tag LOCUS_14770 61618 63000 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036680.1 protein_id gnl|my_center|LOCUS_14770 66114 63067 gene locus_tag LOCUS_14780 66114 63067 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_14780 67823 66111 gene locus_tag LOCUS_14790 67823 66111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 69142 67820 gene locus_tag LOCUS_14800 69142 67820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202946090.1 protein_id gnl|my_center|LOCUS_14800 69351 69139 gene locus_tag LOCUS_14810 69351 69139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 70964 69498 gene locus_tag LOCUS_14820 70964 69498 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891943.1 protein_id gnl|my_center|LOCUS_14820 73090 70961 gene locus_tag LOCUS_14830 73090 70961 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368420.1 protein_id gnl|my_center|LOCUS_14830 73708 73355 gene locus_tag LOCUS_tm00010 73708 73355 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 74313 73816 gene locus_tag LOCUS_14840 gene smpB 74313 73816 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036652.1 protein_id gnl|my_center|LOCUS_14840 74346 74795 gene locus_tag LOCUS_14850 74346 74795 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036653.1 protein_id gnl|my_center|LOCUS_14850 74792 75073 gene locus_tag LOCUS_14860 74792 75073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 >Feature sequence12 1150 194 gene locus_tag LOCUS_14870 1150 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 1917 1186 gene locus_tag LOCUS_14880 1917 1186 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039158.1 protein_id gnl|my_center|LOCUS_14880 2022 2960 gene locus_tag LOCUS_14890 gene glyQ 2022 2960 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039156.1 protein_id gnl|my_center|LOCUS_14890 2957 5143 gene locus_tag LOCUS_14900 gene glyS 2957 5143 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039155.1 protein_id gnl|my_center|LOCUS_14900 5149 6972 gene locus_tag LOCUS_14910 5149 6972 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019238119.1 protein_id gnl|my_center|LOCUS_14910 6972 10394 gene locus_tag LOCUS_14920 6972 10394 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113331.1 protein_id gnl|my_center|LOCUS_14920 12559 10688 gene locus_tag LOCUS_14930 12559 10688 CDS product autotransporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038255.1 protein_id gnl|my_center|LOCUS_14930 12696 13610 gene locus_tag LOCUS_14940 gene ubiA 12696 13610 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035644.1 protein_id gnl|my_center|LOCUS_14940 14267 13509 gene locus_tag LOCUS_14950 14267 13509 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944939.1 protein_id gnl|my_center|LOCUS_14950 14340 15350 gene locus_tag LOCUS_14960 gene bioB 14340 15350 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035642.1 protein_id gnl|my_center|LOCUS_14960 15356 16543 gene locus_tag LOCUS_14970 gene bioF 15356 16543 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035641.1 protein_id gnl|my_center|LOCUS_14970 16540 17343 gene locus_tag LOCUS_14980 gene bioH 16540 17343 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035639.1 protein_id gnl|my_center|LOCUS_14980 17396 18247 gene locus_tag LOCUS_14990 gene bioC 17396 18247 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035637.1 protein_id gnl|my_center|LOCUS_14990 19306 18260 gene locus_tag LOCUS_15000 19306 18260 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035633.1 protein_id gnl|my_center|LOCUS_15000 20328 19312 gene locus_tag LOCUS_15010 20328 19312 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036633.1 protein_id gnl|my_center|LOCUS_15010 20366 22576 gene locus_tag LOCUS_15020 gene uvrD 20366 22576 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039097.1 protein_id gnl|my_center|LOCUS_15020 23684 24817 gene locus_tag LOCUS_15030 gene dctP 23684 24817 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_15030 23881 23977 gene locus_tag LOCUS_t00390 23881 23977 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 25607 24831 gene locus_tag LOCUS_15040 gene xth 25607 24831 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039115.1 protein_id gnl|my_center|LOCUS_15040 25770 27494 gene locus_tag LOCUS_15050 gene ggt 25770 27494 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038421.1 protein_id gnl|my_center|LOCUS_15050 27562 28194 gene locus_tag LOCUS_15060 27562 28194 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035431.1 protein_id gnl|my_center|LOCUS_15060 28204 28680 gene locus_tag LOCUS_15070 28204 28680 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035432.1 protein_id gnl|my_center|LOCUS_15070 28767 29375 gene locus_tag LOCUS_15080 28767 29375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 29407 30159 gene locus_tag LOCUS_15090 29407 30159 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035436.1 protein_id gnl|my_center|LOCUS_15090 30170 31156 gene locus_tag LOCUS_15100 30170 31156 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035437.1 protein_id gnl|my_center|LOCUS_15100 31938 31150 gene locus_tag LOCUS_15110 31938 31150 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035441.1 protein_id gnl|my_center|LOCUS_15110 32243 31935 gene locus_tag LOCUS_15120 32243 31935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 32154 33563 gene locus_tag LOCUS_15130 gene glnA 32154 33563 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035442.1 protein_id gnl|my_center|LOCUS_15130 33611 34867 gene locus_tag LOCUS_15140 33611 34867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 35041 36114 gene locus_tag LOCUS_15150 35041 36114 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014509462.1 protein_id gnl|my_center|LOCUS_15150 36111 37589 gene locus_tag LOCUS_15160 gene ntrC 36111 37589 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035445.1 protein_id gnl|my_center|LOCUS_15160 38476 37586 gene locus_tag LOCUS_15170 38476 37586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070689331.1 protein_id gnl|my_center|LOCUS_15170 38536 39471 gene locus_tag LOCUS_15180 38536 39471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 39511 40797 gene locus_tag LOCUS_15190 39511 40797 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035450.1 protein_id gnl|my_center|LOCUS_15190 42902 42123 gene locus_tag LOCUS_15200 42902 42123 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275145.1 protein_id gnl|my_center|LOCUS_15200 44566 42899 gene locus_tag LOCUS_15210 gene ubiB 44566 42899 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035479.1 protein_id gnl|my_center|LOCUS_15210 45216 44563 gene locus_tag LOCUS_15220 45216 44563 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035478.1 protein_id gnl|my_center|LOCUS_15220 47286 45226 gene locus_tag LOCUS_15230 47286 45226 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113760.1 protein_id gnl|my_center|LOCUS_15230 47636 47340 gene locus_tag LOCUS_15240 47636 47340 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088517.1 protein_id gnl|my_center|LOCUS_15240 47695 48615 gene locus_tag LOCUS_15250 47695 48615 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035554.1 protein_id gnl|my_center|LOCUS_15250 49416 48634 gene locus_tag LOCUS_15260 49416 48634 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994124.1 protein_id gnl|my_center|LOCUS_15260 50402 49413 gene locus_tag LOCUS_15270 50402 49413 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039048.1 protein_id gnl|my_center|LOCUS_15270 51095 50502 gene locus_tag LOCUS_15280 51095 50502 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530733.1 protein_id gnl|my_center|LOCUS_15280 51198 51950 gene locus_tag LOCUS_15290 51198 51950 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994123.1 protein_id gnl|my_center|LOCUS_15290 51967 53145 gene locus_tag LOCUS_15300 51967 53145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 53149 54684 gene locus_tag LOCUS_15310 53149 54684 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039042.1 protein_id gnl|my_center|LOCUS_15310 54698 55444 gene locus_tag LOCUS_15320 54698 55444 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039041.1 protein_id gnl|my_center|LOCUS_15320 55441 56622 gene locus_tag LOCUS_15330 55441 56622 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275547.1 protein_id gnl|my_center|LOCUS_15330 57639 56671 gene locus_tag LOCUS_15340 57639 56671 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039039.1 protein_id gnl|my_center|LOCUS_15340 58641 57715 gene locus_tag LOCUS_15350 58641 57715 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039039.1 protein_id gnl|my_center|LOCUS_15350 58782 61283 gene locus_tag LOCUS_15360 gene hrpB 58782 61283 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275159.1 protein_id gnl|my_center|LOCUS_15360 61747 63693 gene locus_tag LOCUS_15370 gene mnmG 61747 63693 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035631.1 protein_id gnl|my_center|LOCUS_15370 63713 64810 gene locus_tag LOCUS_15380 63713 64810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 64807 66189 gene locus_tag LOCUS_15390 64807 66189 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073049.1 protein_id gnl|my_center|LOCUS_15390 66395 66471 gene locus_tag LOCUS_t00400 66395 66471 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence13 1082 609 gene locus_tag LOCUS_15400 1082 609 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038042.1 protein_id gnl|my_center|LOCUS_15400 2471 1098 gene locus_tag LOCUS_15410 2471 1098 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038043.1 protein_id gnl|my_center|LOCUS_15410 8067 2464 gene locus_tag LOCUS_15420 8067 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 10156 8123 gene locus_tag LOCUS_15430 10156 8123 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038045.1 protein_id gnl|my_center|LOCUS_15430 10720 10187 gene locus_tag LOCUS_15440 10720 10187 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508568.1 protein_id gnl|my_center|LOCUS_15440 11118 10717 gene locus_tag LOCUS_15450 gene pilG 11118 10717 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 protein_id gnl|my_center|LOCUS_15450 11306 12253 gene locus_tag LOCUS_15460 gene gshB 11306 12253 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038049.1 protein_id gnl|my_center|LOCUS_15460 12250 13131 gene locus_tag LOCUS_15470 12250 13131 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038050.1 protein_id gnl|my_center|LOCUS_15470 13960 13148 gene locus_tag LOCUS_15480 gene tsaB 13960 13148 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038052.1 protein_id gnl|my_center|LOCUS_15480 16031 13950 gene locus_tag LOCUS_15490 16031 13950 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038053.1 protein_id gnl|my_center|LOCUS_15490 16504 16028 gene locus_tag LOCUS_15500 16504 16028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038054.1 protein_id gnl|my_center|LOCUS_15500 18801 16537 gene locus_tag LOCUS_15510 gene mrcB 18801 16537 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038055.1 protein_id gnl|my_center|LOCUS_15510 18836 22969 gene locus_tag LOCUS_15520 18836 22969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 25109 22974 gene locus_tag LOCUS_15530 25109 22974 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275520.1 protein_id gnl|my_center|LOCUS_15530 25128 25649 gene locus_tag LOCUS_15540 25128 25649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038064.1 protein_id gnl|my_center|LOCUS_15540 29643 25654 gene locus_tag LOCUS_15550 gene hrpA 29643 25654 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105494.1 protein_id gnl|my_center|LOCUS_15550 31316 29676 gene locus_tag LOCUS_15560 31316 29676 CDS product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_15560 31751 31323 gene locus_tag LOCUS_15570 31751 31323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 32191 31748 gene locus_tag LOCUS_15580 32191 31748 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184408.1 protein_id gnl|my_center|LOCUS_15580 32639 32202 gene locus_tag LOCUS_15590 32639 32202 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 protein_id gnl|my_center|LOCUS_15590 32731 33606 gene locus_tag LOCUS_15600 32731 33606 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807247.1 protein_id gnl|my_center|LOCUS_15600 33688 33613 gene locus_tag LOCUS_t00410 33688 33613 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 34515 33769 gene locus_tag LOCUS_15610 gene queC 34515 33769 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104586586.1 protein_id gnl|my_center|LOCUS_15610 35231 34524 gene locus_tag LOCUS_15620 gene queE 35231 34524 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038131.1 protein_id gnl|my_center|LOCUS_15620 36107 35235 gene locus_tag LOCUS_15630 gene ybgF 36107 35235 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038132.1 protein_id gnl|my_center|LOCUS_15630 36623 36111 gene locus_tag LOCUS_15640 gene pal 36623 36111 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038133.1 protein_id gnl|my_center|LOCUS_15640 38014 36701 gene locus_tag LOCUS_15650 gene tolB 38014 36701 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038134.1 protein_id gnl|my_center|LOCUS_15650 39017 38082 gene locus_tag LOCUS_15660 39017 38082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 39454 39017 gene locus_tag LOCUS_15670 gene tolR 39454 39017 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038136.1 protein_id gnl|my_center|LOCUS_15670 40267 39491 gene locus_tag LOCUS_15680 gene tolQ 40267 39491 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038137.1 protein_id gnl|my_center|LOCUS_15680 40713 40261 gene locus_tag LOCUS_15690 gene ybgC 40713 40261 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038138.1 protein_id gnl|my_center|LOCUS_15690 41750 40710 gene locus_tag LOCUS_15700 gene ruvB 41750 40710 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038139.1 protein_id gnl|my_center|LOCUS_15700 42365 41769 gene locus_tag LOCUS_15710 gene ruvA 42365 41769 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006450983.1 protein_id gnl|my_center|LOCUS_15710 42933 42406 gene locus_tag LOCUS_15720 gene ruvC 42933 42406 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038141.1 protein_id gnl|my_center|LOCUS_15720 43658 42930 gene locus_tag LOCUS_15730 43658 42930 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038142.1 protein_id gnl|my_center|LOCUS_15730 44386 43754 gene locus_tag LOCUS_15740 44386 43754 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275303.1 protein_id gnl|my_center|LOCUS_15740 46196 44430 gene locus_tag LOCUS_15750 gene aspS 46196 44430 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038145.1 protein_id gnl|my_center|LOCUS_15750 48382 46283 gene locus_tag LOCUS_15760 48382 46283 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545619.1 protein_id gnl|my_center|LOCUS_15760 49335 48397 gene locus_tag LOCUS_15770 49335 48397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 49954 49697 gene locus_tag LOCUS_15780 49954 49697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 50411 50010 gene locus_tag LOCUS_15790 50411 50010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 50824 50567 gene locus_tag LOCUS_15800 50824 50567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 52007 51174 gene locus_tag LOCUS_15810 52007 51174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15810 52226 52047 gene locus_tag LOCUS_15820 52226 52047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 52452 52144 gene locus_tag LOCUS_15830 52452 52144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 54483 52513 gene locus_tag LOCUS_15840 54483 52513 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038157.1 protein_id gnl|my_center|LOCUS_15840 54638 57241 gene locus_tag LOCUS_15850 54638 57241 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919539.1 protein_id gnl|my_center|LOCUS_15850 58795 57275 gene locus_tag LOCUS_15860 58795 57275 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256609.1 protein_id gnl|my_center|LOCUS_15860 58733 58921 gene locus_tag LOCUS_15870 58733 58921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 59380 58934 gene locus_tag LOCUS_15880 59380 58934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 59641 62052 gene locus_tag LOCUS_15890 59641 62052 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037300.1 protein_id gnl|my_center|LOCUS_15890 62155 62063 gene locus_tag LOCUS_t00420 62155 62063 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 63154 62078 gene locus_tag LOCUS_15900 63154 62078 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030122.1 protein_id gnl|my_center|LOCUS_15900 65649 63151 gene locus_tag LOCUS_15910 65649 63151 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030123.1 protein_id gnl|my_center|LOCUS_15910 >Feature sequence14 1559 537 gene locus_tag LOCUS_15920 1559 537 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035972.1 protein_id gnl|my_center|LOCUS_15920 4333 1586 gene locus_tag LOCUS_15930 gene secA 4333 1586 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035970.1 protein_id gnl|my_center|LOCUS_15930 5348 4449 gene locus_tag LOCUS_15940 5348 4449 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035969.1 protein_id gnl|my_center|LOCUS_15940 5347 5871 gene locus_tag LOCUS_15950 5347 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 6551 6222 gene locus_tag LOCUS_15960 6551 6222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 7892 6981 gene locus_tag LOCUS_15970 gene lpxC 7892 6981 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_15970 9329 8085 gene locus_tag LOCUS_15980 gene ftsZ 9329 8085 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035966.1 protein_id gnl|my_center|LOCUS_15980 10640 9405 gene locus_tag LOCUS_15990 gene ftsA 10640 9405 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003485272.1 protein_id gnl|my_center|LOCUS_15990 11371 10637 gene locus_tag LOCUS_16000 11371 10637 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035965.1 protein_id gnl|my_center|LOCUS_16000 12393 11368 gene locus_tag LOCUS_16010 12393 11368 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035964.1 protein_id gnl|my_center|LOCUS_16010 13826 12390 gene locus_tag LOCUS_16020 gene murC 13826 12390 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035963.1 protein_id gnl|my_center|LOCUS_16020 14890 13808 gene locus_tag LOCUS_16030 gene murG 14890 13808 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035962.1 protein_id gnl|my_center|LOCUS_16030 16194 14887 gene locus_tag LOCUS_16040 gene ftsW 16194 14887 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027080830.1 protein_id gnl|my_center|LOCUS_16040 17270 16194 gene locus_tag LOCUS_16050 gene mraY 17270 16194 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035960.1 protein_id gnl|my_center|LOCUS_16050 18627 17260 gene locus_tag LOCUS_16060 gene murF 18627 17260 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035959.1 protein_id gnl|my_center|LOCUS_16060 20096 18624 gene locus_tag LOCUS_16070 20096 18624 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994100.1 protein_id gnl|my_center|LOCUS_16070 21883 20093 gene locus_tag LOCUS_16080 21883 20093 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042597405.1 protein_id gnl|my_center|LOCUS_16080 22149 21880 gene locus_tag LOCUS_16090 gene ftsL 22149 21880 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035956.1 protein_id gnl|my_center|LOCUS_16090 23102 22146 gene locus_tag LOCUS_16100 gene rsmH 23102 22146 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047697615.1 protein_id gnl|my_center|LOCUS_16100 23553 23107 gene locus_tag LOCUS_16110 gene mraZ 23553 23107 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005910933.1 protein_id gnl|my_center|LOCUS_16110 25127 24288 gene locus_tag LOCUS_16120 gene rsmI 25127 24288 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035951.1 protein_id gnl|my_center|LOCUS_16120 25183 26958 gene locus_tag LOCUS_16130 25183 26958 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035950.1 protein_id gnl|my_center|LOCUS_16130 26967 27374 gene locus_tag LOCUS_16140 26967 27374 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040603.1 protein_id gnl|my_center|LOCUS_16140 27959 27381 gene locus_tag LOCUS_16150 gene pgpA 27959 27381 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154063.1 protein_id gnl|my_center|LOCUS_16150 28927 27956 gene locus_tag LOCUS_16160 gene thiL 28927 27956 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035938.1 protein_id gnl|my_center|LOCUS_16160 29479 29021 gene locus_tag LOCUS_16170 gene nusB 29479 29021 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035937.1 protein_id gnl|my_center|LOCUS_16170 29970 29476 gene locus_tag LOCUS_16180 gene ribH 29970 29476 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035936.1 protein_id gnl|my_center|LOCUS_16180 31186 30062 gene locus_tag LOCUS_16190 gene ribB 31186 30062 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035935.1 protein_id gnl|my_center|LOCUS_16190 31800 31183 gene locus_tag LOCUS_16200 31800 31183 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035934.1 protein_id gnl|my_center|LOCUS_16200 32995 31904 gene locus_tag LOCUS_16210 gene ribD 32995 31904 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035932.1 protein_id gnl|my_center|LOCUS_16210 33558 33034 gene locus_tag LOCUS_16220 gene nrdR 33558 33034 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005997276.1 protein_id gnl|my_center|LOCUS_16220 34954 33701 gene locus_tag LOCUS_16230 34954 33701 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035930.1 protein_id gnl|my_center|LOCUS_16230 35109 36770 gene locus_tag LOCUS_16240 gene ettA 35109 36770 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035928.1 protein_id gnl|my_center|LOCUS_16240 36866 37696 gene locus_tag LOCUS_16250 gene pyrF 36866 37696 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 protein_id gnl|my_center|LOCUS_16250 38660 37680 gene locus_tag LOCUS_16260 38660 37680 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459545.1 protein_id gnl|my_center|LOCUS_16260 39573 38686 gene locus_tag LOCUS_16270 39573 38686 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035916.1 protein_id gnl|my_center|LOCUS_16270 40418 39570 gene locus_tag LOCUS_16280 40418 39570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 41278 40415 gene locus_tag LOCUS_16290 41278 40415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035911.1 protein_id gnl|my_center|LOCUS_16290 42453 41275 gene locus_tag LOCUS_16300 42453 41275 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_16300 43226 42450 gene locus_tag LOCUS_16310 43226 42450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 45375 43234 gene locus_tag LOCUS_16320 gene gspD 45375 43234 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035910.1 protein_id gnl|my_center|LOCUS_16320 46067 45372 gene locus_tag LOCUS_16330 46067 45372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 46680 46060 gene locus_tag LOCUS_16340 gene gspM 46680 46060 CDS product type II secretion system protein GspM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076056636.1 protein_id gnl|my_center|LOCUS_16340 47800 46667 gene locus_tag LOCUS_16350 47800 46667 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035907.1 protein_id gnl|my_center|LOCUS_16350 48681 47800 gene locus_tag LOCUS_16360 48681 47800 CDS product type II secretion system protein GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035906.1 protein_id gnl|my_center|LOCUS_16360 49346 48678 gene locus_tag LOCUS_16370 49346 48678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 49783 49343 gene locus_tag LOCUS_16380 49783 49343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 50265 49780 gene locus_tag LOCUS_16390 50265 49780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 50706 50290 gene locus_tag LOCUS_16400 gene gspG 50706 50290 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035902.1 protein_id gnl|my_center|LOCUS_16400 51929 50706 gene locus_tag LOCUS_16410 51929 50706 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035901.1 protein_id gnl|my_center|LOCUS_16410 53685 51934 gene locus_tag LOCUS_16420 gene gspE 53685 51934 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070691812.1 protein_id gnl|my_center|LOCUS_16420 58113 54262 gene locus_tag LOCUS_16430 gene purL 58113 54262 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035897.1 protein_id gnl|my_center|LOCUS_16430 58874 58110 gene locus_tag LOCUS_16440 58874 58110 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035896.1 protein_id gnl|my_center|LOCUS_16440 59920 58958 gene locus_tag LOCUS_16450 gene xerD 59920 58958 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035895.1 protein_id gnl|my_center|LOCUS_16450 59956 60480 gene locus_tag LOCUS_16460 59956 60480 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035894.1 protein_id gnl|my_center|LOCUS_16460 61555 60455 gene locus_tag LOCUS_16470 gene lptG 61555 60455 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035892.1 protein_id gnl|my_center|LOCUS_16470 62643 61552 gene locus_tag LOCUS_16480 gene lptF 62643 61552 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035891.1 protein_id gnl|my_center|LOCUS_16480 62764 64236 gene locus_tag LOCUS_16490 62764 64236 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035890.1 protein_id gnl|my_center|LOCUS_16490 64274 64702 gene locus_tag LOCUS_16500 64274 64702 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005995970.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence15 697 1983 gene locus_tag LOCUS_16510 697 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 2140 2598 gene locus_tag LOCUS_16520 2140 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 2656 3780 gene locus_tag LOCUS_16530 2656 3780 CDS product trans-acting enoyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093996.1 protein_id gnl|my_center|LOCUS_16530 3800 5947 gene locus_tag LOCUS_16540 3800 5947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 6015 8789 gene locus_tag LOCUS_16550 gene polA 6015 8789 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039091.1 protein_id gnl|my_center|LOCUS_16550 9112 9357 gene locus_tag LOCUS_16560 9112 9357 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528289.1 protein_id gnl|my_center|LOCUS_16560 9354 9740 gene locus_tag LOCUS_16570 9354 9740 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969348.1 protein_id gnl|my_center|LOCUS_16570 9871 11193 gene locus_tag LOCUS_16580 9871 11193 CDS product FAD/NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975948.1 protein_id gnl|my_center|LOCUS_16580 11271 11480 gene locus_tag LOCUS_16590 11271 11480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 12704 11769 gene locus_tag LOCUS_16600 gene hemF 12704 11769 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039090.1 protein_id gnl|my_center|LOCUS_16600 12833 13753 gene locus_tag LOCUS_16610 12833 13753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 14818 13754 gene locus_tag LOCUS_16620 14818 13754 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_16620 17298 14887 gene locus_tag LOCUS_16630 17298 14887 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994129.1 protein_id gnl|my_center|LOCUS_16630 17434 20670 gene locus_tag LOCUS_16640 17434 20670 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039067.1 protein_id gnl|my_center|LOCUS_16640 22590 20674 gene locus_tag LOCUS_16650 gene rho 22590 20674 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275460.1 protein_id gnl|my_center|LOCUS_16650 23103 22777 gene locus_tag LOCUS_16660 gene trxA 23103 22777 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038858.1 protein_id gnl|my_center|LOCUS_16660 23289 24974 gene locus_tag LOCUS_16670 gene rhlB 23289 24974 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038857.1 protein_id gnl|my_center|LOCUS_16670 24977 25663 gene locus_tag LOCUS_16680 gene ftsE 24977 25663 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003484499.1 protein_id gnl|my_center|LOCUS_16680 25660 26622 gene locus_tag LOCUS_16690 gene ftsX 25660 26622 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038856.1 protein_id gnl|my_center|LOCUS_16690 26619 27464 gene locus_tag LOCUS_16700 26619 27464 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506371.1 protein_id gnl|my_center|LOCUS_16700 27451 28191 gene locus_tag LOCUS_16710 gene ung 27451 28191 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038854.1 protein_id gnl|my_center|LOCUS_16710 29235 30095 gene locus_tag LOCUS_16720 gene rpoH 29235 30095 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038853.1 protein_id gnl|my_center|LOCUS_16720 30098 30664 gene locus_tag LOCUS_16730 30098 30664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 32654 30678 gene locus_tag LOCUS_16740 32654 30678 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038847.1 protein_id gnl|my_center|LOCUS_16740 33066 34643 gene locus_tag LOCUS_16750 33066 34643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 34640 36058 gene locus_tag LOCUS_16760 34640 36058 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038844.1 protein_id gnl|my_center|LOCUS_16760 36091 37959 gene locus_tag LOCUS_16770 gene sppA 36091 37959 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038843.1 protein_id gnl|my_center|LOCUS_16770 37976 38782 gene locus_tag LOCUS_16780 37976 38782 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038842.1 protein_id gnl|my_center|LOCUS_16780 40558 38795 gene locus_tag LOCUS_16790 40558 38795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 43181 40605 gene locus_tag LOCUS_16800 43181 40605 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038837.1 protein_id gnl|my_center|LOCUS_16800 43774 43298 gene locus_tag LOCUS_16810 43774 43298 CDS product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038834.1 protein_id gnl|my_center|LOCUS_16810 44961 43774 gene locus_tag LOCUS_16820 44961 43774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 46122 45022 gene locus_tag LOCUS_16830 46122 45022 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038832.1 protein_id gnl|my_center|LOCUS_16830 46312 46818 gene locus_tag LOCUS_16840 gene def 46312 46818 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038831.1 protein_id gnl|my_center|LOCUS_16840 46818 47765 gene locus_tag LOCUS_16850 gene fmt 46818 47765 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038830.1 protein_id gnl|my_center|LOCUS_16850 47762 49183 gene locus_tag LOCUS_16860 gene rsmB 47762 49183 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275458.1 protein_id gnl|my_center|LOCUS_16860 50436 49117 gene locus_tag LOCUS_16870 50436 49117 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440230.1 protein_id gnl|my_center|LOCUS_16870 51095 50433 gene locus_tag LOCUS_16880 51095 50433 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390935.1 protein_id gnl|my_center|LOCUS_16880 51407 51096 gene locus_tag LOCUS_16890 51407 51096 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265694.1 protein_id gnl|my_center|LOCUS_16890 52204 51422 gene locus_tag LOCUS_16900 52204 51422 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703807.1 protein_id gnl|my_center|LOCUS_16900 52349 53764 gene locus_tag LOCUS_16910 gene trkA 52349 53764 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_16910 53766 55232 gene locus_tag LOCUS_16920 53766 55232 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070440.1 protein_id gnl|my_center|LOCUS_16920 56757 55207 gene locus_tag LOCUS_16930 56757 55207 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038824.1 protein_id gnl|my_center|LOCUS_16930 57286 56741 gene locus_tag LOCUS_16940 57286 56741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 58179 57289 gene locus_tag LOCUS_16950 58179 57289 CDS product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038820.1 protein_id gnl|my_center|LOCUS_16950 58246 58683 gene locus_tag LOCUS_16960 gene dtd 58246 58683 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038819.1 protein_id gnl|my_center|LOCUS_16960 58799 60643 gene locus_tag LOCUS_16970 gene rpoD 58799 60643 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038818.1 protein_id gnl|my_center|LOCUS_16970 60689 60761 gene locus_tag LOCUS_t00430 60689 60761 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 61593 60778 gene locus_tag LOCUS_16980 gene mutM 61593 60778 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039216.1 protein_id gnl|my_center|LOCUS_16980 63920 61737 gene locus_tag LOCUS_16990 gene katG 63920 61737 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391529.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence16 718 1206 gene locus_tag LOCUS_17000 718 1206 CDS product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506828.1 protein_id gnl|my_center|LOCUS_17000 2377 1232 gene locus_tag LOCUS_17010 gene prpC 2377 1232 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187967.1 protein_id gnl|my_center|LOCUS_17010 2465 3259 gene locus_tag LOCUS_17020 2465 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 4156 3269 gene locus_tag LOCUS_17030 gene prpB 4156 3269 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036231.1 protein_id gnl|my_center|LOCUS_17030 5156 4173 gene locus_tag LOCUS_17040 5156 4173 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119517.1 protein_id gnl|my_center|LOCUS_17040 6408 5230 gene locus_tag LOCUS_17050 6408 5230 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383982.1 protein_id gnl|my_center|LOCUS_17050 7019 6513 gene locus_tag LOCUS_17060 7019 6513 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036141.1 protein_id gnl|my_center|LOCUS_17060 7190 9016 gene locus_tag LOCUS_17070 gene typA 7190 9016 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036140.1 protein_id gnl|my_center|LOCUS_17070 9273 10775 gene locus_tag LOCUS_17080 9273 10775 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076056374.1 protein_id gnl|my_center|LOCUS_17080 11219 10818 gene locus_tag LOCUS_17090 11219 10818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 11250 12752 gene locus_tag LOCUS_17100 11250 12752 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_17100 12763 13605 gene locus_tag LOCUS_17110 12763 13605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142083.1 protein_id gnl|my_center|LOCUS_17110 13628 14005 gene locus_tag LOCUS_17120 13628 14005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 15425 14031 gene locus_tag LOCUS_17130 15425 14031 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040942381.1 protein_id gnl|my_center|LOCUS_17130 15958 15434 gene locus_tag LOCUS_17140 15958 15434 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036135.1 protein_id gnl|my_center|LOCUS_17140 16848 16024 gene locus_tag LOCUS_17150 16848 16024 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040207.1 protein_id gnl|my_center|LOCUS_17150 16901 17440 gene locus_tag LOCUS_17160 16901 17440 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037966.1 protein_id gnl|my_center|LOCUS_17160 17440 18516 gene locus_tag LOCUS_17170 gene aroB 17440 18516 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037967.1 protein_id gnl|my_center|LOCUS_17170 18513 19511 gene locus_tag LOCUS_17180 18513 19511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 19712 21136 gene locus_tag LOCUS_17190 gene ahcY 19712 21136 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035988.1 protein_id gnl|my_center|LOCUS_17190 21156 21977 gene locus_tag LOCUS_17200 gene metF 21156 21977 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035975.1 protein_id gnl|my_center|LOCUS_17200 22028 22945 gene locus_tag LOCUS_17210 22028 22945 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707859.1 protein_id gnl|my_center|LOCUS_17210 24276 22984 gene locus_tag LOCUS_17220 24276 22984 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437598.1 protein_id gnl|my_center|LOCUS_17220 25006 24287 gene locus_tag LOCUS_17230 25006 24287 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003490678.1 protein_id gnl|my_center|LOCUS_17230 26139 25201 gene locus_tag LOCUS_17240 gene rimK 26139 25201 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038222.1 protein_id gnl|my_center|LOCUS_17240 26572 26108 gene locus_tag LOCUS_17250 26572 26108 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261389.1 protein_id gnl|my_center|LOCUS_17250 26980 28041 gene locus_tag LOCUS_17260 26980 28041 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 protein_id gnl|my_center|LOCUS_17260 28134 30983 gene locus_tag LOCUS_17270 28134 30983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 32122 31163 gene locus_tag LOCUS_17280 32122 31163 CDS product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014387.1 protein_id gnl|my_center|LOCUS_17280 32459 32386 gene locus_tag LOCUS_t00440 32459 32386 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 32510 32710 gene locus_tag LOCUS_17290 gene thiS 32510 32710 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_17290 32728 33522 gene locus_tag LOCUS_17300 32728 33522 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038257.1 protein_id gnl|my_center|LOCUS_17300 33551 34306 gene locus_tag LOCUS_17310 gene trmB 33551 34306 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038258.1 protein_id gnl|my_center|LOCUS_17310 34320 36179 gene locus_tag LOCUS_17320 34320 36179 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038259.1 protein_id gnl|my_center|LOCUS_17320 36558 36196 gene locus_tag LOCUS_17330 36558 36196 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038260.1 protein_id gnl|my_center|LOCUS_17330 36590 36859 gene locus_tag LOCUS_17340 36590 36859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 36856 37548 gene locus_tag LOCUS_17350 36856 37548 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038262.1 protein_id gnl|my_center|LOCUS_17350 38826 37558 gene locus_tag LOCUS_17360 38826 37558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 39641 38871 gene locus_tag LOCUS_17370 39641 38871 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038272.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17370 42802 39638 gene locus_tag LOCUS_17380 42802 39638 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038276.1 protein_id gnl|my_center|LOCUS_17380 43885 42815 gene locus_tag LOCUS_17390 43885 42815 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038277.1 protein_id gnl|my_center|LOCUS_17390 45080 44076 gene locus_tag LOCUS_17400 45080 44076 CDS product fructose-bisphosphate aldolase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038292.1 protein_id gnl|my_center|LOCUS_17400 46739 45756 gene locus_tag LOCUS_17410 gene rhuM 46739 45756 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_17410 48288 46822 gene locus_tag LOCUS_17420 gene pyk 48288 46822 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508780.1 protein_id gnl|my_center|LOCUS_17420 48349 48885 gene locus_tag LOCUS_17430 48349 48885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 50110 48899 gene locus_tag LOCUS_17440 50110 48899 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038295.1 protein_id gnl|my_center|LOCUS_17440 50146 51126 gene locus_tag LOCUS_17450 50146 51126 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188980.1 protein_id gnl|my_center|LOCUS_17450 51440 51219 gene locus_tag LOCUS_17460 51440 51219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 53467 52376 gene locus_tag LOCUS_17470 gene ddlA 53467 52376 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095807.1 protein_id gnl|my_center|LOCUS_17470 >Feature sequence17 229 1947 gene locus_tag LOCUS_17480 229 1947 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035881.1 protein_id gnl|my_center|LOCUS_17480 2074 2436 gene locus_tag LOCUS_17490 2074 2436 CDS product H-NS family nucleoid-associated regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035880.1 protein_id gnl|my_center|LOCUS_17490 3659 2463 gene locus_tag LOCUS_17500 3659 2463 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035879.1 protein_id gnl|my_center|LOCUS_17500 3541 3834 gene locus_tag LOCUS_17510 3541 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 3831 4940 gene locus_tag LOCUS_17520 3831 4940 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035878.1 protein_id gnl|my_center|LOCUS_17520 4937 5707 gene locus_tag LOCUS_17530 4937 5707 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035877.1 protein_id gnl|my_center|LOCUS_17530 5709 6665 gene locus_tag LOCUS_17540 5709 6665 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035876.1 protein_id gnl|my_center|LOCUS_17540 6662 7312 gene locus_tag LOCUS_17550 6662 7312 CDS product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109195.1 protein_id gnl|my_center|LOCUS_17550 7862 7212 gene locus_tag LOCUS_17560 7862 7212 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275445.1 protein_id gnl|my_center|LOCUS_17560 7998 9599 gene locus_tag LOCUS_17570 7998 9599 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035873.1 protein_id gnl|my_center|LOCUS_17570 9650 10708 gene locus_tag LOCUS_17580 gene rfbB 9650 10708 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035864.1 protein_id gnl|my_center|LOCUS_17580 10719 11606 gene locus_tag LOCUS_17590 gene rfbA 10719 11606 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439277.1 protein_id gnl|my_center|LOCUS_17590 11616 12173 gene locus_tag LOCUS_17600 gene rfbC 11616 12173 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035866.1 protein_id gnl|my_center|LOCUS_17600 12170 13120 gene locus_tag LOCUS_17610 gene rfbD 12170 13120 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035867.1 protein_id gnl|my_center|LOCUS_17610 14061 13129 gene locus_tag LOCUS_17620 14061 13129 CDS product WxcM-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035858.1 protein_id gnl|my_center|LOCUS_17620 15165 14065 gene locus_tag LOCUS_17630 15165 14065 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035860.1 protein_id gnl|my_center|LOCUS_17630 15250 16161 gene locus_tag LOCUS_17640 15250 16161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224688.1 protein_id gnl|my_center|LOCUS_17640 16193 16768 gene locus_tag LOCUS_17650 16193 16768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035849.1 protein_id gnl|my_center|LOCUS_17650 16785 18134 gene locus_tag LOCUS_17660 16785 18134 CDS product phosphohexose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506571.1 protein_id gnl|my_center|LOCUS_17660 18172 19146 gene locus_tag LOCUS_17670 18172 19146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 19233 20636 gene locus_tag LOCUS_17680 19233 20636 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035868.1 protein_id gnl|my_center|LOCUS_17680 20623 21156 gene locus_tag LOCUS_17690 20623 21156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 21153 21833 gene locus_tag LOCUS_17700 21153 21833 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525084.1 protein_id gnl|my_center|LOCUS_17700 21830 22216 gene locus_tag LOCUS_17710 21830 22216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 23449 22229 gene locus_tag LOCUS_17720 23449 22229 CDS product UDP-N-acetylglucosamine 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261000.1 protein_id gnl|my_center|LOCUS_17720 24437 23454 gene locus_tag LOCUS_17730 24437 23454 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703658.1 protein_id gnl|my_center|LOCUS_17730 25009 24434 gene locus_tag LOCUS_17740 25009 24434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 25070 25360 gene locus_tag LOCUS_17750 25070 25360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 26013 25303 gene locus_tag LOCUS_17760 26013 25303 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480005.1 protein_id gnl|my_center|LOCUS_17760 28571 26043 gene locus_tag LOCUS_17770 28571 26043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 31838 29343 gene locus_tag LOCUS_17780 31838 29343 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004419149.1 protein_id gnl|my_center|LOCUS_17780 32841 31870 gene locus_tag LOCUS_17790 gene gmd 32841 31870 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096890.1 protein_id gnl|my_center|LOCUS_17790 33747 32842 gene locus_tag LOCUS_17800 gene rmd 33747 32842 CDS product GDP-6-deoxy-D-mannose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114107.1 protein_id gnl|my_center|LOCUS_17800 35546 33744 gene locus_tag LOCUS_17810 35546 33744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 37026 35626 gene locus_tag LOCUS_17820 37026 35626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 38287 37040 gene locus_tag LOCUS_17830 38287 37040 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004419151.1 protein_id gnl|my_center|LOCUS_17830 39084 38284 gene locus_tag LOCUS_17840 39084 38284 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004419153.1 protein_id gnl|my_center|LOCUS_17840 39674 39237 gene locus_tag LOCUS_17850 39674 39237 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529815.1 protein_id gnl|my_center|LOCUS_17850 40104 39685 gene locus_tag LOCUS_17860 40104 39685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 40103 40849 gene locus_tag LOCUS_17870 40103 40849 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035863.1 protein_id gnl|my_center|LOCUS_17870 40882 41823 gene locus_tag LOCUS_17880 40882 41823 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035862.1 protein_id gnl|my_center|LOCUS_17880 42528 41899 gene locus_tag LOCUS_17890 42528 41899 CDS product succinyl-CoA--3-ketoacid CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035871.1 protein_id gnl|my_center|LOCUS_17890 43246 42530 gene locus_tag LOCUS_17900 43246 42530 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035870.1 protein_id gnl|my_center|LOCUS_17900 44503 43346 gene locus_tag LOCUS_17910 44503 43346 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 protein_id gnl|my_center|LOCUS_17910 45914 44538 gene locus_tag LOCUS_17920 45914 44538 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035841.1 protein_id gnl|my_center|LOCUS_17920 46242 46024 gene locus_tag LOCUS_17930 46242 46024 CDS product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019237985.1 protein_id gnl|my_center|LOCUS_17930 47369 46419 gene locus_tag LOCUS_17940 47369 46419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 47739 47371 gene locus_tag LOCUS_17950 47739 47371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 47825 48940 gene locus_tag LOCUS_17960 47825 48940 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439300.1 protein_id gnl|my_center|LOCUS_17960 >Feature sequence18 1875 274 gene locus_tag LOCUS_17970 1875 274 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103418.1 protein_id gnl|my_center|LOCUS_17970 2174 1953 gene locus_tag LOCUS_17980 2174 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 2308 2541 gene locus_tag LOCUS_17990 2308 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 2534 3865 gene locus_tag LOCUS_18000 2534 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 3884 4699 gene locus_tag LOCUS_18010 3884 4699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 7930 4883 gene locus_tag LOCUS_18020 7930 4883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 10317 7930 gene locus_tag LOCUS_18030 10317 7930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 10841 10314 gene locus_tag LOCUS_18040 10841 10314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 11902 11357 gene locus_tag LOCUS_18050 11902 11357 CDS product cyclin-dependent kinase inhibitor 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888792.1 protein_id gnl|my_center|LOCUS_18050 13134 11899 gene locus_tag LOCUS_18060 13134 11899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 13133 13456 gene locus_tag LOCUS_18070 13133 13456 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165196.1 protein_id gnl|my_center|LOCUS_18070 13453 14346 gene locus_tag LOCUS_18080 13453 14346 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302783.1 protein_id gnl|my_center|LOCUS_18080 14556 14383 gene locus_tag LOCUS_18090 14556 14383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 14650 15297 gene locus_tag LOCUS_18100 14650 15297 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065267398.1 protein_id gnl|my_center|LOCUS_18100 16089 15589 gene locus_tag LOCUS_18110 16089 15589 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356400.1 protein_id gnl|my_center|LOCUS_18110 17876 16098 gene locus_tag LOCUS_18120 17876 16098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 19052 17880 gene locus_tag LOCUS_18130 19052 17880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 20194 19049 gene locus_tag LOCUS_18140 20194 19049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 22953 20194 gene locus_tag LOCUS_18150 22953 20194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 23978 23493 gene locus_tag LOCUS_18160 23978 23493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 24473 24027 gene locus_tag LOCUS_18170 24473 24027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 26024 24693 gene locus_tag LOCUS_18180 26024 24693 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038087.1 protein_id gnl|my_center|LOCUS_18180 26494 26027 gene locus_tag LOCUS_18190 gene umuD 26494 26027 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219995814.1 protein_id gnl|my_center|LOCUS_18190 27002 26826 gene locus_tag LOCUS_18200 27002 26826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 27291 27614 gene locus_tag LOCUS_18210 27291 27614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 27614 28798 gene locus_tag LOCUS_18220 27614 28798 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763811.1 protein_id gnl|my_center|LOCUS_18220 29131 29457 gene locus_tag LOCUS_18230 29131 29457 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703181.1 protein_id gnl|my_center|LOCUS_18230 29444 29752 gene locus_tag LOCUS_18240 29444 29752 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010201208.1 protein_id gnl|my_center|LOCUS_18240 >Feature sequence19 401 228 gene locus_tag LOCUS_18250 401 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 370 846 gene locus_tag LOCUS_18260 370 846 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161962652.1 protein_id gnl|my_center|LOCUS_18260 1915 854 gene locus_tag LOCUS_18270 gene truD 1915 854 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036881.1 protein_id gnl|my_center|LOCUS_18270 2441 1941 gene locus_tag LOCUS_18280 gene ispF 2441 1941 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036880.1 protein_id gnl|my_center|LOCUS_18280 3150 2452 gene locus_tag LOCUS_18290 gene ispD 3150 2452 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036879.1 protein_id gnl|my_center|LOCUS_18290 3487 3161 gene locus_tag LOCUS_18300 3487 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 4790 3501 gene locus_tag LOCUS_18310 gene eno 4790 3501 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036877.1 protein_id gnl|my_center|LOCUS_18310 5673 4840 gene locus_tag LOCUS_18320 gene kdsA 5673 4840 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036875.1 protein_id gnl|my_center|LOCUS_18320 7340 5673 gene locus_tag LOCUS_18330 7340 5673 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036874.1 protein_id gnl|my_center|LOCUS_18330 7494 9395 gene locus_tag LOCUS_18340 gene parE 7494 9395 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055568.1 protein_id gnl|my_center|LOCUS_18340 10446 9640 gene locus_tag LOCUS_18350 gene hutG 10446 9640 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524693.1 protein_id gnl|my_center|LOCUS_18350 11696 10443 gene locus_tag LOCUS_18360 11696 10443 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037710.1 protein_id gnl|my_center|LOCUS_18360 13005 11749 gene locus_tag LOCUS_18370 13005 11749 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037711.1 protein_id gnl|my_center|LOCUS_18370 13481 13002 gene locus_tag LOCUS_18380 13481 13002 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037712.1 protein_id gnl|my_center|LOCUS_18380 13649 14146 gene locus_tag LOCUS_18390 13649 14146 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369637.1 protein_id gnl|my_center|LOCUS_18390 14548 14156 gene locus_tag LOCUS_18400 14548 14156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 14601 15494 gene locus_tag LOCUS_18410 14601 15494 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095811.1 protein_id gnl|my_center|LOCUS_18410 15719 17062 gene locus_tag LOCUS_18420 15719 17062 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035834.1 protein_id gnl|my_center|LOCUS_18420 17211 17618 gene locus_tag LOCUS_18430 17211 17618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 17635 18663 gene locus_tag LOCUS_18440 17635 18663 CDS product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 protein_id gnl|my_center|LOCUS_18440 18701 19576 gene locus_tag LOCUS_18450 18701 19576 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114604.1 protein_id gnl|my_center|LOCUS_18450 19924 21258 gene locus_tag LOCUS_18460 19924 21258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 21255 22814 gene locus_tag LOCUS_18470 21255 22814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 22805 25072 gene locus_tag LOCUS_18480 22805 25072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 25074 26054 gene locus_tag LOCUS_18490 25074 26054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 27001 26051 gene locus_tag LOCUS_18500 27001 26051 CDS product IS1595-like element ISXca4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037261.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence20 1054 290 gene locus_tag LOCUS_18510 1054 290 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039010.1 protein_id gnl|my_center|LOCUS_18510 1811 1041 gene locus_tag LOCUS_18520 gene birA 1811 1041 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039011.1 protein_id gnl|my_center|LOCUS_18520 2277 1909 gene locus_tag LOCUS_18530 2277 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 2290 3078 gene locus_tag LOCUS_18540 2290 3078 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039012.1 protein_id gnl|my_center|LOCUS_18540 4497 3103 gene locus_tag LOCUS_18550 4497 3103 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170873898.1 protein_id gnl|my_center|LOCUS_18550 5181 4501 gene locus_tag LOCUS_18560 5181 4501 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 protein_id gnl|my_center|LOCUS_18560 5634 5215 gene locus_tag LOCUS_18570 5634 5215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 6704 5712 gene locus_tag LOCUS_18580 gene dusA 6704 5712 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039017.1 protein_id gnl|my_center|LOCUS_18580 6809 8254 gene locus_tag LOCUS_18590 6809 8254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 8423 9760 gene locus_tag LOCUS_18600 8423 9760 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035947.1 protein_id gnl|my_center|LOCUS_18600 10198 9812 gene locus_tag LOCUS_18610 gene rplQ 10198 9812 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036134.1 protein_id gnl|my_center|LOCUS_18610 11225 10227 gene locus_tag LOCUS_18620 gene rpoA 11225 10227 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002811635.1 protein_id gnl|my_center|LOCUS_18620 11875 11246 gene locus_tag LOCUS_18630 gene rpsD 11875 11246 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002811641.1 protein_id gnl|my_center|LOCUS_18630 12289 11894 gene locus_tag LOCUS_18640 gene rpsK 12289 11894 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486671.1 protein_id gnl|my_center|LOCUS_18640 12658 12302 gene locus_tag LOCUS_18650 gene rpsM 12658 12302 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036133.1 protein_id gnl|my_center|LOCUS_18650 14239 12869 gene locus_tag LOCUS_18660 gene secY 14239 12869 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036132.1 protein_id gnl|my_center|LOCUS_18660 14699 14265 gene locus_tag LOCUS_18670 gene rplO 14699 14265 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439114.1 protein_id gnl|my_center|LOCUS_18670 14898 14710 gene locus_tag LOCUS_18680 gene rpmD 14898 14710 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006450646.1 protein_id gnl|my_center|LOCUS_18680 15418 14885 gene locus_tag LOCUS_18690 gene rpsE 15418 14885 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486682.1 protein_id gnl|my_center|LOCUS_18690 15851 15513 gene locus_tag LOCUS_18700 gene rplR 15851 15513 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005993383.1 protein_id gnl|my_center|LOCUS_18700 16409 15882 gene locus_tag LOCUS_18710 gene rplF 16409 15882 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036130.1 protein_id gnl|my_center|LOCUS_18710 16821 16426 gene locus_tag LOCUS_18720 gene rpsH 16821 16426 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010371096.1 protein_id gnl|my_center|LOCUS_18720 17244 16939 gene locus_tag LOCUS_18730 gene rpsN 17244 16939 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005917137.1 protein_id gnl|my_center|LOCUS_18730 17803 17261 gene locus_tag LOCUS_18740 gene rplE 17803 17261 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010371090.1 protein_id gnl|my_center|LOCUS_18740 18129 17815 gene locus_tag LOCUS_18750 gene rplX 18129 17815 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008571669.1 protein_id gnl|my_center|LOCUS_18750 18513 18145 gene locus_tag LOCUS_18760 gene rplN 18513 18145 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486699.1 protein_id gnl|my_center|LOCUS_18760 18791 18528 gene locus_tag LOCUS_18770 gene rpsQ 18791 18528 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036129.1 protein_id gnl|my_center|LOCUS_18770 18986 18801 gene locus_tag LOCUS_18780 gene rpmC 18986 18801 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036128.1 protein_id gnl|my_center|LOCUS_18780 19399 18986 gene locus_tag LOCUS_18790 gene rplP 19399 18986 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036127.1 protein_id gnl|my_center|LOCUS_18790 20106 19411 gene locus_tag LOCUS_18800 gene rpsC 20106 19411 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036126.1 protein_id gnl|my_center|LOCUS_18800 20465 20118 gene locus_tag LOCUS_18810 gene rplV 20465 20118 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486710.1 protein_id gnl|my_center|LOCUS_18810 20745 20470 gene locus_tag LOCUS_18820 gene rpsS 20745 20470 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005993369.1 protein_id gnl|my_center|LOCUS_18820 21579 20752 gene locus_tag LOCUS_18830 gene rplB 21579 20752 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036125.1 protein_id gnl|my_center|LOCUS_18830 21884 21591 gene locus_tag LOCUS_18840 gene rplW 21884 21591 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002811694.1 protein_id gnl|my_center|LOCUS_18840 22483 21881 gene locus_tag LOCUS_18850 gene rplD 22483 21881 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036124.1 protein_id gnl|my_center|LOCUS_18850 23138 22494 gene locus_tag LOCUS_18860 gene rplC 23138 22494 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036123.1 protein_id gnl|my_center|LOCUS_18860 23461 23150 gene locus_tag LOCUS_18870 gene rpsJ 23461 23150 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036122.1 protein_id gnl|my_center|LOCUS_18870 >Feature sequence21 1312 644 gene locus_tag LOCUS_18880 gene maiA 1312 644 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192028266.1 protein_id gnl|my_center|LOCUS_18880 2454 1396 gene locus_tag LOCUS_18890 2454 1396 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035835.1 protein_id gnl|my_center|LOCUS_18890 3750 2455 gene locus_tag LOCUS_18900 gene hmgA 3750 2455 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039046.1 protein_id gnl|my_center|LOCUS_18900 4864 3761 gene locus_tag LOCUS_18910 gene hppD 4864 3761 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070689502.1 protein_id gnl|my_center|LOCUS_18910 4989 5429 gene locus_tag LOCUS_18920 4989 5429 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035688.1 protein_id gnl|my_center|LOCUS_18920 6985 5465 gene locus_tag LOCUS_18930 6985 5465 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070558.1 protein_id gnl|my_center|LOCUS_18930 8007 7141 gene locus_tag LOCUS_18940 8007 7141 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035685.1 protein_id gnl|my_center|LOCUS_18940 8118 9194 gene locus_tag LOCUS_18950 gene pdhA 8118 9194 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035683.1 protein_id gnl|my_center|LOCUS_18950 9191 10198 gene locus_tag LOCUS_18960 9191 10198 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006448747.1 protein_id gnl|my_center|LOCUS_18960 10251 11573 gene locus_tag LOCUS_18970 10251 11573 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035680.1 protein_id gnl|my_center|LOCUS_18970 11918 11592 gene locus_tag LOCUS_18980 11918 11592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389484.1 protein_id gnl|my_center|LOCUS_18980 12905 11940 gene locus_tag LOCUS_18990 12905 11940 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275150.1 protein_id gnl|my_center|LOCUS_18990 14316 12958 gene locus_tag LOCUS_19000 14316 12958 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036016.1 protein_id gnl|my_center|LOCUS_19000 15026 14313 gene locus_tag LOCUS_19010 15026 14313 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506728.1 protein_id gnl|my_center|LOCUS_19010 16507 15155 gene locus_tag LOCUS_19020 16507 15155 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397667.1 protein_id gnl|my_center|LOCUS_19020 17403 16507 gene locus_tag LOCUS_19030 gene mazG 17403 16507 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038006.1 protein_id gnl|my_center|LOCUS_19030 18238 17396 gene locus_tag LOCUS_19040 gene cysQ 18238 17396 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038007.1 protein_id gnl|my_center|LOCUS_19040 18792 18235 gene locus_tag LOCUS_19050 gene nudE 18792 18235 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216848.1 protein_id gnl|my_center|LOCUS_19050 18874 20283 gene locus_tag LOCUS_19060 gene bioA 18874 20283 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038009.1 protein_id gnl|my_center|LOCUS_19060 20274 21011 gene locus_tag LOCUS_19070 20274 21011 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038010.1 protein_id gnl|my_center|LOCUS_19070 >Feature sequence22 1300 623 gene locus_tag LOCUS_19080 1300 623 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705973.1 protein_id gnl|my_center|LOCUS_19080 2673 1309 gene locus_tag LOCUS_19090 2673 1309 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038494.1 protein_id gnl|my_center|LOCUS_19090 3352 2750 gene locus_tag LOCUS_19100 gene yihA 3352 2750 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038495.1 protein_id gnl|my_center|LOCUS_19100 3524 4321 gene locus_tag LOCUS_19110 3524 4321 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437398.1 protein_id gnl|my_center|LOCUS_19110 4422 5120 gene locus_tag LOCUS_19120 4422 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19120 5125 5853 gene locus_tag LOCUS_19130 5125 5853 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038499.1 protein_id gnl|my_center|LOCUS_19130 7964 5907 gene locus_tag LOCUS_19140 7964 5907 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545619.1 protein_id gnl|my_center|LOCUS_19140 9338 8364 gene locus_tag LOCUS_19150 9338 8364 CDS product IS30-like element ISCfr4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204525119.1 protein_id gnl|my_center|LOCUS_19150 10786 10091 gene locus_tag LOCUS_19160 10786 10091 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141273.1 protein_id gnl|my_center|LOCUS_19160 11921 10815 gene locus_tag LOCUS_19170 11921 10815 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928727.1 protein_id gnl|my_center|LOCUS_19170 12502 12104 gene locus_tag LOCUS_19180 12502 12104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 13190 12585 gene locus_tag LOCUS_19190 13190 12585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 14524 13358 gene locus_tag LOCUS_19200 14524 13358 CDS product XyeB family radical SAM/SPASM peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162928747.1 protein_id gnl|my_center|LOCUS_19200 14774 14604 gene locus_tag LOCUS_19210 14774 14604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 16146 14992 gene locus_tag LOCUS_19220 16146 14992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 17038 16136 gene locus_tag LOCUS_19230 17038 16136 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038527.1 protein_id gnl|my_center|LOCUS_19230 >Feature sequence23 280 1290 gene locus_tag LOCUS_19240 280 1290 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_19240 1380 1634 gene locus_tag LOCUS_19250 1380 1634 CDS product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037968.1 protein_id gnl|my_center|LOCUS_19250 1631 2701 gene locus_tag LOCUS_19260 gene hemE 1631 2701 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037969.1 protein_id gnl|my_center|LOCUS_19260 2726 3268 gene locus_tag LOCUS_19270 2726 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 6780 3163 gene locus_tag LOCUS_19280 6780 3163 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994009.1 protein_id gnl|my_center|LOCUS_19280 6970 7527 gene locus_tag LOCUS_19290 6970 7527 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037975.1 protein_id gnl|my_center|LOCUS_19290 7574 8155 gene locus_tag LOCUS_19300 7574 8155 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037976.1 protein_id gnl|my_center|LOCUS_19300 8388 8140 gene locus_tag LOCUS_19310 8388 8140 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037977.1 protein_id gnl|my_center|LOCUS_19310 8434 9813 gene locus_tag LOCUS_19320 8434 9813 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037978.1 protein_id gnl|my_center|LOCUS_19320 9870 11171 gene locus_tag LOCUS_19330 9870 11171 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258395.1 protein_id gnl|my_center|LOCUS_19330 13493 11223 gene locus_tag LOCUS_19340 13493 11223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 13663 15885 gene locus_tag LOCUS_19350 13663 15885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 15897 16688 gene locus_tag LOCUS_19360 15897 16688 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037983.1 protein_id gnl|my_center|LOCUS_19360 16793 18394 gene locus_tag LOCUS_19370 16793 18394 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037984.1 protein_id gnl|my_center|LOCUS_19370 >Feature sequence24 421 251 gene locus_tag LOCUS_19380 421 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 751 518 gene locus_tag LOCUS_19390 751 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 874 1119 gene locus_tag LOCUS_19400 874 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 1326 1402 gene locus_tag LOCUS_t00450 1326 1402 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1543 2103 gene locus_tag LOCUS_19410 gene rimP 1543 2103 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037646.1 protein_id gnl|my_center|LOCUS_19410 2138 3625 gene locus_tag LOCUS_19420 gene nusA 2138 3625 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037645.1 protein_id gnl|my_center|LOCUS_19420 3697 6300 gene locus_tag LOCUS_19430 gene infB 3697 6300 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275326.1 protein_id gnl|my_center|LOCUS_19430 6304 6747 gene locus_tag LOCUS_19440 gene rbfA 6304 6747 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216910.1 protein_id gnl|my_center|LOCUS_19440 6785 7708 gene locus_tag LOCUS_19450 gene truB 6785 7708 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037642.1 protein_id gnl|my_center|LOCUS_19450 7865 8125 gene locus_tag LOCUS_19460 gene rpsO 7865 8125 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037641.1 protein_id gnl|my_center|LOCUS_19460 8266 10368 gene locus_tag LOCUS_19470 gene pnp 8266 10368 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037640.1 protein_id gnl|my_center|LOCUS_19470 11353 10457 gene locus_tag LOCUS_19480 gene folP 11353 10457 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275372.1 protein_id gnl|my_center|LOCUS_19480 13294 11384 gene locus_tag LOCUS_19490 gene ftsH 13294 11384 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040941435.1 protein_id gnl|my_center|LOCUS_19490 13923 13291 gene locus_tag LOCUS_19500 gene rlmE 13923 13291 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438562.1 protein_id gnl|my_center|LOCUS_19500 14014 14316 gene locus_tag LOCUS_19510 gene yhbY 14014 14316 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036888.1 protein_id gnl|my_center|LOCUS_19510 14326 14715 gene locus_tag LOCUS_19520 14326 14715 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036887.1 protein_id gnl|my_center|LOCUS_19520 15618 14725 gene locus_tag LOCUS_19530 15618 14725 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161963283.1 protein_id gnl|my_center|LOCUS_19530 16283 15612 gene locus_tag LOCUS_19540 16283 15612 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036884.1 protein_id gnl|my_center|LOCUS_19540 17059 16283 gene locus_tag LOCUS_19550 gene surE 17059 16283 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036883.1 protein_id gnl|my_center|LOCUS_19550 >Feature sequence25 2273 183 gene locus_tag LOCUS_19560 gene fusA 2273 183 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036120.1 protein_id gnl|my_center|LOCUS_19560 2758 2291 gene locus_tag LOCUS_19570 gene rpsG 2758 2291 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005993356.1 protein_id gnl|my_center|LOCUS_19570 3166 2792 gene locus_tag LOCUS_19580 gene rpsL 3166 2792 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003469157.1 protein_id gnl|my_center|LOCUS_19580 7549 3341 gene locus_tag LOCUS_19590 gene rpoC 7549 3341 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036119.1 protein_id gnl|my_center|LOCUS_19590 11760 7573 gene locus_tag LOCUS_19600 gene rpoB 11760 7573 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115576597.1 protein_id gnl|my_center|LOCUS_19600 12327 11953 gene locus_tag LOCUS_19610 gene rplL 12327 11953 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028973.1 protein_id gnl|my_center|LOCUS_19610 12874 12377 gene locus_tag LOCUS_19620 gene rplJ 12874 12377 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036116.1 protein_id gnl|my_center|LOCUS_19620 13907 13203 gene locus_tag LOCUS_19630 gene rplA 13907 13203 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036115.1 protein_id gnl|my_center|LOCUS_19630 14339 13911 gene locus_tag LOCUS_19640 gene rplK 14339 13911 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036114.1 protein_id gnl|my_center|LOCUS_19640 15107 14547 gene locus_tag LOCUS_19650 gene nusG 15107 14547 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036113.1 protein_id gnl|my_center|LOCUS_19650 15493 15104 gene locus_tag LOCUS_19660 gene secE 15493 15104 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006450619.1 protein_id gnl|my_center|LOCUS_19660 15612 15537 gene locus_tag LOCUS_t00460 15612 15537 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence26 149 703 gene locus_tag LOCUS_19670 149 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 2406 769 gene locus_tag LOCUS_19680 2406 769 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459240.1 protein_id gnl|my_center|LOCUS_19680 4479 2653 gene locus_tag LOCUS_19690 gene glmS 4479 2653 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035815.1 protein_id gnl|my_center|LOCUS_19690 4437 4339 gene locus_tag LOCUS_t00470 4437 4339 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5943 4528 gene locus_tag LOCUS_19700 gene glmU 5943 4528 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035805.1 protein_id gnl|my_center|LOCUS_19700 6509 6069 gene locus_tag LOCUS_19710 6509 6069 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035802.1 protein_id gnl|my_center|LOCUS_19710 7921 6515 gene locus_tag LOCUS_19720 gene atpD 7921 6515 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035801.1 protein_id gnl|my_center|LOCUS_19720 8830 7967 gene locus_tag LOCUS_19730 gene atpG 8830 7967 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035800.1 protein_id gnl|my_center|LOCUS_19730 10391 8847 gene locus_tag LOCUS_19740 gene atpA 10391 8847 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035799.1 protein_id gnl|my_center|LOCUS_19740 10964 10434 gene locus_tag LOCUS_19750 10964 10434 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035798.1 protein_id gnl|my_center|LOCUS_19750 11447 10977 gene locus_tag LOCUS_19760 11447 10977 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035797.1 protein_id gnl|my_center|LOCUS_19760 11850 11542 gene locus_tag LOCUS_19770 gene atpE 11850 11542 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002814105.1 protein_id gnl|my_center|LOCUS_19770 12789 11953 gene locus_tag LOCUS_19780 gene atpB 12789 11953 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035796.1 protein_id gnl|my_center|LOCUS_19780 13115 12798 gene locus_tag LOCUS_19790 13115 12798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 >Feature sequence27 490 1440 gene locus_tag LOCUS_19800 490 1440 CDS product IS1595-like element ISXca4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037261.1 protein_id gnl|my_center|LOCUS_19800 1480 1857 gene locus_tag LOCUS_19810 1480 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 1854 3155 gene locus_tag LOCUS_19820 1854 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 3152 3901 gene locus_tag LOCUS_19830 3152 3901 CDS product abortive infection family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932365.1 protein_id gnl|my_center|LOCUS_19830 3898 6189 gene locus_tag LOCUS_19840 3898 6189 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932366.1 protein_id gnl|my_center|LOCUS_19840 6189 9332 gene locus_tag LOCUS_19850 6189 9332 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_19850 9353 10255 gene locus_tag LOCUS_19860 9353 10255 CDS product CBASS cGAMP-activated phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062610134.1 protein_id gnl|my_center|LOCUS_19860 10252 11589 gene locus_tag LOCUS_19870 10252 11589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 >Feature sequence28 406 867 gene locus_tag LOCUS_19880 406 867 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038368.1 protein_id gnl|my_center|LOCUS_19880 1065 883 gene locus_tag LOCUS_19890 1065 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 1129 1767 gene locus_tag LOCUS_19900 gene thiE 1129 1767 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038371.1 protein_id gnl|my_center|LOCUS_19900 1764 3059 gene locus_tag LOCUS_19910 gene hemL 1764 3059 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038374.1 protein_id gnl|my_center|LOCUS_19910 3056 3697 gene locus_tag LOCUS_19920 3056 3697 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000242.1 protein_id gnl|my_center|LOCUS_19920 3687 4841 gene locus_tag LOCUS_19930 3687 4841 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870223.1 protein_id gnl|my_center|LOCUS_19930 5411 4851 gene locus_tag LOCUS_19940 5411 4851 CDS product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114096.1 protein_id gnl|my_center|LOCUS_19940 6696 5431 gene locus_tag LOCUS_19950 6696 5431 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113046.1 protein_id gnl|my_center|LOCUS_19950 7388 6693 gene locus_tag LOCUS_19960 7388 6693 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093325.1 protein_id gnl|my_center|LOCUS_19960 7960 7385 gene locus_tag LOCUS_19970 7960 7385 CDS product DUF2796 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113048.1 protein_id gnl|my_center|LOCUS_19970 >Feature sequence29 1091 51 gene locus_tag LOCUS_19980 1091 51 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308002.1 protein_id gnl|my_center|LOCUS_19980 1820 1098 gene locus_tag LOCUS_19990 1820 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 4507 2957 gene locus_tag LOCUS_20000 4507 2957 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037428.1 protein_id gnl|my_center|LOCUS_20000 4645 5922 gene locus_tag LOCUS_20010 4645 5922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 6873 5929 gene locus_tag LOCUS_20020 6873 5929 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707863.1 protein_id gnl|my_center|LOCUS_20020 >Feature sequence30 <1 1471 gene locus_tag LOCUS_20030 <1 1471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039964.1:GGDEF domain-containing protein 1621 2616 gene locus_tag LOCUS_20040 1621 2616 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191725.1 protein_id gnl|my_center|LOCUS_20040 2665 3876 gene locus_tag LOCUS_20050 2665 3876 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088337.1 protein_id gnl|my_center|LOCUS_20050 <4761 3906 gene locus_tag LOCUS_20060 <4761 3906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114562.1:potassium/proton antiporter >Feature sequence31 91 714 gene locus_tag LOCUS_20070 91 714 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142953.1 protein_id gnl|my_center|LOCUS_20070 943 1224 gene locus_tag LOCUS_20080 943 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 3045 3482 gene locus_tag LOCUS_20090 3045 3482 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213216.1 protein_id gnl|my_center|LOCUS_20090 3479 4570 gene locus_tag LOCUS_20100 3479 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20100 >Feature sequence32 1447 122 gene locus_tag LOCUS_20110 1447 122 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043922084.1 protein_id gnl|my_center|LOCUS_20110 2590 1670 gene locus_tag LOCUS_20120 gene rocF 2590 1670 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039000.1 protein_id gnl|my_center|LOCUS_20120 2696 2621 gene locus_tag LOCUS_t00480 2696 2621 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3395 2745 gene locus_tag LOCUS_20130 3395 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 >Feature sequence33 2126 1170 gene locus_tag LOCUS_20140 2126 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 3513 2317 gene locus_tag LOCUS_20150 3513 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 >Feature sequence34 <1 1411 gene locus_tag LOCUS_20160 <1 1411 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064828.1:glutamine--fructose-6-phosphate transaminase (isomerizing) 1899 2114 gene locus_tag LOCUS_20170 1899 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 >Feature sequence35 91 714 gene locus_tag LOCUS_20180 91 714 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021922.1 protein_id gnl|my_center|LOCUS_20180 1606 743 gene locus_tag LOCUS_20190 1606 743 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647871.1 protein_id gnl|my_center|LOCUS_20190 2199 1603 gene locus_tag LOCUS_20200 2199 1603 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084435184.1 protein_id gnl|my_center|LOCUS_20200 2311 2634 gene locus_tag LOCUS_20210 2311 2634 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165196.1 protein_id gnl|my_center|LOCUS_20210 2631 3524 gene locus_tag LOCUS_20220 2631 3524 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302783.1 protein_id gnl|my_center|LOCUS_20220 >Feature sequence36 529 1182 gene locus_tag LOCUS_20230 529 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 1186 2097 gene locus_tag LOCUS_20240 1186 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 2193 3389 gene locus_tag LOCUS_20250 2193 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 3595 3419 gene locus_tag LOCUS_20260 3595 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 >Feature sequence37 25 1677 gene locus_tag LOCUS_20270 25 1677 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089722.1 protein_id gnl|my_center|LOCUS_20270 1695 1892 gene locus_tag LOCUS_20280 1695 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 1958 3016 gene locus_tag LOCUS_20290 1958 3016 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091446486.1 protein_id gnl|my_center|LOCUS_20290 >Feature sequence38 1278 3131 gene locus_tag LOCUS_20300 1278 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 >Feature sequence39 <1 541 gene locus_tag LOCUS_20310 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039011.1:bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA 535 1377 gene locus_tag LOCUS_20320 535 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 >Feature sequence40 1323 130 gene locus_tag LOCUS_20330 1323 130 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084682.1 protein_id gnl|my_center|LOCUS_20330 <2788 1483 gene locus_tag LOCUS_20340 <2788 1483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000097647.1:4-aminobutyrate--2-oxoglutarate transaminase >Feature sequence41 <1 580 gene locus_tag LOCUS_20350 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193847.1:ATP-binding cassette domain-containing protein 658 2313 gene locus_tag LOCUS_20360 658 2313 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813705.1 protein_id gnl|my_center|LOCUS_20360