>Feature sequence001 2875 1487 gene locus_tag LOCUS_00010 2875 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 3689 2904 gene locus_tag LOCUS_00020 gene nagB 3689 2904 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030128.1 protein_id gnl|my_center|LOCUS_00020 4291 3800 gene locus_tag LOCUS_00030 4291 3800 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_00030 5325 4291 gene locus_tag LOCUS_00040 5325 4291 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245976.1 protein_id gnl|my_center|LOCUS_00040 6263 5319 gene locus_tag LOCUS_00050 gene rnhC 6263 5319 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883701.1 protein_id gnl|my_center|LOCUS_00050 6868 6263 gene locus_tag LOCUS_00060 gene recR 6868 6263 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814133.1 protein_id gnl|my_center|LOCUS_00060 7205 6882 gene locus_tag LOCUS_00070 7205 6882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9962 7302 gene locus_tag LOCUS_00080 gene secDF 9962 7302 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971714.1 protein_id gnl|my_center|LOCUS_00080 10439 9987 gene locus_tag LOCUS_00090 10439 9987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11580 10501 gene locus_tag LOCUS_00100 11580 10501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11706 12020 gene locus_tag LOCUS_00110 gene rhaM 11706 12020 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759851.1 protein_id gnl|my_center|LOCUS_00110 13375 12077 gene locus_tag LOCUS_00120 gene thiC 13375 12077 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902492.1 protein_id gnl|my_center|LOCUS_00120 14848 13553 gene locus_tag LOCUS_00130 14848 13553 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_00130 16684 14849 gene locus_tag LOCUS_00140 gene glmS 16684 14849 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931824.1 protein_id gnl|my_center|LOCUS_00140 17125 16694 gene locus_tag LOCUS_00150 17125 16694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 18913 17141 gene locus_tag LOCUS_00160 gene ptsP 18913 17141 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152804487.1 protein_id gnl|my_center|LOCUS_00160 19213 18923 gene locus_tag LOCUS_00170 19213 18923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 19395 20672 gene locus_tag LOCUS_00180 19395 20672 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943062.1 protein_id gnl|my_center|LOCUS_00180 21398 20748 gene locus_tag LOCUS_00190 21398 20748 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970384.1 protein_id gnl|my_center|LOCUS_00190 22510 21401 gene locus_tag LOCUS_00200 22510 21401 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_00200 22598 23422 gene locus_tag LOCUS_00210 22598 23422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 25020 23752 gene locus_tag LOCUS_00220 25020 23752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 26051 25116 gene locus_tag LOCUS_00230 26051 25116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 27691 26114 gene locus_tag LOCUS_00240 27691 26114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 28074 27688 gene locus_tag LOCUS_00250 28074 27688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 28524 29117 gene locus_tag LOCUS_00260 28524 29117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 29319 29696 gene locus_tag LOCUS_00270 29319 29696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 29975 30340 gene locus_tag LOCUS_00280 29975 30340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 31074 30418 gene locus_tag LOCUS_00290 gene metW 31074 30418 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 protein_id gnl|my_center|LOCUS_00290 32188 31067 gene locus_tag LOCUS_00300 32188 31067 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391014.1 protein_id gnl|my_center|LOCUS_00300 35155 32312 gene locus_tag LOCUS_00310 35155 32312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 36441 35152 gene locus_tag LOCUS_00320 gene hflX 36441 35152 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016249.1 protein_id gnl|my_center|LOCUS_00320 36596 36679 gene locus_tag LOCUS_t00010 36596 36679 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 37071 38648 gene locus_tag LOCUS_00330 37071 38648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 38707 40344 gene locus_tag LOCUS_00340 38707 40344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 40804 40355 gene locus_tag LOCUS_00350 40804 40355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 41715 40855 gene locus_tag LOCUS_00360 41715 40855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 42961 41738 gene locus_tag LOCUS_00370 42961 41738 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890714.1 protein_id gnl|my_center|LOCUS_00370 44600 42963 gene locus_tag LOCUS_00380 44600 42963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 45643 44624 gene locus_tag LOCUS_00390 45643 44624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 46448 45630 gene locus_tag LOCUS_00400 46448 45630 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_00400 46635 48047 gene locus_tag LOCUS_00410 gene rpoN 46635 48047 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098942.1 protein_id gnl|my_center|LOCUS_00410 50171 48144 gene locus_tag LOCUS_00420 50171 48144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 51892 50168 gene locus_tag LOCUS_00430 51892 50168 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877158.1 protein_id gnl|my_center|LOCUS_00430 52341 51889 gene locus_tag LOCUS_00440 gene nuoE 52341 51889 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250565.1 protein_id gnl|my_center|LOCUS_00440 53321 52431 gene locus_tag LOCUS_00450 gene arnD 53321 52431 CDS product 4-deoxy-4-formamido-L-arabinose-phosphoundecaprenol deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211822.1 protein_id gnl|my_center|LOCUS_00450 55322 53328 gene locus_tag LOCUS_00460 gene arnA 55322 53328 CDS product bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704925.1 protein_id gnl|my_center|LOCUS_00460 56815 55466 gene locus_tag LOCUS_00470 gene glmM 56815 55466 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_00470 57892 56834 gene locus_tag LOCUS_00480 57892 56834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 58532 57873 gene locus_tag LOCUS_00490 gene tmk 58532 57873 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391590.1 protein_id gnl|my_center|LOCUS_00490 58644 59762 gene locus_tag LOCUS_00500 58644 59762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 59801 60496 gene locus_tag LOCUS_00510 59801 60496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 60508 61269 gene locus_tag LOCUS_00520 60508 61269 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021264.1 protein_id gnl|my_center|LOCUS_00520 61271 62419 gene locus_tag LOCUS_00530 61271 62419 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256508.1 protein_id gnl|my_center|LOCUS_00530 62416 62886 gene locus_tag LOCUS_00540 62416 62886 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421374.1 protein_id gnl|my_center|LOCUS_00540 62879 63373 gene locus_tag LOCUS_00550 62879 63373 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258042.1 protein_id gnl|my_center|LOCUS_00550 65629 63422 gene locus_tag LOCUS_00560 65629 63422 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461874.1 protein_id gnl|my_center|LOCUS_00560 65803 65636 gene locus_tag LOCUS_00570 65803 65636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 66123 66899 gene locus_tag LOCUS_00580 66123 66899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 67006 68064 gene locus_tag LOCUS_00590 67006 68064 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082407.1 protein_id gnl|my_center|LOCUS_00590 68307 69086 gene locus_tag LOCUS_00600 68307 69086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 69149 70084 gene locus_tag LOCUS_00610 69149 70084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 70094 72262 gene locus_tag LOCUS_00620 70094 72262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 72276 75338 gene locus_tag LOCUS_00630 72276 75338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 75635 76864 gene locus_tag LOCUS_00640 75635 76864 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528101.1 protein_id gnl|my_center|LOCUS_00640 77040 77747 gene locus_tag LOCUS_00650 77040 77747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 77759 80044 gene locus_tag LOCUS_00660 77759 80044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 80278 81660 gene locus_tag LOCUS_00670 80278 81660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 81749 82468 gene locus_tag LOCUS_00680 81749 82468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 >Feature sequence002 1285 920 gene locus_tag LOCUS_00690 1285 920 CDS product DUF2089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583104.1 protein_id gnl|my_center|LOCUS_00690 3665 1458 gene locus_tag LOCUS_00700 3665 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 4341 3682 gene locus_tag LOCUS_00710 4341 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 5458 4358 gene locus_tag LOCUS_00720 5458 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 6232 6156 gene locus_tag LOCUS_t00020 6232 6156 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6344 6268 gene locus_tag LOCUS_t00030 6344 6268 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7552 6428 gene locus_tag LOCUS_00730 gene dprA 7552 6428 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922340.1 protein_id gnl|my_center|LOCUS_00730 8609 7545 gene locus_tag LOCUS_00740 gene aroB 8609 7545 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056627.1 protein_id gnl|my_center|LOCUS_00740 9649 8606 gene locus_tag LOCUS_00750 9649 8606 CDS product DUF3089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918560.1 protein_id gnl|my_center|LOCUS_00750 11448 9670 gene locus_tag LOCUS_00760 11448 9670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 11384 11572 gene locus_tag LOCUS_00770 11384 11572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 11678 12064 gene locus_tag LOCUS_00780 gene crcB 11678 12064 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870206.1 protein_id gnl|my_center|LOCUS_00780 12132 12488 gene locus_tag LOCUS_tm00010 12132 12488 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 13087 12695 gene locus_tag LOCUS_00790 13087 12695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 13296 13102 gene locus_tag LOCUS_00800 13296 13102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 14633 13404 gene locus_tag LOCUS_00810 14633 13404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 17350 14630 gene locus_tag LOCUS_00820 17350 14630 CDS product NHLP bacteriocin export ABC transporter permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458930.1 protein_id gnl|my_center|LOCUS_00820 19520 17358 gene locus_tag LOCUS_00830 19520 17358 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_00830 20849 19524 gene locus_tag LOCUS_00840 20849 19524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 22793 20862 gene locus_tag LOCUS_00850 22793 20862 CDS product RiPP maturation radical SAM C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084777.1 protein_id gnl|my_center|LOCUS_00850 24133 22766 gene locus_tag LOCUS_00860 24133 22766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 24494 24153 gene locus_tag LOCUS_00870 24494 24153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 25470 24418 gene locus_tag LOCUS_00880 25470 24418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 26737 25442 gene locus_tag LOCUS_00890 26737 25442 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142242.1 protein_id gnl|my_center|LOCUS_00890 27075 26764 gene locus_tag LOCUS_00900 27075 26764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 27411 27094 gene locus_tag LOCUS_00910 27411 27094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 27745 27428 gene locus_tag LOCUS_00920 27745 27428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 29723 27975 gene locus_tag LOCUS_00930 29723 27975 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_00930 31831 29717 gene locus_tag LOCUS_00940 31831 29717 CDS product alginate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972694.1 protein_id gnl|my_center|LOCUS_00940 32422 31886 gene locus_tag LOCUS_00950 32422 31886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 33011 32409 gene locus_tag LOCUS_00960 33011 32409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 34866 33061 gene locus_tag LOCUS_00970 34866 33061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 35652 34888 gene locus_tag LOCUS_00980 35652 34888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 36523 35684 gene locus_tag LOCUS_00990 36523 35684 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020084.1 protein_id gnl|my_center|LOCUS_00990 37314 36520 gene locus_tag LOCUS_01000 37314 36520 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_01000 38340 37321 gene locus_tag LOCUS_01010 38340 37321 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938638.1 protein_id gnl|my_center|LOCUS_01010 38535 39695 gene locus_tag LOCUS_01020 38535 39695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 39765 40553 gene locus_tag LOCUS_01030 39765 40553 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545351.1 protein_id gnl|my_center|LOCUS_01030 40646 41965 gene locus_tag LOCUS_01040 40646 41965 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116269310.1 protein_id gnl|my_center|LOCUS_01040 41962 42402 gene locus_tag LOCUS_01050 41962 42402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 42522 42764 gene locus_tag LOCUS_01060 42522 42764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 43422 42781 gene locus_tag LOCUS_01070 43422 42781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 43869 43438 gene locus_tag LOCUS_01080 43869 43438 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723834.1 protein_id gnl|my_center|LOCUS_01080 44529 43873 gene locus_tag LOCUS_01090 44529 43873 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263280.1 protein_id gnl|my_center|LOCUS_01090 45842 44541 gene locus_tag LOCUS_01100 45842 44541 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173427597.1 protein_id gnl|my_center|LOCUS_01100 46403 45882 gene locus_tag LOCUS_01110 46403 45882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 47503 46400 gene locus_tag LOCUS_01120 47503 46400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 48504 47527 gene locus_tag LOCUS_01130 48504 47527 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_01130 49381 48533 gene locus_tag LOCUS_01140 gene hisG 49381 48533 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403496.1 protein_id gnl|my_center|LOCUS_01140 49666 49403 gene locus_tag LOCUS_01150 49666 49403 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403497.1 protein_id gnl|my_center|LOCUS_01150 49863 50741 gene locus_tag LOCUS_01160 gene amrS 49863 50741 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 protein_id gnl|my_center|LOCUS_01160 50743 51453 gene locus_tag LOCUS_01170 50743 51453 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763153.1 protein_id gnl|my_center|LOCUS_01170 51586 52539 gene locus_tag LOCUS_01180 51586 52539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 52689 53225 gene locus_tag LOCUS_01190 52689 53225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 53251 54066 gene locus_tag LOCUS_01200 53251 54066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 54080 54505 gene locus_tag LOCUS_01210 54080 54505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 54513 55223 gene locus_tag LOCUS_01220 54513 55223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 55198 55788 gene locus_tag LOCUS_01230 55198 55788 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788015.1 protein_id gnl|my_center|LOCUS_01230 55785 56123 gene locus_tag LOCUS_01240 55785 56123 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765016.1 protein_id gnl|my_center|LOCUS_01240 56125 60267 gene locus_tag LOCUS_01250 56125 60267 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202977.1 protein_id gnl|my_center|LOCUS_01250 61727 60309 gene locus_tag LOCUS_01260 gene hydG 61727 60309 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_01260 62011 61760 gene locus_tag LOCUS_01270 62011 61760 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963809.1 protein_id gnl|my_center|LOCUS_01270 62408 67789 gene locus_tag LOCUS_01280 62408 67789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 67804 67950 gene locus_tag LOCUS_01290 67804 67950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 71572 68009 gene locus_tag LOCUS_01300 71572 68009 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_01300 72634 71711 gene locus_tag LOCUS_01310 72634 71711 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003836797.1 protein_id gnl|my_center|LOCUS_01310 72822 72631 gene locus_tag LOCUS_01320 72822 72631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 76542 73132 gene locus_tag LOCUS_01330 76542 73132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 >Feature sequence003 56 442 gene locus_tag LOCUS_01340 56 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 1681 446 gene locus_tag LOCUS_01350 1681 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 2080 1682 gene locus_tag LOCUS_01360 2080 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 2735 2073 gene locus_tag LOCUS_01370 2735 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 3375 2803 gene locus_tag LOCUS_01380 3375 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 4505 3408 gene locus_tag LOCUS_01390 4505 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 5196 5120 gene locus_tag LOCUS_t00040 5196 5120 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5487 7010 gene locus_tag LOCUS_01400 5487 7010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 7158 7733 gene locus_tag LOCUS_01410 7158 7733 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088278.1 protein_id gnl|my_center|LOCUS_01410 7775 8665 gene locus_tag LOCUS_01420 7775 8665 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140222.1 protein_id gnl|my_center|LOCUS_01420 10097 8736 gene locus_tag LOCUS_01430 10097 8736 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870788.1 protein_id gnl|my_center|LOCUS_01430 11346 10213 gene locus_tag LOCUS_01440 11346 10213 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767192.1 protein_id gnl|my_center|LOCUS_01440 12168 11455 gene locus_tag LOCUS_01450 12168 11455 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256704.1 protein_id gnl|my_center|LOCUS_01450 15313 12278 gene locus_tag LOCUS_01460 15313 12278 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582581.1 protein_id gnl|my_center|LOCUS_01460 15435 16379 gene locus_tag LOCUS_01470 15435 16379 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099264237.1 protein_id gnl|my_center|LOCUS_01470 16384 18405 gene locus_tag LOCUS_01480 16384 18405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 19191 18409 gene locus_tag LOCUS_01490 19191 18409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 22712 19188 gene locus_tag LOCUS_01500 22712 19188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 23442 22765 gene locus_tag LOCUS_01510 23442 22765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 24194 25738 gene locus_tag LOCUS_01520 24194 25738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 27090 25765 gene locus_tag LOCUS_01530 gene xylB 27090 25765 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_01530 27991 27095 gene locus_tag LOCUS_01540 27991 27095 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939546.1 protein_id gnl|my_center|LOCUS_01540 28989 27988 gene locus_tag LOCUS_01550 28989 27988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 31334 28986 gene locus_tag LOCUS_01560 31334 28986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 31433 32509 gene locus_tag LOCUS_01570 31433 32509 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223493.1 protein_id gnl|my_center|LOCUS_01570 32584 33888 gene locus_tag LOCUS_01580 32584 33888 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_01580 36004 33908 gene locus_tag LOCUS_01590 36004 33908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392408.1 protein_id gnl|my_center|LOCUS_01590 36802 36032 gene locus_tag LOCUS_01600 36802 36032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 37058 37933 gene locus_tag LOCUS_01610 37058 37933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 40280 38037 gene locus_tag LOCUS_01620 40280 38037 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108336.1 protein_id gnl|my_center|LOCUS_01620 41758 40484 gene locus_tag LOCUS_01630 41758 40484 CDS product sn-glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082995.1 protein_id gnl|my_center|LOCUS_01630 42042 43979 gene locus_tag LOCUS_01640 42042 43979 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144073.1 protein_id gnl|my_center|LOCUS_01640 43990 44646 gene locus_tag LOCUS_01650 gene ung 43990 44646 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977484.1 protein_id gnl|my_center|LOCUS_01650 44655 46775 gene locus_tag LOCUS_01660 44655 46775 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108336.1 protein_id gnl|my_center|LOCUS_01660 46772 47539 gene locus_tag LOCUS_01670 46772 47539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 47781 50462 gene locus_tag LOCUS_01680 gene gyrA 47781 50462 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_01680 50462 51292 gene locus_tag LOCUS_01690 gene folP 50462 51292 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644433.1 protein_id gnl|my_center|LOCUS_01690 51334 52191 gene locus_tag LOCUS_01700 gene cdaA 51334 52191 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_01700 52191 53156 gene locus_tag LOCUS_01710 52191 53156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 53184 54827 gene locus_tag LOCUS_01720 53184 54827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 54925 55680 gene locus_tag LOCUS_01730 54925 55680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 55723 56823 gene locus_tag LOCUS_01740 55723 56823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 56813 57454 gene locus_tag LOCUS_01750 gene trmB 56813 57454 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941189.1 protein_id gnl|my_center|LOCUS_01750 57583 58878 gene locus_tag LOCUS_01760 gene tyrS 57583 58878 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963956.1 protein_id gnl|my_center|LOCUS_01760 58965 59990 gene locus_tag LOCUS_01770 gene pgl 58965 59990 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244689.1 protein_id gnl|my_center|LOCUS_01770 60550 60149 gene locus_tag LOCUS_01780 60550 60149 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064953.1 protein_id gnl|my_center|LOCUS_01780 60704 62287 gene locus_tag LOCUS_01790 60704 62287 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103018905.1 protein_id gnl|my_center|LOCUS_01790 62524 63525 gene locus_tag LOCUS_01800 62524 63525 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969920.1 protein_id gnl|my_center|LOCUS_01800 63642 64376 gene locus_tag LOCUS_01810 63642 64376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 64393 65904 gene locus_tag LOCUS_01820 64393 65904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 65920 66765 gene locus_tag LOCUS_01830 65920 66765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 67614 66787 gene locus_tag LOCUS_01840 67614 66787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 67809 68600 gene locus_tag LOCUS_01850 67809 68600 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963680.1 protein_id gnl|my_center|LOCUS_01850 70877 68607 gene locus_tag LOCUS_01860 70877 68607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 71840 70968 gene locus_tag LOCUS_01870 71840 70968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 >Feature sequence004 417 2099 gene locus_tag LOCUS_01880 gene arnT 417 2099 CDS product lipid IV(A) 4-amino-4-deoxy-L-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704923.1 protein_id gnl|my_center|LOCUS_01880 2115 2690 gene locus_tag LOCUS_01890 2115 2690 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921582.1 protein_id gnl|my_center|LOCUS_01890 3671 2919 gene locus_tag LOCUS_01900 3671 2919 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940643.1 protein_id gnl|my_center|LOCUS_01900 5059 3737 gene locus_tag LOCUS_01910 5059 3737 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942374.1 protein_id gnl|my_center|LOCUS_01910 5511 5083 gene locus_tag LOCUS_01920 5511 5083 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942381.1 protein_id gnl|my_center|LOCUS_01920 6003 5530 gene locus_tag LOCUS_01930 6003 5530 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942383.1 protein_id gnl|my_center|LOCUS_01930 7585 6005 gene locus_tag LOCUS_01940 7585 6005 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542552.1 protein_id gnl|my_center|LOCUS_01940 9081 7612 gene locus_tag LOCUS_01950 9081 7612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 9835 9074 gene locus_tag LOCUS_01960 9835 9074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 10858 9842 gene locus_tag LOCUS_01970 10858 9842 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220194564.1 protein_id gnl|my_center|LOCUS_01970 11222 10851 gene locus_tag LOCUS_01980 gene rbfA 11222 10851 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931015.1 protein_id gnl|my_center|LOCUS_01980 13327 11225 gene locus_tag LOCUS_01990 gene infB 13327 11225 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043635.1 protein_id gnl|my_center|LOCUS_01990 14593 13355 gene locus_tag LOCUS_02000 14593 13355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 15006 16148 gene locus_tag LOCUS_02010 15006 16148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 16148 16858 gene locus_tag LOCUS_02020 16148 16858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 16877 18886 gene locus_tag LOCUS_02030 16877 18886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 19009 19899 gene locus_tag LOCUS_02040 19009 19899 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943244.1 protein_id gnl|my_center|LOCUS_02040 19896 20687 gene locus_tag LOCUS_02050 19896 20687 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930637.1 protein_id gnl|my_center|LOCUS_02050 25482 20761 gene locus_tag LOCUS_02060 25482 20761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 26668 25643 gene locus_tag LOCUS_02070 26668 25643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 26917 27651 gene locus_tag LOCUS_02080 26917 27651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 27716 29233 gene locus_tag LOCUS_02090 27716 29233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 29248 30138 gene locus_tag LOCUS_02100 29248 30138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 30963 30157 gene locus_tag LOCUS_02110 30963 30157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 31074 32453 gene locus_tag LOCUS_02120 31074 32453 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530194.1 protein_id gnl|my_center|LOCUS_02120 33876 32497 gene locus_tag LOCUS_02130 33876 32497 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006194892.1 protein_id gnl|my_center|LOCUS_02130 35100 33901 gene locus_tag LOCUS_02140 35100 33901 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392434.1 protein_id gnl|my_center|LOCUS_02140 35906 35115 gene locus_tag LOCUS_02150 35906 35115 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583165.1 protein_id gnl|my_center|LOCUS_02150 37136 35922 gene locus_tag LOCUS_02160 37136 35922 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166479973.1 protein_id gnl|my_center|LOCUS_02160 37317 38945 gene locus_tag LOCUS_02170 37317 38945 CDS product UDP-phosphomannose--protein mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957674.1 protein_id gnl|my_center|LOCUS_02170 41407 38948 gene locus_tag LOCUS_02180 41407 38948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 42120 41434 gene locus_tag LOCUS_02190 42120 41434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 43289 42225 gene locus_tag LOCUS_02200 gene cytR 43289 42225 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644897.1 protein_id gnl|my_center|LOCUS_02200 44085 43474 gene locus_tag LOCUS_02210 44085 43474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 45682 44087 gene locus_tag LOCUS_02220 45682 44087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 46136 45741 gene locus_tag LOCUS_02230 46136 45741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 46954 46133 gene locus_tag LOCUS_02240 46954 46133 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941438.1 protein_id gnl|my_center|LOCUS_02240 48361 47024 gene locus_tag LOCUS_02250 48361 47024 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684564.1 protein_id gnl|my_center|LOCUS_02250 49785 48484 gene locus_tag LOCUS_02260 49785 48484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 49913 50671 gene locus_tag LOCUS_02270 49913 50671 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242402.1 protein_id gnl|my_center|LOCUS_02270 50671 52530 gene locus_tag LOCUS_02280 50671 52530 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083312.1 protein_id gnl|my_center|LOCUS_02280 52535 53059 gene locus_tag LOCUS_02290 52535 53059 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031170.1 protein_id gnl|my_center|LOCUS_02290 53062 54519 gene locus_tag LOCUS_02300 53062 54519 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118296.1 protein_id gnl|my_center|LOCUS_02300 54672 55331 gene locus_tag LOCUS_02310 54672 55331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 55335 56483 gene locus_tag LOCUS_02320 55335 56483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 >Feature sequence005 817 2400 gene locus_tag LOCUS_02330 817 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 2609 3646 gene locus_tag LOCUS_02340 2609 3646 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804129.1 protein_id gnl|my_center|LOCUS_02340 3660 5237 gene locus_tag LOCUS_02350 3660 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 5239 6909 gene locus_tag LOCUS_02360 5239 6909 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819869.1 protein_id gnl|my_center|LOCUS_02360 6946 10014 gene locus_tag LOCUS_02370 6946 10014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 10021 10827 gene locus_tag LOCUS_02380 10021 10827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 10938 11675 gene locus_tag LOCUS_02390 10938 11675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 13061 11799 gene locus_tag LOCUS_02400 13061 11799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 17112 13219 gene locus_tag LOCUS_02410 17112 13219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 17747 17142 gene locus_tag LOCUS_02420 17747 17142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 18873 17761 gene locus_tag LOCUS_02430 18873 17761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 19272 20357 gene locus_tag LOCUS_02440 19272 20357 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906005.1 protein_id gnl|my_center|LOCUS_02440 20433 21074 gene locus_tag LOCUS_02450 20433 21074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 21071 23491 gene locus_tag LOCUS_02460 21071 23491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 24673 23756 gene locus_tag LOCUS_02470 24673 23756 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966649.1 protein_id gnl|my_center|LOCUS_02470 25471 25395 gene locus_tag LOCUS_t00050 25471 25395 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 26627 25545 gene locus_tag LOCUS_02480 gene araR 26627 25545 CDS product arabinose utilization transcriptional regulator AraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243070.1 protein_id gnl|my_center|LOCUS_02480 27852 26791 gene locus_tag LOCUS_02490 27852 26791 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391708.1 protein_id gnl|my_center|LOCUS_02490 28399 27845 gene locus_tag LOCUS_02500 28399 27845 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391707.1 protein_id gnl|my_center|LOCUS_02500 29657 28668 gene locus_tag LOCUS_02510 29657 28668 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545989.1 protein_id gnl|my_center|LOCUS_02510 30770 29721 gene locus_tag LOCUS_02520 gene plsX 30770 29721 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_02520 30983 30804 gene locus_tag LOCUS_02530 gene rpmF 30983 30804 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419113.1 protein_id gnl|my_center|LOCUS_02530 31482 31249 gene locus_tag LOCUS_02540 31482 31249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 32032 31391 gene locus_tag LOCUS_02550 32032 31391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 32372 33628 gene locus_tag LOCUS_02560 32372 33628 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_02560 33625 35475 gene locus_tag LOCUS_02570 33625 35475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 35541 36275 gene locus_tag LOCUS_02580 35541 36275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 37007 36390 gene locus_tag LOCUS_02590 37007 36390 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867324.1 protein_id gnl|my_center|LOCUS_02590 38341 37049 gene locus_tag LOCUS_02600 gene thrC 38341 37049 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870985.1 protein_id gnl|my_center|LOCUS_02600 38543 38914 gene locus_tag LOCUS_02610 38543 38914 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404162.1 protein_id gnl|my_center|LOCUS_02610 38935 39093 gene locus_tag LOCUS_02620 38935 39093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 39126 39377 gene locus_tag LOCUS_02630 39126 39377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 43589 39480 gene locus_tag LOCUS_02640 43589 39480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 44378 43647 gene locus_tag LOCUS_02650 44378 43647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 45523 44486 gene locus_tag LOCUS_02660 45523 44486 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393756.1 protein_id gnl|my_center|LOCUS_02660 45821 47689 gene locus_tag LOCUS_02670 45821 47689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 47800 48747 gene locus_tag LOCUS_02680 47800 48747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 48767 49465 gene locus_tag LOCUS_02690 48767 49465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 49698 50093 gene locus_tag LOCUS_02700 49698 50093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 50109 50495 gene locus_tag LOCUS_02710 50109 50495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 50563 52710 gene locus_tag LOCUS_02720 50563 52710 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461804.1 protein_id gnl|my_center|LOCUS_02720 52719 53063 gene locus_tag LOCUS_02730 52719 53063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 >Feature sequence006 568 897 gene locus_tag LOCUS_02740 568 897 CDS product DUF2590 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938931.1 protein_id gnl|my_center|LOCUS_02740 897 2177 gene locus_tag LOCUS_02750 897 2177 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136930.1 protein_id gnl|my_center|LOCUS_02750 2174 2725 gene locus_tag LOCUS_02760 2174 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815680.1 protein_id gnl|my_center|LOCUS_02760 2794 2949 gene locus_tag LOCUS_02770 2794 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 2942 4093 gene locus_tag LOCUS_02780 2942 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 4109 4732 gene locus_tag LOCUS_02790 4109 4732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 4736 6769 gene locus_tag LOCUS_02800 4736 6769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 6762 6947 gene locus_tag LOCUS_02810 6762 6947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 6940 9150 gene locus_tag LOCUS_02820 6940 9150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 9165 9776 gene locus_tag LOCUS_02830 9165 9776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 9773 10576 gene locus_tag LOCUS_02840 9773 10576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 10557 11054 gene locus_tag LOCUS_02850 10557 11054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 11070 11567 gene locus_tag LOCUS_02860 11070 11567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 11564 12514 gene locus_tag LOCUS_02870 11564 12514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 12498 13202 gene locus_tag LOCUS_02880 12498 13202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02880 13835 13752 gene locus_tag LOCUS_t00060 13835 13752 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15858 14014 gene locus_tag LOCUS_02890 15858 14014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 17305 15881 gene locus_tag LOCUS_02900 17305 15881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 17655 18461 gene locus_tag LOCUS_02910 17655 18461 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_02910 18917 19657 gene locus_tag LOCUS_02920 18917 19657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 19654 22944 gene locus_tag LOCUS_02930 19654 22944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 24352 22952 gene locus_tag LOCUS_02940 24352 22952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 24858 24349 gene locus_tag LOCUS_02950 24858 24349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 26368 24872 gene locus_tag LOCUS_02960 26368 24872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 26666 27328 gene locus_tag LOCUS_02970 26666 27328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 27487 28233 gene locus_tag LOCUS_02980 27487 28233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 29060 28425 gene locus_tag LOCUS_02990 gene purO 29060 28425 CDS product IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876651.1 protein_id gnl|my_center|LOCUS_02990 31161 29140 gene locus_tag LOCUS_03000 31161 29140 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097213.1 protein_id gnl|my_center|LOCUS_03000 32431 31415 gene locus_tag LOCUS_03010 gene galR 32431 31415 CDS product HTH-type transcriptional regulator GalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816990.1 protein_id gnl|my_center|LOCUS_03010 35366 32532 gene locus_tag LOCUS_03020 gene lacZ 35366 32532 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_03020 35565 35795 gene locus_tag LOCUS_03030 35565 35795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 35976 37283 gene locus_tag LOCUS_03040 gene tig 35976 37283 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330527.1 protein_id gnl|my_center|LOCUS_03040 37460 38065 gene locus_tag LOCUS_03050 gene clpP 37460 38065 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081059.1 protein_id gnl|my_center|LOCUS_03050 38072 39415 gene locus_tag LOCUS_03060 gene clpX 38072 39415 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005301524.1 protein_id gnl|my_center|LOCUS_03060 39438 40562 gene locus_tag LOCUS_03070 39438 40562 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328819.1 protein_id gnl|my_center|LOCUS_03070 40565 41554 gene locus_tag LOCUS_03080 40565 41554 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964544.1 protein_id gnl|my_center|LOCUS_03080 42917 41646 gene locus_tag LOCUS_03090 42917 41646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 43172 46474 gene locus_tag LOCUS_03100 43172 46474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 46471 48342 gene locus_tag LOCUS_03110 46471 48342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 49004 48591 gene locus_tag LOCUS_03120 49004 48591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 49606 49265 gene locus_tag LOCUS_03130 49606 49265 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460613.1 protein_id gnl|my_center|LOCUS_03130 49896 49603 gene locus_tag LOCUS_03140 49896 49603 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460614.1 protein_id gnl|my_center|LOCUS_03140 >Feature sequence007 3508 365 gene locus_tag LOCUS_03150 3508 365 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868786.1 protein_id gnl|my_center|LOCUS_03150 4696 3524 gene locus_tag LOCUS_03160 4696 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 6588 4846 gene locus_tag LOCUS_03170 6588 4846 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722633.1 protein_id gnl|my_center|LOCUS_03170 7278 6592 gene locus_tag LOCUS_03180 7278 6592 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_03180 7527 7452 gene locus_tag LOCUS_t00070 7527 7452 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 7696 7772 gene locus_tag LOCUS_t00080 7696 7772 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7785 7861 gene locus_tag LOCUS_t00090 7785 7861 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9419 7998 gene locus_tag LOCUS_03190 9419 7998 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938513.1 protein_id gnl|my_center|LOCUS_03190 9538 9855 gene locus_tag LOCUS_03200 9538 9855 CDS product YqfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092679.1 protein_id gnl|my_center|LOCUS_03200 9868 10500 gene locus_tag LOCUS_03210 9868 10500 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243167.1 protein_id gnl|my_center|LOCUS_03210 10518 11711 gene locus_tag LOCUS_03220 gene xseA 10518 11711 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_03220 13223 11865 gene locus_tag LOCUS_03230 gene katA 13223 11865 CDS product catalase KatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245322.1 protein_id gnl|my_center|LOCUS_03230 13414 13986 gene locus_tag LOCUS_03240 gene yihX 13414 13986 CDS product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368969.1 protein_id gnl|my_center|LOCUS_03240 14076 16640 gene locus_tag LOCUS_03250 14076 16640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 16763 17485 gene locus_tag LOCUS_03260 16763 17485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 17553 18008 gene locus_tag LOCUS_03270 gene aroQ 17553 18008 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942665.1 protein_id gnl|my_center|LOCUS_03270 18051 18506 gene locus_tag LOCUS_03280 gene accB 18051 18506 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942663.1 protein_id gnl|my_center|LOCUS_03280 18526 19899 gene locus_tag LOCUS_03290 gene accC 18526 19899 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259259.1 protein_id gnl|my_center|LOCUS_03290 19896 20369 gene locus_tag LOCUS_03300 19896 20369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 20425 20961 gene locus_tag LOCUS_03310 20425 20961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 20942 21499 gene locus_tag LOCUS_03320 20942 21499 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_03320 22157 21879 gene locus_tag LOCUS_03330 22157 21879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 23671 22925 gene locus_tag LOCUS_03340 23671 22925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 24552 23833 gene locus_tag LOCUS_03350 24552 23833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 25402 24665 gene locus_tag LOCUS_03360 25402 24665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 27592 25541 gene locus_tag LOCUS_03370 27592 25541 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033404426.1 protein_id gnl|my_center|LOCUS_03370 28641 27658 gene locus_tag LOCUS_03380 gene purR 28641 27658 CDS product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096929.1 protein_id gnl|my_center|LOCUS_03380 28884 28960 gene locus_tag LOCUS_t00100 28884 28960 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 29637 30899 gene locus_tag LOCUS_03390 29637 30899 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211475.1 protein_id gnl|my_center|LOCUS_03390 32350 30941 gene locus_tag LOCUS_03400 32350 30941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 32611 32354 gene locus_tag LOCUS_03410 32611 32354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 33178 32615 gene locus_tag LOCUS_03420 33178 32615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 33945 33286 gene locus_tag LOCUS_03430 33945 33286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 35469 34078 gene locus_tag LOCUS_03440 35469 34078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 35683 36681 gene locus_tag LOCUS_03450 gene gap 35683 36681 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785248.1 protein_id gnl|my_center|LOCUS_03450 36773 38026 gene locus_tag LOCUS_03460 36773 38026 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964029.1 protein_id gnl|my_center|LOCUS_03460 38176 40020 gene locus_tag LOCUS_03470 38176 40020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 40817 40014 gene locus_tag LOCUS_03480 40817 40014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 41597 41106 gene locus_tag LOCUS_03490 gene lepB 41597 41106 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711857.1 protein_id gnl|my_center|LOCUS_03490 42166 43542 gene locus_tag LOCUS_03500 42166 43542 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510938.1 protein_id gnl|my_center|LOCUS_03500 >Feature sequence008 <1 673 gene locus_tag LOCUS_03510 <1 673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784478.1:FAD-dependent oxidoreductase 697 1011 gene locus_tag LOCUS_03520 697 1011 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922401.1 protein_id gnl|my_center|LOCUS_03520 1265 1567 gene locus_tag LOCUS_03530 1265 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 1577 1702 gene locus_tag LOCUS_03540 1577 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 2619 1672 gene locus_tag LOCUS_03550 2619 1672 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_03550 3852 2854 gene locus_tag LOCUS_03560 3852 2854 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_03560 4064 5746 gene locus_tag LOCUS_03570 4064 5746 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939525.1 protein_id gnl|my_center|LOCUS_03570 5760 6290 gene locus_tag LOCUS_03580 5760 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 6318 8270 gene locus_tag LOCUS_03590 6318 8270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 8273 8974 gene locus_tag LOCUS_03600 8273 8974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 8981 10093 gene locus_tag LOCUS_03610 8981 10093 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039287.1 protein_id gnl|my_center|LOCUS_03610 10090 11355 gene locus_tag LOCUS_03620 10090 11355 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541328.1 protein_id gnl|my_center|LOCUS_03620 12696 11293 gene locus_tag LOCUS_03630 12696 11293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 14192 12756 gene locus_tag LOCUS_03640 14192 12756 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932736.1 protein_id gnl|my_center|LOCUS_03640 14379 15230 gene locus_tag LOCUS_03650 14379 15230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 15233 16750 gene locus_tag LOCUS_03660 15233 16750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 16899 17585 gene locus_tag LOCUS_03670 16899 17585 CDS product DUF2293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921987.1 protein_id gnl|my_center|LOCUS_03670 17650 18819 gene locus_tag LOCUS_03680 17650 18819 CDS product histidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369839.1 protein_id gnl|my_center|LOCUS_03680 19093 21147 gene locus_tag LOCUS_03690 19093 21147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 22395 21262 gene locus_tag LOCUS_03700 22395 21262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 23318 22392 gene locus_tag LOCUS_03710 23318 22392 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257188.1 protein_id gnl|my_center|LOCUS_03710 23514 24491 gene locus_tag LOCUS_03720 23514 24491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 24491 25588 gene locus_tag LOCUS_03730 24491 25588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 25598 26500 gene locus_tag LOCUS_03740 25598 26500 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171047034.1 protein_id gnl|my_center|LOCUS_03740 26529 27281 gene locus_tag LOCUS_03750 26529 27281 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335855.1 protein_id gnl|my_center|LOCUS_03750 27274 28188 gene locus_tag LOCUS_03760 27274 28188 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118333.1 protein_id gnl|my_center|LOCUS_03760 28877 28197 gene locus_tag LOCUS_03770 28877 28197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 29103 28882 gene locus_tag LOCUS_03780 29103 28882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 29615 29130 gene locus_tag LOCUS_03790 29615 29130 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101942.1 protein_id gnl|my_center|LOCUS_03790 30840 30568 gene locus_tag LOCUS_03800 30840 30568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 31048 31407 gene locus_tag LOCUS_03810 31048 31407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 31526 32314 gene locus_tag LOCUS_03820 31526 32314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 32311 33438 gene locus_tag LOCUS_03830 32311 33438 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114554.1 protein_id gnl|my_center|LOCUS_03830 33431 34240 gene locus_tag LOCUS_03840 gene rfaP 33431 34240 CDS product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114553.1 protein_id gnl|my_center|LOCUS_03840 34450 35430 gene locus_tag LOCUS_03850 34450 35430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 35432 36943 gene locus_tag LOCUS_03860 35432 36943 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268315.1 protein_id gnl|my_center|LOCUS_03860 36963 37955 gene locus_tag LOCUS_03870 gene rbsC 36963 37955 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419501.1 protein_id gnl|my_center|LOCUS_03870 41536 37976 gene locus_tag LOCUS_03880 41536 37976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 41865 41548 gene locus_tag LOCUS_03890 41865 41548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 >Feature sequence009 <1 1081 gene locus_tag LOCUS_03900 <1 1081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803942.1:polysaccharide biosynthesis tyrosine autokinase 1081 1839 gene locus_tag LOCUS_03910 1081 1839 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227815.1 protein_id gnl|my_center|LOCUS_03910 1785 3713 gene locus_tag LOCUS_03920 1785 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 4598 3729 gene locus_tag LOCUS_03930 4598 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 4725 6350 gene locus_tag LOCUS_03940 4725 6350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 6613 6293 gene locus_tag LOCUS_03950 6613 6293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 6786 6610 gene locus_tag LOCUS_03960 6786 6610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 6873 7214 gene locus_tag LOCUS_03970 6873 7214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 7350 8078 gene locus_tag LOCUS_03980 7350 8078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 8274 9203 gene locus_tag LOCUS_03990 8274 9203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 9376 10893 gene locus_tag LOCUS_04000 9376 10893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 11056 12171 gene locus_tag LOCUS_04010 11056 12171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 14097 12190 gene locus_tag LOCUS_04020 14097 12190 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948279.1 protein_id gnl|my_center|LOCUS_04020 15533 14121 gene locus_tag LOCUS_04030 15533 14121 CDS product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261579.1 protein_id gnl|my_center|LOCUS_04030 16467 15682 gene locus_tag LOCUS_04040 16467 15682 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_04040 17544 16486 gene locus_tag LOCUS_04050 17544 16486 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185221.1 protein_id gnl|my_center|LOCUS_04050 18912 17899 gene locus_tag LOCUS_04060 18912 17899 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943444.1 protein_id gnl|my_center|LOCUS_04060 19048 19941 gene locus_tag LOCUS_04070 19048 19941 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461665.1 protein_id gnl|my_center|LOCUS_04070 22434 20260 gene locus_tag LOCUS_04080 22434 20260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 23797 22439 gene locus_tag LOCUS_04090 23797 22439 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_04090 23958 25232 gene locus_tag LOCUS_04100 23958 25232 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_04100 26153 25461 gene locus_tag LOCUS_04110 26153 25461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 28949 26178 gene locus_tag LOCUS_04120 28949 26178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392408.1 protein_id gnl|my_center|LOCUS_04120 29488 28946 gene locus_tag LOCUS_04130 29488 28946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 29656 30609 gene locus_tag LOCUS_04140 29656 30609 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080078.1 protein_id gnl|my_center|LOCUS_04140 32222 30669 gene locus_tag LOCUS_04150 32222 30669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 32427 34643 gene locus_tag LOCUS_04160 32427 34643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 34630 35811 gene locus_tag LOCUS_04170 34630 35811 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121802.1 protein_id gnl|my_center|LOCUS_04170 35780 36571 gene locus_tag LOCUS_04180 gene larE 35780 36571 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080596.1 protein_id gnl|my_center|LOCUS_04180 38002 36935 gene locus_tag LOCUS_04190 38002 36935 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153479.1 protein_id gnl|my_center|LOCUS_04190 38806 38027 gene locus_tag LOCUS_04200 38806 38027 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_04200 38984 39862 gene locus_tag LOCUS_04210 38984 39862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 40183 40108 gene locus_tag LOCUS_t00110 40183 40108 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 40442 41845 gene locus_tag LOCUS_04220 gene gltX 40442 41845 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_04220 >Feature sequence010 103 2967 gene locus_tag LOCUS_04230 gene uvrA 103 2967 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_04230 3154 3555 gene locus_tag LOCUS_04240 3154 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 3601 3981 gene locus_tag LOCUS_04250 3601 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 4106 6334 gene locus_tag LOCUS_04260 gene priA 4106 6334 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_04260 6351 6635 gene locus_tag LOCUS_04270 6351 6635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 6632 7054 gene locus_tag LOCUS_04280 6632 7054 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764905.1 protein_id gnl|my_center|LOCUS_04280 7156 7917 gene locus_tag LOCUS_04290 7156 7917 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203150.1 protein_id gnl|my_center|LOCUS_04290 8073 8978 gene locus_tag LOCUS_04300 8073 8978 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133938067.1 protein_id gnl|my_center|LOCUS_04300 9195 8956 gene locus_tag LOCUS_04310 9195 8956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 9982 9497 gene locus_tag LOCUS_04320 gene ybeY 9982 9497 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259163.1 protein_id gnl|my_center|LOCUS_04320 12314 9906 gene locus_tag LOCUS_04330 12314 9906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 13280 12318 gene locus_tag LOCUS_04340 13280 12318 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880868.1 protein_id gnl|my_center|LOCUS_04340 13979 13377 gene locus_tag LOCUS_04350 13979 13377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 15442 14189 gene locus_tag LOCUS_04360 gene fabF 15442 14189 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942250.1 protein_id gnl|my_center|LOCUS_04360 15858 15619 gene locus_tag LOCUS_04370 gene acpP 15858 15619 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_04370 16793 16041 gene locus_tag LOCUS_04380 gene fabG 16793 16041 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792012.1 protein_id gnl|my_center|LOCUS_04380 17795 16881 gene locus_tag LOCUS_04390 gene fabD 17795 16881 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962577.1 protein_id gnl|my_center|LOCUS_04390 18049 18819 gene locus_tag LOCUS_04400 18049 18819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 21756 18856 gene locus_tag LOCUS_04410 21756 18856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 22539 21775 gene locus_tag LOCUS_04420 22539 21775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 22691 23530 gene locus_tag LOCUS_04430 22691 23530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 24764 23547 gene locus_tag LOCUS_04440 24764 23547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 28284 24835 gene locus_tag LOCUS_04450 28284 24835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 28958 28281 gene locus_tag LOCUS_04460 28958 28281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 30013 28955 gene locus_tag LOCUS_04470 30013 28955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 33458 30348 gene locus_tag LOCUS_04480 33458 30348 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393549.1 protein_id gnl|my_center|LOCUS_04480 34586 33471 gene locus_tag LOCUS_04490 gene vmeP 34586 33471 CDS product efflux RND transporter periplasmic adaptor subunit VmeP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005391278.1 protein_id gnl|my_center|LOCUS_04490 35136 34705 gene locus_tag LOCUS_04500 35136 34705 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966683.1 protein_id gnl|my_center|LOCUS_04500 35390 36529 gene locus_tag LOCUS_04510 35390 36529 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311957.1 protein_id gnl|my_center|LOCUS_04510 36576 37193 gene locus_tag LOCUS_04520 36576 37193 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144228759.1 protein_id gnl|my_center|LOCUS_04520 37211 40105 gene locus_tag LOCUS_04530 37211 40105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 >Feature sequence011 4197 2959 gene locus_tag LOCUS_04540 4197 2959 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539146.1 protein_id gnl|my_center|LOCUS_04540 4477 5787 gene locus_tag LOCUS_04550 4477 5787 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071740.1 protein_id gnl|my_center|LOCUS_04550 5784 6257 gene locus_tag LOCUS_04560 gene trmL 5784 6257 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356826.1 protein_id gnl|my_center|LOCUS_04560 6267 6560 gene locus_tag LOCUS_04570 6267 6560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 8063 6852 gene locus_tag LOCUS_04580 8063 6852 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020191.1 protein_id gnl|my_center|LOCUS_04580 8371 8060 gene locus_tag LOCUS_04590 8371 8060 CDS product DUF167 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933492.1 protein_id gnl|my_center|LOCUS_04590 10397 8346 gene locus_tag LOCUS_04600 gene ftsH 10397 8346 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388853.1 protein_id gnl|my_center|LOCUS_04600 11236 10703 gene locus_tag LOCUS_04610 11236 10703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 12316 11345 gene locus_tag LOCUS_04620 12316 11345 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_04620 13106 12303 gene locus_tag LOCUS_04630 13106 12303 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354922.1 protein_id gnl|my_center|LOCUS_04630 13207 13704 gene locus_tag LOCUS_04640 13207 13704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 13707 14048 gene locus_tag LOCUS_04650 13707 14048 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005302630.1 protein_id gnl|my_center|LOCUS_04650 14100 14921 gene locus_tag LOCUS_04660 14100 14921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 14921 15541 gene locus_tag LOCUS_04670 14921 15541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 16733 15546 gene locus_tag LOCUS_04680 16733 15546 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202787.1 protein_id gnl|my_center|LOCUS_04680 17608 16754 gene locus_tag LOCUS_04690 17608 16754 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761948.1 protein_id gnl|my_center|LOCUS_04690 17791 18795 gene locus_tag LOCUS_04700 17791 18795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 19097 18840 gene locus_tag LOCUS_04710 19097 18840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 21116 19155 gene locus_tag LOCUS_04720 21116 19155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 21851 21126 gene locus_tag LOCUS_04730 21851 21126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 22975 21875 gene locus_tag LOCUS_04740 22975 21875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 23950 23129 gene locus_tag LOCUS_04750 23950 23129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 24149 25039 gene locus_tag LOCUS_04760 24149 25039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 26056 25019 gene locus_tag LOCUS_04770 26056 25019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 27218 26238 gene locus_tag LOCUS_04780 27218 26238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 27573 27773 gene locus_tag LOCUS_04790 27573 27773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 27855 28088 gene locus_tag LOCUS_04800 27855 28088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 28045 28230 gene locus_tag LOCUS_04810 28045 28230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 28742 28392 gene locus_tag LOCUS_04820 28742 28392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 28924 29133 gene locus_tag LOCUS_04830 28924 29133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 31903 29309 gene locus_tag LOCUS_04840 31903 29309 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035772.1 protein_id gnl|my_center|LOCUS_04840 31979 33232 gene locus_tag LOCUS_04850 31979 33232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 33366 34949 gene locus_tag LOCUS_04860 33366 34949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 36189 35053 gene locus_tag LOCUS_04870 36189 35053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 37016 36435 gene locus_tag LOCUS_04880 37016 36435 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167392103.1 protein_id gnl|my_center|LOCUS_04880 37231 37064 gene locus_tag LOCUS_04890 37231 37064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 37917 37213 gene locus_tag LOCUS_04900 37917 37213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 39172 37919 gene locus_tag LOCUS_04910 39172 37919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 39602 39402 gene locus_tag LOCUS_04920 39602 39402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 >Feature sequence012 3122 642 gene locus_tag LOCUS_04930 gene gyrB 3122 642 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871536.1 protein_id gnl|my_center|LOCUS_04930 3262 3900 gene locus_tag LOCUS_04940 3262 3900 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933377.1 protein_id gnl|my_center|LOCUS_04940 4471 4007 gene locus_tag LOCUS_04950 4471 4007 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094714.1 protein_id gnl|my_center|LOCUS_04950 4965 4468 gene locus_tag LOCUS_04960 gene coaD 4965 4468 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704185.1 protein_id gnl|my_center|LOCUS_04960 5085 6062 gene locus_tag LOCUS_04970 gene ribF 5085 6062 CDS product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228004.1 protein_id gnl|my_center|LOCUS_04970 6111 7178 gene locus_tag LOCUS_04980 6111 7178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 7175 7555 gene locus_tag LOCUS_04990 gene acpS 7175 7555 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262547.1 protein_id gnl|my_center|LOCUS_04990 7567 8382 gene locus_tag LOCUS_05000 7567 8382 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111539.1 protein_id gnl|my_center|LOCUS_05000 9629 8451 gene locus_tag LOCUS_05010 9629 8451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 11149 9866 gene locus_tag LOCUS_05020 11149 9866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 15860 11220 gene locus_tag LOCUS_05030 15860 11220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 16665 15961 gene locus_tag LOCUS_05040 16665 15961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 17865 16906 gene locus_tag LOCUS_05050 17865 16906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 18953 17889 gene locus_tag LOCUS_05060 gene recF 18953 17889 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391554.1 protein_id gnl|my_center|LOCUS_05060 20061 18967 gene locus_tag LOCUS_05070 gene dnaN 20061 18967 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673176.1 protein_id gnl|my_center|LOCUS_05070 20630 21274 gene locus_tag LOCUS_05080 gene gmhA 20630 21274 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351733.1 protein_id gnl|my_center|LOCUS_05080 21271 21975 gene locus_tag LOCUS_05090 21271 21975 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732812.1 protein_id gnl|my_center|LOCUS_05090 22017 22895 gene locus_tag LOCUS_05100 gene cdsA 22017 22895 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212137.1 protein_id gnl|my_center|LOCUS_05100 22979 23461 gene locus_tag LOCUS_05110 22979 23461 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968070.1 protein_id gnl|my_center|LOCUS_05110 23424 24620 gene locus_tag LOCUS_05120 23424 24620 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_05120 24687 25388 gene locus_tag LOCUS_05130 24687 25388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 25468 26049 gene locus_tag LOCUS_05140 25468 26049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 26061 26756 gene locus_tag LOCUS_05150 gene thyX 26061 26756 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681263.1 protein_id gnl|my_center|LOCUS_05150 26758 27726 gene locus_tag LOCUS_05160 gene pdxA 26758 27726 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940791.1 protein_id gnl|my_center|LOCUS_05160 27731 28708 gene locus_tag LOCUS_05170 27731 28708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 28815 31634 gene locus_tag LOCUS_05180 28815 31634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 31820 32191 gene locus_tag LOCUS_05190 31820 32191 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462292.1 protein_id gnl|my_center|LOCUS_05190 32328 33122 gene locus_tag LOCUS_05200 32328 33122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 33322 33867 gene locus_tag LOCUS_05210 33322 33867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 34712 37861 gene locus_tag LOCUS_05220 34712 37861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 37884 38789 gene locus_tag LOCUS_05230 gene cas1 37884 38789 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_05230 38825 39130 gene locus_tag LOCUS_05240 gene cas2 38825 39130 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 protein_id gnl|my_center|LOCUS_05240 39188 39488 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aatataaccccccttcaaataacatcaaatcacaac >Feature sequence013 234 1304 gene locus_tag LOCUS_05250 234 1304 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211038.1 protein_id gnl|my_center|LOCUS_05250 1335 1991 gene locus_tag LOCUS_05260 1335 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 2007 3995 gene locus_tag LOCUS_05270 2007 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 3992 5224 gene locus_tag LOCUS_05280 3992 5224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 7683 5281 gene locus_tag LOCUS_05290 7683 5281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 8374 7697 gene locus_tag LOCUS_05300 8374 7697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 9424 8393 gene locus_tag LOCUS_05310 gene ccpA 9424 8393 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830844.1 protein_id gnl|my_center|LOCUS_05310 12129 9592 gene locus_tag LOCUS_05320 12129 9592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 14930 12210 gene locus_tag LOCUS_05330 gene ppdK 14930 12210 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_05330 15420 15013 gene locus_tag LOCUS_05340 15420 15013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 16616 15510 gene locus_tag LOCUS_05350 gene hydE 16616 15510 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393236.1 protein_id gnl|my_center|LOCUS_05350 16793 16869 gene locus_tag LOCUS_t00120 16793 16869 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 16922 16998 gene locus_tag LOCUS_t00130 16922 16998 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 18009 17149 gene locus_tag LOCUS_05360 gene miaA 18009 17149 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837132.1 protein_id gnl|my_center|LOCUS_05360 18102 18953 gene locus_tag LOCUS_05370 gene lpxC 18102 18953 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883290.1 protein_id gnl|my_center|LOCUS_05370 18979 19893 gene locus_tag LOCUS_05380 18979 19893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 19919 21223 gene locus_tag LOCUS_05390 19919 21223 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211395.1 protein_id gnl|my_center|LOCUS_05390 21237 22640 gene locus_tag LOCUS_05400 gene pyk 21237 22640 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761922.1 protein_id gnl|my_center|LOCUS_05400 22681 23700 gene locus_tag LOCUS_05410 22681 23700 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787054.1 protein_id gnl|my_center|LOCUS_05410 25023 23824 gene locus_tag LOCUS_05420 25023 23824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 26847 25036 gene locus_tag LOCUS_05430 gene lepA 26847 25036 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816487.1 protein_id gnl|my_center|LOCUS_05430 27012 28487 gene locus_tag LOCUS_05440 27012 28487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 28498 28854 gene locus_tag LOCUS_05450 gene folB 28498 28854 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419537.1 protein_id gnl|my_center|LOCUS_05450 28857 29435 gene locus_tag LOCUS_05460 28857 29435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 29422 31956 gene locus_tag LOCUS_05470 gene mutS 29422 31956 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_05470 35992 31958 gene locus_tag LOCUS_05480 35992 31958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 37521 35989 gene locus_tag LOCUS_05490 37521 35989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 38229 37537 gene locus_tag LOCUS_05500 38229 37537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 39315 38245 gene locus_tag LOCUS_05510 gene cytR 39315 38245 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224452.1 protein_id gnl|my_center|LOCUS_05510 >Feature sequence014 3318 631 gene locus_tag LOCUS_05520 3318 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 4080 3349 gene locus_tag LOCUS_05530 4080 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 5184 4108 gene locus_tag LOCUS_05540 gene degA 5184 4108 CDS product transcriptional regulator DegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245813.1 protein_id gnl|my_center|LOCUS_05540 5663 5379 gene locus_tag LOCUS_05550 5663 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 6786 5578 gene locus_tag LOCUS_05560 6786 5578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 7193 7978 gene locus_tag LOCUS_05570 7193 7978 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392145.1 protein_id gnl|my_center|LOCUS_05570 8007 10304 gene locus_tag LOCUS_05580 8007 10304 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582808.1 protein_id gnl|my_center|LOCUS_05580 10330 11715 gene locus_tag LOCUS_05590 10330 11715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 12944 11778 gene locus_tag LOCUS_05600 12944 11778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 13453 12941 gene locus_tag LOCUS_05610 13453 12941 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924863.1 protein_id gnl|my_center|LOCUS_05610 13829 13473 gene locus_tag LOCUS_05620 13829 13473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 15185 13869 gene locus_tag LOCUS_05630 15185 13869 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_05630 16597 15197 gene locus_tag LOCUS_05640 16597 15197 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_05640 17712 16594 gene locus_tag LOCUS_05650 gene alr 17712 16594 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_05650 19488 17839 gene locus_tag LOCUS_05660 gene rny 19488 17839 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_05660 20108 19551 gene locus_tag LOCUS_05670 20108 19551 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_05670 21468 20101 gene locus_tag LOCUS_05680 21468 20101 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546821.1 protein_id gnl|my_center|LOCUS_05680 24151 21914 gene locus_tag LOCUS_05690 24151 21914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 24435 25190 gene locus_tag LOCUS_05700 24435 25190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 25225 27237 gene locus_tag LOCUS_05710 25225 27237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 27304 28005 gene locus_tag LOCUS_05720 27304 28005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 28159 29154 gene locus_tag LOCUS_05730 28159 29154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 29181 29945 gene locus_tag LOCUS_05740 29181 29945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 29950 34848 gene locus_tag LOCUS_05750 29950 34848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 35299 35613 gene locus_tag LOCUS_05760 35299 35613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 35771 37597 gene locus_tag LOCUS_05770 35771 37597 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963883.1 protein_id gnl|my_center|LOCUS_05770 38139 37714 gene locus_tag LOCUS_05780 38139 37714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 >Feature sequence015 743 5227 gene locus_tag LOCUS_05790 743 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 6649 5297 gene locus_tag LOCUS_05800 6649 5297 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230096.1 protein_id gnl|my_center|LOCUS_05800 7182 6646 gene locus_tag LOCUS_05810 7182 6646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 7516 8307 gene locus_tag LOCUS_05820 7516 8307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 8571 9662 gene locus_tag LOCUS_05830 8571 9662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 9659 10663 gene locus_tag LOCUS_05840 9659 10663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 11553 10648 gene locus_tag LOCUS_05850 11553 10648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 11611 14007 gene locus_tag LOCUS_05860 11611 14007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 14166 15233 gene locus_tag LOCUS_05870 14166 15233 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099200.1 protein_id gnl|my_center|LOCUS_05870 15230 18010 gene locus_tag LOCUS_05880 gene rbbA 15230 18010 CDS product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943324.1 protein_id gnl|my_center|LOCUS_05880 18013 19164 gene locus_tag LOCUS_05890 18013 19164 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943323.1 protein_id gnl|my_center|LOCUS_05890 19242 22187 gene locus_tag LOCUS_05900 19242 22187 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927048.1 protein_id gnl|my_center|LOCUS_05900 22474 23895 gene locus_tag LOCUS_05910 22474 23895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 25116 23953 gene locus_tag LOCUS_05920 25116 23953 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_05920 25387 27177 gene locus_tag LOCUS_05930 25387 27177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 27660 28553 gene locus_tag LOCUS_05940 27660 28553 CDS product amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461907.1 protein_id gnl|my_center|LOCUS_05940 28556 29317 gene locus_tag LOCUS_05950 28556 29317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 29318 30013 gene locus_tag LOCUS_05960 29318 30013 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167392103.1 protein_id gnl|my_center|LOCUS_05960 31101 30256 gene locus_tag LOCUS_05970 31101 30256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 32469 31369 gene locus_tag LOCUS_05980 32469 31369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 33057 32482 gene locus_tag LOCUS_05990 33057 32482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 33599 33078 gene locus_tag LOCUS_06000 33599 33078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 34569 34432 gene locus_tag LOCUS_06010 34569 34432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 35189 34776 gene locus_tag LOCUS_06020 35189 34776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 35355 35191 gene locus_tag LOCUS_06030 35355 35191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 37266 37697 gene locus_tag LOCUS_06040 37266 37697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 >Feature sequence016 <1 697 gene locus_tag LOCUS_06050 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942692.1:bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ 715 1521 gene locus_tag LOCUS_06060 715 1521 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942280.1 protein_id gnl|my_center|LOCUS_06060 2428 1598 gene locus_tag LOCUS_06070 2428 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 5267 3159 gene locus_tag LOCUS_06080 5267 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 8605 5291 gene locus_tag LOCUS_06090 8605 5291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 9393 8590 gene locus_tag LOCUS_06100 9393 8590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 10411 9422 gene locus_tag LOCUS_06110 10411 9422 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229210.1 protein_id gnl|my_center|LOCUS_06110 11680 10793 gene locus_tag LOCUS_06120 11680 10793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 13197 11677 gene locus_tag LOCUS_06130 13197 11677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 13916 13212 gene locus_tag LOCUS_06140 13916 13212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 14998 13949 gene locus_tag LOCUS_06150 14998 13949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 16665 15307 gene locus_tag LOCUS_06160 16665 15307 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_06160 17585 18745 gene locus_tag LOCUS_06170 17585 18745 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_06170 19642 18842 gene locus_tag LOCUS_06180 19642 18842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 20073 19642 gene locus_tag LOCUS_06190 20073 19642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 20139 20420 gene locus_tag LOCUS_06200 20139 20420 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_06200 20422 20631 gene locus_tag LOCUS_06210 20422 20631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 21912 20638 gene locus_tag LOCUS_06220 21912 20638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 22777 22082 gene locus_tag LOCUS_06230 22777 22082 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167939808.1 protein_id gnl|my_center|LOCUS_06230 25971 22774 gene locus_tag LOCUS_06240 25971 22774 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938992.1 protein_id gnl|my_center|LOCUS_06240 26984 25974 gene locus_tag LOCUS_06250 26984 25974 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272230.1 protein_id gnl|my_center|LOCUS_06250 28283 27048 gene locus_tag LOCUS_06260 28283 27048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 29414 28290 gene locus_tag LOCUS_06270 29414 28290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 30982 29411 gene locus_tag LOCUS_06280 30982 29411 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938997.1 protein_id gnl|my_center|LOCUS_06280 31560 30985 gene locus_tag LOCUS_06290 31560 30985 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128417842.1 protein_id gnl|my_center|LOCUS_06290 32854 31781 gene locus_tag LOCUS_06300 32854 31781 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202293.1 protein_id gnl|my_center|LOCUS_06300 33829 32903 gene locus_tag LOCUS_06310 33829 32903 CDS product DUF5655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109315.1 protein_id gnl|my_center|LOCUS_06310 34084 33899 gene locus_tag LOCUS_06320 34084 33899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 34419 35798 gene locus_tag LOCUS_06330 34419 35798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 35746 36081 gene locus_tag LOCUS_06340 35746 36081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 >Feature sequence017 <1 1619 gene locus_tag LOCUS_06350 <1 1619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680710.1:isoleucine--tRNA ligase 1624 2625 gene locus_tag LOCUS_06360 1624 2625 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_06360 2622 2894 gene locus_tag LOCUS_06370 2622 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 2912 3763 gene locus_tag LOCUS_06380 2912 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 3828 4616 gene locus_tag LOCUS_06390 3828 4616 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972698.1 protein_id gnl|my_center|LOCUS_06390 4757 4918 gene locus_tag LOCUS_06400 4757 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 7110 6286 gene locus_tag LOCUS_06410 7110 6286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 7227 9707 gene locus_tag LOCUS_06420 7227 9707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 9691 10011 gene locus_tag LOCUS_06430 9691 10011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 11668 10112 gene locus_tag LOCUS_06440 11668 10112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 11869 12846 gene locus_tag LOCUS_06450 11869 12846 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_06450 13399 14481 gene locus_tag LOCUS_06460 13399 14481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 14608 15279 gene locus_tag LOCUS_06470 14608 15279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 15292 16791 gene locus_tag LOCUS_06480 15292 16791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 18294 17017 gene locus_tag LOCUS_06490 18294 17017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 18469 19317 gene locus_tag LOCUS_06500 gene purU 18469 19317 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228594.1 protein_id gnl|my_center|LOCUS_06500 19314 21146 gene locus_tag LOCUS_06510 19314 21146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 22341 21133 gene locus_tag LOCUS_06520 22341 21133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 23108 22338 gene locus_tag LOCUS_06530 23108 22338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 23995 23105 gene locus_tag LOCUS_06540 23995 23105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 24363 24019 gene locus_tag LOCUS_06550 24363 24019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 26042 24657 gene locus_tag LOCUS_06560 26042 24657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 27454 26177 gene locus_tag LOCUS_06570 27454 26177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 27810 28898 gene locus_tag LOCUS_06580 27810 28898 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_06580 28927 29670 gene locus_tag LOCUS_06590 28927 29670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 29717 32881 gene locus_tag LOCUS_06600 29717 32881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 33243 32968 gene locus_tag LOCUS_06610 33243 32968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 34832 33351 gene locus_tag LOCUS_06620 34832 33351 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817435.1 protein_id gnl|my_center|LOCUS_06620 35435 34896 gene locus_tag LOCUS_06630 gene lspA 35435 34896 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651632.1 protein_id gnl|my_center|LOCUS_06630 35825 35439 gene locus_tag LOCUS_06640 35825 35439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 >Feature sequence018 1337 4396 gene locus_tag LOCUS_06650 1337 4396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 4544 6031 gene locus_tag LOCUS_06660 4544 6031 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615418.1 protein_id gnl|my_center|LOCUS_06660 6028 7761 gene locus_tag LOCUS_06670 6028 7761 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340030.1 protein_id gnl|my_center|LOCUS_06670 7852 9075 gene locus_tag LOCUS_06680 7852 9075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 9072 11315 gene locus_tag LOCUS_06690 9072 11315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 11442 12014 gene locus_tag LOCUS_06700 11442 12014 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942383.1 protein_id gnl|my_center|LOCUS_06700 12016 13308 gene locus_tag LOCUS_06710 12016 13308 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545255.1 protein_id gnl|my_center|LOCUS_06710 13305 15041 gene locus_tag LOCUS_06720 gene iorA 13305 15041 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942384.1 protein_id gnl|my_center|LOCUS_06720 16956 15109 gene locus_tag LOCUS_06730 16956 15109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 17762 16959 gene locus_tag LOCUS_06740 17762 16959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 18123 19460 gene locus_tag LOCUS_06750 18123 19460 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135257956.1 protein_id gnl|my_center|LOCUS_06750 19541 20197 gene locus_tag LOCUS_06760 19541 20197 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460834.1 protein_id gnl|my_center|LOCUS_06760 20201 21295 gene locus_tag LOCUS_06770 20201 21295 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_06770 21437 23026 gene locus_tag LOCUS_06780 21437 23026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 23285 23806 gene locus_tag LOCUS_06790 23285 23806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 26205 24016 gene locus_tag LOCUS_06800 26205 24016 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111154492.1 protein_id gnl|my_center|LOCUS_06800 26439 29408 gene locus_tag LOCUS_06810 26439 29408 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942279.1 protein_id gnl|my_center|LOCUS_06810 29488 30237 gene locus_tag LOCUS_06820 29488 30237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 30242 31258 gene locus_tag LOCUS_06830 gene dusB 30242 31258 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391694.1 protein_id gnl|my_center|LOCUS_06830 31255 32151 gene locus_tag LOCUS_06840 31255 32151 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009279.1 protein_id gnl|my_center|LOCUS_06840 32771 32436 gene locus_tag LOCUS_06850 32771 32436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 33246 32887 gene locus_tag LOCUS_06860 33246 32887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 33662 33345 gene locus_tag LOCUS_06870 33662 33345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 35286 33811 gene locus_tag LOCUS_06880 35286 33811 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066425.1 protein_id gnl|my_center|LOCUS_06880 >Feature sequence019 1276 170 gene locus_tag LOCUS_06890 1276 170 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_06890 1480 2334 gene locus_tag LOCUS_06900 1480 2334 CDS product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721549.1 protein_id gnl|my_center|LOCUS_06900 3504 2365 gene locus_tag LOCUS_06910 3504 2365 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767191.1 protein_id gnl|my_center|LOCUS_06910 4242 3517 gene locus_tag LOCUS_06920 4242 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 7154 4260 gene locus_tag LOCUS_06930 7154 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 7449 7706 gene locus_tag LOCUS_06940 7449 7706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 8602 7595 gene locus_tag LOCUS_06950 gene pta 8602 7595 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_06950 9847 8639 gene locus_tag LOCUS_06960 9847 8639 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940289.1 protein_id gnl|my_center|LOCUS_06960 10178 9960 gene locus_tag LOCUS_06970 gene infA 10178 9960 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156508.1 protein_id gnl|my_center|LOCUS_06970 10930 10160 gene locus_tag LOCUS_06980 gene map 10930 10160 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_06980 11583 10933 gene locus_tag LOCUS_06990 11583 10933 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_06990 12873 11608 gene locus_tag LOCUS_07000 gene hisS 12873 11608 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080372.1 protein_id gnl|my_center|LOCUS_07000 13305 13006 gene locus_tag LOCUS_07010 13305 13006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 14655 13423 gene locus_tag LOCUS_07020 gene larC 14655 13423 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460167.1 protein_id gnl|my_center|LOCUS_07020 15902 14820 gene locus_tag LOCUS_07030 gene tgt 15902 14820 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_07030 16638 16093 gene locus_tag LOCUS_07040 16638 16093 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476463.1 protein_id gnl|my_center|LOCUS_07040 16725 17624 gene locus_tag LOCUS_07050 gene xerD 16725 17624 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700300.1 protein_id gnl|my_center|LOCUS_07050 18348 17650 gene locus_tag LOCUS_07060 18348 17650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 19210 18458 gene locus_tag LOCUS_07070 19210 18458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 20241 19363 gene locus_tag LOCUS_07080 20241 19363 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118674.1 protein_id gnl|my_center|LOCUS_07080 21476 20307 gene locus_tag LOCUS_07090 21476 20307 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028331.1 protein_id gnl|my_center|LOCUS_07090 23623 21473 gene locus_tag LOCUS_07100 23623 21473 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080133.1 protein_id gnl|my_center|LOCUS_07100 25044 23620 gene locus_tag LOCUS_07110 25044 23620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 25804 25061 gene locus_tag LOCUS_07120 25804 25061 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084048.1 protein_id gnl|my_center|LOCUS_07120 26559 25810 gene locus_tag LOCUS_07130 26559 25810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 26765 27823 gene locus_tag LOCUS_07140 26765 27823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 27930 28628 gene locus_tag LOCUS_07150 27930 28628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 28885 31932 gene locus_tag LOCUS_07160 28885 31932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 32349 32041 gene locus_tag LOCUS_07170 32349 32041 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092213181.1 protein_id gnl|my_center|LOCUS_07170 32796 32383 gene locus_tag LOCUS_07180 32796 32383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 32856 33767 gene locus_tag LOCUS_07190 32856 33767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 >Feature sequence020 2429 1704 gene locus_tag LOCUS_07200 2429 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 6424 2759 gene locus_tag LOCUS_07210 6424 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 7148 6444 gene locus_tag LOCUS_07220 7148 6444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 8408 7380 gene locus_tag LOCUS_07230 8408 7380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 9444 8428 gene locus_tag LOCUS_07240 9444 8428 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_07240 10705 9437 gene locus_tag LOCUS_07250 10705 9437 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732326.1 protein_id gnl|my_center|LOCUS_07250 11431 10742 gene locus_tag LOCUS_07260 11431 10742 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 protein_id gnl|my_center|LOCUS_07260 12692 11424 gene locus_tag LOCUS_07270 12692 11424 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_07270 12923 14092 gene locus_tag LOCUS_07280 gene czcB 12923 14092 CDS product CzcB/NccB family metal efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880415.1 protein_id gnl|my_center|LOCUS_07280 14093 17155 gene locus_tag LOCUS_07290 14093 17155 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868786.1 protein_id gnl|my_center|LOCUS_07290 17682 18821 gene locus_tag LOCUS_07300 17682 18821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 18833 19465 gene locus_tag LOCUS_07310 18833 19465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 20198 19488 gene locus_tag LOCUS_07320 gene deoC 20198 19488 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037228457.1 protein_id gnl|my_center|LOCUS_07320 20704 20213 gene locus_tag LOCUS_07330 20704 20213 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071912.1 protein_id gnl|my_center|LOCUS_07330 21672 20701 gene locus_tag LOCUS_07340 21672 20701 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160648704.1 protein_id gnl|my_center|LOCUS_07340 22091 21669 gene locus_tag LOCUS_07350 22091 21669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 23044 22088 gene locus_tag LOCUS_07360 23044 22088 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088722.1 protein_id gnl|my_center|LOCUS_07360 23702 23064 gene locus_tag LOCUS_07370 23702 23064 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083329.1 protein_id gnl|my_center|LOCUS_07370 25482 23692 gene locus_tag LOCUS_07380 gene ilvB 25482 23692 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012310511.1 protein_id gnl|my_center|LOCUS_07380 26322 25498 gene locus_tag LOCUS_07390 26322 25498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 27647 26319 gene locus_tag LOCUS_07400 gene rfbH 27647 26319 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939427.1 protein_id gnl|my_center|LOCUS_07400 28705 27635 gene locus_tag LOCUS_07410 gene rfbG 28705 27635 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 protein_id gnl|my_center|LOCUS_07410 29530 28712 gene locus_tag LOCUS_07420 gene rfbF 29530 28712 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037178.1 protein_id gnl|my_center|LOCUS_07420 29871 29683 gene locus_tag LOCUS_07430 29871 29683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 30833 30084 gene locus_tag LOCUS_07440 30833 30084 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890768.1 protein_id gnl|my_center|LOCUS_07440 32537 30849 gene locus_tag LOCUS_07450 gene leuA 32537 30849 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389681.1 protein_id gnl|my_center|LOCUS_07450 >Feature sequence021 2486 435 gene locus_tag LOCUS_07460 gene brxL 2486 435 CDS product BREX system Lon protease-like protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939301.1 protein_id gnl|my_center|LOCUS_07460 5000 2499 gene locus_tag LOCUS_07470 gene pglZ 5000 2499 CDS product BREX-1 system phosphatase PglZ type A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939302.1 protein_id gnl|my_center|LOCUS_07470 6025 4997 gene locus_tag LOCUS_07480 6025 4997 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167939813.1 protein_id gnl|my_center|LOCUS_07480 7155 6031 gene locus_tag LOCUS_07490 7155 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 9205 7979 gene locus_tag LOCUS_07500 9205 7979 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869804.1 protein_id gnl|my_center|LOCUS_07500 10983 9202 gene locus_tag LOCUS_07510 10983 9202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 14502 10993 gene locus_tag LOCUS_07520 gene brxC 14502 10993 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205228200.1 protein_id gnl|my_center|LOCUS_07520 14968 14486 gene locus_tag LOCUS_07530 14968 14486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 15946 15740 gene locus_tag LOCUS_07540 15946 15740 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 protein_id gnl|my_center|LOCUS_07540 17785 16649 gene locus_tag LOCUS_07550 17785 16649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 21283 17870 gene locus_tag LOCUS_07560 21283 17870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 22612 21314 gene locus_tag LOCUS_07570 22612 21314 CDS product glycoside hydrolase family 27 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776921.1 protein_id gnl|my_center|LOCUS_07570 23430 22624 gene locus_tag LOCUS_07580 23430 22624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 24812 23727 gene locus_tag LOCUS_07590 24812 23727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 25898 24825 gene locus_tag LOCUS_07600 25898 24825 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100168880.1 protein_id gnl|my_center|LOCUS_07600 28041 25891 gene locus_tag LOCUS_07610 28041 25891 CDS product pyruvate formate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767243.1 protein_id gnl|my_center|LOCUS_07610 28940 28038 gene locus_tag LOCUS_07620 28940 28038 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767244.1 protein_id gnl|my_center|LOCUS_07620 30019 29030 gene locus_tag LOCUS_07630 30019 29030 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226192.1 protein_id gnl|my_center|LOCUS_07630 31339 30131 gene locus_tag LOCUS_07640 31339 30131 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_07640 >Feature sequence022 1 291 gene locus_tag LOCUS_07650 1 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 329 682 gene locus_tag LOCUS_07660 gene rplU 329 682 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419082.1 protein_id gnl|my_center|LOCUS_07660 702 1598 gene locus_tag LOCUS_07670 702 1598 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_07670 1668 2426 gene locus_tag LOCUS_07680 1668 2426 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803785.1 protein_id gnl|my_center|LOCUS_07680 2444 3478 gene locus_tag LOCUS_07690 2444 3478 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203436.1 protein_id gnl|my_center|LOCUS_07690 4323 3505 gene locus_tag LOCUS_07700 4323 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 4433 5311 gene locus_tag LOCUS_07710 4433 5311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 5329 6570 gene locus_tag LOCUS_07720 5329 6570 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776531.1 protein_id gnl|my_center|LOCUS_07720 6770 7042 gene locus_tag LOCUS_07730 6770 7042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 7039 9153 gene locus_tag LOCUS_07740 7039 9153 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 protein_id gnl|my_center|LOCUS_07740 9320 9404 gene locus_tag LOCUS_t00140 9320 9404 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9592 10668 gene locus_tag LOCUS_07750 9592 10668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 10945 11250 gene locus_tag LOCUS_07760 10945 11250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 11270 13489 gene locus_tag LOCUS_07770 11270 13489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 13716 13898 gene locus_tag LOCUS_07780 13716 13898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 14458 14892 gene locus_tag LOCUS_07790 14458 14892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 14912 15934 gene locus_tag LOCUS_07800 14912 15934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 15950 16246 gene locus_tag LOCUS_07810 15950 16246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 16473 17753 gene locus_tag LOCUS_07820 16473 17753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 17744 18442 gene locus_tag LOCUS_07830 17744 18442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 18439 19353 gene locus_tag LOCUS_07840 gene xerC 18439 19353 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231988.1 protein_id gnl|my_center|LOCUS_07840 19408 20433 gene locus_tag LOCUS_07850 gene ruvB 19408 20433 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977309.1 protein_id gnl|my_center|LOCUS_07850 20582 21124 gene locus_tag LOCUS_07860 20582 21124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 21914 21177 gene locus_tag LOCUS_07870 21914 21177 CDS product PaeR7I family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176598.1 protein_id gnl|my_center|LOCUS_07870 23597 21918 gene locus_tag LOCUS_07880 23597 21918 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089418476.1 protein_id gnl|my_center|LOCUS_07880 25307 23865 gene locus_tag LOCUS_07890 25307 23865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 26019 25453 gene locus_tag LOCUS_07900 26019 25453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 26082 28034 gene locus_tag LOCUS_07910 26082 28034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 29147 28167 gene locus_tag LOCUS_07920 29147 28167 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266623.1 protein_id gnl|my_center|LOCUS_07920 29298 30515 gene locus_tag LOCUS_07930 29298 30515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 30992 30498 gene locus_tag LOCUS_07940 30992 30498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 31717 30986 gene locus_tag LOCUS_07950 gene cobS 31717 30986 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392616.1 protein_id gnl|my_center|LOCUS_07950 >Feature sequence023 1118 228 gene locus_tag LOCUS_07960 gene epmA 1118 228 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942397.1 protein_id gnl|my_center|LOCUS_07960 1870 1187 gene locus_tag LOCUS_07970 1870 1187 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904084.1 protein_id gnl|my_center|LOCUS_07970 2541 1870 gene locus_tag LOCUS_07980 gene rsxG 2541 1870 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339119.1 protein_id gnl|my_center|LOCUS_07980 3666 2548 gene locus_tag LOCUS_07990 3666 2548 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082949.1 protein_id gnl|my_center|LOCUS_07990 5019 3688 gene locus_tag LOCUS_08000 gene rsxC 5019 3688 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583453.1 protein_id gnl|my_center|LOCUS_08000 5861 5016 gene locus_tag LOCUS_08010 5861 5016 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869100.1 protein_id gnl|my_center|LOCUS_08010 6464 5874 gene locus_tag LOCUS_08020 gene rsxA 6464 5874 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761247.1 protein_id gnl|my_center|LOCUS_08020 6844 7491 gene locus_tag LOCUS_08030 6844 7491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 7488 8519 gene locus_tag LOCUS_08040 7488 8519 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086100.1 protein_id gnl|my_center|LOCUS_08040 8516 10555 gene locus_tag LOCUS_08050 8516 10555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 10540 12399 gene locus_tag LOCUS_08060 10540 12399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 12589 13053 gene locus_tag LOCUS_08070 12589 13053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 13074 13466 gene locus_tag LOCUS_08080 13074 13466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 13651 14217 gene locus_tag LOCUS_08090 gene pyrE 13651 14217 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583288.1 protein_id gnl|my_center|LOCUS_08090 14219 17263 gene locus_tag LOCUS_08100 gene secA 14219 17263 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932908.1 protein_id gnl|my_center|LOCUS_08100 18224 17568 gene locus_tag LOCUS_08110 18224 17568 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882769.1 protein_id gnl|my_center|LOCUS_08110 18576 18229 gene locus_tag LOCUS_08120 gene rplS 18576 18229 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_08120 19274 18573 gene locus_tag LOCUS_08130 gene trmD 19274 18573 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_08130 19631 19290 gene locus_tag LOCUS_08140 19631 19290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 20096 19713 gene locus_tag LOCUS_08150 20096 19713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 20442 23510 gene locus_tag LOCUS_08160 20442 23510 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027462.1 protein_id gnl|my_center|LOCUS_08160 23510 24430 gene locus_tag LOCUS_08170 23510 24430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 25516 24452 gene locus_tag LOCUS_08180 gene queA 25516 24452 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965581.1 protein_id gnl|my_center|LOCUS_08180 26381 25530 gene locus_tag LOCUS_08190 26381 25530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 28119 26560 gene locus_tag LOCUS_08200 28119 26560 CDS product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169689.1 protein_id gnl|my_center|LOCUS_08200 28518 29177 gene locus_tag LOCUS_08210 28518 29177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 29174 29806 gene locus_tag LOCUS_08220 29174 29806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 31560 29821 gene locus_tag LOCUS_08230 31560 29821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 >Feature sequence024 1669 560 gene locus_tag LOCUS_08240 1669 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 2188 1679 gene locus_tag LOCUS_08250 2188 1679 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931814.1 protein_id gnl|my_center|LOCUS_08250 2362 3135 gene locus_tag LOCUS_08260 gene hisF 2362 3135 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943716.1 protein_id gnl|my_center|LOCUS_08260 3153 4484 gene locus_tag LOCUS_08270 3153 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 5325 4567 gene locus_tag LOCUS_08280 5325 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 9518 5415 gene locus_tag LOCUS_08290 9518 5415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 9667 10593 gene locus_tag LOCUS_08300 gene rhaS 9667 10593 CDS product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217112.1 protein_id gnl|my_center|LOCUS_08300 12756 10717 gene locus_tag LOCUS_08310 12756 10717 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941556.1 protein_id gnl|my_center|LOCUS_08310 13654 12830 gene locus_tag LOCUS_08320 gene truA 13654 12830 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725204.1 protein_id gnl|my_center|LOCUS_08320 14727 13651 gene locus_tag LOCUS_08330 gene hemW 14727 13651 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460876.1 protein_id gnl|my_center|LOCUS_08330 15614 14724 gene locus_tag LOCUS_08340 15614 14724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 15738 17087 gene locus_tag LOCUS_08350 15738 17087 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028108.1 protein_id gnl|my_center|LOCUS_08350 17207 19144 gene locus_tag LOCUS_08360 17207 19144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 19167 21074 gene locus_tag LOCUS_08370 19167 21074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 21356 21856 gene locus_tag LOCUS_08380 gene ilvN 21356 21856 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545180.1 protein_id gnl|my_center|LOCUS_08380 21991 22179 gene locus_tag LOCUS_08390 21991 22179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 22248 23333 gene locus_tag LOCUS_08400 22248 23333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062194302.1 protein_id gnl|my_center|LOCUS_08400 24173 23325 gene locus_tag LOCUS_08410 24173 23325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 24259 25380 gene locus_tag LOCUS_08420 24259 25380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 26591 25419 gene locus_tag LOCUS_08430 26591 25419 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766061.1 protein_id gnl|my_center|LOCUS_08430 27585 26683 gene locus_tag LOCUS_08440 27585 26683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 27796 28569 gene locus_tag LOCUS_08450 27796 28569 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_08450 28593 30518 gene locus_tag LOCUS_08460 28593 30518 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681492.1 protein_id gnl|my_center|LOCUS_08460 31198 30617 gene locus_tag LOCUS_08470 31198 30617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 31559 31200 gene locus_tag LOCUS_08480 31559 31200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence025 1321 185 gene locus_tag LOCUS_08490 1321 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 2997 1615 gene locus_tag LOCUS_08500 2997 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 3243 4448 gene locus_tag LOCUS_08510 3243 4448 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_08510 4452 5354 gene locus_tag LOCUS_08520 gene argF 4452 5354 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584136.1 protein_id gnl|my_center|LOCUS_08520 5404 6003 gene locus_tag LOCUS_08530 5404 6003 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948910.1 protein_id gnl|my_center|LOCUS_08530 6576 6019 gene locus_tag LOCUS_08540 6576 6019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 7713 6595 gene locus_tag LOCUS_08550 7713 6595 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546105.1 protein_id gnl|my_center|LOCUS_08550 9453 7741 gene locus_tag LOCUS_08560 9453 7741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 9968 9552 gene locus_tag LOCUS_08570 9968 9552 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943269.1 protein_id gnl|my_center|LOCUS_08570 10124 12169 gene locus_tag LOCUS_08580 10124 12169 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767349.1 protein_id gnl|my_center|LOCUS_08580 13818 12226 gene locus_tag LOCUS_08590 13818 12226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 15342 13999 gene locus_tag LOCUS_08600 gene gdhA 15342 13999 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094817.1 protein_id gnl|my_center|LOCUS_08600 17452 15596 gene locus_tag LOCUS_08610 17452 15596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 17816 17535 gene locus_tag LOCUS_08620 17816 17535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 19669 17924 gene locus_tag LOCUS_08630 19669 17924 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964921.1 protein_id gnl|my_center|LOCUS_08630 19878 20132 gene locus_tag LOCUS_08640 gene rpmA 19878 20132 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258180.1 protein_id gnl|my_center|LOCUS_08640 20222 21238 gene locus_tag LOCUS_08650 gene obgE 20222 21238 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_08650 21354 23588 gene locus_tag LOCUS_08660 21354 23588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 23732 24049 gene locus_tag LOCUS_08670 23732 24049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 24933 24181 gene locus_tag LOCUS_08680 24933 24181 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986663.1 protein_id gnl|my_center|LOCUS_08680 25541 24954 gene locus_tag LOCUS_08690 25541 24954 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643829.1 protein_id gnl|my_center|LOCUS_08690 26032 25562 gene locus_tag LOCUS_08700 26032 25562 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816014.1 protein_id gnl|my_center|LOCUS_08700 26692 26615 gene locus_tag LOCUS_t00150 26692 26615 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 27385 26798 gene locus_tag LOCUS_08710 27385 26798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 29066 27420 gene locus_tag LOCUS_08720 29066 27420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 29731 29354 gene locus_tag LOCUS_08730 29731 29354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 29928 29794 gene locus_tag LOCUS_08740 gene rpmH 29928 29794 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948689.1 protein_id gnl|my_center|LOCUS_08740 >Feature sequence026 723 4250 gene locus_tag LOCUS_08750 723 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 4968 5594 gene locus_tag LOCUS_08760 4968 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 5591 6760 gene locus_tag LOCUS_08770 5591 6760 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541251.1 protein_id gnl|my_center|LOCUS_08770 7812 6805 gene locus_tag LOCUS_08780 7812 6805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 8013 8396 gene locus_tag LOCUS_08790 8013 8396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 10420 8447 gene locus_tag LOCUS_08800 10420 8447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 11076 10426 gene locus_tag LOCUS_08810 11076 10426 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159676.1 protein_id gnl|my_center|LOCUS_08810 12545 11247 gene locus_tag LOCUS_08820 12545 11247 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_08820 13859 12558 gene locus_tag LOCUS_08830 13859 12558 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082946.1 protein_id gnl|my_center|LOCUS_08830 13991 14845 gene locus_tag LOCUS_08840 13991 14845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 14927 15331 gene locus_tag LOCUS_08850 14927 15331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 16451 15339 gene locus_tag LOCUS_08860 16451 15339 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061625.1 protein_id gnl|my_center|LOCUS_08860 17574 16453 gene locus_tag LOCUS_08870 17574 16453 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389544.1 protein_id gnl|my_center|LOCUS_08870 19310 17571 gene locus_tag LOCUS_08880 19310 17571 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391778.1 protein_id gnl|my_center|LOCUS_08880 20287 19403 gene locus_tag LOCUS_08890 20287 19403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 21310 20291 gene locus_tag LOCUS_08900 21310 20291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 23090 21381 gene locus_tag LOCUS_08910 23090 21381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 23628 23083 gene locus_tag LOCUS_08920 23628 23083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 24373 23711 gene locus_tag LOCUS_08930 24373 23711 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762936.1 protein_id gnl|my_center|LOCUS_08930 25649 24381 gene locus_tag LOCUS_08940 25649 24381 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080272.1 protein_id gnl|my_center|LOCUS_08940 26473 25646 gene locus_tag LOCUS_08950 gene lpxA 26473 25646 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941664.1 protein_id gnl|my_center|LOCUS_08950 27211 26492 gene locus_tag LOCUS_08960 gene pyrH 27211 26492 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215090.1 protein_id gnl|my_center|LOCUS_08960 27387 28403 gene locus_tag LOCUS_08970 27387 28403 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_08970 28414 29271 gene locus_tag LOCUS_08980 gene ispE 28414 29271 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941321.1 protein_id gnl|my_center|LOCUS_08980 29298 30059 gene locus_tag LOCUS_08990 29298 30059 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868539.1 protein_id gnl|my_center|LOCUS_08990 >Feature sequence027 400 2007 gene locus_tag LOCUS_09000 400 2007 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626143.1 protein_id gnl|my_center|LOCUS_09000 2993 2100 gene locus_tag LOCUS_09010 2993 2100 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109171.1 protein_id gnl|my_center|LOCUS_09010 3165 3650 gene locus_tag LOCUS_09020 3165 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 3647 4756 gene locus_tag LOCUS_09030 3647 4756 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817170.1 protein_id gnl|my_center|LOCUS_09030 4767 7931 gene locus_tag LOCUS_09040 4767 7931 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393549.1 protein_id gnl|my_center|LOCUS_09040 8093 10210 gene locus_tag LOCUS_09050 8093 10210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 10497 11195 gene locus_tag LOCUS_09060 10497 11195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 11456 12538 gene locus_tag LOCUS_09070 11456 12538 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976006.1 protein_id gnl|my_center|LOCUS_09070 12591 13259 gene locus_tag LOCUS_09080 12591 13259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 13307 15760 gene locus_tag LOCUS_09090 13307 15760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 16714 15839 gene locus_tag LOCUS_09100 16714 15839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 17516 16749 gene locus_tag LOCUS_09110 17516 16749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 18634 17528 gene locus_tag LOCUS_09120 18634 17528 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584083.1 protein_id gnl|my_center|LOCUS_09120 18999 19664 gene locus_tag LOCUS_09130 18999 19664 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002938037.1 protein_id gnl|my_center|LOCUS_09130 19764 21977 gene locus_tag LOCUS_09140 19764 21977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 21980 23554 gene locus_tag LOCUS_09150 21980 23554 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261398.1 protein_id gnl|my_center|LOCUS_09150 23551 24429 gene locus_tag LOCUS_09160 23551 24429 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436936.1 protein_id gnl|my_center|LOCUS_09160 24444 25190 gene locus_tag LOCUS_09170 24444 25190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 25207 26136 gene locus_tag LOCUS_09180 25207 26136 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921630.1 protein_id gnl|my_center|LOCUS_09180 29652 26362 gene locus_tag LOCUS_09190 29652 26362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 >Feature sequence028 <1 2001 gene locus_tag LOCUS_09200 <1 2001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121080.1:ATP-dependent Clp protease ATP-binding subunit 2988 2281 gene locus_tag LOCUS_09210 2988 2281 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228828.1 protein_id gnl|my_center|LOCUS_09210 3146 3796 gene locus_tag LOCUS_09220 gene catA 3146 3796 CDS product type A chloramphenicol O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986550.1 protein_id gnl|my_center|LOCUS_09220 3844 4410 gene locus_tag LOCUS_09230 3844 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 4426 5403 gene locus_tag LOCUS_09240 4426 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 5472 6182 gene locus_tag LOCUS_09250 5472 6182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 6929 6231 gene locus_tag LOCUS_09260 6929 6231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 7320 7051 gene locus_tag LOCUS_09270 7320 7051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 7602 7357 gene locus_tag LOCUS_09280 7602 7357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 9252 7603 gene locus_tag LOCUS_09290 9252 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 9725 9249 gene locus_tag LOCUS_09300 9725 9249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 10289 9984 gene locus_tag LOCUS_09310 10289 9984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 11126 10359 gene locus_tag LOCUS_09320 11126 10359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 12238 11198 gene locus_tag LOCUS_09330 12238 11198 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393756.1 protein_id gnl|my_center|LOCUS_09330 12406 14721 gene locus_tag LOCUS_09340 12406 14721 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_09340 16828 14783 gene locus_tag LOCUS_09350 16828 14783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 18057 16894 gene locus_tag LOCUS_09360 18057 16894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 19279 18050 gene locus_tag LOCUS_09370 19279 18050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 20139 19276 gene locus_tag LOCUS_09380 20139 19276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 20502 20155 gene locus_tag LOCUS_09390 20502 20155 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942075.1 protein_id gnl|my_center|LOCUS_09390 22052 20502 gene locus_tag LOCUS_09400 22052 20502 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390841.1 protein_id gnl|my_center|LOCUS_09400 23218 22049 gene locus_tag LOCUS_09410 23218 22049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 25818 23236 gene locus_tag LOCUS_09420 25818 23236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 28322 25815 gene locus_tag LOCUS_09430 28322 25815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 29616 28483 gene locus_tag LOCUS_09440 gene glgD 29616 28483 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183792.1 protein_id gnl|my_center|LOCUS_09440 <30129 29621 gene locus_tag LOCUS_09450 <30129 29621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000787248.1:glucose-1-phosphate adenylyltransferase >Feature sequence029 1235 1310 gene locus_tag LOCUS_t00160 1235 1310 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2604 1357 gene locus_tag LOCUS_09460 2604 1357 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958631.1 protein_id gnl|my_center|LOCUS_09460 3376 2606 gene locus_tag LOCUS_09470 3376 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 4334 3378 gene locus_tag LOCUS_09480 4334 3378 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930147.1 protein_id gnl|my_center|LOCUS_09480 5461 4340 gene locus_tag LOCUS_09490 5461 4340 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122559.1 protein_id gnl|my_center|LOCUS_09490 6472 5477 gene locus_tag LOCUS_09500 6472 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 7269 6493 gene locus_tag LOCUS_09510 7269 6493 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397690.1 protein_id gnl|my_center|LOCUS_09510 8296 7250 gene locus_tag LOCUS_09520 8296 7250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 9291 8293 gene locus_tag LOCUS_09530 9291 8293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 9467 10435 gene locus_tag LOCUS_09540 9467 10435 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582579.1 protein_id gnl|my_center|LOCUS_09540 10556 11647 gene locus_tag LOCUS_09550 10556 11647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 11944 11651 gene locus_tag LOCUS_09560 11944 11651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 13163 11934 gene locus_tag LOCUS_09570 gene trpB 13163 11934 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722206.1 protein_id gnl|my_center|LOCUS_09570 14885 13509 gene locus_tag LOCUS_09580 14885 13509 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_09580 15383 14931 gene locus_tag LOCUS_09590 15383 14931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 16687 15404 gene locus_tag LOCUS_09600 gene purD 16687 15404 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327551.1 protein_id gnl|my_center|LOCUS_09600 16806 17291 gene locus_tag LOCUS_09610 16806 17291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 17335 19401 gene locus_tag LOCUS_09620 17335 19401 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263031.1 protein_id gnl|my_center|LOCUS_09620 19499 20134 gene locus_tag LOCUS_09630 19499 20134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 20183 20584 gene locus_tag LOCUS_09640 20183 20584 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243483.1 protein_id gnl|my_center|LOCUS_09640 20624 23590 gene locus_tag LOCUS_09650 20624 23590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 24404 23562 gene locus_tag LOCUS_09660 24404 23562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 25335 24421 gene locus_tag LOCUS_09670 25335 24421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 26812 25490 gene locus_tag LOCUS_09680 26812 25490 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167274874.1 protein_id gnl|my_center|LOCUS_09680 27808 26843 gene locus_tag LOCUS_09690 27808 26843 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225188.1 protein_id gnl|my_center|LOCUS_09690 >Feature sequence030 1990 41 gene locus_tag LOCUS_09700 1990 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 2784 1987 gene locus_tag LOCUS_09710 2784 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 3661 2789 gene locus_tag LOCUS_09720 3661 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 3752 4879 gene locus_tag LOCUS_09730 gene gluQRS 3752 4879 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_09730 4972 5256 gene locus_tag LOCUS_09740 4972 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 5253 5693 gene locus_tag LOCUS_09750 5253 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 5798 6391 gene locus_tag LOCUS_09760 5798 6391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 6399 7760 gene locus_tag LOCUS_09770 6399 7760 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943698.1 protein_id gnl|my_center|LOCUS_09770 7854 9356 gene locus_tag LOCUS_09780 7854 9356 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_09780 10022 10297 gene locus_tag LOCUS_09790 10022 10297 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878901.1 protein_id gnl|my_center|LOCUS_09790 11181 10366 gene locus_tag LOCUS_09800 11181 10366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 12524 11256 gene locus_tag LOCUS_09810 12524 11256 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_09810 14480 12642 gene locus_tag LOCUS_09820 gene recD 14480 12642 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942182.1 protein_id gnl|my_center|LOCUS_09820 17992 14477 gene locus_tag LOCUS_09830 gene recB 17992 14477 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942181.1 protein_id gnl|my_center|LOCUS_09830 21249 17989 gene locus_tag LOCUS_09840 gene recC 21249 17989 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942180.1 protein_id gnl|my_center|LOCUS_09840 21829 21302 gene locus_tag LOCUS_09850 21829 21302 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033534649.1 protein_id gnl|my_center|LOCUS_09850 22035 22865 gene locus_tag LOCUS_09860 22035 22865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 23891 23085 gene locus_tag LOCUS_09870 23891 23085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 23966 26473 gene locus_tag LOCUS_09880 23966 26473 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202068.1 protein_id gnl|my_center|LOCUS_09880 26553 28097 gene locus_tag LOCUS_09890 26553 28097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 >Feature sequence031 2153 1368 gene locus_tag LOCUS_09900 gene rph 2153 1368 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545252.1 protein_id gnl|my_center|LOCUS_09900 3043 2306 gene locus_tag LOCUS_09910 3043 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 4106 3321 gene locus_tag LOCUS_09920 gene accD 4106 3321 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_09920 6087 4402 gene locus_tag LOCUS_09930 gene ilvD 6087 4402 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967560.1 protein_id gnl|my_center|LOCUS_09930 6465 7919 gene locus_tag LOCUS_09940 gene ffh 6465 7919 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392481.1 protein_id gnl|my_center|LOCUS_09940 7932 8729 gene locus_tag LOCUS_09950 7932 8729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 8734 9534 gene locus_tag LOCUS_09960 8734 9534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 9552 10352 gene locus_tag LOCUS_09970 9552 10352 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390199.1 protein_id gnl|my_center|LOCUS_09970 10354 11340 gene locus_tag LOCUS_09980 10354 11340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 11346 11735 gene locus_tag LOCUS_09990 11346 11735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 11753 14290 gene locus_tag LOCUS_10000 11753 14290 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938723.1 protein_id gnl|my_center|LOCUS_10000 14287 14835 gene locus_tag LOCUS_10010 14287 14835 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390527.1 protein_id gnl|my_center|LOCUS_10010 14835 16679 gene locus_tag LOCUS_10020 14835 16679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 17866 16829 gene locus_tag LOCUS_10030 17866 16829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 20923 18026 gene locus_tag LOCUS_10040 20923 18026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 21665 20943 gene locus_tag LOCUS_10050 21665 20943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 22747 21662 gene locus_tag LOCUS_10060 22747 21662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 24446 22899 gene locus_tag LOCUS_10070 24446 22899 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671898.1 protein_id gnl|my_center|LOCUS_10070 25270 24446 gene locus_tag LOCUS_10080 25270 24446 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_10080 <28156 25322 gene locus_tag LOCUS_10090 <28156 25322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918683.1:sialate O-acetylesterase >Feature sequence032 340 1059 gene locus_tag LOCUS_10100 340 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 1072 3369 gene locus_tag LOCUS_10110 1072 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 4810 3632 gene locus_tag LOCUS_10120 gene rlmI 4810 3632 CDS product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213052.1 protein_id gnl|my_center|LOCUS_10120 5282 4836 gene locus_tag LOCUS_10130 gene nrdR 5282 4836 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399430.1 protein_id gnl|my_center|LOCUS_10130 6332 5286 gene locus_tag LOCUS_10140 6332 5286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 6464 7528 gene locus_tag LOCUS_10150 gene pheA 6464 7528 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880586.1 protein_id gnl|my_center|LOCUS_10150 7551 8432 gene locus_tag LOCUS_10160 7551 8432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 8466 9521 gene locus_tag LOCUS_10170 8466 9521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 9914 10216 gene locus_tag LOCUS_10180 9914 10216 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939490.1 protein_id gnl|my_center|LOCUS_10180 10907 10491 gene locus_tag LOCUS_10190 10907 10491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 11116 10904 gene locus_tag LOCUS_10200 11116 10904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 11468 11103 gene locus_tag LOCUS_10210 11468 11103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 11886 11458 gene locus_tag LOCUS_10220 11886 11458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 13157 11901 gene locus_tag LOCUS_10230 13157 11901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 14747 13704 gene locus_tag LOCUS_10240 14747 13704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 15986 14844 gene locus_tag LOCUS_10250 15986 14844 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061571.1 protein_id gnl|my_center|LOCUS_10250 16086 16958 gene locus_tag LOCUS_10260 16086 16958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 17067 17957 gene locus_tag LOCUS_10270 17067 17957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 18635 17991 gene locus_tag LOCUS_10280 18635 17991 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203326.1 protein_id gnl|my_center|LOCUS_10280 19446 18673 gene locus_tag LOCUS_10290 gene tam 19446 18673 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530924.1 protein_id gnl|my_center|LOCUS_10290 19748 20752 gene locus_tag LOCUS_10300 19748 20752 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810397.1 protein_id gnl|my_center|LOCUS_10300 21680 20763 gene locus_tag LOCUS_10310 21680 20763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 22177 22090 gene locus_tag LOCUS_t00170 22177 22090 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 24147 22240 gene locus_tag LOCUS_10320 gene htpG 24147 22240 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943026.1 protein_id gnl|my_center|LOCUS_10320 24407 26509 gene locus_tag LOCUS_10330 24407 26509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 26562 27587 gene locus_tag LOCUS_10340 gene argC 26562 27587 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_10340 >Feature sequence033 319 1017 gene locus_tag LOCUS_10350 319 1017 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922726.1 protein_id gnl|my_center|LOCUS_10350 1601 1116 gene locus_tag LOCUS_10360 1601 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 2337 3683 gene locus_tag LOCUS_10370 2337 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 3931 4161 gene locus_tag LOCUS_10380 3931 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 4161 4562 gene locus_tag LOCUS_10390 4161 4562 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967510.1 protein_id gnl|my_center|LOCUS_10390 5248 4679 gene locus_tag LOCUS_10400 5248 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 6441 5398 gene locus_tag LOCUS_10410 6441 5398 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140590772.1 protein_id gnl|my_center|LOCUS_10410 6646 6987 gene locus_tag LOCUS_10420 6646 6987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 8041 7286 gene locus_tag LOCUS_10430 8041 7286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 11153 8229 gene locus_tag LOCUS_10440 11153 8229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 11731 11528 gene locus_tag LOCUS_10450 11731 11528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 13745 12141 gene locus_tag LOCUS_10460 13745 12141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 15087 14731 gene locus_tag LOCUS_10470 15087 14731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 16243 16761 gene locus_tag LOCUS_10480 16243 16761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 17029 18654 gene locus_tag LOCUS_10490 17029 18654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 18876 18700 gene locus_tag LOCUS_10500 18876 18700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 18911 19597 gene locus_tag LOCUS_10510 gene idnO 18911 19597 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210264.1 protein_id gnl|my_center|LOCUS_10510 19645 20415 gene locus_tag LOCUS_10520 19645 20415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 20631 22853 gene locus_tag LOCUS_10530 20631 22853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 23298 23543 gene locus_tag LOCUS_10540 23298 23543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 25156 23600 gene locus_tag LOCUS_10550 25156 23600 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202160.1 protein_id gnl|my_center|LOCUS_10550 25432 25223 gene locus_tag LOCUS_10560 25432 25223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 25804 25436 gene locus_tag LOCUS_10570 25804 25436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 26232 25801 gene locus_tag LOCUS_10580 26232 25801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 26808 26380 gene locus_tag LOCUS_10590 26808 26380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 27407 26925 gene locus_tag LOCUS_10600 27407 26925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 >Feature sequence034 1371 2387 gene locus_tag LOCUS_10610 1371 2387 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016551819.1 protein_id gnl|my_center|LOCUS_10610 2419 2706 gene locus_tag LOCUS_10620 2419 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 3102 2707 gene locus_tag LOCUS_10630 3102 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 3463 3158 gene locus_tag LOCUS_10640 3463 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 3816 3460 gene locus_tag LOCUS_10650 3816 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 5098 4118 gene locus_tag LOCUS_10660 5098 4118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 5572 5186 gene locus_tag LOCUS_10670 5572 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 7874 5625 gene locus_tag LOCUS_10680 7874 5625 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047777.1 protein_id gnl|my_center|LOCUS_10680 8994 7861 gene locus_tag LOCUS_10690 8994 7861 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047778.1 protein_id gnl|my_center|LOCUS_10690 9860 9522 gene locus_tag LOCUS_10700 9860 9522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 10195 9857 gene locus_tag LOCUS_10710 10195 9857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 11710 10292 gene locus_tag LOCUS_10720 11710 10292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 12050 12766 gene locus_tag LOCUS_10730 12050 12766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 12868 15888 gene locus_tag LOCUS_10740 12868 15888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 15976 17559 gene locus_tag LOCUS_10750 15976 17559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 17556 19415 gene locus_tag LOCUS_10760 17556 19415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 19497 21818 gene locus_tag LOCUS_10770 19497 21818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 23481 21913 gene locus_tag LOCUS_10780 gene rtcR 23481 21913 CDS product RNA repair transcriptional activator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112813.1 protein_id gnl|my_center|LOCUS_10780 23665 24684 gene locus_tag LOCUS_10790 gene rtcA 23665 24684 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922229.1 protein_id gnl|my_center|LOCUS_10790 24681 25883 gene locus_tag LOCUS_10800 24681 25883 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230594.1 protein_id gnl|my_center|LOCUS_10800 26047 26643 gene locus_tag LOCUS_10810 26047 26643 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462102.1 protein_id gnl|my_center|LOCUS_10810 >Feature sequence035 3427 473 gene locus_tag LOCUS_10820 3427 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 4437 3529 gene locus_tag LOCUS_10830 4437 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 4608 5285 gene locus_tag LOCUS_10840 4608 5285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 5675 5328 gene locus_tag LOCUS_10850 5675 5328 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393515.1 protein_id gnl|my_center|LOCUS_10850 9094 5864 gene locus_tag LOCUS_10860 9094 5864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 9773 9135 gene locus_tag LOCUS_10870 9773 9135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 9772 9954 gene locus_tag LOCUS_10880 9772 9954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 12481 10190 gene locus_tag LOCUS_10890 12481 10190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392408.1 protein_id gnl|my_center|LOCUS_10890 12975 12817 gene locus_tag LOCUS_10900 12975 12817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 13265 13603 gene locus_tag LOCUS_10910 13265 13603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 14197 15102 gene locus_tag LOCUS_10920 14197 15102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 15555 17198 gene locus_tag LOCUS_10930 15555 17198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 18071 17592 gene locus_tag LOCUS_10940 18071 17592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 18330 18064 gene locus_tag LOCUS_10950 18330 18064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 18896 18327 gene locus_tag LOCUS_10960 18896 18327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 19247 19110 gene locus_tag LOCUS_10970 19247 19110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 19581 19492 gene locus_tag LOCUS_t00180 19581 19492 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 20809 19667 gene locus_tag LOCUS_10980 gene nagA 20809 19667 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722368.1 protein_id gnl|my_center|LOCUS_10980 21018 21926 gene locus_tag LOCUS_10990 21018 21926 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_10990 21923 23032 gene locus_tag LOCUS_11000 21923 23032 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_11000 23241 24626 gene locus_tag LOCUS_11010 23241 24626 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022654.1 protein_id gnl|my_center|LOCUS_11010 24658 25110 gene locus_tag LOCUS_11020 24658 25110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 25342 26340 gene locus_tag LOCUS_11030 25342 26340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 >Feature sequence036 1718 1065 gene locus_tag LOCUS_11040 1718 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 2829 1741 gene locus_tag LOCUS_11050 2829 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 4027 3104 gene locus_tag LOCUS_11060 4027 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 6561 4036 gene locus_tag LOCUS_11070 6561 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 6786 8201 gene locus_tag LOCUS_11080 gene gndA 6786 8201 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230365.1 protein_id gnl|my_center|LOCUS_11080 8221 8997 gene locus_tag LOCUS_11090 8221 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 9377 10408 gene locus_tag LOCUS_11100 9377 10408 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921512.1 protein_id gnl|my_center|LOCUS_11100 10468 14334 gene locus_tag LOCUS_11110 10468 14334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 14446 15195 gene locus_tag LOCUS_11120 14446 15195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 15220 16608 gene locus_tag LOCUS_11130 15220 16608 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227203.1 protein_id gnl|my_center|LOCUS_11130 18196 16652 gene locus_tag LOCUS_11140 gene hcp 18196 16652 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927070.1 protein_id gnl|my_center|LOCUS_11140 18860 18297 gene locus_tag LOCUS_11150 18860 18297 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963075.1 protein_id gnl|my_center|LOCUS_11150 19613 18972 gene locus_tag LOCUS_11160 19613 18972 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582866.1 protein_id gnl|my_center|LOCUS_11160 19783 20682 gene locus_tag LOCUS_11170 19783 20682 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921630.1 protein_id gnl|my_center|LOCUS_11170 24867 20752 gene locus_tag LOCUS_11180 24867 20752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 25587 24883 gene locus_tag LOCUS_11190 25587 24883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 <26461 25763 gene locus_tag LOCUS_11200 <26461 25763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228423.1:serine hydrolase domain-containing protein >Feature sequence037 135 1667 gene locus_tag LOCUS_11210 135 1667 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047702.1 protein_id gnl|my_center|LOCUS_11210 1797 5867 gene locus_tag LOCUS_11220 1797 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 5864 11278 gene locus_tag LOCUS_11230 5864 11278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 11431 12513 gene locus_tag LOCUS_11240 11431 12513 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977450.1 protein_id gnl|my_center|LOCUS_11240 12557 13204 gene locus_tag LOCUS_11250 12557 13204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 13233 16544 gene locus_tag LOCUS_11260 13233 16544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 16555 18783 gene locus_tag LOCUS_11270 16555 18783 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942746.1 protein_id gnl|my_center|LOCUS_11270 19671 18796 gene locus_tag LOCUS_11280 19671 18796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 19782 20852 gene locus_tag LOCUS_11290 19782 20852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 21357 22649 gene locus_tag LOCUS_11300 21357 22649 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_11300 22671 24080 gene locus_tag LOCUS_11310 22671 24080 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272364.1 protein_id gnl|my_center|LOCUS_11310 24093 24905 gene locus_tag LOCUS_11320 gene zupT 24093 24905 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861091.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence038 4242 412 gene locus_tag LOCUS_11330 4242 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 5845 4427 gene locus_tag LOCUS_11340 5845 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 9088 5882 gene locus_tag LOCUS_11350 gene carB 9088 5882 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_11350 10423 9455 gene locus_tag LOCUS_11360 gene arnC 10423 9455 CDS product undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816394.1 protein_id gnl|my_center|LOCUS_11360 12257 10407 gene locus_tag LOCUS_11370 12257 10407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 13412 12270 gene locus_tag LOCUS_11380 gene arnB 13412 12270 CDS product UDP-4-amino-4-deoxy-L-arabinose aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019842024.1 protein_id gnl|my_center|LOCUS_11380 14261 13440 gene locus_tag LOCUS_11390 gene mazG 14261 13440 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941834.1 protein_id gnl|my_center|LOCUS_11390 16588 14261 gene locus_tag LOCUS_11400 gene bamA 16588 14261 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_11400 18073 16634 gene locus_tag LOCUS_11410 gene dnaB 18073 16634 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546182.1 protein_id gnl|my_center|LOCUS_11410 18509 18060 gene locus_tag LOCUS_11420 gene rplI 18509 18060 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_11420 18761 18531 gene locus_tag LOCUS_11430 gene rpsR 18761 18531 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869404.1 protein_id gnl|my_center|LOCUS_11430 19453 18839 gene locus_tag LOCUS_11440 19453 18839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 19841 19512 gene locus_tag LOCUS_11450 19841 19512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 20487 19852 gene locus_tag LOCUS_11460 gene pth 20487 19852 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062281463.1 protein_id gnl|my_center|LOCUS_11460 21146 20514 gene locus_tag LOCUS_11470 21146 20514 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329125.1 protein_id gnl|my_center|LOCUS_11470 22145 21192 gene locus_tag LOCUS_11480 22145 21192 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546354.1 protein_id gnl|my_center|LOCUS_11480 24765 22441 gene locus_tag LOCUS_11490 24765 22441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 25470 24769 gene locus_tag LOCUS_11500 25470 24769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 >Feature sequence039 1416 328 gene locus_tag LOCUS_11510 1416 328 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732008.1 protein_id gnl|my_center|LOCUS_11510 1750 1520 gene locus_tag LOCUS_11520 1750 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 3079 2144 gene locus_tag LOCUS_11530 3079 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 4990 3101 gene locus_tag LOCUS_11540 4990 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 5423 8689 gene locus_tag LOCUS_11550 5423 8689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 8729 9466 gene locus_tag LOCUS_11560 8729 9466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 9589 11484 gene locus_tag LOCUS_11570 9589 11484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 11453 12508 gene locus_tag LOCUS_11580 11453 12508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 13054 14094 gene locus_tag LOCUS_11590 gene degA 13054 14094 CDS product transcriptional regulator DegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245813.1 protein_id gnl|my_center|LOCUS_11590 14152 16131 gene locus_tag LOCUS_11600 14152 16131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 16312 16995 gene locus_tag LOCUS_11610 16312 16995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 17019 20969 gene locus_tag LOCUS_11620 17019 20969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 20972 22120 gene locus_tag LOCUS_11630 20972 22120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 22139 22375 gene locus_tag LOCUS_11640 22139 22375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 22372 23448 gene locus_tag LOCUS_11650 22372 23448 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203436.1 protein_id gnl|my_center|LOCUS_11650 24352 23954 gene locus_tag LOCUS_11660 gene rpsI 24352 23954 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546072.1 protein_id gnl|my_center|LOCUS_11660 24796 24365 gene locus_tag LOCUS_11670 gene rplM 24796 24365 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295975.1 protein_id gnl|my_center|LOCUS_11670 <25665 25043 gene locus_tag LOCUS_11680 <25665 25043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476148.1:valine--tRNA ligase >Feature sequence040 1945 665 gene locus_tag LOCUS_11690 1945 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 2361 1960 gene locus_tag LOCUS_11700 2361 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 3207 2365 gene locus_tag LOCUS_11710 3207 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 3506 4315 gene locus_tag LOCUS_11720 gene murI 3506 4315 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_11720 4409 4849 gene locus_tag LOCUS_11730 4409 4849 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072772321.1 protein_id gnl|my_center|LOCUS_11730 4890 6608 gene locus_tag LOCUS_11740 4890 6608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 6632 7879 gene locus_tag LOCUS_11750 gene serS 6632 7879 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583734.1 protein_id gnl|my_center|LOCUS_11750 8806 7928 gene locus_tag LOCUS_11760 8806 7928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 9405 8827 gene locus_tag LOCUS_11770 9405 8827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 9613 10347 gene locus_tag LOCUS_11780 9613 10347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 11147 10383 gene locus_tag LOCUS_11790 11147 10383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 11304 12731 gene locus_tag LOCUS_11800 11304 12731 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_11800 12744 13988 gene locus_tag LOCUS_11810 gene spoVE 12744 13988 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949037.1 protein_id gnl|my_center|LOCUS_11810 13988 15118 gene locus_tag LOCUS_11820 gene murG 13988 15118 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931257.1 protein_id gnl|my_center|LOCUS_11820 15167 15529 gene locus_tag LOCUS_11830 15167 15529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 15539 15955 gene locus_tag LOCUS_11840 15539 15955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 15963 16520 gene locus_tag LOCUS_11850 gene gmhB 15963 16520 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_11850 16520 17464 gene locus_tag LOCUS_11860 16520 17464 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790916.1 protein_id gnl|my_center|LOCUS_11860 17475 19397 gene locus_tag LOCUS_11870 17475 19397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 19394 20071 gene locus_tag LOCUS_11880 19394 20071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 20128 21450 gene locus_tag LOCUS_11890 20128 21450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 21476 22024 gene locus_tag LOCUS_11900 gene amrA 21476 22024 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938040.1 protein_id gnl|my_center|LOCUS_11900 22110 23531 gene locus_tag LOCUS_11910 22110 23531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 23524 23817 gene locus_tag LOCUS_11920 23524 23817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 24233 25219 gene locus_tag LOCUS_11930 24233 25219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 >Feature sequence041 766 3102 gene locus_tag LOCUS_11940 766 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 4250 3351 gene locus_tag LOCUS_11950 4250 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 4513 5820 gene locus_tag LOCUS_11960 4513 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 5849 6610 gene locus_tag LOCUS_11970 5849 6610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 6625 9174 gene locus_tag LOCUS_11980 6625 9174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 9489 10487 gene locus_tag LOCUS_11990 9489 10487 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803764.1 protein_id gnl|my_center|LOCUS_11990 10498 11211 gene locus_tag LOCUS_12000 10498 11211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 11216 14290 gene locus_tag LOCUS_12010 11216 14290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 14287 15141 gene locus_tag LOCUS_12020 14287 15141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 15942 15241 gene locus_tag LOCUS_12030 15942 15241 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783729.1 protein_id gnl|my_center|LOCUS_12030 16635 16006 gene locus_tag LOCUS_12040 16635 16006 CDS product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107746.1 protein_id gnl|my_center|LOCUS_12040 17643 16648 gene locus_tag LOCUS_12050 gene hlyD 17643 16648 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061628.1 protein_id gnl|my_center|LOCUS_12050 17804 18826 gene locus_tag LOCUS_12060 17804 18826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 18823 19398 gene locus_tag LOCUS_12070 18823 19398 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764076.1 protein_id gnl|my_center|LOCUS_12070 20506 19403 gene locus_tag LOCUS_12080 20506 19403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 20672 20914 gene locus_tag LOCUS_12090 20672 20914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 22531 20960 gene locus_tag LOCUS_12100 22531 20960 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941965.1 protein_id gnl|my_center|LOCUS_12100 23934 22564 gene locus_tag LOCUS_12110 23934 22564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 24075 25364 gene locus_tag LOCUS_12120 24075 25364 CDS product autotransporter strand-loop-strand O-heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200982.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence042 1557 166 gene locus_tag LOCUS_12130 1557 166 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678778.1 protein_id gnl|my_center|LOCUS_12130 1826 1554 gene locus_tag LOCUS_12140 1826 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 3029 1842 gene locus_tag LOCUS_12150 3029 1842 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_12150 4752 3037 gene locus_tag LOCUS_12160 4752 3037 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396717.1 protein_id gnl|my_center|LOCUS_12160 5060 4803 gene locus_tag LOCUS_12170 5060 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 7902 5221 gene locus_tag LOCUS_12180 gene adhE 7902 5221 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056082.1 protein_id gnl|my_center|LOCUS_12180 8127 8495 gene locus_tag LOCUS_12190 8127 8495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 9327 8518 gene locus_tag LOCUS_12200 9327 8518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 10011 9334 gene locus_tag LOCUS_12210 10011 9334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 10803 10033 gene locus_tag LOCUS_12220 10803 10033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 12352 11444 gene locus_tag LOCUS_12230 12352 11444 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039237.1 protein_id gnl|my_center|LOCUS_12230 13855 12710 gene locus_tag LOCUS_12240 gene hlyD 13855 12710 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061628.1 protein_id gnl|my_center|LOCUS_12240 15658 13859 gene locus_tag LOCUS_12250 15658 13859 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966836.1 protein_id gnl|my_center|LOCUS_12250 16245 15778 gene locus_tag LOCUS_12260 16245 15778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 17093 16248 gene locus_tag LOCUS_12270 17093 16248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 18172 17090 gene locus_tag LOCUS_12280 18172 17090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 18795 18184 gene locus_tag LOCUS_12290 18795 18184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 20059 18932 gene locus_tag LOCUS_12300 20059 18932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 20155 20370 gene locus_tag LOCUS_12310 20155 20370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 21315 20374 gene locus_tag LOCUS_12320 gene htpX 21315 20374 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989629.1 protein_id gnl|my_center|LOCUS_12320 21878 21318 gene locus_tag LOCUS_12330 21878 21318 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_12330 22146 22006 gene locus_tag LOCUS_12340 22146 22006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 22485 22180 gene locus_tag LOCUS_12350 22485 22180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 23542 22634 gene locus_tag LOCUS_12360 23542 22634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 23764 24705 gene locus_tag LOCUS_12370 23764 24705 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703939.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence043 <1 1362 gene locus_tag LOCUS_12380 <1 1362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816533.1:murein biosynthesis integral membrane protein MurJ 1711 2892 gene locus_tag LOCUS_12390 1711 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 2921 3652 gene locus_tag LOCUS_12400 2921 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 3688 5580 gene locus_tag LOCUS_12410 3688 5580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 5577 7142 gene locus_tag LOCUS_12420 5577 7142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 11190 7120 gene locus_tag LOCUS_12430 11190 7120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 11948 11223 gene locus_tag LOCUS_12440 11948 11223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 12996 11998 gene locus_tag LOCUS_12450 12996 11998 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229210.1 protein_id gnl|my_center|LOCUS_12450 14718 13123 gene locus_tag LOCUS_12460 14718 13123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 15373 14705 gene locus_tag LOCUS_12470 15373 14705 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098784.1 protein_id gnl|my_center|LOCUS_12470 15586 15981 gene locus_tag LOCUS_12480 15586 15981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 16133 16321 gene locus_tag LOCUS_12490 16133 16321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 16345 17991 gene locus_tag LOCUS_12500 16345 17991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 18331 18519 gene locus_tag LOCUS_12510 18331 18519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 18607 20103 gene locus_tag LOCUS_12520 18607 20103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 21327 20053 gene locus_tag LOCUS_12530 21327 20053 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388987.1 protein_id gnl|my_center|LOCUS_12530 21460 23109 gene locus_tag LOCUS_12540 21460 23109 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788903.1 protein_id gnl|my_center|LOCUS_12540 23124 23429 gene locus_tag LOCUS_12550 gene gatC 23124 23429 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_12550 23432 24880 gene locus_tag LOCUS_12560 gene gatA 23432 24880 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943992.1 protein_id gnl|my_center|LOCUS_12560 >Feature sequence044 624 277 gene locus_tag LOCUS_12570 624 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 1203 835 gene locus_tag LOCUS_12580 1203 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 1665 1877 gene locus_tag LOCUS_12590 1665 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 2270 2058 gene locus_tag LOCUS_12600 2270 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 2662 2315 gene locus_tag LOCUS_12610 2662 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 2932 2858 gene locus_tag LOCUS_t00190 2932 2858 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3092 3784 gene locus_tag LOCUS_12620 3092 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 3847 6057 gene locus_tag LOCUS_12630 gene feoB 3847 6057 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931750.1 protein_id gnl|my_center|LOCUS_12630 6054 6725 gene locus_tag LOCUS_12640 6054 6725 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021298.1 protein_id gnl|my_center|LOCUS_12640 7426 6947 gene locus_tag LOCUS_12650 7426 6947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 8189 7551 gene locus_tag LOCUS_12660 8189 7551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 8868 8512 gene locus_tag LOCUS_12670 8868 8512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 9178 8882 gene locus_tag LOCUS_12680 9178 8882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 10450 9203 gene locus_tag LOCUS_12690 10450 9203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 12035 10590 gene locus_tag LOCUS_12700 gene amyS 12035 10590 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480254.1 protein_id gnl|my_center|LOCUS_12700 13570 12623 gene locus_tag LOCUS_12710 13570 12623 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099264237.1 protein_id gnl|my_center|LOCUS_12710 13718 15790 gene locus_tag LOCUS_12720 13718 15790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 15972 16814 gene locus_tag LOCUS_12730 15972 16814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 16843 20853 gene locus_tag LOCUS_12740 16843 20853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 20868 23420 gene locus_tag LOCUS_12750 20868 23420 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence045 1522 1884 gene locus_tag LOCUS_12760 1522 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 3088 2273 gene locus_tag LOCUS_12770 3088 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 4908 3088 gene locus_tag LOCUS_12780 4908 3088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 6082 5069 gene locus_tag LOCUS_12790 6082 5069 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729196.1 protein_id gnl|my_center|LOCUS_12790 7110 6097 gene locus_tag LOCUS_12800 7110 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 9080 7329 gene locus_tag LOCUS_12810 9080 7329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 11063 9081 gene locus_tag LOCUS_12820 11063 9081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 11758 11066 gene locus_tag LOCUS_12830 11758 11066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 12671 11943 gene locus_tag LOCUS_12840 12671 11943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 13024 15174 gene locus_tag LOCUS_12850 13024 15174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 16691 16122 gene locus_tag LOCUS_12860 16691 16122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 19419 17308 gene locus_tag LOCUS_12870 19419 17308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 20324 19410 gene locus_tag LOCUS_12880 20324 19410 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208518.1 protein_id gnl|my_center|LOCUS_12880 22207 20363 gene locus_tag LOCUS_12890 22207 20363 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764318.1 protein_id gnl|my_center|LOCUS_12890 23170 22511 gene locus_tag LOCUS_12900 23170 22511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 >Feature sequence046 3 905 gene locus_tag LOCUS_12910 3 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 898 1776 gene locus_tag LOCUS_12920 898 1776 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257710.1 protein_id gnl|my_center|LOCUS_12920 2839 1790 gene locus_tag LOCUS_12930 2839 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 3202 5055 gene locus_tag LOCUS_12940 gene mnmG 3202 5055 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944073.1 protein_id gnl|my_center|LOCUS_12940 5052 5987 gene locus_tag LOCUS_12950 5052 5987 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868768.1 protein_id gnl|my_center|LOCUS_12950 6005 6385 gene locus_tag LOCUS_12960 6005 6385 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948047.1 protein_id gnl|my_center|LOCUS_12960 7932 6418 gene locus_tag LOCUS_12970 7932 6418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 8343 7948 gene locus_tag LOCUS_12980 8343 7948 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640294.1 protein_id gnl|my_center|LOCUS_12980 9234 8383 gene locus_tag LOCUS_12990 9234 8383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 10153 9227 gene locus_tag LOCUS_13000 10153 9227 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259448.1 protein_id gnl|my_center|LOCUS_13000 10683 10150 gene locus_tag LOCUS_13010 10683 10150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 11300 10698 gene locus_tag LOCUS_13020 11300 10698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 13044 11701 gene locus_tag LOCUS_13030 13044 11701 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809868.1 protein_id gnl|my_center|LOCUS_13030 13276 14832 gene locus_tag LOCUS_13040 13276 14832 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_13040 14838 17171 gene locus_tag LOCUS_13050 gene galB 14838 17171 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202546.1 protein_id gnl|my_center|LOCUS_13050 17933 17181 gene locus_tag LOCUS_13060 17933 17181 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355616.1 protein_id gnl|my_center|LOCUS_13060 18645 17926 gene locus_tag LOCUS_13070 18645 17926 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 protein_id gnl|my_center|LOCUS_13070 19401 18658 gene locus_tag LOCUS_13080 19401 18658 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005915025.1 protein_id gnl|my_center|LOCUS_13080 21561 19474 gene locus_tag LOCUS_13090 21561 19474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 21756 22589 gene locus_tag LOCUS_13100 21756 22589 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769713.1 protein_id gnl|my_center|LOCUS_13100 23460 22699 gene locus_tag LOCUS_13110 23460 22699 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089546.1 protein_id gnl|my_center|LOCUS_13110 23940 23653 gene locus_tag LOCUS_13120 23940 23653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 24299 24598 gene locus_tag LOCUS_13130 24299 24598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 >Feature sequence047 611 183 gene locus_tag LOCUS_13140 611 183 CDS product radical SAM mobile pair system MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679434.1 protein_id gnl|my_center|LOCUS_13140 1020 1553 gene locus_tag LOCUS_13150 1020 1553 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107760.1 protein_id gnl|my_center|LOCUS_13150 1579 1821 gene locus_tag LOCUS_13160 1579 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 2310 1891 gene locus_tag LOCUS_13170 2310 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 2868 2395 gene locus_tag LOCUS_13180 2868 2395 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851141.1 protein_id gnl|my_center|LOCUS_13180 3882 2989 gene locus_tag LOCUS_13190 3882 2989 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_13190 4035 4286 gene locus_tag LOCUS_13200 4035 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 4288 4875 gene locus_tag LOCUS_13210 4288 4875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 4884 5930 gene locus_tag LOCUS_13220 4884 5930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 5946 6389 gene locus_tag LOCUS_13230 5946 6389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 6394 7053 gene locus_tag LOCUS_13240 6394 7053 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966606.1 protein_id gnl|my_center|LOCUS_13240 7065 8042 gene locus_tag LOCUS_13250 7065 8042 CDS product DUF6282 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007717423.1 protein_id gnl|my_center|LOCUS_13250 8062 9348 gene locus_tag LOCUS_13260 8062 9348 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080165.1 protein_id gnl|my_center|LOCUS_13260 10320 9418 gene locus_tag LOCUS_13270 10320 9418 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_13270 10455 10703 gene locus_tag LOCUS_13280 10455 10703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 10707 11903 gene locus_tag LOCUS_13290 10707 11903 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211257.1 protein_id gnl|my_center|LOCUS_13290 11917 13080 gene locus_tag LOCUS_13300 11917 13080 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295292.1 protein_id gnl|my_center|LOCUS_13300 13285 14622 gene locus_tag LOCUS_13310 13285 14622 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203639.1 protein_id gnl|my_center|LOCUS_13310 14696 15199 gene locus_tag LOCUS_13320 14696 15199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 15223 15438 gene locus_tag LOCUS_13330 15223 15438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13330 15435 16169 gene locus_tag LOCUS_13340 gene tatC 15435 16169 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266364.1 protein_id gnl|my_center|LOCUS_13340 16156 17400 gene locus_tag LOCUS_13350 16156 17400 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964085.1 protein_id gnl|my_center|LOCUS_13350 17726 18502 gene locus_tag LOCUS_13360 17726 18502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 18541 21549 gene locus_tag LOCUS_13370 18541 21549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 21569 23416 gene locus_tag LOCUS_13380 21569 23416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 23505 24524 gene locus_tag LOCUS_13390 23505 24524 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099264237.1 protein_id gnl|my_center|LOCUS_13390 >Feature sequence048 <1 1326 gene locus_tag LOCUS_13400 <1 1326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202102.1:alpha-N-acetylglucosaminidase 1533 2558 gene locus_tag LOCUS_13410 1533 2558 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311173.1 protein_id gnl|my_center|LOCUS_13410 2574 3158 gene locus_tag LOCUS_13420 2574 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 3261 4322 gene locus_tag LOCUS_13430 3261 4322 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_13430 4319 5050 gene locus_tag LOCUS_13440 4319 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 5060 6601 gene locus_tag LOCUS_13450 5060 6601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 6964 6791 gene locus_tag LOCUS_13460 6964 6791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 7109 7627 gene locus_tag LOCUS_13470 7109 7627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 7870 8718 gene locus_tag LOCUS_13480 7870 8718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 8895 9965 gene locus_tag LOCUS_13490 8895 9965 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088184.1 protein_id gnl|my_center|LOCUS_13490 9981 10973 gene locus_tag LOCUS_13500 9981 10973 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393751.1 protein_id gnl|my_center|LOCUS_13500 11291 12265 gene locus_tag LOCUS_13510 11291 12265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 12750 12677 gene locus_tag LOCUS_t00200 12750 12677 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 13055 13681 gene locus_tag LOCUS_13520 13055 13681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 14848 13754 gene locus_tag LOCUS_13530 14848 13754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 15077 15154 gene locus_tag LOCUS_t00210 15077 15154 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 15216 16148 gene locus_tag LOCUS_13540 15216 16148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 17612 16341 gene locus_tag LOCUS_13550 17612 16341 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_13550 18415 17609 gene locus_tag LOCUS_13560 18415 17609 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179944199.1 protein_id gnl|my_center|LOCUS_13560 19941 18415 gene locus_tag LOCUS_13570 19941 18415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 21614 19944 gene locus_tag LOCUS_13580 21614 19944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 21887 23461 gene locus_tag LOCUS_13590 21887 23461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 >Feature sequence049 1890 256 gene locus_tag LOCUS_13600 gene groL 1890 256 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392083.1 protein_id gnl|my_center|LOCUS_13600 2247 1951 gene locus_tag LOCUS_13610 gene groES 2247 1951 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583322.1 protein_id gnl|my_center|LOCUS_13610 4272 2365 gene locus_tag LOCUS_13620 gene dnaK 4272 2365 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_13620 4591 4905 gene locus_tag LOCUS_13630 gene trxA 4591 4905 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020199.1 protein_id gnl|my_center|LOCUS_13630 5037 5408 gene locus_tag LOCUS_13640 gene queD 5037 5408 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546681.1 protein_id gnl|my_center|LOCUS_13640 5416 6057 gene locus_tag LOCUS_13650 gene queE 5416 6057 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120697.1 protein_id gnl|my_center|LOCUS_13650 6311 6072 gene locus_tag LOCUS_13660 6311 6072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 7554 6241 gene locus_tag LOCUS_13670 7554 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 8292 7579 gene locus_tag LOCUS_13680 8292 7579 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051345837.1 protein_id gnl|my_center|LOCUS_13680 9692 8319 gene locus_tag LOCUS_13690 9692 8319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 9827 10786 gene locus_tag LOCUS_13700 9827 10786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 13293 10801 gene locus_tag LOCUS_13710 gene hrpB 13293 10801 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440436.1 protein_id gnl|my_center|LOCUS_13710 14446 13334 gene locus_tag LOCUS_13720 14446 13334 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126014666.1 protein_id gnl|my_center|LOCUS_13720 14598 15692 gene locus_tag LOCUS_13730 14598 15692 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095405.1 protein_id gnl|my_center|LOCUS_13730 15725 16471 gene locus_tag LOCUS_13740 15725 16471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 16486 19833 gene locus_tag LOCUS_13750 16486 19833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 19893 20690 gene locus_tag LOCUS_13760 19893 20690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 20677 23307 gene locus_tag LOCUS_13770 20677 23307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 >Feature sequence050 619 56 gene locus_tag LOCUS_13780 619 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 1163 2914 gene locus_tag LOCUS_13790 1163 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 3037 4194 gene locus_tag LOCUS_13800 3037 4194 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116062060.1 protein_id gnl|my_center|LOCUS_13800 9598 4211 gene locus_tag LOCUS_13810 9598 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 10319 9615 gene locus_tag LOCUS_13820 10319 9615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 11467 10505 gene locus_tag LOCUS_13830 11467 10505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 12482 11430 gene locus_tag LOCUS_13840 12482 11430 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089653.1 protein_id gnl|my_center|LOCUS_13840 12582 13412 gene locus_tag LOCUS_13850 12582 13412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 13583 13837 gene locus_tag LOCUS_13860 13583 13837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 14377 22209 gene locus_tag LOCUS_13870 14377 22209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 22231 22374 gene locus_tag LOCUS_13880 22231 22374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 22376 23239 gene locus_tag LOCUS_13890 22376 23239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 >Feature sequence051 2397 3389 gene locus_tag LOCUS_13900 gene ilvC 2397 3389 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392863.1 protein_id gnl|my_center|LOCUS_13900 3618 5492 gene locus_tag LOCUS_13910 3618 5492 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251419.1 protein_id gnl|my_center|LOCUS_13910 5499 6695 gene locus_tag LOCUS_13920 5499 6695 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170942.1 protein_id gnl|my_center|LOCUS_13920 6689 7435 gene locus_tag LOCUS_13930 gene rhgT 6689 7435 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233825.1 protein_id gnl|my_center|LOCUS_13930 7447 7749 gene locus_tag LOCUS_13940 7447 7749 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207800.1 protein_id gnl|my_center|LOCUS_13940 7774 8484 gene locus_tag LOCUS_13950 7774 8484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 9680 8439 gene locus_tag LOCUS_13960 9680 8439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 10657 9668 gene locus_tag LOCUS_13970 gene rfaD 10657 9668 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546025.1 protein_id gnl|my_center|LOCUS_13970 13299 10660 gene locus_tag LOCUS_13980 13299 10660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 14966 13296 gene locus_tag LOCUS_13990 14966 13296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 15797 14985 gene locus_tag LOCUS_14000 15797 14985 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938977.1 protein_id gnl|my_center|LOCUS_14000 16485 15880 gene locus_tag LOCUS_14010 16485 15880 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545768.1 protein_id gnl|my_center|LOCUS_14010 16556 17935 gene locus_tag LOCUS_14020 gene tilS 16556 17935 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942455.1 protein_id gnl|my_center|LOCUS_14020 18424 19470 gene locus_tag LOCUS_14030 18424 19470 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969920.1 protein_id gnl|my_center|LOCUS_14030 19467 20192 gene locus_tag LOCUS_14040 19467 20192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 20207 22849 gene locus_tag LOCUS_14050 20207 22849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 >Feature sequence052 4 1611 gene locus_tag LOCUS_14060 4 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 2092 1928 gene locus_tag LOCUS_14070 2092 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 2222 2875 gene locus_tag LOCUS_14080 2222 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 2888 4393 gene locus_tag LOCUS_14090 2888 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 5596 4412 gene locus_tag LOCUS_14100 5596 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 6659 5598 gene locus_tag LOCUS_14110 6659 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 7430 6672 gene locus_tag LOCUS_14120 7430 6672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 9790 7505 gene locus_tag LOCUS_14130 9790 7505 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082096.1 protein_id gnl|my_center|LOCUS_14130 9956 10975 gene locus_tag LOCUS_14140 9956 10975 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091307767.1 protein_id gnl|my_center|LOCUS_14140 12903 11107 gene locus_tag LOCUS_14150 12903 11107 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 protein_id gnl|my_center|LOCUS_14150 14202 13045 gene locus_tag LOCUS_14160 14202 13045 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126014666.1 protein_id gnl|my_center|LOCUS_14160 14419 15123 gene locus_tag LOCUS_14170 14419 15123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 15137 18916 gene locus_tag LOCUS_14180 15137 18916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 18956 19897 gene locus_tag LOCUS_14190 18956 19897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 20023 20529 gene locus_tag LOCUS_14200 20023 20529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 20462 21334 gene locus_tag LOCUS_14210 20462 21334 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974125.1 protein_id gnl|my_center|LOCUS_14210 21348 22709 gene locus_tag LOCUS_14220 21348 22709 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027550.1 protein_id gnl|my_center|LOCUS_14220 >Feature sequence053 2 520 gene locus_tag LOCUS_14230 2 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 1644 544 gene locus_tag LOCUS_14240 gene thiH 1644 544 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393166.1 protein_id gnl|my_center|LOCUS_14240 2433 1660 gene locus_tag LOCUS_14250 gene thiG 2433 1660 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944065.1 protein_id gnl|my_center|LOCUS_14250 3072 2467 gene locus_tag LOCUS_14260 gene thiF 3072 2467 CDS product sulfur carrier protein ThiS adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939369.1 protein_id gnl|my_center|LOCUS_14260 3272 3075 gene locus_tag LOCUS_14270 3272 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 5277 3433 gene locus_tag LOCUS_14280 5277 3433 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_14280 7396 5423 gene locus_tag LOCUS_14290 7396 5423 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942735.1 protein_id gnl|my_center|LOCUS_14290 10063 7424 gene locus_tag LOCUS_14300 10063 7424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 11865 10075 gene locus_tag LOCUS_14310 11865 10075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 12401 11862 gene locus_tag LOCUS_14320 12401 11862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 12599 13717 gene locus_tag LOCUS_14330 gene lptF 12599 13717 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_14330 13734 15575 gene locus_tag LOCUS_14340 13734 15575 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939361.1 protein_id gnl|my_center|LOCUS_14340 15607 16410 gene locus_tag LOCUS_14350 gene dapB 15607 16410 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940836.1 protein_id gnl|my_center|LOCUS_14350 16438 17298 gene locus_tag LOCUS_14360 16438 17298 CDS product DUF4886 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119653.1 protein_id gnl|my_center|LOCUS_14360 17295 18491 gene locus_tag LOCUS_14370 gene lpxB 17295 18491 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938656.1 protein_id gnl|my_center|LOCUS_14370 19053 18472 gene locus_tag LOCUS_14380 19053 18472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 19904 19326 gene locus_tag LOCUS_14390 19904 19326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 20209 21714 gene locus_tag LOCUS_14400 20209 21714 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869758.1 protein_id gnl|my_center|LOCUS_14400 21698 22447 gene locus_tag LOCUS_14410 21698 22447 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108916.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence054 2474 804 gene locus_tag LOCUS_14420 2474 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 3897 2485 gene locus_tag LOCUS_14430 3897 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 4612 5616 gene locus_tag LOCUS_14440 4612 5616 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_14440 5772 6518 gene locus_tag LOCUS_14450 5772 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 6730 7413 gene locus_tag LOCUS_14460 6730 7413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 7427 11203 gene locus_tag LOCUS_14470 7427 11203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 14155 11303 gene locus_tag LOCUS_14480 14155 11303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 15688 14414 gene locus_tag LOCUS_14490 gene eno 15688 14414 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785741.1 protein_id gnl|my_center|LOCUS_14490 15884 16456 gene locus_tag LOCUS_14500 15884 16456 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272666.1 protein_id gnl|my_center|LOCUS_14500 16483 17256 gene locus_tag LOCUS_14510 16483 17256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 17258 17986 gene locus_tag LOCUS_14520 17258 17986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 18903 18004 gene locus_tag LOCUS_14530 18903 18004 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939546.1 protein_id gnl|my_center|LOCUS_14530 21082 18905 gene locus_tag LOCUS_14540 21082 18905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 21193 21996 gene locus_tag LOCUS_14550 21193 21996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 >Feature sequence055 810 118 gene locus_tag LOCUS_14560 810 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 1825 866 gene locus_tag LOCUS_14570 1825 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 2356 1883 gene locus_tag LOCUS_14580 2356 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 2807 2439 gene locus_tag LOCUS_14590 2807 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 7984 2852 gene locus_tag LOCUS_14600 7984 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 8422 8171 gene locus_tag LOCUS_14610 8422 8171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 8802 8461 gene locus_tag LOCUS_14620 8802 8461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 9058 8837 gene locus_tag LOCUS_14630 9058 8837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 9812 9093 gene locus_tag LOCUS_14640 9812 9093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 10051 10554 gene locus_tag LOCUS_14650 10051 10554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 11930 10587 gene locus_tag LOCUS_14660 11930 10587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 13623 12844 gene locus_tag LOCUS_14670 13623 12844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 14603 13722 gene locus_tag LOCUS_14680 14603 13722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 15014 14634 gene locus_tag LOCUS_14690 15014 14634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 15267 15007 gene locus_tag LOCUS_14700 15267 15007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 15581 15315 gene locus_tag LOCUS_14710 15581 15315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 15799 16011 gene locus_tag LOCUS_14720 15799 16011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 16539 16138 gene locus_tag LOCUS_14730 16539 16138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 17027 16524 gene locus_tag LOCUS_14740 17027 16524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 17254 17024 gene locus_tag LOCUS_14750 17254 17024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 17609 17364 gene locus_tag LOCUS_14760 17609 17364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 18393 18142 gene locus_tag LOCUS_14770 18393 18142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 18718 18332 gene locus_tag LOCUS_14780 18718 18332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 19131 18715 gene locus_tag LOCUS_14790 19131 18715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 19783 19625 gene locus_tag LOCUS_14800 19783 19625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 21566 19989 gene locus_tag LOCUS_14810 21566 19989 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202160.1 protein_id gnl|my_center|LOCUS_14810 21807 21634 gene locus_tag LOCUS_14820 21807 21634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 22000 21800 gene locus_tag LOCUS_14830 22000 21800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 >Feature sequence056 2270 3112 gene locus_tag LOCUS_14840 2270 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 3109 4620 gene locus_tag LOCUS_14850 3109 4620 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267807.1 protein_id gnl|my_center|LOCUS_14850 4635 5414 gene locus_tag LOCUS_14860 4635 5414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 5690 6397 gene locus_tag LOCUS_14870 5690 6397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14870 6394 7635 gene locus_tag LOCUS_14880 6394 7635 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203010.1 protein_id gnl|my_center|LOCUS_14880 7916 7620 gene locus_tag LOCUS_14890 7916 7620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 8141 7929 gene locus_tag LOCUS_14900 8141 7929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 8402 9484 gene locus_tag LOCUS_14910 8402 9484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 9471 10307 gene locus_tag LOCUS_14920 9471 10307 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203012.1 protein_id gnl|my_center|LOCUS_14920 10454 11209 gene locus_tag LOCUS_14930 10454 11209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 11206 12012 gene locus_tag LOCUS_14940 11206 12012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203007.1 protein_id gnl|my_center|LOCUS_14940 12063 13238 gene locus_tag LOCUS_14950 12063 13238 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203057.1 protein_id gnl|my_center|LOCUS_14950 13268 14527 gene locus_tag LOCUS_14960 13268 14527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 15018 15671 gene locus_tag LOCUS_14970 15018 15671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 15805 16509 gene locus_tag LOCUS_14980 15805 16509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 16843 16526 gene locus_tag LOCUS_14990 16843 16526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 17276 17058 gene locus_tag LOCUS_15000 17276 17058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 17905 18672 gene locus_tag LOCUS_15010 17905 18672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 19081 19548 gene locus_tag LOCUS_15020 19081 19548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 19550 20401 gene locus_tag LOCUS_15030 gene rfbD 19550 20401 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_15030 20405 21670 gene locus_tag LOCUS_15040 20405 21670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 >Feature sequence057 1988 2458 gene locus_tag LOCUS_15050 1988 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 2461 3009 gene locus_tag LOCUS_15060 2461 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15060 3006 4058 gene locus_tag LOCUS_15070 3006 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15070 4688 4143 gene locus_tag LOCUS_15080 4688 4143 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966026.1 protein_id gnl|my_center|LOCUS_15080 6964 4754 gene locus_tag LOCUS_15090 6964 4754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 7110 7526 gene locus_tag LOCUS_15100 7110 7526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 8747 7560 gene locus_tag LOCUS_15110 8747 7560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 9515 8862 gene locus_tag LOCUS_15120 9515 8862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 11149 9578 gene locus_tag LOCUS_15130 gene serA 11149 9578 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_15130 12089 11238 gene locus_tag LOCUS_15140 12089 11238 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363393.1 protein_id gnl|my_center|LOCUS_15140 14193 12091 gene locus_tag LOCUS_15150 14193 12091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 14428 15510 gene locus_tag LOCUS_15160 14428 15510 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203436.1 protein_id gnl|my_center|LOCUS_15160 17037 15517 gene locus_tag LOCUS_15170 17037 15517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 17825 17127 gene locus_tag LOCUS_15180 17825 17127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 18835 17822 gene locus_tag LOCUS_15190 18835 17822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 19878 18865 gene locus_tag LOCUS_15200 gene cytR 19878 18865 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644904.1 protein_id gnl|my_center|LOCUS_15200 21180 20311 gene locus_tag LOCUS_15210 21180 20311 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082270.1 protein_id gnl|my_center|LOCUS_15210 >Feature sequence058 413 1273 gene locus_tag LOCUS_15220 gene rpsB 413 1273 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220918.1 protein_id gnl|my_center|LOCUS_15220 1305 2111 gene locus_tag LOCUS_15230 gene tsf 1305 2111 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699817.1 protein_id gnl|my_center|LOCUS_15230 2761 2477 gene locus_tag LOCUS_15240 2761 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15240 3363 2800 gene locus_tag LOCUS_15250 3363 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15250 3387 3602 gene locus_tag LOCUS_15260 3387 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 4397 3990 gene locus_tag LOCUS_15270 4397 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15270 4652 4470 gene locus_tag LOCUS_15280 4652 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 5992 4649 gene locus_tag LOCUS_15290 5992 4649 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803818.1 protein_id gnl|my_center|LOCUS_15290 6257 8596 gene locus_tag LOCUS_15300 6257 8596 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615777.1 protein_id gnl|my_center|LOCUS_15300 9919 8615 gene locus_tag LOCUS_15310 9919 8615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 10064 11050 gene locus_tag LOCUS_15320 10064 11050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 11361 12119 gene locus_tag LOCUS_15330 11361 12119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 12154 14529 gene locus_tag LOCUS_15340 12154 14529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 14570 15649 gene locus_tag LOCUS_15350 14570 15649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 15859 16461 gene locus_tag LOCUS_15360 15859 16461 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641962.1 protein_id gnl|my_center|LOCUS_15360 16579 18141 gene locus_tag LOCUS_15370 16579 18141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 18271 19095 gene locus_tag LOCUS_15380 gene mutM 18271 19095 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372546.1 protein_id gnl|my_center|LOCUS_15380 19228 20415 gene locus_tag LOCUS_15390 19228 20415 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142594.1 protein_id gnl|my_center|LOCUS_15390 20438 20920 gene locus_tag LOCUS_15400 20438 20920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 >Feature sequence059 1465 1389 gene locus_tag LOCUS_t00220 1465 1389 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2492 1743 gene locus_tag LOCUS_15410 2492 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 2806 3429 gene locus_tag LOCUS_15420 2806 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 4790 3474 gene locus_tag LOCUS_15430 4790 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 6205 4787 gene locus_tag LOCUS_15440 6205 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 6645 6202 gene locus_tag LOCUS_15450 6645 6202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 7533 6655 gene locus_tag LOCUS_15460 7533 6655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 8427 7543 gene locus_tag LOCUS_15470 8427 7543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 10174 8429 gene locus_tag LOCUS_15480 10174 8429 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_15480 10975 10196 gene locus_tag LOCUS_15490 10975 10196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 11947 11087 gene locus_tag LOCUS_15500 11947 11087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 12161 11952 gene locus_tag LOCUS_15510 12161 11952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 12927 12265 gene locus_tag LOCUS_15520 12927 12265 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392265.1 protein_id gnl|my_center|LOCUS_15520 13562 12927 gene locus_tag LOCUS_15530 gene nth 13562 12927 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116115.1 protein_id gnl|my_center|LOCUS_15530 14179 13562 gene locus_tag LOCUS_15540 gene hisH 14179 13562 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_15540 14522 15307 gene locus_tag LOCUS_15550 14522 15307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 15333 16451 gene locus_tag LOCUS_15560 15333 16451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 16448 18406 gene locus_tag LOCUS_15570 16448 18406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 >Feature sequence060 2323 992 gene locus_tag LOCUS_15580 2323 992 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804146.1 protein_id gnl|my_center|LOCUS_15580 4856 2529 gene locus_tag LOCUS_15590 4856 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 5559 4882 gene locus_tag LOCUS_15600 5559 4882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 6636 5563 gene locus_tag LOCUS_15610 6636 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 6865 7485 gene locus_tag LOCUS_15620 6865 7485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 7508 8257 gene locus_tag LOCUS_15630 7508 8257 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598675.1 protein_id gnl|my_center|LOCUS_15630 10152 8668 gene locus_tag LOCUS_15640 gene zwf 10152 8668 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080226.1 protein_id gnl|my_center|LOCUS_15640 10952 10170 gene locus_tag LOCUS_15650 10952 10170 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330362.1 protein_id gnl|my_center|LOCUS_15650 12433 10949 gene locus_tag LOCUS_15660 12433 10949 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080425.1 protein_id gnl|my_center|LOCUS_15660 12712 13203 gene locus_tag LOCUS_15670 12712 13203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 15075 13252 gene locus_tag LOCUS_15680 15075 13252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 16503 15097 gene locus_tag LOCUS_15690 16503 15097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 17804 16632 gene locus_tag LOCUS_15700 17804 16632 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940592.1 protein_id gnl|my_center|LOCUS_15700 18444 17881 gene locus_tag LOCUS_15710 gene kdpC 18444 17881 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973321.1 protein_id gnl|my_center|LOCUS_15710 20520 18463 gene locus_tag LOCUS_15720 gene kdpB 20520 18463 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963801.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence061 737 2608 gene locus_tag LOCUS_15730 737 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 2994 4067 gene locus_tag LOCUS_15740 2994 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 6264 4027 gene locus_tag LOCUS_15750 6264 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 7383 6751 gene locus_tag LOCUS_15760 7383 6751 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136894.1 protein_id gnl|my_center|LOCUS_15760 7850 7380 gene locus_tag LOCUS_15770 7850 7380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 10039 7847 gene locus_tag LOCUS_15780 gene ppk1 10039 7847 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141500.1 protein_id gnl|my_center|LOCUS_15780 11607 10036 gene locus_tag LOCUS_15790 11607 10036 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329914.1 protein_id gnl|my_center|LOCUS_15790 12187 11624 gene locus_tag LOCUS_15800 12187 11624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 12322 13167 gene locus_tag LOCUS_15810 gene aroE 12322 13167 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812091.1 protein_id gnl|my_center|LOCUS_15810 13161 14057 gene locus_tag LOCUS_15820 13161 14057 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_15820 14153 15397 gene locus_tag LOCUS_15830 14153 15397 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258147.1 protein_id gnl|my_center|LOCUS_15830 15497 17395 gene locus_tag LOCUS_15840 15497 17395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 17414 18043 gene locus_tag LOCUS_15850 17414 18043 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_15850 18059 18598 gene locus_tag LOCUS_15860 gene folE 18059 18598 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091896.1 protein_id gnl|my_center|LOCUS_15860 18595 19035 gene locus_tag LOCUS_15870 gene dtd 18595 19035 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071581519.1 protein_id gnl|my_center|LOCUS_15870 19036 20184 gene locus_tag LOCUS_15880 19036 20184 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766370.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence062 223 2889 gene locus_tag LOCUS_15890 223 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 3258 3971 gene locus_tag LOCUS_15900 3258 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 3972 5159 gene locus_tag LOCUS_15910 3972 5159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 5205 8456 gene locus_tag LOCUS_15920 5205 8456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 11946 8506 gene locus_tag LOCUS_15930 11946 8506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 12619 11957 gene locus_tag LOCUS_15940 12619 11957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 13602 12616 gene locus_tag LOCUS_15950 13602 12616 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976006.1 protein_id gnl|my_center|LOCUS_15950 14630 13797 gene locus_tag LOCUS_15960 14630 13797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 14808 15512 gene locus_tag LOCUS_15970 14808 15512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 15527 17920 gene locus_tag LOCUS_15980 15527 17920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 18471 17914 gene locus_tag LOCUS_15990 18471 17914 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581032.1 protein_id gnl|my_center|LOCUS_15990 18629 19918 gene locus_tag LOCUS_16000 18629 19918 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942548.1 protein_id gnl|my_center|LOCUS_16000 >Feature sequence063 366 1301 gene locus_tag LOCUS_16010 366 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 1857 1288 gene locus_tag LOCUS_16020 1857 1288 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108149.1 protein_id gnl|my_center|LOCUS_16020 3263 1893 gene locus_tag LOCUS_16030 3263 1893 CDS product L-cystine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094344.1 protein_id gnl|my_center|LOCUS_16030 3519 5720 gene locus_tag LOCUS_16040 gene gshAB 3519 5720 CDS product bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990064.1 protein_id gnl|my_center|LOCUS_16040 6604 5756 gene locus_tag LOCUS_16050 gene araC 6604 5756 CDS product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045790020.1 protein_id gnl|my_center|LOCUS_16050 6725 8278 gene locus_tag LOCUS_16060 6725 8278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 8290 9879 gene locus_tag LOCUS_16070 8290 9879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 9899 10570 gene locus_tag LOCUS_16080 9899 10570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 11466 10648 gene locus_tag LOCUS_16090 11466 10648 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099264237.1 protein_id gnl|my_center|LOCUS_16090 11804 11520 gene locus_tag LOCUS_16100 11804 11520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 13228 11873 gene locus_tag LOCUS_16110 13228 11873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 14805 13225 gene locus_tag LOCUS_16120 14805 13225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 15494 14820 gene locus_tag LOCUS_16130 15494 14820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 16063 15491 gene locus_tag LOCUS_16140 16063 15491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 17453 16089 gene locus_tag LOCUS_16150 gene glmM 17453 16089 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839748.1 protein_id gnl|my_center|LOCUS_16150 17678 18382 gene locus_tag LOCUS_16160 17678 18382 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_16160 18396 19394 gene locus_tag LOCUS_16170 18396 19394 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_16170 >Feature sequence064 2043 604 gene locus_tag LOCUS_16180 2043 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 3146 2052 gene locus_tag LOCUS_16190 3146 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 3398 4297 gene locus_tag LOCUS_16200 3398 4297 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229868.1 protein_id gnl|my_center|LOCUS_16200 4995 4318 gene locus_tag LOCUS_16210 4995 4318 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048325.1 protein_id gnl|my_center|LOCUS_16210 5333 6103 gene locus_tag LOCUS_16220 5333 6103 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065249.1 protein_id gnl|my_center|LOCUS_16220 6107 8095 gene locus_tag LOCUS_16230 6107 8095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 8100 10148 gene locus_tag LOCUS_16240 8100 10148 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184828.1 protein_id gnl|my_center|LOCUS_16240 10163 12028 gene locus_tag LOCUS_16250 10163 12028 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184828.1 protein_id gnl|my_center|LOCUS_16250 12053 13195 gene locus_tag LOCUS_16260 12053 13195 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582733.1 protein_id gnl|my_center|LOCUS_16260 13192 14079 gene locus_tag LOCUS_16270 13192 14079 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942747.1 protein_id gnl|my_center|LOCUS_16270 14432 14151 gene locus_tag LOCUS_16280 14432 14151 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035600.1 protein_id gnl|my_center|LOCUS_16280 15288 14470 gene locus_tag LOCUS_16290 15288 14470 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958026.1 protein_id gnl|my_center|LOCUS_16290 17723 15291 gene locus_tag LOCUS_16300 17723 15291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 18437 17730 gene locus_tag LOCUS_16310 18437 17730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 19561 18434 gene locus_tag LOCUS_16320 19561 18434 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082979.1 protein_id gnl|my_center|LOCUS_16320 >Feature sequence065 768 1793 gene locus_tag LOCUS_16330 768 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 1795 2709 gene locus_tag LOCUS_16340 1795 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 2909 3703 gene locus_tag LOCUS_16350 2909 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 4257 6581 gene locus_tag LOCUS_16360 4257 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 6598 9510 gene locus_tag LOCUS_16370 6598 9510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 9514 10830 gene locus_tag LOCUS_16380 9514 10830 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123159.1 protein_id gnl|my_center|LOCUS_16380 10982 11716 gene locus_tag LOCUS_16390 10982 11716 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761827.1 protein_id gnl|my_center|LOCUS_16390 11880 12794 gene locus_tag LOCUS_16400 11880 12794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 12813 14753 gene locus_tag LOCUS_16410 12813 14753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 15901 16395 gene locus_tag LOCUS_16420 15901 16395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 17148 18560 gene locus_tag LOCUS_16430 17148 18560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 >Feature sequence066 3 707 gene locus_tag LOCUS_16440 3 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 879 2216 gene locus_tag LOCUS_16450 879 2216 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303078.1 protein_id gnl|my_center|LOCUS_16450 2213 3460 gene locus_tag LOCUS_16460 2213 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 3473 4552 gene locus_tag LOCUS_16470 3473 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 4707 5801 gene locus_tag LOCUS_16480 gene mraY 4707 5801 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545877.1 protein_id gnl|my_center|LOCUS_16480 5936 8116 gene locus_tag LOCUS_16490 5936 8116 CDS product DNA polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943858.1 protein_id gnl|my_center|LOCUS_16490 8141 8692 gene locus_tag LOCUS_16500 8141 8692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 9014 8712 gene locus_tag LOCUS_16510 9014 8712 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008132970.1 protein_id gnl|my_center|LOCUS_16510 9679 9011 gene locus_tag LOCUS_16520 9679 9011 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792222.1 protein_id gnl|my_center|LOCUS_16520 10652 9687 gene locus_tag LOCUS_16530 10652 9687 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573446.1 protein_id gnl|my_center|LOCUS_16530 12847 10730 gene locus_tag LOCUS_16540 12847 10730 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764318.1 protein_id gnl|my_center|LOCUS_16540 13072 14052 gene locus_tag LOCUS_16550 13072 14052 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932731.1 protein_id gnl|my_center|LOCUS_16550 14258 14067 gene locus_tag LOCUS_16560 14258 14067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 14958 14170 gene locus_tag LOCUS_16570 14958 14170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 15203 15880 gene locus_tag LOCUS_16580 15203 15880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 18226 16112 gene locus_tag LOCUS_16590 gene pnp 18226 16112 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037246149.1 protein_id gnl|my_center|LOCUS_16590 19411 18476 gene locus_tag LOCUS_16600 19411 18476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 >Feature sequence067 1515 667 gene locus_tag LOCUS_16610 1515 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 2636 1653 gene locus_tag LOCUS_16620 2636 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 3750 2653 gene locus_tag LOCUS_16630 3750 2653 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100168880.1 protein_id gnl|my_center|LOCUS_16630 3836 4750 gene locus_tag LOCUS_16640 3836 4750 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086430.1 protein_id gnl|my_center|LOCUS_16640 7075 4754 gene locus_tag LOCUS_16650 7075 4754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 7873 7124 gene locus_tag LOCUS_16660 7873 7124 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255197.1 protein_id gnl|my_center|LOCUS_16660 8380 10677 gene locus_tag LOCUS_16670 gene ldcA 8380 10677 CDS product lysine-specific pyridoxal 5'-phosphate-dependent carboxylase LdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113592.1 protein_id gnl|my_center|LOCUS_16670 10701 12134 gene locus_tag LOCUS_16680 10701 12134 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174157.1 protein_id gnl|my_center|LOCUS_16680 12550 12849 gene locus_tag LOCUS_16690 12550 12849 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_16690 12913 13692 gene locus_tag LOCUS_16700 12913 13692 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938977.1 protein_id gnl|my_center|LOCUS_16700 13810 14487 gene locus_tag LOCUS_16710 13810 14487 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010537055.1 protein_id gnl|my_center|LOCUS_16710 16161 14497 gene locus_tag LOCUS_16720 16161 14497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 17724 16201 gene locus_tag LOCUS_16730 17724 16201 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933195.1 protein_id gnl|my_center|LOCUS_16730 18946 17756 gene locus_tag LOCUS_16740 18946 17756 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938142.1 protein_id gnl|my_center|LOCUS_16740 19309 19611 gene locus_tag LOCUS_16750 19309 19611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 >Feature sequence068 1291 179 gene locus_tag LOCUS_16760 1291 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 2354 1563 gene locus_tag LOCUS_16770 gene trpA 2354 1563 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392849.1 protein_id gnl|my_center|LOCUS_16770 3532 2354 gene locus_tag LOCUS_16780 gene trpB 3532 2354 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097340.1 protein_id gnl|my_center|LOCUS_16780 4053 3529 gene locus_tag LOCUS_16790 4053 3529 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_16790 4880 4095 gene locus_tag LOCUS_16800 gene trpC 4880 4095 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437196.1 protein_id gnl|my_center|LOCUS_16800 5886 4864 gene locus_tag LOCUS_16810 gene trpD 5886 4864 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_16810 6483 5890 gene locus_tag LOCUS_16820 gene pabA 6483 5890 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392854.1 protein_id gnl|my_center|LOCUS_16820 7964 6495 gene locus_tag LOCUS_16830 gene trpE 7964 6495 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_16830 9324 8482 gene locus_tag LOCUS_16840 9324 8482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 9435 10574 gene locus_tag LOCUS_16850 9435 10574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 10697 12067 gene locus_tag LOCUS_16860 10697 12067 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948764.1 protein_id gnl|my_center|LOCUS_16860 12064 12747 gene locus_tag LOCUS_16870 12064 12747 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986495.1 protein_id gnl|my_center|LOCUS_16870 12744 15392 gene locus_tag LOCUS_16880 12744 15392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 15389 16090 gene locus_tag LOCUS_16890 15389 16090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 16759 16097 gene locus_tag LOCUS_16900 16759 16097 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820913.1 protein_id gnl|my_center|LOCUS_16900 18135 16756 gene locus_tag LOCUS_16910 gene glmM 18135 16756 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922275.1 protein_id gnl|my_center|LOCUS_16910 >Feature sequence069 334 243 gene locus_tag LOCUS_t00230 334 243 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 813 1850 gene locus_tag LOCUS_16920 813 1850 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_16920 1847 5617 gene locus_tag LOCUS_16930 1847 5617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 5632 6363 gene locus_tag LOCUS_16940 5632 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 6366 7334 gene locus_tag LOCUS_16950 6366 7334 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786056.1 protein_id gnl|my_center|LOCUS_16950 10520 7458 gene locus_tag LOCUS_16960 10520 7458 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389909.1 protein_id gnl|my_center|LOCUS_16960 11540 10809 gene locus_tag LOCUS_16970 11540 10809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 13135 11537 gene locus_tag LOCUS_16980 13135 11537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 14276 13170 gene locus_tag LOCUS_16990 14276 13170 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_16990 14767 15693 gene locus_tag LOCUS_17000 gene cysK 14767 15693 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257225.1 protein_id gnl|my_center|LOCUS_17000 17368 15818 gene locus_tag LOCUS_17010 17368 15818 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267898.1 protein_id gnl|my_center|LOCUS_17010 18563 17472 gene locus_tag LOCUS_17020 18563 17472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence070 2237 234 gene locus_tag LOCUS_17030 2237 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 2441 3247 gene locus_tag LOCUS_17040 2441 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 3247 4344 gene locus_tag LOCUS_17050 3247 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 4462 5007 gene locus_tag LOCUS_17060 4462 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 5165 6238 gene locus_tag LOCUS_17070 5165 6238 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095328.1 protein_id gnl|my_center|LOCUS_17070 6260 7144 gene locus_tag LOCUS_17080 6260 7144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 7301 8311 gene locus_tag LOCUS_17090 7301 8311 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029843.1 protein_id gnl|my_center|LOCUS_17090 8446 9369 gene locus_tag LOCUS_17100 8446 9369 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082403.1 protein_id gnl|my_center|LOCUS_17100 9390 10073 gene locus_tag LOCUS_17110 9390 10073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 10073 13024 gene locus_tag LOCUS_17120 10073 13024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 13990 13133 gene locus_tag LOCUS_17130 13990 13133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 14678 14016 gene locus_tag LOCUS_17140 14678 14016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 16844 14772 gene locus_tag LOCUS_17150 gene tkt 16844 14772 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019779.1 protein_id gnl|my_center|LOCUS_17150 16989 18011 gene locus_tag LOCUS_17160 gene ruvB 16989 18011 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_17160 18032 18670 gene locus_tag LOCUS_17170 18032 18670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 18696 19409 gene locus_tag LOCUS_17180 18696 19409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 >Feature sequence071 806 111 gene locus_tag LOCUS_17190 806 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 1613 1029 gene locus_tag LOCUS_17200 gene nusG 1613 1029 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390510.1 protein_id gnl|my_center|LOCUS_17200 1868 1626 gene locus_tag LOCUS_17210 1868 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 1981 1905 gene locus_tag LOCUS_t00240 1981 1905 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2152 2003 gene locus_tag LOCUS_17220 gene rpmG 2152 2003 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943500.1 protein_id gnl|my_center|LOCUS_17220 3424 2228 gene locus_tag LOCUS_17230 gene tuf 3424 2228 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221846.1 protein_id gnl|my_center|LOCUS_17230 3569 3494 gene locus_tag LOCUS_t00250 3569 3494 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3760 3676 gene locus_tag LOCUS_t00260 3760 3676 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5670 3907 gene locus_tag LOCUS_17240 5670 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 6863 5667 gene locus_tag LOCUS_17250 gene ftsZ 6863 5667 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583602.1 protein_id gnl|my_center|LOCUS_17250 8145 6868 gene locus_tag LOCUS_17260 gene ftsA 8145 6868 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392368.1 protein_id gnl|my_center|LOCUS_17260 9396 8260 gene locus_tag LOCUS_17270 9396 8260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 9800 9393 gene locus_tag LOCUS_17280 9800 9393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 11529 10183 gene locus_tag LOCUS_17290 gene miaB 11529 10183 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005381.1 protein_id gnl|my_center|LOCUS_17290 12656 11526 gene locus_tag LOCUS_17300 gene proB 12656 11526 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331575.1 protein_id gnl|my_center|LOCUS_17300 14603 12705 gene locus_tag LOCUS_17310 14603 12705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 16429 14600 gene locus_tag LOCUS_17320 16429 14600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 17120 16509 gene locus_tag LOCUS_17330 17120 16509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 18395 17397 gene locus_tag LOCUS_17340 18395 17397 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808871.1 protein_id gnl|my_center|LOCUS_17340 <19524 18445 gene locus_tag LOCUS_17350 <19524 18445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035993.1:alpha/beta hydrolase >Feature sequence072 892 416 gene locus_tag LOCUS_17360 892 416 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938878.1 protein_id gnl|my_center|LOCUS_17360 1926 889 gene locus_tag LOCUS_17370 1926 889 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_17370 3197 1956 gene locus_tag LOCUS_17380 3197 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 3418 5181 gene locus_tag LOCUS_17390 gene ilvB 3418 5181 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327661.1 protein_id gnl|my_center|LOCUS_17390 5189 6460 gene locus_tag LOCUS_17400 gene aroA 5189 6460 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289296.1 protein_id gnl|my_center|LOCUS_17400 6472 7149 gene locus_tag LOCUS_17410 6472 7149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 7413 7105 gene locus_tag LOCUS_17420 7413 7105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 8413 7352 gene locus_tag LOCUS_17430 gene rlmN 8413 7352 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922584.1 protein_id gnl|my_center|LOCUS_17430 10049 8418 gene locus_tag LOCUS_17440 10049 8418 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924857.1 protein_id gnl|my_center|LOCUS_17440 10555 11922 gene locus_tag LOCUS_17450 10555 11922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 11925 12617 gene locus_tag LOCUS_17460 11925 12617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 12614 14170 gene locus_tag LOCUS_17470 12614 14170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941782.1 protein_id gnl|my_center|LOCUS_17470 14970 14311 gene locus_tag LOCUS_17480 14970 14311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 15619 14960 gene locus_tag LOCUS_17490 15619 14960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 15719 17524 gene locus_tag LOCUS_17500 gene aspS 15719 17524 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389825.1 protein_id gnl|my_center|LOCUS_17500 17528 18517 gene locus_tag LOCUS_17510 17528 18517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 18517 19104 gene locus_tag LOCUS_17520 18517 19104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 >Feature sequence073 450 2057 gene locus_tag LOCUS_17530 450 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 2412 2092 gene locus_tag LOCUS_17540 2412 2092 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802790.1 protein_id gnl|my_center|LOCUS_17540 2678 3592 gene locus_tag LOCUS_17550 2678 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 3612 5954 gene locus_tag LOCUS_17560 3612 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 6948 5893 gene locus_tag LOCUS_17570 6948 5893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 7234 9552 gene locus_tag LOCUS_17580 7234 9552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 9557 10303 gene locus_tag LOCUS_17590 9557 10303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 10323 13394 gene locus_tag LOCUS_17600 10323 13394 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080411.1 protein_id gnl|my_center|LOCUS_17600 13404 15422 gene locus_tag LOCUS_17610 13404 15422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 15477 18362 gene locus_tag LOCUS_17620 15477 18362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 <19386 18397 gene locus_tag LOCUS_17630 <19386 18397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392360.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase >Feature sequence074 70 2163 gene locus_tag LOCUS_17640 70 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 2153 3520 gene locus_tag LOCUS_17650 2153 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 3752 4759 gene locus_tag LOCUS_17660 3752 4759 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977450.1 protein_id gnl|my_center|LOCUS_17660 4811 5479 gene locus_tag LOCUS_17670 4811 5479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 5507 7681 gene locus_tag LOCUS_17680 5507 7681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 7678 9654 gene locus_tag LOCUS_17690 7678 9654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 10745 9675 gene locus_tag LOCUS_17700 10745 9675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 10965 12038 gene locus_tag LOCUS_17710 10965 12038 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942836.1 protein_id gnl|my_center|LOCUS_17710 12052 12267 gene locus_tag LOCUS_17720 12052 12267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 12463 13518 gene locus_tag LOCUS_17730 12463 13518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 13561 16026 gene locus_tag LOCUS_17740 13561 16026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 16040 16726 gene locus_tag LOCUS_17750 16040 16726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 17765 16758 gene locus_tag LOCUS_17760 17765 16758 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223494.1 protein_id gnl|my_center|LOCUS_17760 <19252 17762 gene locus_tag LOCUS_17770 <19252 17762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001201677.1:alpha-galactosidase >Feature sequence075 2084 687 gene locus_tag LOCUS_17780 gene lpdA 2084 687 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393264.1 protein_id gnl|my_center|LOCUS_17780 2499 2236 gene locus_tag LOCUS_17790 gene rpsS 2499 2236 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005993369.1 protein_id gnl|my_center|LOCUS_17790 3329 2499 gene locus_tag LOCUS_17800 gene rplB 3329 2499 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974264.1 protein_id gnl|my_center|LOCUS_17800 3630 3349 gene locus_tag LOCUS_17810 gene rplW 3630 3349 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258233.1 protein_id gnl|my_center|LOCUS_17810 4277 3642 gene locus_tag LOCUS_17820 gene rplD 4277 3642 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546805.1 protein_id gnl|my_center|LOCUS_17820 4947 4291 gene locus_tag LOCUS_17830 gene rplC 4947 4291 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421173.1 protein_id gnl|my_center|LOCUS_17830 5350 5027 gene locus_tag LOCUS_17840 gene rpsJ 5350 5027 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 protein_id gnl|my_center|LOCUS_17840 7468 5354 gene locus_tag LOCUS_17850 gene fusA 7468 5354 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_17850 7939 7487 gene locus_tag LOCUS_17860 gene rpsG 7939 7487 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545233.1 protein_id gnl|my_center|LOCUS_17860 8402 7998 gene locus_tag LOCUS_17870 gene rpsL 8402 7998 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057584.1 protein_id gnl|my_center|LOCUS_17870 12991 8594 gene locus_tag LOCUS_17880 gene rpoC 12991 8594 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871661.1 protein_id gnl|my_center|LOCUS_17880 16831 13010 gene locus_tag LOCUS_17890 gene rpoB 16831 13010 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725157.1 protein_id gnl|my_center|LOCUS_17890 17600 17196 gene locus_tag LOCUS_17900 gene rplL 17600 17196 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943494.1 protein_id gnl|my_center|LOCUS_17900 18136 17615 gene locus_tag LOCUS_17910 gene rplJ 18136 17615 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892752.1 protein_id gnl|my_center|LOCUS_17910 18840 18133 gene locus_tag LOCUS_17920 gene rplA 18840 18133 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_17920 >Feature sequence076 <1 1350 gene locus_tag LOCUS_17930 <1 1350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787605.1:alpha amylase C-terminal domain-containing protein 2179 1283 gene locus_tag LOCUS_17940 2179 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 3249 2176 gene locus_tag LOCUS_17950 3249 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 4030 3398 gene locus_tag LOCUS_17960 4030 3398 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888540.1 protein_id gnl|my_center|LOCUS_17960 5037 4144 gene locus_tag LOCUS_17970 gene miaA 5037 4144 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228033.1 protein_id gnl|my_center|LOCUS_17970 6454 5027 gene locus_tag LOCUS_17980 6454 5027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 6712 6542 gene locus_tag LOCUS_17990 6712 6542 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869128.1 protein_id gnl|my_center|LOCUS_17990 8177 6780 gene locus_tag LOCUS_18000 8177 6780 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_18000 8362 9411 gene locus_tag LOCUS_18010 8362 9411 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_18010 9432 9833 gene locus_tag LOCUS_18020 9432 9833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 10416 9991 gene locus_tag LOCUS_18030 10416 9991 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667028.1 protein_id gnl|my_center|LOCUS_18030 11353 10454 gene locus_tag LOCUS_18040 11353 10454 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066855.1 protein_id gnl|my_center|LOCUS_18040 13118 11364 gene locus_tag LOCUS_18050 13118 11364 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939685.1 protein_id gnl|my_center|LOCUS_18050 13645 13115 gene locus_tag LOCUS_18060 13645 13115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 13819 15117 gene locus_tag LOCUS_18070 13819 15117 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939339.1 protein_id gnl|my_center|LOCUS_18070 17800 15296 gene locus_tag LOCUS_18080 17800 15296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 >Feature sequence077 776 1030 gene locus_tag LOCUS_18090 776 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 1682 1131 gene locus_tag LOCUS_18100 1682 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 2701 1685 gene locus_tag LOCUS_18110 2701 1685 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567511.1 protein_id gnl|my_center|LOCUS_18110 3307 2861 gene locus_tag LOCUS_18120 gene rpsK 3307 2861 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390415.1 protein_id gnl|my_center|LOCUS_18120 3808 3410 gene locus_tag LOCUS_18130 gene rpsM 3808 3410 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873866.1 protein_id gnl|my_center|LOCUS_18130 4494 5942 gene locus_tag LOCUS_18140 4494 5942 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764741.1 protein_id gnl|my_center|LOCUS_18140 5958 6791 gene locus_tag LOCUS_18150 gene speE 5958 6791 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424716.1 protein_id gnl|my_center|LOCUS_18150 8340 7039 gene locus_tag LOCUS_18160 8340 7039 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378953.1 protein_id gnl|my_center|LOCUS_18160 8818 8333 gene locus_tag LOCUS_18170 8818 8333 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091409.1 protein_id gnl|my_center|LOCUS_18170 9837 8818 gene locus_tag LOCUS_18180 9837 8818 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_18180 11745 10036 gene locus_tag LOCUS_18190 gene recJ 11745 10036 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421620.1 protein_id gnl|my_center|LOCUS_18190 11947 12032 gene locus_tag LOCUS_t00270 11947 12032 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12071 12144 gene locus_tag LOCUS_t00280 12071 12144 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 12151 12235 gene locus_tag LOCUS_t00290 12151 12235 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 12735 14261 gene locus_tag LOCUS_18200 12735 14261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 14473 14745 gene locus_tag LOCUS_18210 14473 14745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 14738 16174 gene locus_tag LOCUS_18220 14738 16174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 16698 17105 gene locus_tag LOCUS_18230 16698 17105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 17109 17360 gene locus_tag LOCUS_18240 17109 17360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 17501 17710 gene locus_tag LOCUS_18250 17501 17710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 17740 18408 gene locus_tag LOCUS_18260 17740 18408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 >Feature sequence078 1738 29 gene locus_tag LOCUS_18270 1738 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 1960 3255 gene locus_tag LOCUS_18280 1960 3255 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656298.1 protein_id gnl|my_center|LOCUS_18280 3268 4335 gene locus_tag LOCUS_18290 3268 4335 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250419.1 protein_id gnl|my_center|LOCUS_18290 5381 4389 gene locus_tag LOCUS_18300 5381 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 6336 5392 gene locus_tag LOCUS_18310 6336 5392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 6493 7404 gene locus_tag LOCUS_18320 6493 7404 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763252.1 protein_id gnl|my_center|LOCUS_18320 7413 8435 gene locus_tag LOCUS_18330 7413 8435 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798976.1 protein_id gnl|my_center|LOCUS_18330 8454 10172 gene locus_tag LOCUS_18340 8454 10172 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789707.1 protein_id gnl|my_center|LOCUS_18340 10257 10523 gene locus_tag LOCUS_18350 10257 10523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 10533 11045 gene locus_tag LOCUS_18360 gene purE 10533 11045 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769750.1 protein_id gnl|my_center|LOCUS_18360 11068 11679 gene locus_tag LOCUS_18370 11068 11679 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939073.1 protein_id gnl|my_center|LOCUS_18370 11676 12449 gene locus_tag LOCUS_18380 gene dppA 11676 12449 CDS product D-aminopeptidase DppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245814.1 protein_id gnl|my_center|LOCUS_18380 12586 13005 gene locus_tag LOCUS_18390 12586 13005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 13012 13347 gene locus_tag LOCUS_18400 13012 13347 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064179.1 protein_id gnl|my_center|LOCUS_18400 13367 13630 gene locus_tag LOCUS_18410 13367 13630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 13679 16234 gene locus_tag LOCUS_18420 13679 16234 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836187.1 protein_id gnl|my_center|LOCUS_18420 16231 17562 gene locus_tag LOCUS_18430 16231 17562 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268198.1 protein_id gnl|my_center|LOCUS_18430 >Feature sequence079 <1 927 gene locus_tag LOCUS_18440 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927203.1:serine hydrolase domain-containing protein 1016 2029 gene locus_tag LOCUS_18450 1016 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 2035 3060 gene locus_tag LOCUS_18460 2035 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 3066 3842 gene locus_tag LOCUS_18470 3066 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 3858 4607 gene locus_tag LOCUS_18480 gene fabG 3858 4607 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036220.1 protein_id gnl|my_center|LOCUS_18480 4633 5385 gene locus_tag LOCUS_18490 4633 5385 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020528.1 protein_id gnl|my_center|LOCUS_18490 5392 6348 gene locus_tag LOCUS_18500 5392 6348 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930147.1 protein_id gnl|my_center|LOCUS_18500 6488 7540 gene locus_tag LOCUS_18510 6488 7540 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930784.1 protein_id gnl|my_center|LOCUS_18510 8636 7614 gene locus_tag LOCUS_18520 8636 7614 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979599.1 protein_id gnl|my_center|LOCUS_18520 9364 8633 gene locus_tag LOCUS_18530 9364 8633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 10489 9425 gene locus_tag LOCUS_18540 10489 9425 CDS product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072774223.1 protein_id gnl|my_center|LOCUS_18540 10821 11405 gene locus_tag LOCUS_18550 10821 11405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 12610 11501 gene locus_tag LOCUS_18560 12610 11501 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_18560 13242 14324 gene locus_tag LOCUS_18570 13242 14324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 15589 14450 gene locus_tag LOCUS_18580 15589 14450 CDS product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072774223.1 protein_id gnl|my_center|LOCUS_18580 16377 15592 gene locus_tag LOCUS_18590 16377 15592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 17153 16374 gene locus_tag LOCUS_18600 17153 16374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 17935 17171 gene locus_tag LOCUS_18610 17935 17171 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246517.1 protein_id gnl|my_center|LOCUS_18610 >Feature sequence080 101 1366 gene locus_tag LOCUS_18620 101 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 3003 1540 gene locus_tag LOCUS_18630 3003 1540 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767795.1 protein_id gnl|my_center|LOCUS_18630 3173 4987 gene locus_tag LOCUS_18640 3173 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 5584 5015 gene locus_tag LOCUS_18650 5584 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 6510 5581 gene locus_tag LOCUS_18660 gene ispH 6510 5581 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010356621.1 protein_id gnl|my_center|LOCUS_18660 6703 8340 gene locus_tag LOCUS_18670 6703 8340 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879805.1 protein_id gnl|my_center|LOCUS_18670 8342 8926 gene locus_tag LOCUS_18680 8342 8926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 9018 11096 gene locus_tag LOCUS_18690 9018 11096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 12060 11188 gene locus_tag LOCUS_18700 12060 11188 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119308.1 protein_id gnl|my_center|LOCUS_18700 12159 13031 gene locus_tag LOCUS_18710 12159 13031 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462252.1 protein_id gnl|my_center|LOCUS_18710 13036 13737 gene locus_tag LOCUS_18720 13036 13737 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830337.1 protein_id gnl|my_center|LOCUS_18720 13730 14737 gene locus_tag LOCUS_18730 13730 14737 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209518.1 protein_id gnl|my_center|LOCUS_18730 14750 17326 gene locus_tag LOCUS_18740 14750 17326 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082096.1 protein_id gnl|my_center|LOCUS_18740 18041 17313 gene locus_tag LOCUS_18750 gene fabG 18041 17313 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_18750 <18609 18059 gene locus_tag LOCUS_18760 <18609 18059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_171654832.1:galactonate dehydratase >Feature sequence081 2200 1205 gene locus_tag LOCUS_18770 2200 1205 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224436.1 protein_id gnl|my_center|LOCUS_18770 3011 2325 gene locus_tag LOCUS_18780 3011 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 3481 4398 gene locus_tag LOCUS_18790 3481 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 5212 4808 gene locus_tag LOCUS_18800 5212 4808 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263091.1 protein_id gnl|my_center|LOCUS_18800 5634 5212 gene locus_tag LOCUS_18810 5634 5212 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_18810 6301 5645 gene locus_tag LOCUS_18820 6301 5645 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894436.1 protein_id gnl|my_center|LOCUS_18820 7254 6373 gene locus_tag LOCUS_18830 7254 6373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 8371 7565 gene locus_tag LOCUS_18840 8371 7565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 10033 8384 gene locus_tag LOCUS_18850 10033 8384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 11873 10050 gene locus_tag LOCUS_18860 11873 10050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 11954 15376 gene locus_tag LOCUS_18870 11954 15376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 15364 17598 gene locus_tag LOCUS_18880 15364 17598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 >Feature sequence082 <1 1151 gene locus_tag LOCUS_18890 <1 1151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797416.1:arginine--tRNA ligase 1180 1962 gene locus_tag LOCUS_18900 1180 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 1959 2468 gene locus_tag LOCUS_18910 gene ruvC 1959 2468 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256932.1 protein_id gnl|my_center|LOCUS_18910 2468 3091 gene locus_tag LOCUS_18920 2468 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 3978 3304 gene locus_tag LOCUS_18930 3978 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 5195 3975 gene locus_tag LOCUS_18940 gene lysA 5195 3975 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_18940 5566 5216 gene locus_tag LOCUS_18950 5566 5216 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079948.1 protein_id gnl|my_center|LOCUS_18950 7748 5667 gene locus_tag LOCUS_18960 7748 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 8001 11102 gene locus_tag LOCUS_18970 8001 11102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 11211 12362 gene locus_tag LOCUS_18980 11211 12362 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 protein_id gnl|my_center|LOCUS_18980 13867 12515 gene locus_tag LOCUS_18990 gene melA 13867 12515 CDS product alpha-galactosidase MelA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246000.1 protein_id gnl|my_center|LOCUS_18990 14083 14985 gene locus_tag LOCUS_19000 14083 14985 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974053.1 protein_id gnl|my_center|LOCUS_19000 15141 16040 gene locus_tag LOCUS_19010 15141 16040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 16152 16907 gene locus_tag LOCUS_19020 16152 16907 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668967.1 protein_id gnl|my_center|LOCUS_19020 >Feature sequence083 1173 25 gene locus_tag LOCUS_19030 1173 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 1753 1199 gene locus_tag LOCUS_19040 1753 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 5175 2251 gene locus_tag LOCUS_19050 5175 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 6054 5479 gene locus_tag LOCUS_19060 6054 5479 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943440.1 protein_id gnl|my_center|LOCUS_19060 6691 6158 gene locus_tag LOCUS_19070 6691 6158 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088853.1 protein_id gnl|my_center|LOCUS_19070 7887 6676 gene locus_tag LOCUS_19080 7887 6676 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283067.1 protein_id gnl|my_center|LOCUS_19080 8173 9657 gene locus_tag LOCUS_19090 8173 9657 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_19090 10739 9681 gene locus_tag LOCUS_19100 10739 9681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 11248 13506 gene locus_tag LOCUS_19110 11248 13506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 14872 13490 gene locus_tag LOCUS_19120 14872 13490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 15048 15632 gene locus_tag LOCUS_19130 15048 15632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 >Feature sequence084 1276 2019 gene locus_tag LOCUS_19140 1276 2019 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_19140 5239 2339 gene locus_tag LOCUS_19150 5239 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 5973 5236 gene locus_tag LOCUS_19160 5973 5236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 6652 5987 gene locus_tag LOCUS_19170 6652 5987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 7332 6667 gene locus_tag LOCUS_19180 7332 6667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 8348 7332 gene locus_tag LOCUS_19190 8348 7332 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226239.1 protein_id gnl|my_center|LOCUS_19190 8542 10788 gene locus_tag LOCUS_19200 8542 10788 CDS product beta-galactosidase GalA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036450.1 protein_id gnl|my_center|LOCUS_19200 12415 11018 gene locus_tag LOCUS_19210 12415 11018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 13316 12405 gene locus_tag LOCUS_19220 13316 12405 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250829.1 protein_id gnl|my_center|LOCUS_19220 15336 13318 gene locus_tag LOCUS_19230 15336 13318 CDS product DUF5696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390300.1 protein_id gnl|my_center|LOCUS_19230 16084 15365 gene locus_tag LOCUS_19240 16084 15365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 17314 16196 gene locus_tag LOCUS_19250 17314 16196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 >Feature sequence085 2637 1396 gene locus_tag LOCUS_19260 2637 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 3963 2656 gene locus_tag LOCUS_19270 3963 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 5832 3979 gene locus_tag LOCUS_19280 5832 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 6611 5919 gene locus_tag LOCUS_19290 6611 5919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 7019 6642 gene locus_tag LOCUS_19300 7019 6642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 7960 7190 gene locus_tag LOCUS_19310 gene tpiA 7960 7190 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_19310 8509 8105 gene locus_tag LOCUS_19320 8509 8105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 8735 10237 gene locus_tag LOCUS_19330 8735 10237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 10258 11952 gene locus_tag LOCUS_19340 10258 11952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 13209 12073 gene locus_tag LOCUS_19350 gene pdxB 13209 12073 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201894.1 protein_id gnl|my_center|LOCUS_19350 14079 13330 gene locus_tag LOCUS_19360 14079 13330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 14357 14076 gene locus_tag LOCUS_19370 14357 14076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 15193 14354 gene locus_tag LOCUS_19380 15193 14354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 16284 15205 gene locus_tag LOCUS_19390 16284 15205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 16460 16296 gene locus_tag LOCUS_19400 16460 16296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 17282 16773 gene locus_tag LOCUS_19410 17282 16773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 >Feature sequence086 146 604 gene locus_tag LOCUS_19420 146 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 864 4016 gene locus_tag LOCUS_19430 864 4016 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582581.1 protein_id gnl|my_center|LOCUS_19430 4981 4325 gene locus_tag LOCUS_19440 4981 4325 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963522.1 protein_id gnl|my_center|LOCUS_19440 5200 9408 gene locus_tag LOCUS_19450 5200 9408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 9321 10709 gene locus_tag LOCUS_19460 9321 10709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 10810 11211 gene locus_tag LOCUS_19470 10810 11211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 13121 11250 gene locus_tag LOCUS_19480 13121 11250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 13874 13137 gene locus_tag LOCUS_19490 13874 13137 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203675.1 protein_id gnl|my_center|LOCUS_19490 14101 14370 gene locus_tag LOCUS_19500 14101 14370 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112985.1 protein_id gnl|my_center|LOCUS_19500 14373 15731 gene locus_tag LOCUS_19510 14373 15731 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 protein_id gnl|my_center|LOCUS_19510 >Feature sequence087 18 93 gene locus_tag LOCUS_t00300 18 93 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 677 333 gene locus_tag LOCUS_19520 677 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 1970 1146 gene locus_tag LOCUS_19530 1970 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 2106 2870 gene locus_tag LOCUS_19540 2106 2870 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973789.1 protein_id gnl|my_center|LOCUS_19540 2867 3661 gene locus_tag LOCUS_19550 2867 3661 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_19550 3658 4737 gene locus_tag LOCUS_19560 3658 4737 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185221.1 protein_id gnl|my_center|LOCUS_19560 6329 4815 gene locus_tag LOCUS_19570 6329 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 7146 6352 gene locus_tag LOCUS_19580 7146 6352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 8445 7402 gene locus_tag LOCUS_19590 gene purR 8445 7402 CDS product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366884.1 protein_id gnl|my_center|LOCUS_19590 8623 9984 gene locus_tag LOCUS_19600 gene algB 8623 9984 CDS product sigma-54-dependent response regulator transcription factor AlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318895.1 protein_id gnl|my_center|LOCUS_19600 10259 12118 gene locus_tag LOCUS_19610 10259 12118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 12152 13306 gene locus_tag LOCUS_19620 12152 13306 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940592.1 protein_id gnl|my_center|LOCUS_19620 16505 13314 gene locus_tag LOCUS_19630 16505 13314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 17306 16530 gene locus_tag LOCUS_19640 17306 16530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 >Feature sequence088 1009 1761 gene locus_tag LOCUS_19650 1009 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 1777 3873 gene locus_tag LOCUS_19660 1777 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 4489 3977 gene locus_tag LOCUS_19670 4489 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 4663 5535 gene locus_tag LOCUS_19680 gene dapA 4663 5535 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869742.1 protein_id gnl|my_center|LOCUS_19680 5775 6158 gene locus_tag LOCUS_19690 5775 6158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 7475 6312 gene locus_tag LOCUS_19700 7475 6312 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929847.1 protein_id gnl|my_center|LOCUS_19700 7603 8406 gene locus_tag LOCUS_19710 7603 8406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 9806 8337 gene locus_tag LOCUS_19720 9806 8337 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 protein_id gnl|my_center|LOCUS_19720 10613 9819 gene locus_tag LOCUS_19730 10613 9819 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464970.1 protein_id gnl|my_center|LOCUS_19730 10810 11829 gene locus_tag LOCUS_19740 10810 11829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 11826 12704 gene locus_tag LOCUS_19750 gene galU 11826 12704 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965632.1 protein_id gnl|my_center|LOCUS_19750 12749 14359 gene locus_tag LOCUS_19760 12749 14359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 16040 14412 gene locus_tag LOCUS_19770 16040 14412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 16695 16027 gene locus_tag LOCUS_19780 16695 16027 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528748.1 protein_id gnl|my_center|LOCUS_19780 <17409 16808 gene locus_tag LOCUS_19790 <17409 16808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226485.1:tannase/feruloyl esterase family alpha/beta hydrolase >Feature sequence089 3829 398 gene locus_tag LOCUS_19800 3829 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 4935 3844 gene locus_tag LOCUS_19810 4935 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 5124 6212 gene locus_tag LOCUS_19820 5124 6212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 6340 7023 gene locus_tag LOCUS_19830 6340 7023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 7049 9307 gene locus_tag LOCUS_19840 7049 9307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 9307 10788 gene locus_tag LOCUS_19850 9307 10788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 11730 10798 gene locus_tag LOCUS_19860 11730 10798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 12141 11731 gene locus_tag LOCUS_19870 gene tolR 12141 11731 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546534.1 protein_id gnl|my_center|LOCUS_19870 12934 12143 gene locus_tag LOCUS_19880 12934 12143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 13045 14037 gene locus_tag LOCUS_19890 13045 14037 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_19890 14063 15046 gene locus_tag LOCUS_19900 14063 15046 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_19900 15047 15667 gene locus_tag LOCUS_19910 15047 15667 CDS product hydroxyacylglutathione hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933700.1 protein_id gnl|my_center|LOCUS_19910 >Feature sequence090 1131 223 gene locus_tag LOCUS_19920 1131 223 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118555.1 protein_id gnl|my_center|LOCUS_19920 2711 1134 gene locus_tag LOCUS_19930 2711 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 3110 2715 gene locus_tag LOCUS_19940 3110 2715 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548044.1 protein_id gnl|my_center|LOCUS_19940 3621 3250 gene locus_tag LOCUS_19950 3621 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 4712 3636 gene locus_tag LOCUS_19960 4712 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 5349 4714 gene locus_tag LOCUS_19970 5349 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 5749 5342 gene locus_tag LOCUS_19980 5749 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 6246 5746 gene locus_tag LOCUS_19990 6246 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 6674 6246 gene locus_tag LOCUS_20000 gene gspG 6674 6246 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_20000 7885 6671 gene locus_tag LOCUS_20010 7885 6671 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079343.1 protein_id gnl|my_center|LOCUS_20010 9487 7889 gene locus_tag LOCUS_20020 9487 7889 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533577.1 protein_id gnl|my_center|LOCUS_20020 11760 9484 gene locus_tag LOCUS_20030 gene gspD 11760 9484 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394575.1 protein_id gnl|my_center|LOCUS_20030 12710 11835 gene locus_tag LOCUS_20040 12710 11835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 13336 12707 gene locus_tag LOCUS_20050 13336 12707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 14520 13333 gene locus_tag LOCUS_20060 14520 13333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 15247 14573 gene locus_tag LOCUS_20070 15247 14573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 15539 16630 gene locus_tag LOCUS_20080 15539 16630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 >Feature sequence091 995 2674 gene locus_tag LOCUS_20090 995 2674 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_20090 2686 3549 gene locus_tag LOCUS_20100 2686 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 3749 4459 gene locus_tag LOCUS_20110 3749 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 4456 6030 gene locus_tag LOCUS_20120 4456 6030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 6612 8363 gene locus_tag LOCUS_20130 6612 8363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 8415 8606 gene locus_tag LOCUS_20140 8415 8606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 8632 8991 gene locus_tag LOCUS_20150 8632 8991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 8998 9546 gene locus_tag LOCUS_20160 8998 9546 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523374.1 protein_id gnl|my_center|LOCUS_20160 9543 10217 gene locus_tag LOCUS_20170 9543 10217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 10250 11488 gene locus_tag LOCUS_20180 10250 11488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 11488 13359 gene locus_tag LOCUS_20190 11488 13359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 13383 14381 gene locus_tag LOCUS_20200 13383 14381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 14378 15946 gene locus_tag LOCUS_20210 14378 15946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 16037 16771 gene locus_tag LOCUS_20220 16037 16771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 >Feature sequence092 153 2441 gene locus_tag LOCUS_20230 153 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 2699 2863 gene locus_tag LOCUS_20240 2699 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 3098 4054 gene locus_tag LOCUS_20250 3098 4054 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080078.1 protein_id gnl|my_center|LOCUS_20250 4094 4666 gene locus_tag LOCUS_20260 4094 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 4759 5544 gene locus_tag LOCUS_20270 4759 5544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 5563 10365 gene locus_tag LOCUS_20280 5563 10365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 10438 11886 gene locus_tag LOCUS_20290 10438 11886 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920215.1 protein_id gnl|my_center|LOCUS_20290 13470 11959 gene locus_tag LOCUS_20300 13470 11959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 14261 13488 gene locus_tag LOCUS_20310 14261 13488 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028326.1 protein_id gnl|my_center|LOCUS_20310 15194 14274 gene locus_tag LOCUS_20320 15194 14274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 16529 15222 gene locus_tag LOCUS_20330 16529 15222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 >Feature sequence093 580 1104 gene locus_tag LOCUS_20340 580 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 1141 1662 gene locus_tag LOCUS_20350 1141 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 2119 4194 gene locus_tag LOCUS_20360 2119 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 4322 5329 gene locus_tag LOCUS_20370 4322 5329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 5431 6639 gene locus_tag LOCUS_20380 5431 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 7864 6647 gene locus_tag LOCUS_20390 7864 6647 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082946.1 protein_id gnl|my_center|LOCUS_20390 7947 8849 gene locus_tag LOCUS_20400 7947 8849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 10008 8842 gene locus_tag LOCUS_20410 10008 8842 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094617.1 protein_id gnl|my_center|LOCUS_20410 10705 10577 gene locus_tag LOCUS_20420 10705 10577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 11931 10726 gene locus_tag LOCUS_20430 11931 10726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 12420 12130 gene locus_tag LOCUS_20440 12420 12130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 13723 12527 gene locus_tag LOCUS_20450 gene nifS 13723 12527 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942654.1 protein_id gnl|my_center|LOCUS_20450 13883 14980 gene locus_tag LOCUS_20460 13883 14980 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775921.1 protein_id gnl|my_center|LOCUS_20460 15045 16247 gene locus_tag LOCUS_20470 15045 16247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 16249 16800 gene locus_tag LOCUS_20480 16249 16800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 >Feature sequence094 802 1533 gene locus_tag LOCUS_20490 802 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 1788 1958 gene locus_tag LOCUS_20500 1788 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 2286 2211 gene locus_tag LOCUS_t00310 2286 2211 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3047 2382 gene locus_tag LOCUS_20510 3047 2382 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145123293.1 protein_id gnl|my_center|LOCUS_20510 3692 3066 gene locus_tag LOCUS_20520 3692 3066 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145123293.1 protein_id gnl|my_center|LOCUS_20520 4119 4724 gene locus_tag LOCUS_20530 4119 4724 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640258.1 protein_id gnl|my_center|LOCUS_20530 4721 5191 gene locus_tag LOCUS_20540 gene rnhA 4721 5191 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392156.1 protein_id gnl|my_center|LOCUS_20540 5299 7320 gene locus_tag LOCUS_20550 5299 7320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 7590 9212 gene locus_tag LOCUS_20560 7590 9212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 9811 9197 gene locus_tag LOCUS_20570 9811 9197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 11255 9816 gene locus_tag LOCUS_20580 gene gatB 11255 9816 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393504.1 protein_id gnl|my_center|LOCUS_20580 11404 12039 gene locus_tag LOCUS_20590 11404 12039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 13093 12020 gene locus_tag LOCUS_20600 gene holA 13093 12020 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990136.1 protein_id gnl|my_center|LOCUS_20600 13508 13227 gene locus_tag LOCUS_20610 13508 13227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 13703 14578 gene locus_tag LOCUS_20620 13703 14578 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937958.1 protein_id gnl|my_center|LOCUS_20620 14671 14838 gene locus_tag LOCUS_20630 14671 14838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 >Feature sequence095 3069 2620 gene locus_tag LOCUS_20640 3069 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 4625 3066 gene locus_tag LOCUS_20650 gene der 4625 3066 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003598629.1 protein_id gnl|my_center|LOCUS_20650 5456 4641 gene locus_tag LOCUS_20660 gene pyrF 5456 4641 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 protein_id gnl|my_center|LOCUS_20660 6470 5472 gene locus_tag LOCUS_20670 6470 5472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 7072 6467 gene locus_tag LOCUS_20680 7072 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 9799 7148 gene locus_tag LOCUS_20690 9799 7148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 10368 9796 gene locus_tag LOCUS_20700 10368 9796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 12360 10372 gene locus_tag LOCUS_20710 gene rnr 12360 10372 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161889612.1 protein_id gnl|my_center|LOCUS_20710 12560 13348 gene locus_tag LOCUS_20720 gene panB 12560 13348 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356105.1 protein_id gnl|my_center|LOCUS_20720 14317 13433 gene locus_tag LOCUS_20730 14317 13433 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896305.1 protein_id gnl|my_center|LOCUS_20730 15143 14328 gene locus_tag LOCUS_20740 15143 14328 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099264237.1 protein_id gnl|my_center|LOCUS_20740 15054 15254 gene locus_tag LOCUS_20750 15054 15254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 15873 15247 gene locus_tag LOCUS_20760 gene fkpA 15873 15247 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704938.1 protein_id gnl|my_center|LOCUS_20760 >Feature sequence096 4231 152 gene locus_tag LOCUS_20770 4231 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 6381 4234 gene locus_tag LOCUS_20780 6381 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 6565 7515 gene locus_tag LOCUS_20790 6565 7515 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399798.1 protein_id gnl|my_center|LOCUS_20790 7815 8378 gene locus_tag LOCUS_20800 7815 8378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 8443 12294 gene locus_tag LOCUS_20810 8443 12294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 12418 14232 gene locus_tag LOCUS_20820 12418 14232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 14229 15140 gene locus_tag LOCUS_20830 14229 15140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 15163 16110 gene locus_tag LOCUS_20840 15163 16110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 >Feature sequence097 1432 323 gene locus_tag LOCUS_20850 gene lpxD 1432 323 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764416.1 protein_id gnl|my_center|LOCUS_20850 2082 1429 gene locus_tag LOCUS_20860 2082 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 3581 2085 gene locus_tag LOCUS_20870 gene guaB 3581 2085 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227931.1 protein_id gnl|my_center|LOCUS_20870 3835 3954 gene locus_tag LOCUS_20880 3835 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 4035 5969 gene locus_tag LOCUS_20890 gene metG 4035 5969 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545288.1 protein_id gnl|my_center|LOCUS_20890 6391 7455 gene locus_tag LOCUS_20900 6391 7455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 7477 7887 gene locus_tag LOCUS_20910 7477 7887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 11187 7963 gene locus_tag LOCUS_20920 11187 7963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 11870 11214 gene locus_tag LOCUS_20930 11870 11214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 12890 11889 gene locus_tag LOCUS_20940 12890 11889 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976055.1 protein_id gnl|my_center|LOCUS_20940 15097 13061 gene locus_tag LOCUS_20950 15097 13061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 <16108 15333 gene locus_tag LOCUS_20960 <16108 15333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459544.1:ABC transporter ATP-binding protein >Feature sequence098 3163 917 gene locus_tag LOCUS_20970 3163 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 3915 3196 gene locus_tag LOCUS_20980 3915 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 4844 3912 gene locus_tag LOCUS_20990 4844 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 5620 4841 gene locus_tag LOCUS_21000 5620 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 10456 5639 gene locus_tag LOCUS_21010 10456 5639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 11151 10498 gene locus_tag LOCUS_21020 11151 10498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 11285 12163 gene locus_tag LOCUS_21030 11285 12163 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964760.1 protein_id gnl|my_center|LOCUS_21030 12445 12993 gene locus_tag LOCUS_21040 12445 12993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 12990 13445 gene locus_tag LOCUS_21050 12990 13445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 13442 13783 gene locus_tag LOCUS_21060 13442 13783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 13870 14328 gene locus_tag LOCUS_21070 13870 14328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 14325 14771 gene locus_tag LOCUS_21080 14325 14771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 14852 15166 gene locus_tag LOCUS_21090 14852 15166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 >Feature sequence099 4667 2841 gene locus_tag LOCUS_21100 4667 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 6757 4748 gene locus_tag LOCUS_21110 6757 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 8840 8139 gene locus_tag LOCUS_21120 8840 8139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 11065 8993 gene locus_tag LOCUS_21130 11065 8993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 12981 11068 gene locus_tag LOCUS_21140 12981 11068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 14795 12990 gene locus_tag LOCUS_21150 14795 12990 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706185.1 protein_id gnl|my_center|LOCUS_21150 14870 15799 gene locus_tag LOCUS_21160 14870 15799 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948948.1 protein_id gnl|my_center|LOCUS_21160 >Feature sequence100 <1 1178 gene locus_tag LOCUS_21170 <1 1178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942471.1:L-aspartate oxidase 1188 2447 gene locus_tag LOCUS_21180 gene pcnB 1188 2447 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065010.1 protein_id gnl|my_center|LOCUS_21180 2452 3795 gene locus_tag LOCUS_21190 2452 3795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 5052 3814 gene locus_tag LOCUS_21200 5052 3814 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583970.1 protein_id gnl|my_center|LOCUS_21200 5879 5046 gene locus_tag LOCUS_21210 5879 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 6143 6382 gene locus_tag LOCUS_21220 6143 6382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 7424 6963 gene locus_tag LOCUS_21230 gene smpB 7424 6963 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700605.1 protein_id gnl|my_center|LOCUS_21230 8594 7440 gene locus_tag LOCUS_21240 gene dnaJ 8594 7440 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095211.1 protein_id gnl|my_center|LOCUS_21240 9197 8601 gene locus_tag LOCUS_21250 9197 8601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 10291 9530 gene locus_tag LOCUS_21260 10291 9530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 10520 10281 gene locus_tag LOCUS_21270 10520 10281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 11565 10495 gene locus_tag LOCUS_21280 11565 10495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 13484 11775 gene locus_tag LOCUS_21290 gene uidA 13484 11775 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003648792.1 protein_id gnl|my_center|LOCUS_21290 13743 14822 gene locus_tag LOCUS_21300 gene rbsR 13743 14822 CDS product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175187.1 protein_id gnl|my_center|LOCUS_21300 14876 15637 gene locus_tag LOCUS_21310 14876 15637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 >Feature sequence101 136 777 gene locus_tag LOCUS_21320 136 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 871 1173 gene locus_tag LOCUS_21330 871 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 1440 2183 gene locus_tag LOCUS_21340 gene djlA 1440 2183 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073436.1 protein_id gnl|my_center|LOCUS_21340 2180 3046 gene locus_tag LOCUS_21350 2180 3046 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459741.1 protein_id gnl|my_center|LOCUS_21350 3192 4736 gene locus_tag LOCUS_21360 3192 4736 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056580.1 protein_id gnl|my_center|LOCUS_21360 4831 5010 gene locus_tag LOCUS_21370 4831 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 8893 5174 gene locus_tag LOCUS_21380 8893 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 8985 10154 gene locus_tag LOCUS_21390 8985 10154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 10292 12046 gene locus_tag LOCUS_21400 gene fucI 10292 12046 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779363.1 protein_id gnl|my_center|LOCUS_21400 12872 12114 gene locus_tag LOCUS_21410 12872 12114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 12998 13921 gene locus_tag LOCUS_21420 12998 13921 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087473.1 protein_id gnl|my_center|LOCUS_21420 14819 13935 gene locus_tag LOCUS_21430 14819 13935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 15048 15755 gene locus_tag LOCUS_21440 15048 15755 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020206.1 protein_id gnl|my_center|LOCUS_21440 >Feature sequence102 381 719 gene locus_tag LOCUS_21450 381 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 2631 1333 gene locus_tag LOCUS_21460 2631 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 2819 2743 gene locus_tag LOCUS_t00320 2819 2743 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4881 2899 gene locus_tag LOCUS_21470 gene mutL 4881 2899 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922757.1 protein_id gnl|my_center|LOCUS_21470 5491 4874 gene locus_tag LOCUS_21480 5491 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 6498 5488 gene locus_tag LOCUS_21490 6498 5488 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146644.1 protein_id gnl|my_center|LOCUS_21490 6670 7902 gene locus_tag LOCUS_21500 gene fabB 6670 7902 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460738.1 protein_id gnl|my_center|LOCUS_21500 7904 8791 gene locus_tag LOCUS_21510 gene lipA 7904 8791 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393263.1 protein_id gnl|my_center|LOCUS_21510 9612 8749 gene locus_tag LOCUS_21520 9612 8749 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814288.1 protein_id gnl|my_center|LOCUS_21520 10211 9609 gene locus_tag LOCUS_21530 10211 9609 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168857.1 protein_id gnl|my_center|LOCUS_21530 10792 10289 gene locus_tag LOCUS_21540 10792 10289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 10864 11961 gene locus_tag LOCUS_21550 gene tsaD 10864 11961 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942510.1 protein_id gnl|my_center|LOCUS_21550 11955 12593 gene locus_tag LOCUS_21560 gene gph 11955 12593 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532061.1 protein_id gnl|my_center|LOCUS_21560 12624 14630 gene locus_tag LOCUS_21570 12624 14630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 14676 15503 gene locus_tag LOCUS_21580 14676 15503 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932822.1 protein_id gnl|my_center|LOCUS_21580 >Feature sequence103 <1 784 gene locus_tag LOCUS_21590 <1 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141076.1:folylpolyglutamate synthase/dihydrofolate synthase family protein 805 3273 gene locus_tag LOCUS_21600 gene lon 805 3273 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_21600 3270 3986 gene locus_tag LOCUS_21610 3270 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 4758 4000 gene locus_tag LOCUS_21620 4758 4000 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044986.1 protein_id gnl|my_center|LOCUS_21620 4879 6057 gene locus_tag LOCUS_21630 gene lpxK 4879 6057 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626176.1 protein_id gnl|my_center|LOCUS_21630 6075 7229 gene locus_tag LOCUS_21640 gene galK 6075 7229 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456582.1 protein_id gnl|my_center|LOCUS_21640 7271 7714 gene locus_tag LOCUS_21650 7271 7714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 7766 8731 gene locus_tag LOCUS_21660 gene trpS 7766 8731 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016366.1 protein_id gnl|my_center|LOCUS_21660 9769 8846 gene locus_tag LOCUS_21670 9769 8846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 11080 9788 gene locus_tag LOCUS_21680 gene mtaB 11080 9788 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816469.1 protein_id gnl|my_center|LOCUS_21680 11230 11796 gene locus_tag LOCUS_21690 11230 11796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 11812 12615 gene locus_tag LOCUS_21700 11812 12615 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697455.1 protein_id gnl|my_center|LOCUS_21700 12630 13598 gene locus_tag LOCUS_21710 12630 13598 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399798.1 protein_id gnl|my_center|LOCUS_21710 13654 14634 gene locus_tag LOCUS_21720 gene ccpA 13654 14634 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229285.1 protein_id gnl|my_center|LOCUS_21720 15491 14661 gene locus_tag LOCUS_21730 15491 14661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 >Feature sequence104 1462 950 gene locus_tag LOCUS_21740 1462 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 1665 3803 gene locus_tag LOCUS_21750 1665 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 3998 6589 gene locus_tag LOCUS_21760 3998 6589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 6586 7599 gene locus_tag LOCUS_21770 6586 7599 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075386.1 protein_id gnl|my_center|LOCUS_21770 7617 8345 gene locus_tag LOCUS_21780 7617 8345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 8974 8372 gene locus_tag LOCUS_21790 8974 8372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 9817 9410 gene locus_tag LOCUS_21800 9817 9410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 10164 9814 gene locus_tag LOCUS_21810 10164 9814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 11270 10161 gene locus_tag LOCUS_21820 gene gcvT 11270 10161 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938973.1 protein_id gnl|my_center|LOCUS_21820 11980 11273 gene locus_tag LOCUS_21830 gene rpe 11980 11273 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969559.1 protein_id gnl|my_center|LOCUS_21830 15094 12266 gene locus_tag LOCUS_21840 15094 12266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 >Feature sequence105 327 2477 gene locus_tag LOCUS_21850 327 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 2528 3292 gene locus_tag LOCUS_21860 2528 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 5564 3528 gene locus_tag LOCUS_21870 5564 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 7061 5655 gene locus_tag LOCUS_21880 7061 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 7867 7058 gene locus_tag LOCUS_21890 7867 7058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 8634 7900 gene locus_tag LOCUS_21900 8634 7900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 8943 9779 gene locus_tag LOCUS_21910 8943 9779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 10469 11476 gene locus_tag LOCUS_21920 10469 11476 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075361.1 protein_id gnl|my_center|LOCUS_21920 11473 14469 gene locus_tag LOCUS_21930 11473 14469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 14491 15201 gene locus_tag LOCUS_21940 14491 15201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 >Feature sequence106 1541 3952 gene locus_tag LOCUS_21950 1541 3952 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938876.1 protein_id gnl|my_center|LOCUS_21950 4869 4165 gene locus_tag LOCUS_21960 4869 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 5977 4919 gene locus_tag LOCUS_21970 5977 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 6963 6202 gene locus_tag LOCUS_21980 gene hisF 6963 6202 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228686.1 protein_id gnl|my_center|LOCUS_21980 7494 6976 gene locus_tag LOCUS_21990 7494 6976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 9253 7514 gene locus_tag LOCUS_22000 9253 7514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 10580 9357 gene locus_tag LOCUS_22010 10580 9357 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462130.1 protein_id gnl|my_center|LOCUS_22010 11041 11619 gene locus_tag LOCUS_22020 11041 11619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 11981 12475 gene locus_tag LOCUS_22030 11981 12475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 12851 13009 gene locus_tag LOCUS_22040 12851 13009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 14199 13177 gene locus_tag LOCUS_22050 14199 13177 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080062.1 protein_id gnl|my_center|LOCUS_22050 15099 14308 gene locus_tag LOCUS_22060 15099 14308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 >Feature sequence107 1294 644 gene locus_tag LOCUS_22070 1294 644 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407318.1 protein_id gnl|my_center|LOCUS_22070 2334 1297 gene locus_tag LOCUS_22080 gene ribD 2334 1297 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942331.1 protein_id gnl|my_center|LOCUS_22080 3289 2351 gene locus_tag LOCUS_22090 gene ftsY 3289 2351 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249530.1 protein_id gnl|my_center|LOCUS_22090 3801 3286 gene locus_tag LOCUS_22100 gene nusB 3801 3286 CDS product N utilization substance protein NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830247.1 protein_id gnl|my_center|LOCUS_22100 4286 3801 gene locus_tag LOCUS_22110 gene ribH 4286 3801 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223915.1 protein_id gnl|my_center|LOCUS_22110 6767 4386 gene locus_tag LOCUS_22120 gene pheT 6767 4386 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_22120 7810 6791 gene locus_tag LOCUS_22130 gene pheS 7810 6791 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436795.1 protein_id gnl|my_center|LOCUS_22130 8427 8077 gene locus_tag LOCUS_22140 gene rplT 8427 8077 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393357.1 protein_id gnl|my_center|LOCUS_22140 8653 8453 gene locus_tag LOCUS_22150 gene rpmI 8653 8453 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939806.1 protein_id gnl|my_center|LOCUS_22150 9169 8738 gene locus_tag LOCUS_22160 gene infC 9169 8738 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008036.1 protein_id gnl|my_center|LOCUS_22160 11068 9338 gene locus_tag LOCUS_22170 gene thrS 11068 9338 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_22170 12645 11239 gene locus_tag LOCUS_22180 gene ahcY 12645 11239 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229256.1 protein_id gnl|my_center|LOCUS_22180 13670 12651 gene locus_tag LOCUS_22190 13670 12651 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797481.1 protein_id gnl|my_center|LOCUS_22190 14871 13675 gene locus_tag LOCUS_22200 gene metK 14871 13675 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053346.1 protein_id gnl|my_center|LOCUS_22200 >Feature sequence108 2289 1669 gene locus_tag LOCUS_22210 2289 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 3386 2373 gene locus_tag LOCUS_22220 3386 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 3532 4422 gene locus_tag LOCUS_22230 3532 4422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 4415 5287 gene locus_tag LOCUS_22240 4415 5287 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_22240 5293 6228 gene locus_tag LOCUS_22250 5293 6228 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_22250 6236 6916 gene locus_tag LOCUS_22260 6236 6916 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_22260 6937 7875 gene locus_tag LOCUS_22270 6937 7875 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488462.1 protein_id gnl|my_center|LOCUS_22270 7872 10925 gene locus_tag LOCUS_22280 7872 10925 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389909.1 protein_id gnl|my_center|LOCUS_22280 10927 12321 gene locus_tag LOCUS_22290 gene noeA 10927 12321 CDS product nodulation protein NoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967406.1 protein_id gnl|my_center|LOCUS_22290 12308 12694 gene locus_tag LOCUS_22300 12308 12694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 13728 12718 gene locus_tag LOCUS_22310 13728 12718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 15479 13932 gene locus_tag LOCUS_22320 15479 13932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 >Feature sequence109 1034 309 gene locus_tag LOCUS_22330 1034 309 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888715.1 protein_id gnl|my_center|LOCUS_22330 3204 1336 gene locus_tag LOCUS_22340 3204 1336 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776870.1 protein_id gnl|my_center|LOCUS_22340 3368 3973 gene locus_tag LOCUS_22350 3368 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 3960 5660 gene locus_tag LOCUS_22360 3960 5660 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674781.1 protein_id gnl|my_center|LOCUS_22360 5650 6840 gene locus_tag LOCUS_22370 5650 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 10004 6816 gene locus_tag LOCUS_22380 10004 6816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 10736 10029 gene locus_tag LOCUS_22390 10736 10029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 12171 11083 gene locus_tag LOCUS_22400 12171 11083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 12436 12900 gene locus_tag LOCUS_22410 12436 12900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 12917 13273 gene locus_tag LOCUS_22420 12917 13273 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922983.1 protein_id gnl|my_center|LOCUS_22420 13877 13431 gene locus_tag LOCUS_22430 13877 13431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401233.1 protein_id gnl|my_center|LOCUS_22430 14395 14153 gene locus_tag LOCUS_22440 14395 14153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 14966 14511 gene locus_tag LOCUS_22450 14966 14511 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886890.1 protein_id gnl|my_center|LOCUS_22450 >Feature sequence110 885 94 gene locus_tag LOCUS_22460 885 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 1566 904 gene locus_tag LOCUS_22470 1566 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 1749 2348 gene locus_tag LOCUS_22480 1749 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 2302 2838 gene locus_tag LOCUS_22490 2302 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 3624 2857 gene locus_tag LOCUS_22500 3624 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 4592 3720 gene locus_tag LOCUS_22510 4592 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 4664 6577 gene locus_tag LOCUS_22520 4664 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 6577 7332 gene locus_tag LOCUS_22530 6577 7332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 7345 8406 gene locus_tag LOCUS_22540 7345 8406 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082283.1 protein_id gnl|my_center|LOCUS_22540 8513 8589 gene locus_tag LOCUS_t00330 8513 8589 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 8886 9977 gene locus_tag LOCUS_22550 8886 9977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 9999 10934 gene locus_tag LOCUS_22560 9999 10934 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776771.1 protein_id gnl|my_center|LOCUS_22560 11036 11800 gene locus_tag LOCUS_22570 11036 11800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 11802 14747 gene locus_tag LOCUS_22580 11802 14747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 >Feature sequence111 1421 210 gene locus_tag LOCUS_22590 1421 210 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974189.1 protein_id gnl|my_center|LOCUS_22590 2400 1504 gene locus_tag LOCUS_22600 2400 1504 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042983.1 protein_id gnl|my_center|LOCUS_22600 2731 2393 gene locus_tag LOCUS_22610 2731 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 5305 4166 gene locus_tag LOCUS_22620 5305 4166 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267353.1 protein_id gnl|my_center|LOCUS_22620 6462 5305 gene locus_tag LOCUS_22630 6462 5305 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118864.1 protein_id gnl|my_center|LOCUS_22630 7609 7139 gene locus_tag LOCUS_22640 7609 7139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 8540 8277 gene locus_tag LOCUS_22650 8540 8277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 9250 8825 gene locus_tag LOCUS_22660 9250 8825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 11799 11116 gene locus_tag LOCUS_22670 11799 11116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 14626 13832 gene locus_tag LOCUS_22680 14626 13832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 >Feature sequence112 135 599 gene locus_tag LOCUS_22690 135 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 1078 596 gene locus_tag LOCUS_22700 1078 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 1710 1102 gene locus_tag LOCUS_22710 1710 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 1940 1707 gene locus_tag LOCUS_22720 1940 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 2909 2067 gene locus_tag LOCUS_22730 2909 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 3304 3026 gene locus_tag LOCUS_22740 3304 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22740 3811 3449 gene locus_tag LOCUS_22750 gene gcvH 3811 3449 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942661.1 protein_id gnl|my_center|LOCUS_22750 4654 10479 gene locus_tag LOCUS_22760 4654 10479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 10476 11384 gene locus_tag LOCUS_22770 10476 11384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 11400 13385 gene locus_tag LOCUS_22780 11400 13385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 >Feature sequence113 1803 2819 gene locus_tag LOCUS_22790 1803 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 2816 3592 gene locus_tag LOCUS_22800 2816 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 3725 4636 gene locus_tag LOCUS_22810 3725 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 4772 6520 gene locus_tag LOCUS_22820 4772 6520 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029327287.1 protein_id gnl|my_center|LOCUS_22820 6759 7241 gene locus_tag LOCUS_22830 6759 7241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 7355 8767 gene locus_tag LOCUS_22840 7355 8767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 9799 8861 gene locus_tag LOCUS_22850 9799 8861 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723333.1 protein_id gnl|my_center|LOCUS_22850 10194 9781 gene locus_tag LOCUS_22860 10194 9781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 11031 10198 gene locus_tag LOCUS_22870 11031 10198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 11928 11257 gene locus_tag LOCUS_22880 11928 11257 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641021.1 protein_id gnl|my_center|LOCUS_22880 <14603 12052 gene locus_tag LOCUS_22890 <14603 12052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258924.1:glycosyl hydrolase >Feature sequence114 2160 841 gene locus_tag LOCUS_22900 2160 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 4120 2174 gene locus_tag LOCUS_22910 4120 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 5436 4135 gene locus_tag LOCUS_22920 5436 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 5571 6653 gene locus_tag LOCUS_22930 5571 6653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 6756 7016 gene locus_tag LOCUS_22940 6756 7016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 7030 8709 gene locus_tag LOCUS_22950 7030 8709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 8731 9492 gene locus_tag LOCUS_22960 8731 9492 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675715.1 protein_id gnl|my_center|LOCUS_22960 9589 10269 gene locus_tag LOCUS_22970 gene queC 9589 10269 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390955.1 protein_id gnl|my_center|LOCUS_22970 10996 10352 gene locus_tag LOCUS_22980 10996 10352 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228783.1 protein_id gnl|my_center|LOCUS_22980 11807 10998 gene locus_tag LOCUS_22990 11807 10998 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084558766.1 protein_id gnl|my_center|LOCUS_22990 12103 12885 gene locus_tag LOCUS_23000 12103 12885 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783535.1 protein_id gnl|my_center|LOCUS_23000 12882 13826 gene locus_tag LOCUS_23010 12882 13826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 14246 13872 gene locus_tag LOCUS_23020 14246 13872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 >Feature sequence115 969 166 gene locus_tag LOCUS_23030 969 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 1065 3659 gene locus_tag LOCUS_23040 1065 3659 CDS product non-lysosomal glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108530.1 protein_id gnl|my_center|LOCUS_23040 4636 3800 gene locus_tag LOCUS_23050 4636 3800 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369253.1 protein_id gnl|my_center|LOCUS_23050 7538 4644 gene locus_tag LOCUS_23060 7538 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 8281 7619 gene locus_tag LOCUS_23070 8281 7619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 8682 10142 gene locus_tag LOCUS_23080 8682 10142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 10296 10601 gene locus_tag LOCUS_23090 10296 10601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 10789 11592 gene locus_tag LOCUS_23100 10789 11592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 11592 12203 gene locus_tag LOCUS_23110 11592 12203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 12614 12207 gene locus_tag LOCUS_23120 12614 12207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 14285 12723 gene locus_tag LOCUS_23130 14285 12723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 >Feature sequence116 1012 3099 gene locus_tag LOCUS_23140 1012 3099 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_23140 4377 3112 gene locus_tag LOCUS_23150 4377 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 4900 4385 gene locus_tag LOCUS_23160 4900 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 7377 4897 gene locus_tag LOCUS_23170 7377 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 8713 7385 gene locus_tag LOCUS_23180 gene mnmE 8713 7385 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258674.1 protein_id gnl|my_center|LOCUS_23180 9033 10052 gene locus_tag LOCUS_23190 9033 10052 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_23190 10085 13549 gene locus_tag LOCUS_23200 10085 13549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 13565 14308 gene locus_tag LOCUS_23210 13565 14308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 >Feature sequence117 1757 4234 gene locus_tag LOCUS_23220 1757 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 4327 5511 gene locus_tag LOCUS_23230 gene purT 4327 5511 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406408.1 protein_id gnl|my_center|LOCUS_23230 5511 6389 gene locus_tag LOCUS_23240 5511 6389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 7304 6423 gene locus_tag LOCUS_23250 7304 6423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 7953 8966 gene locus_tag LOCUS_23260 gene cytR 7953 8966 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815292.1 protein_id gnl|my_center|LOCUS_23260 8982 9938 gene locus_tag LOCUS_23270 8982 9938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 10023 10751 gene locus_tag LOCUS_23280 10023 10751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 10752 11699 gene locus_tag LOCUS_23290 10752 11699 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972087.1 protein_id gnl|my_center|LOCUS_23290 11703 12968 gene locus_tag LOCUS_23300 11703 12968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 >Feature sequence118 1881 3410 gene locus_tag LOCUS_23310 1881 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 3444 4322 gene locus_tag LOCUS_23320 gene folD 3444 4322 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_23320 4350 5633 gene locus_tag LOCUS_23330 gene vmeY 4350 5633 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VmeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477351.1 protein_id gnl|my_center|LOCUS_23330 5630 8788 gene locus_tag LOCUS_23340 gene vmeQ 5630 8788 CDS product efflux RND transporter permease subunit VmeQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479247.1 protein_id gnl|my_center|LOCUS_23340 9102 9734 gene locus_tag LOCUS_23350 9102 9734 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888540.1 protein_id gnl|my_center|LOCUS_23350 9753 10532 gene locus_tag LOCUS_23360 9753 10532 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012068.1 protein_id gnl|my_center|LOCUS_23360 10536 11696 gene locus_tag LOCUS_23370 10536 11696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 12719 11745 gene locus_tag LOCUS_23380 12719 11745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 12902 13168 gene locus_tag LOCUS_23390 12902 13168 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761253.1 protein_id gnl|my_center|LOCUS_23390 >Feature sequence119 1481 357 gene locus_tag LOCUS_23400 1481 357 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002374726.1 protein_id gnl|my_center|LOCUS_23400 2022 1777 gene locus_tag LOCUS_23410 2022 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 3550 2099 gene locus_tag LOCUS_23420 3550 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 3924 3547 gene locus_tag LOCUS_23430 3924 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 5697 4510 gene locus_tag LOCUS_23440 gene rodA 5697 4510 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392081.1 protein_id gnl|my_center|LOCUS_23440 7044 5776 gene locus_tag LOCUS_23450 7044 5776 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262728.1 protein_id gnl|my_center|LOCUS_23450 7332 8618 gene locus_tag LOCUS_23460 7332 8618 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_23460 8645 10459 gene locus_tag LOCUS_23470 8645 10459 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003276.1 protein_id gnl|my_center|LOCUS_23470 10462 10917 gene locus_tag LOCUS_23480 10462 10917 CDS product ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556692.1 protein_id gnl|my_center|LOCUS_23480 10974 11609 gene locus_tag LOCUS_23490 10974 11609 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888032.1 protein_id gnl|my_center|LOCUS_23490 11619 13187 gene locus_tag LOCUS_23500 11619 13187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 13825 13238 gene locus_tag LOCUS_23510 13825 13238 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943859.1 protein_id gnl|my_center|LOCUS_23510 >Feature sequence120 3518 2439 gene locus_tag LOCUS_23520 3518 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 6190 3515 gene locus_tag LOCUS_23530 6190 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 7032 6211 gene locus_tag LOCUS_23540 7032 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 7209 8261 gene locus_tag LOCUS_23550 7209 8261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 9071 8286 gene locus_tag LOCUS_23560 9071 8286 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891843.1 protein_id gnl|my_center|LOCUS_23560 13914 9169 gene locus_tag LOCUS_23570 13914 9169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 >Feature sequence121 397 606 gene locus_tag LOCUS_23580 397 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 1871 819 gene locus_tag LOCUS_23590 1871 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 5509 1754 gene locus_tag LOCUS_23600 5509 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 6215 5535 gene locus_tag LOCUS_23610 6215 5535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 6582 6316 gene locus_tag LOCUS_23620 6582 6316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 6725 7030 gene locus_tag LOCUS_23630 6725 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 7073 7759 gene locus_tag LOCUS_23640 7073 7759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23640 8504 7791 gene locus_tag LOCUS_23650 8504 7791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 8668 9519 gene locus_tag LOCUS_23660 8668 9519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 9599 9922 gene locus_tag LOCUS_23670 9599 9922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 10823 9927 gene locus_tag LOCUS_23680 10823 9927 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015848914.1 protein_id gnl|my_center|LOCUS_23680 12850 10820 gene locus_tag LOCUS_23690 12850 10820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 13037 13849 gene locus_tag LOCUS_23700 13037 13849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 >Feature sequence122 1905 406 gene locus_tag LOCUS_23710 1905 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 6389 1902 gene locus_tag LOCUS_23720 6389 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 7293 6394 gene locus_tag LOCUS_23730 7293 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 7514 8551 gene locus_tag LOCUS_23740 7514 8551 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039199.1 protein_id gnl|my_center|LOCUS_23740 9492 8647 gene locus_tag LOCUS_23750 9492 8647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 9707 10420 gene locus_tag LOCUS_23760 9707 10420 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436876.1 protein_id gnl|my_center|LOCUS_23760 12563 10461 gene locus_tag LOCUS_23770 12563 10461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 12864 13349 gene locus_tag LOCUS_23780 12864 13349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 <14141 13356 gene locus_tag LOCUS_23790 <14141 13356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119142.1:exo-alpha-sialidase >Feature sequence123 <1 735 gene locus_tag LOCUS_23800 <1 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_172625979.1:ATP-binding protein 1197 922 gene locus_tag LOCUS_23810 1197 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 1386 1781 gene locus_tag LOCUS_23820 1386 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 2402 2190 gene locus_tag LOCUS_23830 2402 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 2728 3657 gene locus_tag LOCUS_23840 2728 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 3657 4217 gene locus_tag LOCUS_23850 3657 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 4214 4729 gene locus_tag LOCUS_23860 4214 4729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 4726 7029 gene locus_tag LOCUS_23870 gene gspD 4726 7029 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394575.1 protein_id gnl|my_center|LOCUS_23870 7014 8594 gene locus_tag LOCUS_23880 7014 8594 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_23880 8599 9795 gene locus_tag LOCUS_23890 gene gspF 8599 9795 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940995.1 protein_id gnl|my_center|LOCUS_23890 9809 10225 gene locus_tag LOCUS_23900 gene gspG 9809 10225 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088760.1 protein_id gnl|my_center|LOCUS_23900 10230 10658 gene locus_tag LOCUS_23910 10230 10658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 10645 11031 gene locus_tag LOCUS_23920 10645 11031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 11021 11659 gene locus_tag LOCUS_23930 11021 11659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 11646 12608 gene locus_tag LOCUS_23940 11646 12608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 >Feature sequence124 2229 382 gene locus_tag LOCUS_23950 2229 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 3262 2246 gene locus_tag LOCUS_23960 3262 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 3514 3275 gene locus_tag LOCUS_23970 3514 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 7771 3638 gene locus_tag LOCUS_23980 7771 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 8912 7902 gene locus_tag LOCUS_23990 8912 7902 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860719.1 protein_id gnl|my_center|LOCUS_23990 9415 10365 gene locus_tag LOCUS_24000 9415 10365 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267746.1 protein_id gnl|my_center|LOCUS_24000 10365 10970 gene locus_tag LOCUS_24010 10365 10970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 11045 12676 gene locus_tag LOCUS_24020 11045 12676 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777117.1 protein_id gnl|my_center|LOCUS_24020 12750 12825 gene locus_tag LOCUS_t00340 12750 12825 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 12986 13195 gene locus_tag LOCUS_24030 12986 13195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 13283 13447 gene locus_tag LOCUS_24040 13283 13447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 >Feature sequence125 1871 540 gene locus_tag LOCUS_24050 1871 540 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839714.1 protein_id gnl|my_center|LOCUS_24050 1944 2801 gene locus_tag LOCUS_24060 1944 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 3267 2809 gene locus_tag LOCUS_24070 3267 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 4694 3264 gene locus_tag LOCUS_24080 4694 3264 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438093.1 protein_id gnl|my_center|LOCUS_24080 5879 4695 gene locus_tag LOCUS_24090 5879 4695 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438092.1 protein_id gnl|my_center|LOCUS_24090 6686 5886 gene locus_tag LOCUS_24100 6686 5886 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965836.1 protein_id gnl|my_center|LOCUS_24100 7966 6683 gene locus_tag LOCUS_24110 gene larA 7966 6683 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948687.1 protein_id gnl|my_center|LOCUS_24110 8734 8090 gene locus_tag LOCUS_24120 8734 8090 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895132.1 protein_id gnl|my_center|LOCUS_24120 8964 10058 gene locus_tag LOCUS_24130 8964 10058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 10278 11036 gene locus_tag LOCUS_24140 10278 11036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 11087 13474 gene locus_tag LOCUS_24150 11087 13474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 >Feature sequence126 1000 251 gene locus_tag LOCUS_24160 1000 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24160 2789 993 gene locus_tag LOCUS_24170 2789 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 4021 2786 gene locus_tag LOCUS_24180 4021 2786 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631406.1 protein_id gnl|my_center|LOCUS_24180 5082 4018 gene locus_tag LOCUS_24190 gene cbiD 5082 4018 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940016.1 protein_id gnl|my_center|LOCUS_24190 5744 5079 gene locus_tag LOCUS_24200 5744 5079 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943629.1 protein_id gnl|my_center|LOCUS_24200 6274 5744 gene locus_tag LOCUS_24210 gene cobO 6274 5744 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766671.1 protein_id gnl|my_center|LOCUS_24210 8809 6275 gene locus_tag LOCUS_24220 8809 6275 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052877.1 protein_id gnl|my_center|LOCUS_24220 9795 8806 gene locus_tag LOCUS_24230 9795 8806 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937994.1 protein_id gnl|my_center|LOCUS_24230 10487 9792 gene locus_tag LOCUS_24240 gene cobI 10487 9792 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876960.1 protein_id gnl|my_center|LOCUS_24240 11596 10484 gene locus_tag LOCUS_24250 11596 10484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 12537 11746 gene locus_tag LOCUS_24260 12537 11746 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948410.1 protein_id gnl|my_center|LOCUS_24260 13537 12527 gene locus_tag LOCUS_24270 13537 12527 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018304962.1 protein_id gnl|my_center|LOCUS_24270 13764 13534 gene locus_tag LOCUS_24280 13764 13534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 >Feature sequence127 2531 1779 gene locus_tag LOCUS_24290 2531 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 4350 2908 gene locus_tag LOCUS_24300 4350 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 6415 4355 gene locus_tag LOCUS_24310 6415 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 7198 6440 gene locus_tag LOCUS_24320 7198 6440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 8425 7286 gene locus_tag LOCUS_24330 8425 7286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 8885 9076 gene locus_tag LOCUS_24340 8885 9076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 9232 9441 gene locus_tag LOCUS_24350 9232 9441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 9443 10030 gene locus_tag LOCUS_24360 9443 10030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 10995 10009 gene locus_tag LOCUS_24370 10995 10009 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015940983.1 protein_id gnl|my_center|LOCUS_24370 11201 11004 gene locus_tag LOCUS_24380 11201 11004 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 protein_id gnl|my_center|LOCUS_24380 12293 11985 gene locus_tag LOCUS_24390 12293 11985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 13335 12286 gene locus_tag LOCUS_24400 13335 12286 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681769.1 protein_id gnl|my_center|LOCUS_24400 >Feature sequence128 122 973 gene locus_tag LOCUS_24410 122 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 964 2019 gene locus_tag LOCUS_24420 964 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 2029 3501 gene locus_tag LOCUS_24430 2029 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 3498 5606 gene locus_tag LOCUS_24440 3498 5606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 5610 7661 gene locus_tag LOCUS_24450 5610 7661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 7677 9848 gene locus_tag LOCUS_24460 7677 9848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 9854 10249 gene locus_tag LOCUS_24470 9854 10249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 10259 11056 gene locus_tag LOCUS_24480 10259 11056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 11053 11478 gene locus_tag LOCUS_24490 11053 11478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 11493 11930 gene locus_tag LOCUS_24500 11493 11930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 11927 12289 gene locus_tag LOCUS_24510 11927 12289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 12319 12645 gene locus_tag LOCUS_24520 12319 12645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 13146 13385 gene locus_tag LOCUS_24530 13146 13385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 >Feature sequence129 180 938 gene locus_tag LOCUS_24540 180 938 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804037.1 protein_id gnl|my_center|LOCUS_24540 970 2118 gene locus_tag LOCUS_24550 970 2118 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086176.1 protein_id gnl|my_center|LOCUS_24550 2885 2331 gene locus_tag LOCUS_24560 2885 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 3739 2909 gene locus_tag LOCUS_24570 3739 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 4586 3729 gene locus_tag LOCUS_24580 4586 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 4704 6011 gene locus_tag LOCUS_24590 4704 6011 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_24590 7310 6135 gene locus_tag LOCUS_24600 7310 6135 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983707.1 protein_id gnl|my_center|LOCUS_24600 10639 7541 gene locus_tag LOCUS_24610 10639 7541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 11263 10655 gene locus_tag LOCUS_24620 11263 10655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 11656 12792 gene locus_tag LOCUS_24630 11656 12792 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267808.1 protein_id gnl|my_center|LOCUS_24630 12882 13499 gene locus_tag LOCUS_24640 12882 13499 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_24640 >Feature sequence130 1419 487 gene locus_tag LOCUS_24650 gene rhaS 1419 487 CDS product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099335.1 protein_id gnl|my_center|LOCUS_24650 1656 4358 gene locus_tag LOCUS_24660 1656 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 4355 5005 gene locus_tag LOCUS_24670 4355 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 6044 4995 gene locus_tag LOCUS_24680 6044 4995 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582922.1 protein_id gnl|my_center|LOCUS_24680 6910 6041 gene locus_tag LOCUS_24690 gene prmC 6910 6041 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_24690 9341 7047 gene locus_tag LOCUS_24700 9341 7047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 12640 9527 gene locus_tag LOCUS_24710 12640 9527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 13433 12711 gene locus_tag LOCUS_24720 13433 12711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 >Feature sequence131 228 1655 gene locus_tag LOCUS_24730 228 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 1655 2380 gene locus_tag LOCUS_24740 1655 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 3827 2472 gene locus_tag LOCUS_24750 3827 2472 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784328.1 protein_id gnl|my_center|LOCUS_24750 5635 3830 gene locus_tag LOCUS_24760 gene typA 5635 3830 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108480.1 protein_id gnl|my_center|LOCUS_24760 5787 7082 gene locus_tag LOCUS_24770 5787 7082 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118023.1 protein_id gnl|my_center|LOCUS_24770 7378 7136 gene locus_tag LOCUS_24780 7378 7136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 7639 7403 gene locus_tag LOCUS_24790 7639 7403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 7916 7653 gene locus_tag LOCUS_24800 7916 7653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 9697 7913 gene locus_tag LOCUS_24810 9697 7913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 10007 10573 gene locus_tag LOCUS_24820 10007 10573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 10779 11405 gene locus_tag LOCUS_24830 10779 11405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 12419 11460 gene locus_tag LOCUS_24840 12419 11460 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947606.1 protein_id gnl|my_center|LOCUS_24840 12581 13399 gene locus_tag LOCUS_24850 12581 13399 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805101.1 protein_id gnl|my_center|LOCUS_24850 >Feature sequence132 539 1519 gene locus_tag LOCUS_24860 gene bioB 539 1519 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931746.1 protein_id gnl|my_center|LOCUS_24860 1522 2676 gene locus_tag LOCUS_24870 1522 2676 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931745.1 protein_id gnl|my_center|LOCUS_24870 2673 3329 gene locus_tag LOCUS_24880 2673 3329 CDS product DUF452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926793.1 protein_id gnl|my_center|LOCUS_24880 3310 4074 gene locus_tag LOCUS_24890 gene bioC 3310 4074 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205939.1 protein_id gnl|my_center|LOCUS_24890 4076 4762 gene locus_tag LOCUS_24900 gene bioD 4076 4762 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795149.1 protein_id gnl|my_center|LOCUS_24900 4759 6030 gene locus_tag LOCUS_24910 4759 6030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 6670 6080 gene locus_tag LOCUS_24920 6670 6080 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197907.1 protein_id gnl|my_center|LOCUS_24920 7446 6760 gene locus_tag LOCUS_24930 gene radC 7446 6760 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938489.1 protein_id gnl|my_center|LOCUS_24930 8646 7447 gene locus_tag LOCUS_24940 gene rlmD 8646 7447 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_24940 8828 9949 gene locus_tag LOCUS_24950 8828 9949 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_24950 9959 11995 gene locus_tag LOCUS_24960 gene msbA 9959 11995 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_24960 11988 13256 gene locus_tag LOCUS_24970 gene murC 11988 13256 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939773.1 protein_id gnl|my_center|LOCUS_24970 >Feature sequence133 2914 2003 gene locus_tag LOCUS_24980 2914 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 3114 4061 gene locus_tag LOCUS_24990 3114 4061 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703939.1 protein_id gnl|my_center|LOCUS_24990 4063 4824 gene locus_tag LOCUS_25000 4063 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 4852 6198 gene locus_tag LOCUS_25010 4852 6198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 6221 7738 gene locus_tag LOCUS_25020 6221 7738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 8160 7759 gene locus_tag LOCUS_25030 8160 7759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 8420 8175 gene locus_tag LOCUS_25040 8420 8175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 9133 8417 gene locus_tag LOCUS_25050 9133 8417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 9648 9181 gene locus_tag LOCUS_25060 9648 9181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 10288 9641 gene locus_tag LOCUS_25070 10288 9641 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537045.1 protein_id gnl|my_center|LOCUS_25070 12797 10290 gene locus_tag LOCUS_25080 12797 10290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 <13372 12815 gene locus_tag LOCUS_25090 <13372 12815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964335.1:recombinase RecA >Feature sequence134 31 459 gene locus_tag LOCUS_25100 31 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 490 990 gene locus_tag LOCUS_25110 gene fldA 490 990 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140318.1 protein_id gnl|my_center|LOCUS_25110 1126 1830 gene locus_tag LOCUS_25120 1126 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 2674 1871 gene locus_tag LOCUS_25130 2674 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 3106 3576 gene locus_tag LOCUS_25140 3106 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 4699 3782 gene locus_tag LOCUS_25150 4699 3782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 6197 4821 gene locus_tag LOCUS_25160 6197 4821 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017176.1 protein_id gnl|my_center|LOCUS_25160 6400 7290 gene locus_tag LOCUS_25170 6400 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 7287 7760 gene locus_tag LOCUS_25180 gene ispF 7287 7760 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488386.1 protein_id gnl|my_center|LOCUS_25180 8446 7772 gene locus_tag LOCUS_25190 8446 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 10148 8805 gene locus_tag LOCUS_25200 10148 8805 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_25200 10271 10483 gene locus_tag LOCUS_25210 10271 10483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 11173 10571 gene locus_tag LOCUS_25220 11173 10571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 12502 11675 gene locus_tag LOCUS_25230 12502 11675 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462252.1 protein_id gnl|my_center|LOCUS_25230 >Feature sequence135 862 149 gene locus_tag LOCUS_25240 gene rsmI 862 149 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784666.1 protein_id gnl|my_center|LOCUS_25240 1119 889 gene locus_tag LOCUS_25250 1119 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 1021 1638 gene locus_tag LOCUS_25260 1021 1638 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392865.1 protein_id gnl|my_center|LOCUS_25260 2318 1629 gene locus_tag LOCUS_25270 2318 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 3567 2323 gene locus_tag LOCUS_25280 3567 2323 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000479230.1 protein_id gnl|my_center|LOCUS_25280 5268 3658 gene locus_tag LOCUS_25290 5268 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 6698 5265 gene locus_tag LOCUS_25300 6698 5265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 7855 6695 gene locus_tag LOCUS_25310 7855 6695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 9923 7896 gene locus_tag LOCUS_25320 9923 7896 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045029.1 protein_id gnl|my_center|LOCUS_25320 11045 9927 gene locus_tag LOCUS_25330 11045 9927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 11990 11052 gene locus_tag LOCUS_25340 11990 11052 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937986.1 protein_id gnl|my_center|LOCUS_25340 <13347 12038 gene locus_tag LOCUS_25350 <13347 12038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582430.1:FtsH protease activity modulator HflK >Feature sequence136 299 1414 gene locus_tag LOCUS_25360 299 1414 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546390.1 protein_id gnl|my_center|LOCUS_25360 1632 2285 gene locus_tag LOCUS_25370 1632 2285 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669725.1 protein_id gnl|my_center|LOCUS_25370 2339 2854 gene locus_tag LOCUS_25380 gene nuoE 2339 2854 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081672.1 protein_id gnl|my_center|LOCUS_25380 2877 4787 gene locus_tag LOCUS_25390 gene nuoF 2877 4787 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393387.1 protein_id gnl|my_center|LOCUS_25390 4821 6851 gene locus_tag LOCUS_25400 4821 6851 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_25400 7022 8026 gene locus_tag LOCUS_25410 7022 8026 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203127.1 protein_id gnl|my_center|LOCUS_25410 9305 8061 gene locus_tag LOCUS_25420 9305 8061 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980493.1 protein_id gnl|my_center|LOCUS_25420 10008 9433 gene locus_tag LOCUS_25430 10008 9433 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943063.1 protein_id gnl|my_center|LOCUS_25430 10597 10070 gene locus_tag LOCUS_25440 10597 10070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 >Feature sequence137 1623 298 gene locus_tag LOCUS_25450 1623 298 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 protein_id gnl|my_center|LOCUS_25450 2561 1620 gene locus_tag LOCUS_25460 2561 1620 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938246.1 protein_id gnl|my_center|LOCUS_25460 4488 2611 gene locus_tag LOCUS_25470 4488 2611 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015951.1 protein_id gnl|my_center|LOCUS_25470 5713 4658 gene locus_tag LOCUS_25480 5713 4658 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942398.1 protein_id gnl|my_center|LOCUS_25480 6027 12251 gene locus_tag LOCUS_25490 6027 12251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 12267 12428 gene locus_tag LOCUS_25500 12267 12428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 >Feature sequence138 <1 637 gene locus_tag LOCUS_25510 <1 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393713.1:glycosyltransferase family 2 protein 642 1469 gene locus_tag LOCUS_25520 642 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 1466 2743 gene locus_tag LOCUS_25530 1466 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 3285 2734 gene locus_tag LOCUS_25540 3285 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 4256 3282 gene locus_tag LOCUS_25550 gene galE 4256 3282 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964738.1 protein_id gnl|my_center|LOCUS_25550 4504 5472 gene locus_tag LOCUS_25560 4504 5472 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225188.1 protein_id gnl|my_center|LOCUS_25560 5526 6728 gene locus_tag LOCUS_25570 5526 6728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122044.1 protein_id gnl|my_center|LOCUS_25570 6857 7123 gene locus_tag LOCUS_25580 gene rpsT 6857 7123 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583468.1 protein_id gnl|my_center|LOCUS_25580 7205 8128 gene locus_tag LOCUS_25590 7205 8128 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476237.1 protein_id gnl|my_center|LOCUS_25590 9696 8203 gene locus_tag LOCUS_25600 9696 8203 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098859.1 protein_id gnl|my_center|LOCUS_25600 11200 9698 gene locus_tag LOCUS_25610 11200 9698 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964014.1 protein_id gnl|my_center|LOCUS_25610 12807 11293 gene locus_tag LOCUS_25620 12807 11293 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437136.1 protein_id gnl|my_center|LOCUS_25620 >Feature sequence139 1172 117 gene locus_tag LOCUS_25630 1172 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 2630 1698 gene locus_tag LOCUS_25640 gene trxB 2630 1698 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932523.1 protein_id gnl|my_center|LOCUS_25640 4541 2643 gene locus_tag LOCUS_25650 gene asnB 4541 2643 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_25650 4647 5543 gene locus_tag LOCUS_25660 gene thiL 4647 5543 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_25660 5533 5973 gene locus_tag LOCUS_25670 gene tsaE 5533 5973 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234079.1 protein_id gnl|my_center|LOCUS_25670 5976 6719 gene locus_tag LOCUS_25680 5976 6719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 6814 8547 gene locus_tag LOCUS_25690 6814 8547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 9069 9144 gene locus_tag LOCUS_t00350 9069 9144 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 9224 9451 gene locus_tag LOCUS_25700 gene rpmB 9224 9451 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942874.1 protein_id gnl|my_center|LOCUS_25700 9550 9738 gene locus_tag LOCUS_25710 9550 9738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 9735 11405 gene locus_tag LOCUS_25720 9735 11405 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877458.1 protein_id gnl|my_center|LOCUS_25720 >Feature sequence140 290 75 gene locus_tag LOCUS_25730 290 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 626 916 gene locus_tag LOCUS_25740 626 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 1132 1317 gene locus_tag LOCUS_25750 1132 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 1314 1547 gene locus_tag LOCUS_25760 1314 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 1579 3096 gene locus_tag LOCUS_25770 1579 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 3283 4719 gene locus_tag LOCUS_25780 3283 4719 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948764.1 protein_id gnl|my_center|LOCUS_25780 5008 6747 gene locus_tag LOCUS_25790 gene rpsA 5008 6747 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882963.1 protein_id gnl|my_center|LOCUS_25790 6991 8007 gene locus_tag LOCUS_25800 6991 8007 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022981.1 protein_id gnl|my_center|LOCUS_25800 8004 8747 gene locus_tag LOCUS_25810 8004 8747 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022982.1 protein_id gnl|my_center|LOCUS_25810 9598 8693 gene locus_tag LOCUS_25820 gene rhaR 9598 8693 CDS product HTH-type transcriptional activator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099334.1 protein_id gnl|my_center|LOCUS_25820 9722 11353 gene locus_tag LOCUS_25830 9722 11353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 12491 11490 gene locus_tag LOCUS_25840 12491 11490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 >Feature sequence141 1546 506 gene locus_tag LOCUS_25850 1546 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 2553 1543 gene locus_tag LOCUS_25860 2553 1543 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_25860 3836 2550 gene locus_tag LOCUS_25870 3836 2550 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931920.1 protein_id gnl|my_center|LOCUS_25870 3982 5301 gene locus_tag LOCUS_25880 3982 5301 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002683949.1 protein_id gnl|my_center|LOCUS_25880 6005 5310 gene locus_tag LOCUS_25890 6005 5310 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074040.1 protein_id gnl|my_center|LOCUS_25890 7806 5992 gene locus_tag LOCUS_25900 7806 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 9201 7819 gene locus_tag LOCUS_25910 9201 7819 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922235.1 protein_id gnl|my_center|LOCUS_25910 10123 9338 gene locus_tag LOCUS_25920 10123 9338 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021858.1 protein_id gnl|my_center|LOCUS_25920 10222 11106 gene locus_tag LOCUS_25930 10222 11106 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941867.1 protein_id gnl|my_center|LOCUS_25930 12622 11054 gene locus_tag LOCUS_25940 gene abfA 12622 11054 CDS product alpha-L-arabinofuranosidase AbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398747.1 protein_id gnl|my_center|LOCUS_25940 >Feature sequence142 3281 1608 gene locus_tag LOCUS_25950 3281 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 5002 3278 gene locus_tag LOCUS_25960 gene ade 5002 3278 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992329.1 protein_id gnl|my_center|LOCUS_25960 5516 5007 gene locus_tag LOCUS_25970 5516 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 5606 6826 gene locus_tag LOCUS_25980 5606 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 6832 8034 gene locus_tag LOCUS_25990 6832 8034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 8110 10356 gene locus_tag LOCUS_26000 8110 10356 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943959.1 protein_id gnl|my_center|LOCUS_26000 10388 11323 gene locus_tag LOCUS_26010 10388 11323 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335663.1 protein_id gnl|my_center|LOCUS_26010 11490 11723 gene locus_tag LOCUS_26020 gene vorC 11490 11723 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876342.1 protein_id gnl|my_center|LOCUS_26020 >Feature sequence143 3866 882 gene locus_tag LOCUS_26030 3866 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 4635 3934 gene locus_tag LOCUS_26040 4635 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 5890 4739 gene locus_tag LOCUS_26050 5890 4739 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002374726.1 protein_id gnl|my_center|LOCUS_26050 6215 7180 gene locus_tag LOCUS_26060 6215 7180 CDS product DUF4434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762555.1 protein_id gnl|my_center|LOCUS_26060 7272 7937 gene locus_tag LOCUS_26070 7272 7937 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669725.1 protein_id gnl|my_center|LOCUS_26070 7934 8179 gene locus_tag LOCUS_26080 7934 8179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 8176 9924 gene locus_tag LOCUS_26090 8176 9924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 9921 11129 gene locus_tag LOCUS_26100 9921 11129 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_26100 11258 12466 gene locus_tag LOCUS_26110 11258 12466 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807909.1 protein_id gnl|my_center|LOCUS_26110 >Feature sequence144 2956 1010 gene locus_tag LOCUS_26120 2956 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 4051 3008 gene locus_tag LOCUS_26130 gene purM 4051 3008 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_26130 5507 4137 gene locus_tag LOCUS_26140 gene uxaC 5507 4137 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082556.1 protein_id gnl|my_center|LOCUS_26140 7015 5555 gene locus_tag LOCUS_26150 gene purB 7015 5555 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438353.1 protein_id gnl|my_center|LOCUS_26150 7138 7491 gene locus_tag LOCUS_26160 7138 7491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 8261 7575 gene locus_tag LOCUS_26170 8261 7575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 8944 8264 gene locus_tag LOCUS_26180 8944 8264 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392124.1 protein_id gnl|my_center|LOCUS_26180 10403 9021 gene locus_tag LOCUS_26190 10403 9021 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986138.1 protein_id gnl|my_center|LOCUS_26190 11334 10417 gene locus_tag LOCUS_26200 11334 10417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 11851 11528 gene locus_tag LOCUS_26210 11851 11528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 >Feature sequence145 454 8 gene locus_tag LOCUS_26220 454 8 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_26220 685 1611 gene locus_tag LOCUS_26230 gene cysK 685 1611 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_26230 1640 2929 gene locus_tag LOCUS_26240 1640 2929 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932291.1 protein_id gnl|my_center|LOCUS_26240 3335 4027 gene locus_tag LOCUS_26250 3335 4027 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272550.1 protein_id gnl|my_center|LOCUS_26250 5227 4154 gene locus_tag LOCUS_26260 5227 4154 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223493.1 protein_id gnl|my_center|LOCUS_26260 6507 5224 gene locus_tag LOCUS_26270 6507 5224 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082946.1 protein_id gnl|my_center|LOCUS_26270 7280 6522 gene locus_tag LOCUS_26280 7280 6522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 9495 7285 gene locus_tag LOCUS_26290 9495 7285 CDS product pyruvate formate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767243.1 protein_id gnl|my_center|LOCUS_26290 10315 9500 gene locus_tag LOCUS_26300 10315 9500 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767244.1 protein_id gnl|my_center|LOCUS_26300 12089 10416 gene locus_tag LOCUS_26310 12089 10416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061299.1 protein_id gnl|my_center|LOCUS_26310 12159 12461 gene locus_tag LOCUS_26320 12159 12461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 >Feature sequence146 2023 3132 gene locus_tag LOCUS_26330 2023 3132 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224436.1 protein_id gnl|my_center|LOCUS_26330 5216 3156 gene locus_tag LOCUS_26340 5216 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 5900 5238 gene locus_tag LOCUS_26350 5900 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 7063 5900 gene locus_tag LOCUS_26360 7063 5900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 7288 8193 gene locus_tag LOCUS_26370 7288 8193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 9208 8153 gene locus_tag LOCUS_26380 gene aroC 9208 8153 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938193.1 protein_id gnl|my_center|LOCUS_26380 9762 9205 gene locus_tag LOCUS_26390 9762 9205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 10651 9764 gene locus_tag LOCUS_26400 gene argB 10651 9764 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435171.1 protein_id gnl|my_center|LOCUS_26400 >Feature sequence147 2478 2110 gene locus_tag LOCUS_26410 2478 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 5827 2642 gene locus_tag LOCUS_26420 5827 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 6501 5839 gene locus_tag LOCUS_26430 6501 5839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 6715 7731 gene locus_tag LOCUS_26440 6715 7731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 8150 9208 gene locus_tag LOCUS_26450 8150 9208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 9265 9948 gene locus_tag LOCUS_26460 9265 9948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 9971 10615 gene locus_tag LOCUS_26470 9971 10615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 >Feature sequence148 570 1757 gene locus_tag LOCUS_26480 gene gnfL 570 1757 CDS product nitrogen fixation sensor histidine kinase GnfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941669.1 protein_id gnl|my_center|LOCUS_26480 1754 2512 gene locus_tag LOCUS_26490 1754 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 2550 4025 gene locus_tag LOCUS_26500 2550 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 4525 4019 gene locus_tag LOCUS_26510 4525 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061380.1 protein_id gnl|my_center|LOCUS_26510 5001 4522 gene locus_tag LOCUS_26520 5001 4522 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463837.1 protein_id gnl|my_center|LOCUS_26520 6490 5189 gene locus_tag LOCUS_26530 6490 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 7194 6490 gene locus_tag LOCUS_26540 7194 6490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 8686 7307 gene locus_tag LOCUS_26550 8686 7307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 9945 8857 gene locus_tag LOCUS_26560 gene prfA 9945 8857 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_26560 10270 10070 gene locus_tag LOCUS_26570 gene rpmE 10270 10070 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_26570 10393 11619 gene locus_tag LOCUS_26580 10393 11619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 >Feature sequence149 882 6071 gene locus_tag LOCUS_26590 882 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 6386 6162 gene locus_tag LOCUS_26600 6386 6162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 7634 6561 gene locus_tag LOCUS_26610 7634 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 8197 7886 gene locus_tag LOCUS_26620 8197 7886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 10047 8224 gene locus_tag LOCUS_26630 10047 8224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 10713 10114 gene locus_tag LOCUS_26640 gene coaE 10713 10114 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387006.1 protein_id gnl|my_center|LOCUS_26640 10963 11517 gene locus_tag LOCUS_26650 10963 11517 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545109.1 protein_id gnl|my_center|LOCUS_26650 >Feature sequence150 1341 928 gene locus_tag LOCUS_26660 1341 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 3460 1517 gene locus_tag LOCUS_26670 3460 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 4193 3465 gene locus_tag LOCUS_26680 4193 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 5331 4216 gene locus_tag LOCUS_26690 5331 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 6101 5487 gene locus_tag LOCUS_26700 6101 5487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 8263 6599 gene locus_tag LOCUS_26710 gene recN 8263 6599 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403565.1 protein_id gnl|my_center|LOCUS_26710 8581 9684 gene locus_tag LOCUS_26720 8581 9684 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461034.1 protein_id gnl|my_center|LOCUS_26720 9692 10660 gene locus_tag LOCUS_26730 9692 10660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 11539 10661 gene locus_tag LOCUS_26740 11539 10661 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338796.1 protein_id gnl|my_center|LOCUS_26740 12057 11536 gene locus_tag LOCUS_26750 12057 11536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 >Feature sequence151 689 1291 gene locus_tag LOCUS_26760 689 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 1320 1874 gene locus_tag LOCUS_26770 1320 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658266.1 protein_id gnl|my_center|LOCUS_26770 1906 3660 gene locus_tag LOCUS_26780 1906 3660 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669362.1 protein_id gnl|my_center|LOCUS_26780 3653 4954 gene locus_tag LOCUS_26790 3653 4954 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669361.1 protein_id gnl|my_center|LOCUS_26790 4971 5591 gene locus_tag LOCUS_26800 4971 5591 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556694.1 protein_id gnl|my_center|LOCUS_26800 5802 6881 gene locus_tag LOCUS_26810 5802 6881 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206644.1 protein_id gnl|my_center|LOCUS_26810 6894 8372 gene locus_tag LOCUS_26820 6894 8372 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_26820 8433 10169 gene locus_tag LOCUS_26830 8433 10169 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206612.1 protein_id gnl|my_center|LOCUS_26830 10365 10880 gene locus_tag LOCUS_26840 10365 10880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 10902 11612 gene locus_tag LOCUS_26850 10902 11612 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105341.1 protein_id gnl|my_center|LOCUS_26850 >Feature sequence152 1734 628 gene locus_tag LOCUS_26860 1734 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 2684 1731 gene locus_tag LOCUS_26870 2684 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 4038 2692 gene locus_tag LOCUS_26880 4038 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 5109 4054 gene locus_tag LOCUS_26890 5109 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 7104 5116 gene locus_tag LOCUS_26900 7104 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 8217 7123 gene locus_tag LOCUS_26910 8217 7123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 9436 8204 gene locus_tag LOCUS_26920 9436 8204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 10068 9439 gene locus_tag LOCUS_26930 10068 9439 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257359.1 protein_id gnl|my_center|LOCUS_26930 10486 10172 gene locus_tag LOCUS_26940 10486 10172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 <11827 10483 gene locus_tag LOCUS_26950 <11827 10483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000025517.1:fused response regulator/phosphatase >Feature sequence153 695 2380 gene locus_tag LOCUS_26960 695 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 2728 2426 gene locus_tag LOCUS_26970 2728 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 2941 4893 gene locus_tag LOCUS_26980 2941 4893 CDS product polysaccharide lyase 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202488.1 protein_id gnl|my_center|LOCUS_26980 4896 5231 gene locus_tag LOCUS_26990 4896 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 5490 6503 gene locus_tag LOCUS_27000 5490 6503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 6834 7562 gene locus_tag LOCUS_27010 6834 7562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 7653 10694 gene locus_tag LOCUS_27020 7653 10694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 11124 10744 gene locus_tag LOCUS_27030 11124 10744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 >Feature sequence154 105 767 gene locus_tag LOCUS_27040 105 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 889 1659 gene locus_tag LOCUS_27050 889 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 2544 1702 gene locus_tag LOCUS_27060 2544 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 3334 2522 gene locus_tag LOCUS_27070 3334 2522 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_27070 3539 4066 gene locus_tag LOCUS_27080 3539 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 4076 5173 gene locus_tag LOCUS_27090 4076 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 5170 5775 gene locus_tag LOCUS_27100 5170 5775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 6345 5815 gene locus_tag LOCUS_27110 6345 5815 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393765.1 protein_id gnl|my_center|LOCUS_27110 7196 6342 gene locus_tag LOCUS_27120 7196 6342 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816933.1 protein_id gnl|my_center|LOCUS_27120 9661 7202 gene locus_tag LOCUS_27130 9661 7202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 9830 10750 gene locus_tag LOCUS_27140 9830 10750 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107441.1 protein_id gnl|my_center|LOCUS_27140 >Feature sequence155 710 1792 gene locus_tag LOCUS_27150 710 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 1946 3445 gene locus_tag LOCUS_27160 1946 3445 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390163.1 protein_id gnl|my_center|LOCUS_27160 4539 3544 gene locus_tag LOCUS_27170 4539 3544 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803848.1 protein_id gnl|my_center|LOCUS_27170 5772 4597 gene locus_tag LOCUS_27180 5772 4597 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100168880.1 protein_id gnl|my_center|LOCUS_27180 6128 7156 gene locus_tag LOCUS_27190 6128 7156 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815890.1 protein_id gnl|my_center|LOCUS_27190 7174 7896 gene locus_tag LOCUS_27200 7174 7896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 7934 9907 gene locus_tag LOCUS_27210 7934 9907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 9911 11374 gene locus_tag LOCUS_27220 9911 11374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 >Feature sequence156 57 1637 gene locus_tag LOCUS_27230 57 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 1693 3237 gene locus_tag LOCUS_27240 1693 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 4902 3376 gene locus_tag LOCUS_27250 4902 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 5639 4917 gene locus_tag LOCUS_27260 5639 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 6693 5656 gene locus_tag LOCUS_27270 6693 5656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 6883 8403 gene locus_tag LOCUS_27280 6883 8403 CDS product family 78 glycoside hydrolase catalytic domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054643739.1 protein_id gnl|my_center|LOCUS_27280 10322 8364 gene locus_tag LOCUS_27290 gene dxs 10322 8364 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_27290 10489 11025 gene locus_tag LOCUS_27300 10489 11025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 >Feature sequence157 1288 212 gene locus_tag LOCUS_27310 1288 212 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393062.1 protein_id gnl|my_center|LOCUS_27310 2102 1314 gene locus_tag LOCUS_27320 2102 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 3413 2115 gene locus_tag LOCUS_27330 3413 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 3629 3426 gene locus_tag LOCUS_27340 3629 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 4146 3634 gene locus_tag LOCUS_27350 4146 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 5736 4159 gene locus_tag LOCUS_27360 5736 4159 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921199.1 protein_id gnl|my_center|LOCUS_27360 6748 5729 gene locus_tag LOCUS_27370 6748 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 7981 6953 gene locus_tag LOCUS_27380 7981 6953 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584051.1 protein_id gnl|my_center|LOCUS_27380 9336 8293 gene locus_tag LOCUS_27390 9336 8293 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227960.1 protein_id gnl|my_center|LOCUS_27390 10491 9349 gene locus_tag LOCUS_27400 10491 9349 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584053.1 protein_id gnl|my_center|LOCUS_27400 <11365 10488 gene locus_tag LOCUS_27410 <11365 10488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064241956.1:ABC transporter permease >Feature sequence158 1359 862 gene locus_tag LOCUS_27420 1359 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 4259 2211 gene locus_tag LOCUS_27430 4259 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 5638 4256 gene locus_tag LOCUS_27440 5638 4256 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_27440 5916 5638 gene locus_tag LOCUS_27450 5916 5638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 6720 5980 gene locus_tag LOCUS_27460 6720 5980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 7245 6748 gene locus_tag LOCUS_27470 7245 6748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 8258 7281 gene locus_tag LOCUS_27480 8258 7281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 8635 10968 gene locus_tag LOCUS_27490 8635 10968 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459055.1 protein_id gnl|my_center|LOCUS_27490 >Feature sequence159 <1 1014 gene locus_tag LOCUS_27500 <1 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010883567.1:cysteine--tRNA ligase 1151 1846 gene locus_tag LOCUS_27510 1151 1846 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795919.1 protein_id gnl|my_center|LOCUS_27510 1861 3666 gene locus_tag LOCUS_27520 1861 3666 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722633.1 protein_id gnl|my_center|LOCUS_27520 3682 4578 gene locus_tag LOCUS_27530 3682 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 5290 4685 gene locus_tag LOCUS_27540 gene ycaC 5290 4685 CDS product isochorismate family cysteine hydrolase YcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046156.1 protein_id gnl|my_center|LOCUS_27540 5946 5701 gene locus_tag LOCUS_27550 5946 5701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 7040 6228 gene locus_tag LOCUS_27560 7040 6228 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909131.1 protein_id gnl|my_center|LOCUS_27560 7138 8685 gene locus_tag LOCUS_27570 7138 8685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 10398 8869 gene locus_tag LOCUS_27580 gene murC 10398 8869 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377539.1 protein_id gnl|my_center|LOCUS_27580 <11309 10395 gene locus_tag LOCUS_27590 <11309 10395 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545621.1:penicillin-binding protein 2 >Feature sequence160 417 1673 gene locus_tag LOCUS_27600 417 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 2534 1716 gene locus_tag LOCUS_27610 2534 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 2657 4867 gene locus_tag LOCUS_27620 2657 4867 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870178.1 protein_id gnl|my_center|LOCUS_27620 4878 5771 gene locus_tag LOCUS_27630 4878 5771 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939546.1 protein_id gnl|my_center|LOCUS_27630 8118 5782 gene locus_tag LOCUS_27640 8118 5782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 8265 9113 gene locus_tag LOCUS_27650 8265 9113 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933364.1 protein_id gnl|my_center|LOCUS_27650 10451 9156 gene locus_tag LOCUS_27660 10451 9156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 >Feature sequence161 1270 2106 gene locus_tag LOCUS_27670 1270 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 3781 2273 gene locus_tag LOCUS_27680 3781 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 4702 3794 gene locus_tag LOCUS_27690 4702 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 6011 4761 gene locus_tag LOCUS_27700 gene icd 6011 4761 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705337.1 protein_id gnl|my_center|LOCUS_27700 6211 6999 gene locus_tag LOCUS_27710 6211 6999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 7486 7241 gene locus_tag LOCUS_27720 7486 7241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 8416 7514 gene locus_tag LOCUS_27730 8416 7514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256034.1 protein_id gnl|my_center|LOCUS_27730 8903 8556 gene locus_tag LOCUS_27740 8903 8556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 8999 9991 gene locus_tag LOCUS_27750 8999 9991 CDS product retron St85 family RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016192.1 protein_id gnl|my_center|LOCUS_27750 10140 11177 gene locus_tag LOCUS_27760 10140 11177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 >Feature sequence162 298 1962 gene locus_tag LOCUS_27770 298 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27770 4379 2337 gene locus_tag LOCUS_27780 4379 2337 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681239.1 protein_id gnl|my_center|LOCUS_27780 4828 5085 gene locus_tag LOCUS_27790 4828 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 5878 5057 gene locus_tag LOCUS_27800 5878 5057 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086143.1 protein_id gnl|my_center|LOCUS_27800 7640 5892 gene locus_tag LOCUS_27810 gene atzF 7640 5892 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104918.1 protein_id gnl|my_center|LOCUS_27810 11156 7680 gene locus_tag LOCUS_27820 gene uca 11156 7680 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045751776.1 protein_id gnl|my_center|LOCUS_27820 >Feature sequence163 4136 6268 gene locus_tag LOCUS_27830 4136 6268 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_27830 6287 8056 gene locus_tag LOCUS_27840 6287 8056 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_27840 8098 9198 gene locus_tag LOCUS_27850 gene carA 8098 9198 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931760.1 protein_id gnl|my_center|LOCUS_27850 9202 10812 gene locus_tag LOCUS_27860 9202 10812 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326169.1 protein_id gnl|my_center|LOCUS_27860 >Feature sequence164 230 694 gene locus_tag LOCUS_27870 230 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 758 1516 gene locus_tag LOCUS_27880 758 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 1494 4385 gene locus_tag LOCUS_27890 1494 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 4440 4865 gene locus_tag LOCUS_27900 4440 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 4891 6957 gene locus_tag LOCUS_27910 4891 6957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 7293 7075 gene locus_tag LOCUS_27920 7293 7075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 7546 7295 gene locus_tag LOCUS_27930 7546 7295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 8022 7543 gene locus_tag LOCUS_27940 8022 7543 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390171.1 protein_id gnl|my_center|LOCUS_27940 8258 8046 gene locus_tag LOCUS_27950 8258 8046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 9122 8511 gene locus_tag LOCUS_27960 9122 8511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 10177 9575 gene locus_tag LOCUS_27970 10177 9575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 10512 10207 gene locus_tag LOCUS_27980 10512 10207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 >Feature sequence165 4928 4386 gene locus_tag LOCUS_27990 4928 4386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 5548 4925 gene locus_tag LOCUS_28000 gene gmk 5548 4925 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082205.1 protein_id gnl|my_center|LOCUS_28000 5903 5535 gene locus_tag LOCUS_28010 5903 5535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 6531 5971 gene locus_tag LOCUS_28020 6531 5971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 6967 6578 gene locus_tag LOCUS_28030 6967 6578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 7520 7041 gene locus_tag LOCUS_28040 gene folK 7520 7041 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886816.1 protein_id gnl|my_center|LOCUS_28040 7596 8552 gene locus_tag LOCUS_28050 gene fmt 7596 8552 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_28050 8597 10237 gene locus_tag LOCUS_28060 8597 10237 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328924.1 protein_id gnl|my_center|LOCUS_28060 >Feature sequence166 741 1424 gene locus_tag LOCUS_28070 741 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 1418 2413 gene locus_tag LOCUS_28080 1418 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 2424 3380 gene locus_tag LOCUS_28090 2424 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 3439 4134 gene locus_tag LOCUS_28100 3439 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 4149 10799 gene locus_tag LOCUS_28110 4149 10799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 >Feature sequence167 3834 772 gene locus_tag LOCUS_28120 3834 772 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085775.1 protein_id gnl|my_center|LOCUS_28120 5955 3943 gene locus_tag LOCUS_28130 5955 3943 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203328.1 protein_id gnl|my_center|LOCUS_28130 6491 5997 gene locus_tag LOCUS_28140 6491 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 7171 6968 gene locus_tag LOCUS_28150 7171 6968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 9305 8004 gene locus_tag LOCUS_28160 9305 8004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121480.1 protein_id gnl|my_center|LOCUS_28160 10836 9331 gene locus_tag LOCUS_28170 10836 9331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 >Feature sequence168 99 1952 gene locus_tag LOCUS_28180 99 1952 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730690.1 protein_id gnl|my_center|LOCUS_28180 2108 3460 gene locus_tag LOCUS_28190 2108 3460 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091265.1 protein_id gnl|my_center|LOCUS_28190 3748 3461 gene locus_tag LOCUS_28200 3748 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 3829 4578 gene locus_tag LOCUS_28210 3829 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 4578 4997 gene locus_tag LOCUS_28220 gene arfB 4578 4997 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387858.1 protein_id gnl|my_center|LOCUS_28220 5940 5005 gene locus_tag LOCUS_28230 5940 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 6419 6042 gene locus_tag LOCUS_28240 6419 6042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 7181 6450 gene locus_tag LOCUS_28250 7181 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 7912 7169 gene locus_tag LOCUS_28260 7912 7169 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523383.1 protein_id gnl|my_center|LOCUS_28260 9644 7899 gene locus_tag LOCUS_28270 9644 7899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 >Feature sequence169 691 305 gene locus_tag LOCUS_28280 691 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 759 832 gene locus_tag LOCUS_t00360 759 832 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1444 2715 gene locus_tag LOCUS_28290 1444 2715 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548475.1 protein_id gnl|my_center|LOCUS_28290 4879 2777 gene locus_tag LOCUS_28300 4879 2777 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_28300 4963 5352 gene locus_tag LOCUS_28310 4963 5352 CDS product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191031.1 protein_id gnl|my_center|LOCUS_28310 5440 6027 gene locus_tag LOCUS_28320 5440 6027 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966668.1 protein_id gnl|my_center|LOCUS_28320 7293 6073 gene locus_tag LOCUS_28330 7293 6073 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058221.1 protein_id gnl|my_center|LOCUS_28330 8066 7290 gene locus_tag LOCUS_28340 8066 7290 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017012.1 protein_id gnl|my_center|LOCUS_28340 8758 8063 gene locus_tag LOCUS_28350 8758 8063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 9740 8820 gene locus_tag LOCUS_28360 9740 8820 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050431.1 protein_id gnl|my_center|LOCUS_28360 10753 9737 gene locus_tag LOCUS_28370 10753 9737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 >Feature sequence170 485 1204 gene locus_tag LOCUS_28380 485 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 1217 1450 gene locus_tag LOCUS_28390 1217 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 1447 2358 gene locus_tag LOCUS_28400 gene tatC 1447 2358 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115041.1 protein_id gnl|my_center|LOCUS_28400 2439 3239 gene locus_tag LOCUS_28410 2439 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 3351 3656 gene locus_tag LOCUS_28420 gene rplV 3351 3656 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356206.1 protein_id gnl|my_center|LOCUS_28420 3675 4382 gene locus_tag LOCUS_28430 gene rpsC 3675 4382 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919133.1 protein_id gnl|my_center|LOCUS_28430 4330 4743 gene locus_tag LOCUS_28440 gene rplP 4330 4743 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357619.1 protein_id gnl|my_center|LOCUS_28440 4757 4954 gene locus_tag LOCUS_28450 gene rpmC 4757 4954 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205459.1 protein_id gnl|my_center|LOCUS_28450 4963 5241 gene locus_tag LOCUS_28460 gene rpsQ 4963 5241 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963461.1 protein_id gnl|my_center|LOCUS_28460 5260 5625 gene locus_tag LOCUS_28470 gene rplN 5260 5625 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323021.1 protein_id gnl|my_center|LOCUS_28470 5625 5882 gene locus_tag LOCUS_28480 5625 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 5889 6425 gene locus_tag LOCUS_28490 gene rplE 5889 6425 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_28490 6441 6626 gene locus_tag LOCUS_28500 6441 6626 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943473.1 protein_id gnl|my_center|LOCUS_28500 6643 7038 gene locus_tag LOCUS_28510 gene rpsH 6643 7038 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185153.1 protein_id gnl|my_center|LOCUS_28510 7062 7592 gene locus_tag LOCUS_28520 gene rplF 7062 7592 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869914.1 protein_id gnl|my_center|LOCUS_28520 7617 7979 gene locus_tag LOCUS_28530 gene rplR 7617 7979 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549040.1 protein_id gnl|my_center|LOCUS_28530 7990 8529 gene locus_tag LOCUS_28540 gene rpsE 7990 8529 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129922.1 protein_id gnl|my_center|LOCUS_28540 8555 9001 gene locus_tag LOCUS_28550 gene rplO 8555 9001 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638079.1 protein_id gnl|my_center|LOCUS_28550 9025 10410 gene locus_tag LOCUS_28560 gene secY 9025 10410 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545307.1 protein_id gnl|my_center|LOCUS_28560 >Feature sequence171 1021 245 gene locus_tag LOCUS_28570 1021 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 1428 2396 gene locus_tag LOCUS_28580 1428 2396 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_28580 2834 2550 gene locus_tag LOCUS_28590 2834 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 3903 3337 gene locus_tag LOCUS_28600 3903 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 6504 4258 gene locus_tag LOCUS_28610 6504 4258 CDS product pyruvate formate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797468.1 protein_id gnl|my_center|LOCUS_28610 7291 6524 gene locus_tag LOCUS_28620 7291 6524 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087125.1 protein_id gnl|my_center|LOCUS_28620 7747 8223 gene locus_tag LOCUS_28630 7747 8223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 8590 8393 gene locus_tag LOCUS_28640 8590 8393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 9131 8763 gene locus_tag LOCUS_28650 9131 8763 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546565.1 protein_id gnl|my_center|LOCUS_28650 9559 9128 gene locus_tag LOCUS_28660 9559 9128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 10083 9598 gene locus_tag LOCUS_28670 10083 9598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 10483 10139 gene locus_tag LOCUS_28680 10483 10139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 >Feature sequence172 141 3290 gene locus_tag LOCUS_28690 141 3290 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095881.1 protein_id gnl|my_center|LOCUS_28690 4723 3419 gene locus_tag LOCUS_28700 4723 3419 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852462.1 protein_id gnl|my_center|LOCUS_28700 5024 6790 gene locus_tag LOCUS_28710 5024 6790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 6803 7801 gene locus_tag LOCUS_28720 6803 7801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 7871 8740 gene locus_tag LOCUS_28730 7871 8740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 9680 8751 gene locus_tag LOCUS_28740 gene chbR 9680 8751 CDS product transcriptional regulator ChbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097020.1 protein_id gnl|my_center|LOCUS_28740 >Feature sequence173 1889 546 gene locus_tag LOCUS_28750 1889 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 5182 1886 gene locus_tag LOCUS_28760 5182 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 6054 5179 gene locus_tag LOCUS_28770 6054 5179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 6325 7011 gene locus_tag LOCUS_28780 6325 7011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 7021 7980 gene locus_tag LOCUS_28790 7021 7980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 8099 8911 gene locus_tag LOCUS_28800 8099 8911 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249938.1 protein_id gnl|my_center|LOCUS_28800 8917 9162 gene locus_tag LOCUS_28810 8917 9162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 >Feature sequence174 739 353 gene locus_tag LOCUS_28820 739 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 1459 812 gene locus_tag LOCUS_28830 1459 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 1969 1631 gene locus_tag LOCUS_28840 1969 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 3085 2285 gene locus_tag LOCUS_28850 3085 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 3460 5328 gene locus_tag LOCUS_28860 3460 5328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 5336 6439 gene locus_tag LOCUS_28870 5336 6439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 6444 7241 gene locus_tag LOCUS_28880 6444 7241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 7245 7805 gene locus_tag LOCUS_28890 7245 7805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 7823 8788 gene locus_tag LOCUS_28900 7823 8788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 >Feature sequence175 1023 451 gene locus_tag LOCUS_28910 1023 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 1988 1023 gene locus_tag LOCUS_28920 1988 1023 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964112.1 protein_id gnl|my_center|LOCUS_28920 2828 1995 gene locus_tag LOCUS_28930 gene pssA 2828 1995 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957377.1 protein_id gnl|my_center|LOCUS_28930 3523 2825 gene locus_tag LOCUS_28940 3523 2825 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942553.1 protein_id gnl|my_center|LOCUS_28940 4130 3597 gene locus_tag LOCUS_28950 4130 3597 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939086.1 protein_id gnl|my_center|LOCUS_28950 4287 5540 gene locus_tag LOCUS_28960 gene hydF 4287 5540 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939056.1 protein_id gnl|my_center|LOCUS_28960 5537 6529 gene locus_tag LOCUS_28970 5537 6529 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813114.1 protein_id gnl|my_center|LOCUS_28970 7586 6537 gene locus_tag LOCUS_28980 7586 6537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 8314 7583 gene locus_tag LOCUS_28990 8314 7583 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392826.1 protein_id gnl|my_center|LOCUS_28990 9735 8311 gene locus_tag LOCUS_29000 9735 8311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 10355 9735 gene locus_tag LOCUS_29010 10355 9735 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_29010 >Feature sequence176 607 218 gene locus_tag LOCUS_29020 607 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 1131 736 gene locus_tag LOCUS_29030 1131 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 2148 1402 gene locus_tag LOCUS_29040 2148 1402 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943078.1 protein_id gnl|my_center|LOCUS_29040 2752 2195 gene locus_tag LOCUS_29050 2752 2195 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203642.1 protein_id gnl|my_center|LOCUS_29050 3072 4742 gene locus_tag LOCUS_29060 gene sulP 3072 4742 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926914.1 protein_id gnl|my_center|LOCUS_29060 5126 4806 gene locus_tag LOCUS_29070 5126 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 6227 5178 gene locus_tag LOCUS_29080 gene mutY 6227 5178 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171406.1 protein_id gnl|my_center|LOCUS_29080 6883 6221 gene locus_tag LOCUS_29090 gene thiE 6883 6221 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256280.1 protein_id gnl|my_center|LOCUS_29090 7188 6877 gene locus_tag LOCUS_29100 7188 6877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 7431 10010 gene locus_tag LOCUS_29110 gene clpB 7431 10010 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_29110 >Feature sequence177 366 1883 gene locus_tag LOCUS_29120 366 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 1950 2408 gene locus_tag LOCUS_29130 1950 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 2591 3730 gene locus_tag LOCUS_29140 2591 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 3784 4518 gene locus_tag LOCUS_29150 3784 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 4529 8260 gene locus_tag LOCUS_29160 4529 8260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 8721 9740 gene locus_tag LOCUS_29170 8721 9740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 >Feature sequence178 1133 390 gene locus_tag LOCUS_29180 1133 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 5244 1105 gene locus_tag LOCUS_29190 5244 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 6017 5241 gene locus_tag LOCUS_29200 6017 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 7680 6649 gene locus_tag LOCUS_29210 7680 6649 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002425658.1 protein_id gnl|my_center|LOCUS_29210 8287 8069 gene locus_tag LOCUS_29220 8287 8069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 9448 8399 gene locus_tag LOCUS_29230 9448 8399 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920901.1 protein_id gnl|my_center|LOCUS_29230 9702 10037 gene locus_tag LOCUS_29240 9702 10037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 >Feature sequence179 1399 599 gene locus_tag LOCUS_29250 gene iolB 1399 599 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583016.1 protein_id gnl|my_center|LOCUS_29250 2791 1418 gene locus_tag LOCUS_29260 2791 1418 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459729.1 protein_id gnl|my_center|LOCUS_29260 3721 2819 gene locus_tag LOCUS_29270 3721 2819 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941353.1 protein_id gnl|my_center|LOCUS_29270 3894 4652 gene locus_tag LOCUS_29280 3894 4652 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080418.1 protein_id gnl|my_center|LOCUS_29280 4967 5977 gene locus_tag LOCUS_29290 gene ccpA 4967 5977 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906075.1 protein_id gnl|my_center|LOCUS_29290 6064 6897 gene locus_tag LOCUS_29300 6064 6897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 7059 8420 gene locus_tag LOCUS_29310 7059 8420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 9219 8506 gene locus_tag LOCUS_29320 9219 8506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 10303 9383 gene locus_tag LOCUS_29330 10303 9383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 >Feature sequence180 2830 1784 gene locus_tag LOCUS_29340 2830 1784 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795327.1 protein_id gnl|my_center|LOCUS_29340 4901 2901 gene locus_tag LOCUS_29350 4901 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 6046 4898 gene locus_tag LOCUS_29360 6046 4898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 6299 8041 gene locus_tag LOCUS_29370 6299 8041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 8161 8754 gene locus_tag LOCUS_29380 gene def 8161 8754 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142225.1 protein_id gnl|my_center|LOCUS_29380 8759 9676 gene locus_tag LOCUS_29390 8759 9676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 >Feature sequence181 397 2394 gene locus_tag LOCUS_29400 397 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 5489 2448 gene locus_tag LOCUS_29410 5489 2448 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582581.1 protein_id gnl|my_center|LOCUS_29410 8499 5608 gene locus_tag LOCUS_29420 8499 5608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 9340 8579 gene locus_tag LOCUS_29430 9340 8579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 10118 9411 gene locus_tag LOCUS_29440 10118 9411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 >Feature sequence182 1524 718 gene locus_tag LOCUS_29450 1524 718 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682046.1 protein_id gnl|my_center|LOCUS_29450 1837 3852 gene locus_tag LOCUS_29460 gene fusA 1837 3852 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_29460 3947 5797 gene locus_tag LOCUS_29470 3947 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 5886 6197 gene locus_tag LOCUS_29480 5886 6197 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943454.1 protein_id gnl|my_center|LOCUS_29480 6477 7787 gene locus_tag LOCUS_29490 6477 7787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 >Feature sequence183 2563 824 gene locus_tag LOCUS_29500 2563 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 3420 2560 gene locus_tag LOCUS_29510 3420 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 4679 3420 gene locus_tag LOCUS_29520 4679 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 6094 4676 gene locus_tag LOCUS_29530 6094 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 7070 6096 gene locus_tag LOCUS_29540 7070 6096 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331193.1 protein_id gnl|my_center|LOCUS_29540 8835 7060 gene locus_tag LOCUS_29550 8835 7060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 9881 8832 gene locus_tag LOCUS_29560 9881 8832 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326093.1 protein_id gnl|my_center|LOCUS_29560 >Feature sequence184 837 271 gene locus_tag LOCUS_29570 gene efp 837 271 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938955.1 protein_id gnl|my_center|LOCUS_29570 2990 966 gene locus_tag LOCUS_29580 gene uvrB 2990 966 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 protein_id gnl|my_center|LOCUS_29580 3564 3046 gene locus_tag LOCUS_29590 3564 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 4867 3578 gene locus_tag LOCUS_29600 4867 3578 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268659.1 protein_id gnl|my_center|LOCUS_29600 5228 6001 gene locus_tag LOCUS_29610 5228 6001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 6003 9140 gene locus_tag LOCUS_29620 6003 9140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 9347 >10098 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgtgatttgatgttatttgaaggtgggttatatt >Feature sequence185 1828 8 gene locus_tag LOCUS_29630 1828 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 2394 1828 gene locus_tag LOCUS_29640 gene frr 2394 1828 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_29640 4059 2518 gene locus_tag LOCUS_29650 4059 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 4808 4065 gene locus_tag LOCUS_29660 4808 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 4989 5894 gene locus_tag LOCUS_29670 4989 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 5884 6705 gene locus_tag LOCUS_29680 5884 6705 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089860.1 protein_id gnl|my_center|LOCUS_29680 6973 7737 gene locus_tag LOCUS_29690 6973 7737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 7755 10031 gene locus_tag LOCUS_29700 7755 10031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392408.1 protein_id gnl|my_center|LOCUS_29700 >Feature sequence186 1823 2812 gene locus_tag LOCUS_29710 1823 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 3152 2793 gene locus_tag LOCUS_29720 3152 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 3311 3162 gene locus_tag LOCUS_29730 3311 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 3637 3461 gene locus_tag LOCUS_29740 3637 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 3803 5581 gene locus_tag LOCUS_29750 3803 5581 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_29750 5603 6103 gene locus_tag LOCUS_29760 5603 6103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 8423 6198 gene locus_tag LOCUS_29770 8423 6198 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546149.1 protein_id gnl|my_center|LOCUS_29770 9418 8432 gene locus_tag LOCUS_29780 9418 8432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29780 9747 9427 gene locus_tag LOCUS_29790 9747 9427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29790 >Feature sequence187 <1 1186 gene locus_tag LOCUS_29800 <1 1186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393520.1:LacI family DNA-binding transcriptional regulator 1229 1996 gene locus_tag LOCUS_29810 1229 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 2092 2844 gene locus_tag LOCUS_29820 2092 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 2748 3701 gene locus_tag LOCUS_29830 2748 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 3770 5713 gene locus_tag LOCUS_29840 3770 5713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 5729 7384 gene locus_tag LOCUS_29850 gene glaB 5729 7384 CDS product alpha-1,3-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202199.1 protein_id gnl|my_center|LOCUS_29850 7591 9705 gene locus_tag LOCUS_29860 7591 9705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392408.1 protein_id gnl|my_center|LOCUS_29860 >Feature sequence188 1205 1429 gene locus_tag LOCUS_29870 1205 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 1595 1437 gene locus_tag LOCUS_29880 1595 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 2491 2156 gene locus_tag LOCUS_29890 2491 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 3946 4323 gene locus_tag LOCUS_29900 gene hisI 3946 4323 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937424.1 protein_id gnl|my_center|LOCUS_29900 4326 6446 gene locus_tag LOCUS_29910 4326 6446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 6443 7600 gene locus_tag LOCUS_29920 6443 7600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 8488 7610 gene locus_tag LOCUS_29930 8488 7610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 >Feature sequence189 994 203 gene locus_tag LOCUS_29940 994 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 1380 1006 gene locus_tag LOCUS_29950 1380 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 3489 1384 gene locus_tag LOCUS_29960 3489 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 4958 3486 gene locus_tag LOCUS_29970 4958 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 6029 4977 gene locus_tag LOCUS_29980 6029 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 6871 6020 gene locus_tag LOCUS_29990 6871 6020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 7626 6868 gene locus_tag LOCUS_30000 7626 6868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 8456 7623 gene locus_tag LOCUS_30010 8456 7623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 >Feature sequence190 976 71 gene locus_tag LOCUS_30020 gene nadA 976 71 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940699.1 protein_id gnl|my_center|LOCUS_30020 2048 960 gene locus_tag LOCUS_30030 2048 960 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943206.1 protein_id gnl|my_center|LOCUS_30030 2992 2048 gene locus_tag LOCUS_30040 2992 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 3375 3450 gene locus_tag LOCUS_t00370 3375 3450 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3534 4343 gene locus_tag LOCUS_30050 3534 4343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 4416 5891 gene locus_tag LOCUS_30060 4416 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 5893 7146 gene locus_tag LOCUS_30070 5893 7146 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976029.1 protein_id gnl|my_center|LOCUS_30070 7995 7105 gene locus_tag LOCUS_30080 7995 7105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 8116 9354 gene locus_tag LOCUS_30090 8116 9354 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_30090 >Feature sequence191 770 384 gene locus_tag LOCUS_30100 770 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 1576 770 gene locus_tag LOCUS_30110 1576 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 2712 1573 gene locus_tag LOCUS_30120 2712 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 3094 2696 gene locus_tag LOCUS_30130 3094 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 3954 3106 gene locus_tag LOCUS_30140 gene cmr4 3954 3106 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880200.1 protein_id gnl|my_center|LOCUS_30140 5170 3992 gene locus_tag LOCUS_30150 5170 3992 CDS product type III-B CRISPR module-associated protein Cmr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229143.1 protein_id gnl|my_center|LOCUS_30150 7716 5167 gene locus_tag LOCUS_30160 gene cas10 7716 5167 CDS product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082341.1 protein_id gnl|my_center|LOCUS_30160 9070 7955 gene locus_tag LOCUS_30170 9070 7955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 >Feature sequence192 1863 124 gene locus_tag LOCUS_30180 1863 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 1981 2808 gene locus_tag LOCUS_30190 1981 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 4485 3202 gene locus_tag LOCUS_30200 4485 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 5812 4487 gene locus_tag LOCUS_30210 5812 4487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 6658 5822 gene locus_tag LOCUS_30220 6658 5822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 6817 7824 gene locus_tag LOCUS_30230 gene bchC 6817 7824 CDS product chlorophyll synthesis pathway protein BchC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933089.1 protein_id gnl|my_center|LOCUS_30230 7829 8584 gene locus_tag LOCUS_30240 7829 8584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 8834 8986 gene locus_tag LOCUS_30250 8834 8986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 >Feature sequence193 210 43 gene locus_tag LOCUS_30260 210 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 1154 297 gene locus_tag LOCUS_30270 1154 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 1316 2539 gene locus_tag LOCUS_30280 1316 2539 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870654.1 protein_id gnl|my_center|LOCUS_30280 2536 3732 gene locus_tag LOCUS_30290 2536 3732 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545761.1 protein_id gnl|my_center|LOCUS_30290 3760 4869 gene locus_tag LOCUS_30300 3760 4869 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_30300 4936 5793 gene locus_tag LOCUS_30310 4936 5793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 5790 6491 gene locus_tag LOCUS_30320 5790 6491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 6472 7170 gene locus_tag LOCUS_30330 gene rnc 6472 7170 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008630.1 protein_id gnl|my_center|LOCUS_30330 7167 8273 gene locus_tag LOCUS_30340 7167 8273 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970145.1 protein_id gnl|my_center|LOCUS_30340 8270 9199 gene locus_tag LOCUS_30350 8270 9199 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258521.1 protein_id gnl|my_center|LOCUS_30350 >Feature sequence194 <1 678 gene locus_tag LOCUS_30360 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546244.1:acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase 720 2372 gene locus_tag LOCUS_30370 gene gpmI 720 2372 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_30370 5728 2441 gene locus_tag LOCUS_30380 5728 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 6450 5743 gene locus_tag LOCUS_30390 6450 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 6622 7515 gene locus_tag LOCUS_30400 gene rhaS 6622 7515 CDS product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217105.1 protein_id gnl|my_center|LOCUS_30400 7747 7671 gene locus_tag LOCUS_t00380 7747 7671 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7960 8100 gene locus_tag LOCUS_30410 7960 8100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 9167 8385 gene locus_tag LOCUS_30420 9167 8385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 >Feature sequence195 5227 3140 gene locus_tag LOCUS_30430 5227 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895537.1 protein_id gnl|my_center|LOCUS_30430 5968 5255 gene locus_tag LOCUS_30440 5968 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 6209 8131 gene locus_tag LOCUS_30450 6209 8131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 9398 8091 gene locus_tag LOCUS_30460 9398 8091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 >Feature sequence196 396 866 gene locus_tag LOCUS_30470 396 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 863 1618 gene locus_tag LOCUS_30480 863 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 1621 1998 gene locus_tag LOCUS_30490 1621 1998 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728907.1 protein_id gnl|my_center|LOCUS_30490 2584 2018 gene locus_tag LOCUS_30500 2584 2018 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932674.1 protein_id gnl|my_center|LOCUS_30500 2731 3204 gene locus_tag LOCUS_30510 2731 3204 CDS product superoxide dismutase [Ni] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814912.1 protein_id gnl|my_center|LOCUS_30510 3325 6051 gene locus_tag LOCUS_30520 3325 6051 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256996.1 protein_id gnl|my_center|LOCUS_30520 <9340 6169 gene locus_tag LOCUS_30530 <9340 6169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038877.1:AAA family ATPase >Feature sequence197 1589 735 gene locus_tag LOCUS_30540 1589 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 1964 2722 gene locus_tag LOCUS_30550 1964 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 2864 4780 gene locus_tag LOCUS_30560 2864 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 4996 5763 gene locus_tag LOCUS_30570 4996 5763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 5941 9111 gene locus_tag LOCUS_30580 5941 9111 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582581.1 protein_id gnl|my_center|LOCUS_30580 >Feature sequence198 2497 1373 gene locus_tag LOCUS_30590 2497 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 2809 3828 gene locus_tag LOCUS_30600 gene ccpA 2809 3828 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564050.1 protein_id gnl|my_center|LOCUS_30600 3909 4634 gene locus_tag LOCUS_30610 3909 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 4649 7957 gene locus_tag LOCUS_30620 4649 7957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 >Feature sequence199 147 1433 gene locus_tag LOCUS_30630 147 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 1455 3746 gene locus_tag LOCUS_30640 1455 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392408.1 protein_id gnl|my_center|LOCUS_30640 5799 4675 gene locus_tag LOCUS_30650 5799 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 6185 5796 gene locus_tag LOCUS_30660 6185 5796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 8305 6182 gene locus_tag LOCUS_30670 8305 6182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 <9142 8323 gene locus_tag LOCUS_30680 <9142 8323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975036.1:amylo-alpha-1,6-glucosidase >Feature sequence200 1539 142 gene locus_tag LOCUS_30690 gene dnaA 1539 142 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_30690 3354 1993 gene locus_tag LOCUS_30700 3354 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 3544 3930 gene locus_tag LOCUS_30710 3544 3930 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940354.1 protein_id gnl|my_center|LOCUS_30710 3947 4330 gene locus_tag LOCUS_30720 3947 4330 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048271.1 protein_id gnl|my_center|LOCUS_30720 4434 5645 gene locus_tag LOCUS_30730 4434 5645 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940443.1 protein_id gnl|my_center|LOCUS_30730 5681 5842 gene locus_tag LOCUS_30740 5681 5842 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_30740 5863 6231 gene locus_tag LOCUS_30750 5863 6231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 6303 6755 gene locus_tag LOCUS_30760 6303 6755 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940846.1 protein_id gnl|my_center|LOCUS_30760 6906 8753 gene locus_tag LOCUS_30770 6906 8753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 >Feature sequence201 315 127 gene locus_tag LOCUS_30780 315 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 1806 484 gene locus_tag LOCUS_30790 1806 484 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_30790 3057 1966 gene locus_tag LOCUS_30800 3057 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 4567 3128 gene locus_tag LOCUS_30810 4567 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 4944 4678 gene locus_tag LOCUS_30820 4944 4678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 5361 5110 gene locus_tag LOCUS_30830 5361 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 6008 5358 gene locus_tag LOCUS_30840 6008 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 6317 6520 gene locus_tag LOCUS_30850 6317 6520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 7969 6704 gene locus_tag LOCUS_30860 7969 6704 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_30860 >Feature sequence202 628 1794 gene locus_tag LOCUS_30870 628 1794 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427756.1 protein_id gnl|my_center|LOCUS_30870 2833 1823 gene locus_tag LOCUS_30880 2833 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 6551 2847 gene locus_tag LOCUS_30890 gene hrpA 6551 2847 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813236.1 protein_id gnl|my_center|LOCUS_30890 7762 6548 gene locus_tag LOCUS_30900 7762 6548 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680500.1 protein_id gnl|my_center|LOCUS_30900 8361 7777 gene locus_tag LOCUS_30910 gene hisB 8361 7777 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_30910 >Feature sequence203 98 400 gene locus_tag LOCUS_30920 98 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 400 3096 gene locus_tag LOCUS_30930 400 3096 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074056806.1 protein_id gnl|my_center|LOCUS_30930 3445 3699 gene locus_tag LOCUS_30940 3445 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 4605 4330 gene locus_tag LOCUS_30950 4605 4330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 5527 6090 gene locus_tag LOCUS_30960 5527 6090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 6065 6412 gene locus_tag LOCUS_30970 6065 6412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 6478 7605 gene locus_tag LOCUS_30980 6478 7605 CDS product DUF2586 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097393.1 protein_id gnl|my_center|LOCUS_30980 7624 8070 gene locus_tag LOCUS_30990 7624 8070 CDS product DUF2597 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097392.1 protein_id gnl|my_center|LOCUS_30990 8086 8349 gene locus_tag LOCUS_31000 8086 8349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 8700 8530 gene locus_tag LOCUS_31010 8700 8530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 >Feature sequence204 2245 3924 gene locus_tag LOCUS_31020 2245 3924 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_31020 3926 5239 gene locus_tag LOCUS_31030 3926 5239 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788563.1 protein_id gnl|my_center|LOCUS_31030 5236 7548 gene locus_tag LOCUS_31040 5236 7548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 >Feature sequence205 <1 962 gene locus_tag LOCUS_31050 <1 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006310749.1:Gfo/Idh/MocA family oxidoreductase 983 4528 gene locus_tag LOCUS_31060 983 4528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 4563 5228 gene locus_tag LOCUS_31070 4563 5228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 6974 8281 gene locus_tag LOCUS_31080 6974 8281 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082946.1 protein_id gnl|my_center|LOCUS_31080 >Feature sequence206 1844 723 gene locus_tag LOCUS_31090 1844 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 1946 2842 gene locus_tag LOCUS_31100 gene rhaR 1946 2842 CDS product HTH-type transcriptional activator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209110.1 protein_id gnl|my_center|LOCUS_31100 3848 2862 gene locus_tag LOCUS_31110 3848 2862 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707873.1 protein_id gnl|my_center|LOCUS_31110 4098 3943 gene locus_tag LOCUS_31120 4098 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 4371 4997 gene locus_tag LOCUS_31130 gene upp 4371 4997 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081012.1 protein_id gnl|my_center|LOCUS_31130 4994 6361 gene locus_tag LOCUS_31140 4994 6361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 7783 6425 gene locus_tag LOCUS_31150 7783 6425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31150 8484 7780 gene locus_tag LOCUS_31160 8484 7780 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141998.1 protein_id gnl|my_center|LOCUS_31160 >Feature sequence207 1118 114 gene locus_tag LOCUS_31170 1118 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 1472 1927 gene locus_tag LOCUS_31180 1472 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 3150 1921 gene locus_tag LOCUS_31190 3150 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 3961 3227 gene locus_tag LOCUS_31200 3961 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 4201 4938 gene locus_tag LOCUS_31210 4201 4938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 5033 6736 gene locus_tag LOCUS_31220 5033 6736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 8108 6801 gene locus_tag LOCUS_31230 gene fucP 8108 6801 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201906.1 protein_id gnl|my_center|LOCUS_31230 >Feature sequence208 173 370 gene locus_tag LOCUS_31240 173 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 603 935 gene locus_tag LOCUS_31250 603 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 932 1873 gene locus_tag LOCUS_31260 932 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 2131 1949 gene locus_tag LOCUS_31270 2131 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 3569 2136 gene locus_tag LOCUS_31280 3569 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 3795 4796 gene locus_tag LOCUS_31290 3795 4796 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584146.1 protein_id gnl|my_center|LOCUS_31290 4947 6062 gene locus_tag LOCUS_31300 4947 6062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 6059 7222 gene locus_tag LOCUS_31310 6059 7222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 7219 7749 gene locus_tag LOCUS_31320 7219 7749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 >Feature sequence209 922 734 gene locus_tag LOCUS_31330 922 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 1433 1357 gene locus_tag LOCUS_t00390 1433 1357 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1691 3793 gene locus_tag LOCUS_31340 1691 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 4415 3891 gene locus_tag LOCUS_31350 gene nanQ 4415 3891 CDS product N-acetylneuraminate anomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208515.1 protein_id gnl|my_center|LOCUS_31350 4680 5867 gene locus_tag LOCUS_31360 4680 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 6098 5871 gene locus_tag LOCUS_31370 6098 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 6430 6245 gene locus_tag LOCUS_31380 6430 6245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 6891 6601 gene locus_tag LOCUS_31390 6891 6601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 7328 6924 gene locus_tag LOCUS_31400 7328 6924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 7460 7828 gene locus_tag LOCUS_31410 7460 7828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 8000 8164 gene locus_tag LOCUS_31420 8000 8164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 >Feature sequence210 107 367 gene locus_tag LOCUS_31430 107 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 372 1067 gene locus_tag LOCUS_31440 372 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 1262 2143 gene locus_tag LOCUS_31450 1262 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 2234 4387 gene locus_tag LOCUS_31460 2234 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 4454 5179 gene locus_tag LOCUS_31470 4454 5179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 5255 6100 gene locus_tag LOCUS_31480 5255 6100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 >Feature sequence211 1279 200 gene locus_tag LOCUS_31490 1279 200 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022383.1 protein_id gnl|my_center|LOCUS_31490 2706 1276 gene locus_tag LOCUS_31500 2706 1276 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667015.1 protein_id gnl|my_center|LOCUS_31500 5316 2725 gene locus_tag LOCUS_31510 5316 2725 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109304.1 protein_id gnl|my_center|LOCUS_31510 6011 5739 gene locus_tag LOCUS_31520 6011 5739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 >Feature sequence212 243 911 gene locus_tag LOCUS_31530 243 911 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189715.1 protein_id gnl|my_center|LOCUS_31530 1054 2265 gene locus_tag LOCUS_31540 1054 2265 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003544617.1 protein_id gnl|my_center|LOCUS_31540 3849 2407 gene locus_tag LOCUS_31550 3849 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 4472 3867 gene locus_tag LOCUS_31560 gene ruvA 4472 3867 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_31560 5359 4469 gene locus_tag LOCUS_31570 gene nadC 5359 4469 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_31570 5892 5419 gene locus_tag LOCUS_31580 5892 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 7119 6013 gene locus_tag LOCUS_31590 7119 6013 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020271.1 protein_id gnl|my_center|LOCUS_31590 7222 7869 gene locus_tag LOCUS_31600 gene plsY 7222 7869 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880403.1 protein_id gnl|my_center|LOCUS_31600 >Feature sequence213 1799 267 gene locus_tag LOCUS_31610 gene lysS 1799 267 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288202.1 protein_id gnl|my_center|LOCUS_31610 2058 4475 gene locus_tag LOCUS_31620 2058 4475 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767612.1 protein_id gnl|my_center|LOCUS_31620 4538 4921 gene locus_tag LOCUS_31630 4538 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 5148 5750 gene locus_tag LOCUS_31640 gene rpsD 5148 5750 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113375.1 protein_id gnl|my_center|LOCUS_31640 5875 7077 gene locus_tag LOCUS_31650 gene thiI 5875 7077 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391742.1 protein_id gnl|my_center|LOCUS_31650 >Feature sequence214 913 233 gene locus_tag LOCUS_31660 913 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 1349 906 gene locus_tag LOCUS_31670 1349 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 1713 1375 gene locus_tag LOCUS_31680 1713 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 1610 2707 gene locus_tag LOCUS_31690 1610 2707 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086138.1 protein_id gnl|my_center|LOCUS_31690 4438 2681 gene locus_tag LOCUS_31700 4438 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 5106 5909 gene locus_tag LOCUS_31710 5106 5909 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088429.1 protein_id gnl|my_center|LOCUS_31710 5941 6984 gene locus_tag LOCUS_31720 gene waaC 5941 6984 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_31720 6991 7962 gene locus_tag LOCUS_31730 6991 7962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 >Feature sequence215 1338 916 gene locus_tag LOCUS_31740 1338 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 2332 1388 gene locus_tag LOCUS_31750 gene rsmH 2332 1388 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943702.1 protein_id gnl|my_center|LOCUS_31750 2850 2332 gene locus_tag LOCUS_31760 gene mraZ 2850 2332 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355890.1 protein_id gnl|my_center|LOCUS_31760 3040 3534 gene locus_tag LOCUS_31770 3040 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 3792 4973 gene locus_tag LOCUS_31780 3792 4973 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108906.1 protein_id gnl|my_center|LOCUS_31780 7950 5062 gene locus_tag LOCUS_31790 7950 5062 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121109.1 protein_id gnl|my_center|LOCUS_31790 >Feature sequence216 5170 1301 gene locus_tag LOCUS_31800 5170 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 5778 5179 gene locus_tag LOCUS_31810 5778 5179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 6404 5967 gene locus_tag LOCUS_31820 6404 5967 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141337.1 protein_id gnl|my_center|LOCUS_31820 7467 6394 gene locus_tag LOCUS_31830 gene mnmA 7467 6394 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_31830 >Feature sequence217 <1 893 gene locus_tag LOCUS_31840 <1 893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970995.1:LacI family DNA-binding transcriptional regulator 961 1623 gene locus_tag LOCUS_31850 961 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 1694 2371 gene locus_tag LOCUS_31860 1694 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 2392 5694 gene locus_tag LOCUS_31870 2392 5694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 5824 6825 gene locus_tag LOCUS_31880 5824 6825 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080078.1 protein_id gnl|my_center|LOCUS_31880 6852 7772 gene locus_tag LOCUS_31890 6852 7772 CDS product DUF4434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766063.1 protein_id gnl|my_center|LOCUS_31890 >Feature sequence218 20 787 gene locus_tag LOCUS_31900 20 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 885 2714 gene locus_tag LOCUS_31910 885 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 3589 2744 gene locus_tag LOCUS_31920 3589 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 3699 5054 gene locus_tag LOCUS_31930 3699 5054 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804146.1 protein_id gnl|my_center|LOCUS_31930 5903 5562 gene locus_tag LOCUS_31940 5903 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31940 6233 6646 gene locus_tag LOCUS_31950 6233 6646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 6807 7808 gene locus_tag LOCUS_31960 6807 7808 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_31960 >Feature sequence219 262 810 gene locus_tag LOCUS_31970 262 810 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065742.1 protein_id gnl|my_center|LOCUS_31970 1779 859 gene locus_tag LOCUS_31980 1779 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 1821 3620 gene locus_tag LOCUS_31990 1821 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 3758 3833 gene locus_tag LOCUS_t00400 3758 3833 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4218 5282 gene locus_tag LOCUS_32000 4218 5282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 5318 7720 gene locus_tag LOCUS_32010 5318 7720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 >Feature sequence220 105 821 gene locus_tag LOCUS_32020 105 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 918 2999 gene locus_tag LOCUS_32030 918 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 3187 2966 gene locus_tag LOCUS_32040 3187 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 6332 3096 gene locus_tag LOCUS_32050 6332 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 7075 6344 gene locus_tag LOCUS_32060 7075 6344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 >Feature sequence221 1402 497 gene locus_tag LOCUS_32070 1402 497 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163274.1 protein_id gnl|my_center|LOCUS_32070 1665 1420 gene locus_tag LOCUS_32080 1665 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 3296 1986 gene locus_tag LOCUS_32090 3296 1986 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460406.1 protein_id gnl|my_center|LOCUS_32090 3770 3582 gene locus_tag LOCUS_32100 3770 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 5650 3833 gene locus_tag LOCUS_32110 5650 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 5857 6756 gene locus_tag LOCUS_32120 5857 6756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 7301 6852 gene locus_tag LOCUS_32130 7301 6852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964460.1 protein_id gnl|my_center|LOCUS_32130 >Feature sequence222 726 76 gene locus_tag LOCUS_32140 726 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 1548 799 gene locus_tag LOCUS_32150 1548 799 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170055.1 protein_id gnl|my_center|LOCUS_32150 3453 1567 gene locus_tag LOCUS_32160 3453 1567 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_32160 3581 4342 gene locus_tag LOCUS_32170 3581 4342 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533023.1 protein_id gnl|my_center|LOCUS_32170 4344 5669 gene locus_tag LOCUS_32180 gene dgoD 4344 5669 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_32180 5683 6675 gene locus_tag LOCUS_32190 5683 6675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 6672 7631 gene locus_tag LOCUS_32200 6672 7631 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027124.1 protein_id gnl|my_center|LOCUS_32200 >Feature sequence223 <1 1114 gene locus_tag LOCUS_32210 <1 1114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003246301.1:glycine/proline betaine ABC transporter ATP-binding protein OpuAA 1111 1956 gene locus_tag LOCUS_32220 1111 1956 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939573.1 protein_id gnl|my_center|LOCUS_32220 1953 2867 gene locus_tag LOCUS_32230 gene opuAC 1953 2867 CDS product glycine/proline betaine ABC transporter substrate-binding protein OpuAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246462.1 protein_id gnl|my_center|LOCUS_32230 2884 4221 gene locus_tag LOCUS_32240 gene algB 2884 4221 CDS product sigma-54-dependent response regulator transcription factor AlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102840.1 protein_id gnl|my_center|LOCUS_32240 4326 6227 gene locus_tag LOCUS_32250 4326 6227 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963797.1 protein_id gnl|my_center|LOCUS_32250 >Feature sequence224 513 1547 gene locus_tag LOCUS_32260 513 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 1616 2344 gene locus_tag LOCUS_32270 1616 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 2365 3909 gene locus_tag LOCUS_32280 2365 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 4260 5606 gene locus_tag LOCUS_32290 4260 5606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 5684 6934 gene locus_tag LOCUS_32300 5684 6934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 7838 6921 gene locus_tag LOCUS_32310 7838 6921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 >Feature sequence225 1226 141 gene locus_tag LOCUS_32320 1226 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 1560 2657 gene locus_tag LOCUS_32330 1560 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 2751 4787 gene locus_tag LOCUS_32340 2751 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 4784 6964 gene locus_tag LOCUS_32350 4784 6964 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_32350 7087 7440 gene locus_tag LOCUS_32360 7087 7440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 >Feature sequence226 106 564 gene locus_tag LOCUS_32370 106 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 566 697 gene locus_tag LOCUS_32380 566 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 712 1359 gene locus_tag LOCUS_32390 712 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 1393 2148 gene locus_tag LOCUS_32400 1393 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 2171 3007 gene locus_tag LOCUS_32410 2171 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 3465 6155 gene locus_tag LOCUS_32420 gene mgtA 3465 6155 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861942.1 protein_id gnl|my_center|LOCUS_32420 6300 6986 gene locus_tag LOCUS_32430 6300 6986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 >Feature sequence227 1086 430 gene locus_tag LOCUS_32440 1086 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 2499 1153 gene locus_tag LOCUS_32450 2499 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 3771 3169 gene locus_tag LOCUS_32460 3771 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 4385 3768 gene locus_tag LOCUS_32470 4385 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 5182 4382 gene locus_tag LOCUS_32480 5182 4382 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295567.1 protein_id gnl|my_center|LOCUS_32480 7687 5240 gene locus_tag LOCUS_32490 7687 5240 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679930.1 protein_id gnl|my_center|LOCUS_32490 >Feature sequence228 380 1744 gene locus_tag LOCUS_32500 380 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 1741 2931 gene locus_tag LOCUS_32510 1741 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 2928 4442 gene locus_tag LOCUS_32520 2928 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 5535 4471 gene locus_tag LOCUS_32530 5535 4471 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906005.1 protein_id gnl|my_center|LOCUS_32530 5770 6480 gene locus_tag LOCUS_32540 5770 6480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 >Feature sequence229 122 823 gene locus_tag LOCUS_32550 122 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 1587 910 gene locus_tag LOCUS_32560 1587 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 2043 1678 gene locus_tag LOCUS_32570 2043 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 2262 2408 gene locus_tag LOCUS_32580 2262 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 3062 2688 gene locus_tag LOCUS_32590 3062 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 3929 3207 gene locus_tag LOCUS_32600 3929 3207 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389029.1 protein_id gnl|my_center|LOCUS_32600 4120 3989 gene locus_tag LOCUS_32610 4120 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32610 6145 4175 gene locus_tag LOCUS_32620 6145 4175 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678883.1 protein_id gnl|my_center|LOCUS_32620 >Feature sequence230 2420 3019 gene locus_tag LOCUS_32630 2420 3019 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_32630 3242 5887 gene locus_tag LOCUS_32640 3242 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 5905 6732 gene locus_tag LOCUS_32650 5905 6732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 >Feature sequence231 1193 342 gene locus_tag LOCUS_32660 1193 342 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011313588.1 protein_id gnl|my_center|LOCUS_32660 1403 1203 gene locus_tag LOCUS_32670 1403 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 3053 1521 gene locus_tag LOCUS_32680 3053 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 3312 3557 gene locus_tag LOCUS_32690 3312 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 3557 3934 gene locus_tag LOCUS_32700 3557 3934 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770889.1 protein_id gnl|my_center|LOCUS_32700 <7581 3935 gene locus_tag LOCUS_32710 <7581 3935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010774229.1:DEAD/DEAH box helicase family protein >Feature sequence232 2344 125 gene locus_tag LOCUS_32720 gene pflB 2344 125 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056834.1 protein_id gnl|my_center|LOCUS_32720 3172 2447 gene locus_tag LOCUS_32730 3172 2447 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095092.1 protein_id gnl|my_center|LOCUS_32730 4190 3216 gene locus_tag LOCUS_32740 4190 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 6245 4218 gene locus_tag LOCUS_32750 6245 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 >Feature sequence233 1352 105 gene locus_tag LOCUS_32760 1352 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 2512 1355 gene locus_tag LOCUS_32770 2512 1355 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816564.1 protein_id gnl|my_center|LOCUS_32770 3541 2528 gene locus_tag LOCUS_32780 3541 2528 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298109.1 protein_id gnl|my_center|LOCUS_32780 3973 3886 gene locus_tag LOCUS_t00410 3973 3886 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4692 4069 gene locus_tag LOCUS_32790 4692 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 6067 4715 gene locus_tag LOCUS_32800 gene rimO 6067 4715 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_32800 6912 6064 gene locus_tag LOCUS_32810 6912 6064 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658001.1 protein_id gnl|my_center|LOCUS_32810 >Feature sequence234 1427 192 gene locus_tag LOCUS_32820 1427 192 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_32820 3755 1683 gene locus_tag LOCUS_32830 3755 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 4545 3775 gene locus_tag LOCUS_32840 4545 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 5627 4557 gene locus_tag LOCUS_32850 5627 4557 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324232.1 protein_id gnl|my_center|LOCUS_32850 6293 5799 gene locus_tag LOCUS_32860 6293 5799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 7236 6394 gene locus_tag LOCUS_32870 7236 6394 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811803.1 protein_id gnl|my_center|LOCUS_32870 >Feature sequence235 271 1089 gene locus_tag LOCUS_32880 271 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 1815 1105 gene locus_tag LOCUS_32890 1815 1105 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531608.1 protein_id gnl|my_center|LOCUS_32890 1908 2543 gene locus_tag LOCUS_32900 1908 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 2980 2567 gene locus_tag LOCUS_32910 2980 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 6266 3054 gene locus_tag LOCUS_32920 6266 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 6901 6269 gene locus_tag LOCUS_32930 6901 6269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 >Feature sequence236 29 667 gene locus_tag LOCUS_32940 29 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 679 1764 gene locus_tag LOCUS_32950 679 1764 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729985.1 protein_id gnl|my_center|LOCUS_32950 1772 3244 gene locus_tag LOCUS_32960 1772 3244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 5783 3264 gene locus_tag LOCUS_32970 5783 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 7168 5786 gene locus_tag LOCUS_32980 7168 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 >Feature sequence237 458 384 gene locus_tag LOCUS_t00420 458 384 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 543 467 gene locus_tag LOCUS_t00430 543 467 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1839 667 gene locus_tag LOCUS_32990 1839 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 4101 1999 gene locus_tag LOCUS_33000 4101 1999 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_33000 >Feature sequence238 145 1683 gene locus_tag LOCUS_33010 145 1683 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546463.1 protein_id gnl|my_center|LOCUS_33010 1808 2809 gene locus_tag LOCUS_33020 1808 2809 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267463.1 protein_id gnl|my_center|LOCUS_33020 3901 2822 gene locus_tag LOCUS_33030 3901 2822 CDS product 2-dehydropantoate 2-reductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066908.1 protein_id gnl|my_center|LOCUS_33030 4653 3898 gene locus_tag LOCUS_33040 4653 3898 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832720.1 protein_id gnl|my_center|LOCUS_33040 4841 5617 gene locus_tag LOCUS_33050 4841 5617 CDS product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661561.1 protein_id gnl|my_center|LOCUS_33050 5739 6767 gene locus_tag LOCUS_33060 5739 6767 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298109.1 protein_id gnl|my_center|LOCUS_33060 >Feature sequence239 <1 764 gene locus_tag LOCUS_33070 <1 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933195.1:sigma-54-dependent Fis family transcriptional regulator 792 1352 gene locus_tag LOCUS_33080 792 1352 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120861.1 protein_id gnl|my_center|LOCUS_33080 2141 1605 gene locus_tag LOCUS_33090 2141 1605 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_33090 3473 2253 gene locus_tag LOCUS_33100 3473 2253 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083303.1 protein_id gnl|my_center|LOCUS_33100 5442 3544 gene locus_tag LOCUS_33110 gene mrdA 5442 3544 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388232.1 protein_id gnl|my_center|LOCUS_33110 5993 5439 gene locus_tag LOCUS_33120 5993 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 6862 5990 gene locus_tag LOCUS_33130 6862 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 >Feature sequence240 358 1104 gene locus_tag LOCUS_33140 gene larB 358 1104 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100884.1 protein_id gnl|my_center|LOCUS_33140 1126 2772 gene locus_tag LOCUS_33150 gene leuA 1126 2772 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933761.1 protein_id gnl|my_center|LOCUS_33150 2890 4080 gene locus_tag LOCUS_33160 2890 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 4146 5753 gene locus_tag LOCUS_33170 4146 5753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 5766 6836 gene locus_tag LOCUS_33180 gene hisC 5766 6836 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943720.1 protein_id gnl|my_center|LOCUS_33180 >Feature sequence241 13 1056 gene locus_tag LOCUS_33190 13 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 1505 984 gene locus_tag LOCUS_33200 1505 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 2311 1505 gene locus_tag LOCUS_33210 2311 1505 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119992.1 protein_id gnl|my_center|LOCUS_33210 3471 2296 gene locus_tag LOCUS_33220 3471 2296 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836207.1 protein_id gnl|my_center|LOCUS_33220 4236 3481 gene locus_tag LOCUS_33230 4236 3481 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975846.1 protein_id gnl|my_center|LOCUS_33230 4428 5345 gene locus_tag LOCUS_33240 4428 5345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 5422 6855 gene locus_tag LOCUS_33250 5422 6855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 >Feature sequence242 2794 2024 gene locus_tag LOCUS_33260 2794 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 2946 3599 gene locus_tag LOCUS_33270 2946 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 3922 4362 gene locus_tag LOCUS_33280 3922 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 4544 4981 gene locus_tag LOCUS_33290 4544 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 4978 5943 gene locus_tag LOCUS_33300 gene xerC 4978 5943 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_33300 <6949 6198 gene locus_tag LOCUS_33310 <6949 6198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010892188.1:arginine/agmatine antiporter AaxC >Feature sequence243 935 18 gene locus_tag LOCUS_33320 935 18 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_33320 1715 939 gene locus_tag LOCUS_33330 1715 939 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_33330 2331 1702 gene locus_tag LOCUS_33340 2331 1702 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731912.1 protein_id gnl|my_center|LOCUS_33340 6107 2328 gene locus_tag LOCUS_33350 6107 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 >Feature sequence244 1045 155 gene locus_tag LOCUS_33360 1045 155 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234873.1 protein_id gnl|my_center|LOCUS_33360 1341 1754 gene locus_tag LOCUS_33370 1341 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 1985 3787 gene locus_tag LOCUS_33380 1985 3787 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858311.1 protein_id gnl|my_center|LOCUS_33380 3801 5042 gene locus_tag LOCUS_33390 3801 5042 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202275.1 protein_id gnl|my_center|LOCUS_33390 5056 5295 gene locus_tag LOCUS_33400 5056 5295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 >Feature sequence245 4436 1098 gene locus_tag LOCUS_33410 4436 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 <6744 4474 gene locus_tag LOCUS_33420 <6744 4474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113014.1:PAS domain S-box protein >Feature sequence246 513 1772 gene locus_tag LOCUS_33430 513 1772 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_33430 1776 2645 gene locus_tag LOCUS_33440 1776 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 6022 2807 gene locus_tag LOCUS_33450 6022 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 >Feature sequence247 101 1591 gene locus_tag LOCUS_33460 101 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 1639 2394 gene locus_tag LOCUS_33470 1639 2394 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525109.1 protein_id gnl|my_center|LOCUS_33470 2408 3166 gene locus_tag LOCUS_33480 2408 3166 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969223.1 protein_id gnl|my_center|LOCUS_33480 3305 4273 gene locus_tag LOCUS_33490 3305 4273 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969219.1 protein_id gnl|my_center|LOCUS_33490 4312 5631 gene locus_tag LOCUS_33500 4312 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 >Feature sequence248 2131 116 gene locus_tag LOCUS_33510 2131 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 2963 2142 gene locus_tag LOCUS_33520 2963 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 3937 3263 gene locus_tag LOCUS_33530 gene phoU 3937 3263 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326666.1 protein_id gnl|my_center|LOCUS_33530 4718 3948 gene locus_tag LOCUS_33540 gene pstB 4718 3948 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036709.1 protein_id gnl|my_center|LOCUS_33540 5583 4708 gene locus_tag LOCUS_33550 gene pstA 5583 4708 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369014.1 protein_id gnl|my_center|LOCUS_33550 6523 5585 gene locus_tag LOCUS_33560 gene pstC 6523 5585 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656744.1 protein_id gnl|my_center|LOCUS_33560 >Feature sequence249 169 1353 gene locus_tag LOCUS_33570 169 1353 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808433.1 protein_id gnl|my_center|LOCUS_33570 1476 2549 gene locus_tag LOCUS_33580 gene rffG 1476 2549 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216798.1 protein_id gnl|my_center|LOCUS_33580 2546 3412 gene locus_tag LOCUS_33590 gene rfbA 2546 3412 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073074.1 protein_id gnl|my_center|LOCUS_33590 3417 3962 gene locus_tag LOCUS_33600 gene rfbC 3417 3962 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107717.1 protein_id gnl|my_center|LOCUS_33600 4010 4825 gene locus_tag LOCUS_33610 gene rfbD 4010 4825 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_33610 >Feature sequence250 <1 740 gene locus_tag LOCUS_33620 <1 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070719.1:calcium/sodium antiporter 1248 4154 gene locus_tag LOCUS_33630 1248 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 4982 4236 gene locus_tag LOCUS_33640 4982 4236 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_33640 5104 6204 gene locus_tag LOCUS_33650 5104 6204 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_33650 >Feature sequence251 765 2654 gene locus_tag LOCUS_33660 gene ligA 765 2654 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356806.1 protein_id gnl|my_center|LOCUS_33660 3019 4257 gene locus_tag LOCUS_33670 3019 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 4254 4922 gene locus_tag LOCUS_33680 4254 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 >Feature sequence252 1318 407 gene locus_tag LOCUS_33690 1318 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 2362 1322 gene locus_tag LOCUS_33700 2362 1322 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387716.1 protein_id gnl|my_center|LOCUS_33700 3171 2359 gene locus_tag LOCUS_33710 3171 2359 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119041.1 protein_id gnl|my_center|LOCUS_33710 3433 3774 gene locus_tag LOCUS_33720 3433 3774 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083241.1 protein_id gnl|my_center|LOCUS_33720 3822 5162 gene locus_tag LOCUS_33730 gene amt 3822 5162 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056043.1 protein_id gnl|my_center|LOCUS_33730 6427 5306 gene locus_tag LOCUS_33740 6427 5306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 >Feature sequence253 102 1667 gene locus_tag LOCUS_33750 102 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 1664 2365 gene locus_tag LOCUS_33760 1664 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 3155 2403 gene locus_tag LOCUS_33770 3155 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 3305 4267 gene locus_tag LOCUS_33780 3305 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 4236 4970 gene locus_tag LOCUS_33790 4236 4970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 >Feature sequence254 405 1142 gene locus_tag LOCUS_33800 405 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 2540 1524 gene locus_tag LOCUS_33810 2540 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 2734 3930 gene locus_tag LOCUS_33820 2734 3930 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119310.1 protein_id gnl|my_center|LOCUS_33820 3935 6097 gene locus_tag LOCUS_33830 3935 6097 CDS product pyruvate formate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767243.1 protein_id gnl|my_center|LOCUS_33830 >Feature sequence255 357 1091 gene locus_tag LOCUS_33840 357 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 1122 1811 gene locus_tag LOCUS_33850 1122 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 1849 5931 gene locus_tag LOCUS_33860 1849 5931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 >Feature sequence256 385 1551 gene locus_tag LOCUS_33870 385 1551 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048277.1 protein_id gnl|my_center|LOCUS_33870 3141 1666 gene locus_tag LOCUS_33880 3141 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 5393 3138 gene locus_tag LOCUS_33890 5393 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 6169 5405 gene locus_tag LOCUS_33900 6169 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 >Feature sequence257 5 2470 gene locus_tag LOCUS_33910 5 2470 CDS product excinuclease ABC subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389901.1 protein_id gnl|my_center|LOCUS_33910 3501 4328 gene locus_tag LOCUS_33920 3501 4328 CDS product N(5)-(carboxyethyl)ornithine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131029.1 protein_id gnl|my_center|LOCUS_33920 4360 4953 gene locus_tag LOCUS_33930 4360 4953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 5011 5955 gene locus_tag LOCUS_33940 5011 5955 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792911.1 protein_id gnl|my_center|LOCUS_33940 >Feature sequence258 3403 371 gene locus_tag LOCUS_33950 gene vmeI 3403 371 CDS product efflux RND transporter permease subunit VmeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478902.1 protein_id gnl|my_center|LOCUS_33950 4550 3390 gene locus_tag LOCUS_33960 gene vexC 4550 3390 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VexC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069849.1 protein_id gnl|my_center|LOCUS_33960 5201 4563 gene locus_tag LOCUS_33970 5201 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 >Feature sequence259 162 1310 gene locus_tag LOCUS_33980 162 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 1342 3267 gene locus_tag LOCUS_33990 1342 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 3290 4054 gene locus_tag LOCUS_34000 3290 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 >Feature sequence260 736 1230 gene locus_tag LOCUS_34010 736 1230 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902172.1 protein_id gnl|my_center|LOCUS_34010 1253 1852 gene locus_tag LOCUS_34020 1253 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 1849 3177 gene locus_tag LOCUS_34030 gene bexA 1849 3177 CDS product multidrug efflux MATE transporter BexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107339.1 protein_id gnl|my_center|LOCUS_34030 4039 3191 gene locus_tag LOCUS_34040 gene nfo 4039 3191 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795638.1 protein_id gnl|my_center|LOCUS_34040 4932 4036 gene locus_tag LOCUS_34050 4932 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 5048 6106 gene locus_tag LOCUS_34060 5048 6106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 >Feature sequence261 <1 686 gene locus_tag LOCUS_34070 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583238.1:type II secretion system ATPase GspE 705 2396 gene locus_tag LOCUS_34080 705 2396 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 protein_id gnl|my_center|LOCUS_34080 2438 3688 gene locus_tag LOCUS_34090 2438 3688 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_34090 3773 4867 gene locus_tag LOCUS_34100 3773 4867 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120825.1 protein_id gnl|my_center|LOCUS_34100 4877 5578 gene locus_tag LOCUS_34110 4877 5578 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869867.1 protein_id gnl|my_center|LOCUS_34110 >Feature sequence262 580 308 gene locus_tag LOCUS_34120 580 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816325.1 protein_id gnl|my_center|LOCUS_34120 754 1848 gene locus_tag LOCUS_34130 754 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 2947 1877 gene locus_tag LOCUS_34140 2947 1877 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123141.1 protein_id gnl|my_center|LOCUS_34140 4414 3110 gene locus_tag LOCUS_34150 4414 3110 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430161.1 protein_id gnl|my_center|LOCUS_34150 5356 4436 gene locus_tag LOCUS_34160 5356 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 5794 5432 gene locus_tag LOCUS_34170 5794 5432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 >Feature sequence263 1343 309 gene locus_tag LOCUS_34180 1343 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 2330 1362 gene locus_tag LOCUS_34190 2330 1362 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506955.1 protein_id gnl|my_center|LOCUS_34190 3859 2327 gene locus_tag LOCUS_34200 3859 2327 CDS product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457220.1 protein_id gnl|my_center|LOCUS_34200 4393 3869 gene locus_tag LOCUS_34210 4393 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 <6071 4599 gene locus_tag LOCUS_34220 <6071 4599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391612.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase >Feature sequence264 3 413 gene locus_tag LOCUS_34230 3 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 1413 460 gene locus_tag LOCUS_34240 1413 460 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947192.1 protein_id gnl|my_center|LOCUS_34240 1629 2351 gene locus_tag LOCUS_34250 1629 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 2362 5691 gene locus_tag LOCUS_34260 2362 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 >Feature sequence265 2258 738 gene locus_tag LOCUS_34270 gene glgA 2258 738 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246015.1 protein_id gnl|my_center|LOCUS_34270 4899 2353 gene locus_tag LOCUS_34280 4899 2353 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_34280 5391 5089 gene locus_tag LOCUS_34290 5391 5089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34290 >Feature sequence266 2573 1599 gene locus_tag LOCUS_34300 2573 1599 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893107.1 protein_id gnl|my_center|LOCUS_34300 2776 5244 gene locus_tag LOCUS_34310 2776 5244 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263007.1 protein_id gnl|my_center|LOCUS_34310 >Feature sequence267 1265 327 gene locus_tag LOCUS_34320 1265 327 CDS product DUF4434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766063.1 protein_id gnl|my_center|LOCUS_34320 2426 1353 gene locus_tag LOCUS_34330 2426 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 3463 2426 gene locus_tag LOCUS_34340 3463 2426 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785424.1 protein_id gnl|my_center|LOCUS_34340 4961 3687 gene locus_tag LOCUS_34350 4961 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 5947 5222 gene locus_tag LOCUS_34360 5947 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 >Feature sequence268 <1 820 gene locus_tag LOCUS_34370 <1 820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011067998.1:ROK family protein 880 1725 gene locus_tag LOCUS_34380 880 1725 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964640.1 protein_id gnl|my_center|LOCUS_34380 1729 2925 gene locus_tag LOCUS_34390 gene uxuA 1729 2925 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107776.1 protein_id gnl|my_center|LOCUS_34390 4412 2982 gene locus_tag LOCUS_34400 gene araA 4412 2982 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368279.1 protein_id gnl|my_center|LOCUS_34400 5094 4396 gene locus_tag LOCUS_34410 5094 4396 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262722.1 protein_id gnl|my_center|LOCUS_34410 <5961 5087 gene locus_tag LOCUS_34420 <5961 5087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705777.1:ribulokinase >Feature sequence269 697 206 gene locus_tag LOCUS_34430 697 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 1081 722 gene locus_tag LOCUS_34440 1081 722 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760124.1 protein_id gnl|my_center|LOCUS_34440 1617 1078 gene locus_tag LOCUS_34450 1617 1078 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774219.1 protein_id gnl|my_center|LOCUS_34450 2117 1614 gene locus_tag LOCUS_34460 2117 1614 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140415.1 protein_id gnl|my_center|LOCUS_34460 2276 4105 gene locus_tag LOCUS_34470 2276 4105 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228742.1 protein_id gnl|my_center|LOCUS_34470 5185 4115 gene locus_tag LOCUS_34480 5185 4115 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462098.1 protein_id gnl|my_center|LOCUS_34480 >Feature sequence270 <1 740 gene locus_tag LOCUS_34490 <1 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080120.1:LacI family DNA-binding transcriptional regulator 762 1793 gene locus_tag LOCUS_34500 762 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 1803 2558 gene locus_tag LOCUS_34510 1803 2558 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930893.1 protein_id gnl|my_center|LOCUS_34510 2603 3280 gene locus_tag LOCUS_34520 2603 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 >Feature sequence271 2199 136 gene locus_tag LOCUS_34530 2199 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 3411 2368 gene locus_tag LOCUS_34540 3411 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 5427 3724 gene locus_tag LOCUS_34550 5427 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 5875 5432 gene locus_tag LOCUS_34560 5875 5432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 >Feature sequence272 <5815 3360 gene locus_tag LOCUS_34570 <5815 3360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202053.1:alpha-galactosidase >Feature sequence273 958 2580 gene locus_tag LOCUS_34580 958 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 2607 3632 gene locus_tag LOCUS_34590 2607 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 3653 4546 gene locus_tag LOCUS_34600 3653 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 4539 5342 gene locus_tag LOCUS_34610 4539 5342 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806976.1 protein_id gnl|my_center|LOCUS_34610 5452 5703 gene locus_tag LOCUS_34620 5452 5703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 >Feature sequence274 2587 524 gene locus_tag LOCUS_34630 2587 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 4480 2600 gene locus_tag LOCUS_34640 4480 2600 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160859024.1 protein_id gnl|my_center|LOCUS_34640 5711 4560 gene locus_tag LOCUS_34650 5711 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 >Feature sequence275 623 1612 gene locus_tag LOCUS_34660 623 1612 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206339.1 protein_id gnl|my_center|LOCUS_34660 1631 2689 gene locus_tag LOCUS_34670 1631 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 2692 3579 gene locus_tag LOCUS_34680 2692 3579 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206340.1 protein_id gnl|my_center|LOCUS_34680 3597 4316 gene locus_tag LOCUS_34690 3597 4316 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420904.1 protein_id gnl|my_center|LOCUS_34690 4333 4989 gene locus_tag LOCUS_34700 4333 4989 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 protein_id gnl|my_center|LOCUS_34700 4986 5639 gene locus_tag LOCUS_34710 4986 5639 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405298.1 protein_id gnl|my_center|LOCUS_34710 >Feature sequence276 248 1567 gene locus_tag LOCUS_34720 gene ibeA 248 1567 CDS product putative intracellular survival FAD-dependent oxidoreductase IbeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397942.1 protein_id gnl|my_center|LOCUS_34720 2630 1593 gene locus_tag LOCUS_34730 2630 1593 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_34730 2972 5458 gene locus_tag LOCUS_34740 2972 5458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 >Feature sequence277 198 1253 gene locus_tag LOCUS_34750 198 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 1256 2725 gene locus_tag LOCUS_34760 1256 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 3667 3936 gene locus_tag LOCUS_34770 3667 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 >Feature sequence278 613 338 gene locus_tag LOCUS_34780 613 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 3623 639 gene locus_tag LOCUS_34790 3623 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 4416 4652 gene locus_tag LOCUS_34800 4416 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 5001 4714 gene locus_tag LOCUS_34810 5001 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34810 5411 4938 gene locus_tag LOCUS_34820 5411 4938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34820 >Feature sequence279 1880 1140 gene locus_tag LOCUS_34830 1880 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 2979 1978 gene locus_tag LOCUS_34840 gene degA 2979 1978 CDS product transcriptional regulator DegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245813.1 protein_id gnl|my_center|LOCUS_34840 4506 3442 gene locus_tag LOCUS_34850 4506 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 >Feature sequence280 81 1040 gene locus_tag LOCUS_34860 81 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 2866 1172 gene locus_tag LOCUS_34870 2866 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 3513 2863 gene locus_tag LOCUS_34880 3513 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 3683 4597 gene locus_tag LOCUS_34890 3683 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 4594 4992 gene locus_tag LOCUS_34900 4594 4992 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938134.1 protein_id gnl|my_center|LOCUS_34900 >Feature sequence281 1546 200 gene locus_tag LOCUS_34910 gene vpsH 1546 200 CDS product exopolysaccharide biosynthesis protein VpsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495305.1 protein_id gnl|my_center|LOCUS_34910 2821 1568 gene locus_tag LOCUS_34920 2821 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 3585 2818 gene locus_tag LOCUS_34930 3585 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 4790 3585 gene locus_tag LOCUS_34940 4790 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 <5607 4787 gene locus_tag LOCUS_34950 <5607 4787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776662.1:glycosyltransferase family 1 protein >Feature sequence282 2529 775 gene locus_tag LOCUS_34960 2529 775 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229240.1 protein_id gnl|my_center|LOCUS_34960 3441 2533 gene locus_tag LOCUS_34970 3441 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 4049 3456 gene locus_tag LOCUS_34980 4049 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 >Feature sequence283 664 326 gene locus_tag LOCUS_34990 664 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 1810 797 gene locus_tag LOCUS_35000 1810 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 2482 3234 gene locus_tag LOCUS_35010 2482 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 3286 5457 gene locus_tag LOCUS_35020 3286 5457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 >Feature sequence284 1950 1192 gene locus_tag LOCUS_35030 1950 1192 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119041.1 protein_id gnl|my_center|LOCUS_35030 2334 1972 gene locus_tag LOCUS_35040 2334 1972 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016210.1 protein_id gnl|my_center|LOCUS_35040 3595 2339 gene locus_tag LOCUS_35050 3595 2339 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964633.1 protein_id gnl|my_center|LOCUS_35050 5061 3592 gene locus_tag LOCUS_35060 5061 3592 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865341.1 protein_id gnl|my_center|LOCUS_35060 >Feature sequence285 2045 558 gene locus_tag LOCUS_35070 2045 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 5220 2059 gene locus_tag LOCUS_35080 5220 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 >Feature sequence286 1259 363 gene locus_tag LOCUS_35090 1259 363 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108933.1 protein_id gnl|my_center|LOCUS_35090 2286 1261 gene locus_tag LOCUS_35100 2286 1261 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_35100 2511 3644 gene locus_tag LOCUS_35110 gene waaF 2511 3644 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958358.1 protein_id gnl|my_center|LOCUS_35110 3707 5350 gene locus_tag LOCUS_35120 3707 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 >Feature sequence287 371 2248 gene locus_tag LOCUS_35130 371 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 <5408 2396 gene locus_tag LOCUS_35140 <5408 2396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258924.1:glycosyl hydrolase >Feature sequence288 4016 1602 gene locus_tag LOCUS_35150 4016 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 4726 4031 gene locus_tag LOCUS_35160 4726 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 <5392 4866 gene locus_tag LOCUS_35170 <5392 4866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002208881.1:LacI family DNA-binding transcriptional regulator >Feature sequence289 643 3231 gene locus_tag LOCUS_35180 643 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 3478 4182 gene locus_tag LOCUS_35190 3478 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 >Feature sequence290 1474 659 gene locus_tag LOCUS_35200 1474 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 3130 1532 gene locus_tag LOCUS_35210 3130 1532 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764424.1 protein_id gnl|my_center|LOCUS_35210 3527 3339 gene locus_tag LOCUS_35220 3527 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 4124 3540 gene locus_tag LOCUS_35230 4124 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 4335 5018 gene locus_tag LOCUS_35240 4335 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 >Feature sequence291 4699 2831 gene locus_tag LOCUS_35250 4699 2831 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026861.1 protein_id gnl|my_center|LOCUS_35250 >Feature sequence292 <1 1733 gene locus_tag LOCUS_35260 <1 1733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011792363.1:mechanosensitive ion channel 2520 1720 gene locus_tag LOCUS_35270 2520 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 2601 3239 gene locus_tag LOCUS_35280 2601 3239 CDS product CatA-like O-acetyltransferase, family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705203.1 protein_id gnl|my_center|LOCUS_35280 4607 3240 gene locus_tag LOCUS_35290 4607 3240 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118525.1 protein_id gnl|my_center|LOCUS_35290 <5263 4726 gene locus_tag LOCUS_35300 <5263 4726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919030.1:SDR family oxidoreductase >Feature sequence293 5202 1273 gene locus_tag LOCUS_35310 5202 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 >Feature sequence294 1112 123 gene locus_tag LOCUS_35320 1112 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 1507 1187 gene locus_tag LOCUS_35330 gene sugE 1507 1187 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932066.1 protein_id gnl|my_center|LOCUS_35330 2986 1658 gene locus_tag LOCUS_35340 2986 1658 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123159.1 protein_id gnl|my_center|LOCUS_35340 4202 2988 gene locus_tag LOCUS_35350 4202 2988 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767711.1 protein_id gnl|my_center|LOCUS_35350 >Feature sequence295 1 888 gene locus_tag LOCUS_35360 1 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 1130 2152 gene locus_tag LOCUS_35370 1130 2152 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330234.1 protein_id gnl|my_center|LOCUS_35370 2173 3060 gene locus_tag LOCUS_35380 2173 3060 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421555.1 protein_id gnl|my_center|LOCUS_35380 3064 4020 gene locus_tag LOCUS_35390 3064 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 4017 5030 gene locus_tag LOCUS_35400 4017 5030 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121996.1 protein_id gnl|my_center|LOCUS_35400 >Feature sequence296 1290 226 gene locus_tag LOCUS_35410 1290 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 1503 2225 gene locus_tag LOCUS_35420 1503 2225 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428846.1 protein_id gnl|my_center|LOCUS_35420 2240 2581 gene locus_tag LOCUS_35430 2240 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 2663 3331 gene locus_tag LOCUS_35440 2663 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 4260 3391 gene locus_tag LOCUS_35450 4260 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 >Feature sequence297 <1 3330 gene locus_tag LOCUS_35460 <1 3330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012639975.1:MobF family relaxase 3353 3631 gene locus_tag LOCUS_35470 3353 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 3767 3642 gene locus_tag LOCUS_35480 3767 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 >Feature sequence298 1225 359 gene locus_tag LOCUS_35490 1225 359 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962641.1 protein_id gnl|my_center|LOCUS_35490 2082 1228 gene locus_tag LOCUS_35500 2082 1228 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082811.1 protein_id gnl|my_center|LOCUS_35500 2583 2086 gene locus_tag LOCUS_35510 2583 2086 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146469.1 protein_id gnl|my_center|LOCUS_35510 4342 2585 gene locus_tag LOCUS_35520 gene lnt 4342 2585 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939146.1 protein_id gnl|my_center|LOCUS_35520 >Feature sequence299 633 196 gene locus_tag LOCUS_35530 633 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 1654 620 gene locus_tag LOCUS_35540 1654 620 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202260.1 protein_id gnl|my_center|LOCUS_35540 2603 1692 gene locus_tag LOCUS_35550 2603 1692 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938171.1 protein_id gnl|my_center|LOCUS_35550 3796 2660 gene locus_tag LOCUS_35560 3796 2660 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331373.1 protein_id gnl|my_center|LOCUS_35560 >Feature sequence300 712 233 gene locus_tag LOCUS_35570 712 233 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793479.1 protein_id gnl|my_center|LOCUS_35570 841 1821 gene locus_tag LOCUS_35580 841 1821 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_35580 2786 1836 gene locus_tag LOCUS_35590 2786 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 3483 2953 gene locus_tag LOCUS_35600 3483 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 4801 3743 gene locus_tag LOCUS_35610 4801 3743 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084661.1 protein_id gnl|my_center|LOCUS_35610 >Feature sequence301 542 1624 gene locus_tag LOCUS_35620 542 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 1621 2328 gene locus_tag LOCUS_35630 1621 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 2348 4321 gene locus_tag LOCUS_35640 2348 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 >Feature sequence302 2828 1305 gene locus_tag LOCUS_35650 2828 1305 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727481.1 protein_id gnl|my_center|LOCUS_35650 3967 2825 gene locus_tag LOCUS_35660 3967 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 3939 4355 gene locus_tag LOCUS_35670 3939 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 4648 4400 gene locus_tag LOCUS_35680 4648 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 >Feature sequence303 1019 192 gene locus_tag LOCUS_35690 1019 192 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288251.1 protein_id gnl|my_center|LOCUS_35690 1111 2130 gene locus_tag LOCUS_35700 1111 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 2252 2998 gene locus_tag LOCUS_35710 2252 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 2919 4640 gene locus_tag LOCUS_35720 2919 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 >Feature sequence304 260 1231 gene locus_tag LOCUS_35730 260 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 1374 1907 gene locus_tag LOCUS_35740 1374 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 2146 2757 gene locus_tag LOCUS_35750 2146 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 <4788 3306 gene locus_tag LOCUS_35760 <4788 3306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082283.1:glycoside hydrolase family 5 protein >Feature sequence305 987 1808 gene locus_tag LOCUS_35770 987 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 1805 2626 gene locus_tag LOCUS_35780 gene nudC 1805 2626 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966666.1 protein_id gnl|my_center|LOCUS_35780 2619 3164 gene locus_tag LOCUS_35790 2619 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 3169 3834 gene locus_tag LOCUS_35800 3169 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 <4658 3994 gene locus_tag LOCUS_35810 <4658 3994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048169508.1:aldo/keto reductase >Feature sequence306 <1 2239 gene locus_tag LOCUS_35820 <1 2239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015909439.1:flagellar filament outer layer protein FlaA 3188 4237 gene locus_tag LOCUS_35830 3188 4237 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_35830 4303 4578 gene locus_tag LOCUS_35840 4303 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 >Feature sequence307 630 1160 gene locus_tag LOCUS_35850 gene nuoE 630 1160 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986413.1 protein_id gnl|my_center|LOCUS_35850 1354 3198 gene locus_tag LOCUS_35860 1354 3198 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986412.1 protein_id gnl|my_center|LOCUS_35860 >Feature sequence308 207 1007 gene locus_tag LOCUS_35870 207 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 1004 1822 gene locus_tag LOCUS_35880 1004 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 1812 2525 gene locus_tag LOCUS_35890 1812 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 4261 2762 gene locus_tag LOCUS_35900 4261 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 >Feature sequence309 806 2041 gene locus_tag LOCUS_35910 806 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 2057 2764 gene locus_tag LOCUS_35920 2057 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 2792 3217 gene locus_tag LOCUS_35930 2792 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 3899 3318 gene locus_tag LOCUS_35940 3899 3318 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_35940 <4546 3896 gene locus_tag LOCUS_35950 <4546 3896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941581.1:ATP-binding cassette domain-containing protein >Feature sequence310 962 273 gene locus_tag LOCUS_35960 962 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 2185 959 gene locus_tag LOCUS_35970 2185 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 2844 2188 gene locus_tag LOCUS_35980 2844 2188 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030549.1 protein_id gnl|my_center|LOCUS_35980 4503 3520 gene locus_tag LOCUS_35990 4503 3520 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931920.1 protein_id gnl|my_center|LOCUS_35990 >Feature sequence311 2671 935 gene locus_tag LOCUS_36000 2671 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 4427 2790 gene locus_tag LOCUS_36010 4427 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 >Feature sequence312 280 122 gene locus_tag LOCUS_36020 280 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 1275 313 gene locus_tag LOCUS_36030 1275 313 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919030.1 protein_id gnl|my_center|LOCUS_36030 2467 1295 gene locus_tag LOCUS_36040 2467 1295 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776619.1 protein_id gnl|my_center|LOCUS_36040 3623 2475 gene locus_tag LOCUS_36050 gene cap8G 3623 2475 CDS product type 8 capsular polysaccharide synthesis protein Cap8G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413171.1 protein_id gnl|my_center|LOCUS_36050 <4490 3626 gene locus_tag LOCUS_36060 <4490 3626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963418.1:NAD-dependent epimerase/dehydratase family protein >Feature sequence313 2247 1249 gene locus_tag LOCUS_36070 2247 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 3094 2252 gene locus_tag LOCUS_36080 3094 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 <4471 3215 gene locus_tag LOCUS_36090 <4471 3215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009930567.1:DUF445 domain-containing protein >Feature sequence314 1024 194 gene locus_tag LOCUS_36100 1024 194 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228625.1 protein_id gnl|my_center|LOCUS_36100 1939 1037 gene locus_tag LOCUS_36110 1939 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 3599 1929 gene locus_tag LOCUS_36120 3599 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 >Feature sequence315 2204 819 gene locus_tag LOCUS_36130 2204 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 2290 3135 gene locus_tag LOCUS_36140 gene thiD 2290 3135 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228119.1 protein_id gnl|my_center|LOCUS_36140 3141 4118 gene locus_tag LOCUS_36150 3141 4118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 >Feature sequence316 286 50 gene locus_tag LOCUS_36160 286 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 633 283 gene locus_tag LOCUS_36170 633 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 1157 633 gene locus_tag LOCUS_36180 1157 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 3286 1199 gene locus_tag LOCUS_36190 3286 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 4347 3283 gene locus_tag LOCUS_36200 4347 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 >Feature sequence317 343 891 gene locus_tag LOCUS_36210 gene pyrR 343 891 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887753.1 protein_id gnl|my_center|LOCUS_36210 921 1847 gene locus_tag LOCUS_36220 921 1847 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941926.1 protein_id gnl|my_center|LOCUS_36220 1844 3121 gene locus_tag LOCUS_36230 1844 3121 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_36230 3118 4266 gene locus_tag LOCUS_36240 3118 4266 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992361.1 protein_id gnl|my_center|LOCUS_36240 >Feature sequence318 3708 835 gene locus_tag LOCUS_36250 3708 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 >Feature sequence319 1098 61 gene locus_tag LOCUS_36260 1098 61 CDS product lysophospholipid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097282.1 protein_id gnl|my_center|LOCUS_36260 1903 1232 gene locus_tag LOCUS_36270 1903 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 2142 2819 gene locus_tag LOCUS_36280 2142 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 2848 3225 gene locus_tag LOCUS_36290 2848 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 3235 3687 gene locus_tag LOCUS_36300 3235 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 >Feature sequence320 <1 569 gene locus_tag LOCUS_36310 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000047473.1:LPS export ABC transporter ATP-binding protein 622 978 gene locus_tag LOCUS_36320 gene raiA 622 978 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815178.1 protein_id gnl|my_center|LOCUS_36320 1084 1419 gene locus_tag LOCUS_36330 1084 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 1577 2332 gene locus_tag LOCUS_36340 1577 2332 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942056.1 protein_id gnl|my_center|LOCUS_36340 2337 3698 gene locus_tag LOCUS_36350 2337 3698 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 protein_id gnl|my_center|LOCUS_36350 >Feature sequence321 1138 113 gene locus_tag LOCUS_36360 1138 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 >Feature sequence322 1155 73 gene locus_tag LOCUS_36370 gene serC 1155 73 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_36370 2024 1242 gene locus_tag LOCUS_36380 2024 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 3271 2000 gene locus_tag LOCUS_36390 3271 2000 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141365.1 protein_id gnl|my_center|LOCUS_36390 4050 3265 gene locus_tag LOCUS_36400 4050 3265 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958026.1 protein_id gnl|my_center|LOCUS_36400 >Feature sequence323 >Feature sequence324 2708 1617 gene locus_tag LOCUS_36410 2708 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 3468 2785 gene locus_tag LOCUS_36420 3468 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 4193 3519 gene locus_tag LOCUS_36430 4193 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 >Feature sequence325 <1 813 gene locus_tag LOCUS_36440 <1 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222654.1:xylulokinase 966 2333 gene locus_tag LOCUS_36450 966 2333 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 protein_id gnl|my_center|LOCUS_36450 >Feature sequence326 1223 456 gene locus_tag LOCUS_36460 1223 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 3796 1331 gene locus_tag LOCUS_36470 3796 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 >Feature sequence327 108 275 gene locus_tag LOCUS_36480 108 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 280 465 gene locus_tag LOCUS_36490 280 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 489 1448 gene locus_tag LOCUS_36500 489 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 1578 2078 gene locus_tag LOCUS_36510 1578 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 3366 2260 gene locus_tag LOCUS_36520 3366 2260 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366112.1 protein_id gnl|my_center|LOCUS_36520 >Feature sequence328 <1 1296 gene locus_tag LOCUS_36530 <1 1296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_144351383.1:pyruvate formate lyase family protein 1300 2187 gene locus_tag LOCUS_36540 1300 2187 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939546.1 protein_id gnl|my_center|LOCUS_36540 2265 3167 gene locus_tag LOCUS_36550 2265 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 >Feature sequence329 <1 1089 gene locus_tag LOCUS_36560 <1 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943636.1:cobyrinate a,c-diamide synthase 1092 2060 gene locus_tag LOCUS_36570 gene cbiB 1092 2060 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932620.1 protein_id gnl|my_center|LOCUS_36570 2057 2632 gene locus_tag LOCUS_36580 2057 2632 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869658.1 protein_id gnl|my_center|LOCUS_36580 2622 3155 gene locus_tag LOCUS_36590 gene cobU 2622 3155 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869446.1 protein_id gnl|my_center|LOCUS_36590 >Feature sequence330 363 1409 gene locus_tag LOCUS_36600 363 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 1409 2239 gene locus_tag LOCUS_36610 1409 2239 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331327.1 protein_id gnl|my_center|LOCUS_36610 2260 3642 gene locus_tag LOCUS_36620 2260 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 >Feature sequence331 123 197 gene locus_tag LOCUS_t00440 123 197 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 360 1727 gene locus_tag LOCUS_36630 360 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 1797 2702 gene locus_tag LOCUS_36640 1797 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 2912 3256 gene locus_tag LOCUS_36650 2912 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 3253 3519 gene locus_tag LOCUS_36660 3253 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 >Feature sequence332 <1 869 gene locus_tag LOCUS_36670 <1 869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005807926.1:mechanosensitive ion channel family protein 1095 2168 gene locus_tag LOCUS_36680 1095 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 2173 2916 gene locus_tag LOCUS_36690 2173 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 >Feature sequence333 2 1555 gene locus_tag LOCUS_36700 2 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 1552 2247 gene locus_tag LOCUS_36710 1552 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 2424 3299 gene locus_tag LOCUS_36720 2424 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 <4047 3345 gene locus_tag LOCUS_36730 <4047 3345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460667.1:pirin family protein >Feature sequence334 2664 178 gene locus_tag LOCUS_36740 2664 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 <3964 2690 gene locus_tag LOCUS_36750 <3964 2690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114575.1:type 4a pilus secretin PilQ >Feature sequence335 151 444 gene locus_tag LOCUS_36760 151 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 668 1768 gene locus_tag LOCUS_36770 gene ugpC 668 1768 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_36770 1896 3671 gene locus_tag LOCUS_36780 1896 3671 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027306.1 protein_id gnl|my_center|LOCUS_36780 >Feature sequence336 1880 465 gene locus_tag LOCUS_36790 1880 465 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922333.1 protein_id gnl|my_center|LOCUS_36790 >Feature sequence337 694 467 gene locus_tag LOCUS_36800 694 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 1466 795 gene locus_tag LOCUS_36810 1466 795 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946891.1 protein_id gnl|my_center|LOCUS_36810 2421 1468 gene locus_tag LOCUS_36820 2421 1468 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533130.1 protein_id gnl|my_center|LOCUS_36820 3581 2631 gene locus_tag LOCUS_36830 3581 2631 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573417.1 protein_id gnl|my_center|LOCUS_36830 >Feature sequence338 2726 1995 gene locus_tag LOCUS_36840 2726 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 >Feature sequence339 1451 363 gene locus_tag LOCUS_36850 1451 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 2572 1682 gene locus_tag LOCUS_36860 2572 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 3581 2592 gene locus_tag LOCUS_36870 gene mgrA 3581 2592 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640297.1 protein_id gnl|my_center|LOCUS_36870 3865 3596 gene locus_tag LOCUS_36880 3865 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 >Feature sequence340 504 1109 gene locus_tag LOCUS_36890 504 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765473.1 protein_id gnl|my_center|LOCUS_36890 1195 2184 gene locus_tag LOCUS_36900 1195 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 <3844 2249 gene locus_tag LOCUS_36910 <3844 2249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003132571.1:leucine--tRNA ligase >Feature sequence341 <1 673 gene locus_tag LOCUS_36920 <1 673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123560.1:TIM barrel protein 667 1734 gene locus_tag LOCUS_36930 667 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 3689 1707 gene locus_tag LOCUS_36940 3689 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 >Feature sequence342 1800 2306 gene locus_tag LOCUS_36950 gene hpt 1800 2306 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567626.1 protein_id gnl|my_center|LOCUS_36950 3288 2323 gene locus_tag LOCUS_36960 3288 2323 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890820.1 protein_id gnl|my_center|LOCUS_36960 >Feature sequence343 2179 1973 gene locus_tag LOCUS_36970 2179 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 3529 2537 gene locus_tag LOCUS_36980 3529 2537 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583041.1 protein_id gnl|my_center|LOCUS_36980 >Feature sequence344 1291 173 gene locus_tag LOCUS_36990 1291 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 2091 1609 gene locus_tag LOCUS_37000 2091 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 2421 2095 gene locus_tag LOCUS_37010 2421 2095 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207495.1 protein_id gnl|my_center|LOCUS_37010 >Feature sequence345 >Feature sequence346 3629 2949 gene locus_tag LOCUS_37020 3629 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 >Feature sequence347 <1 960 gene locus_tag LOCUS_37030 <1 960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141324.1:histidinol dehydrogenase 1924 1022 gene locus_tag LOCUS_37040 1924 1022 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009279.1 protein_id gnl|my_center|LOCUS_37040 3260 1929 gene locus_tag LOCUS_37050 3260 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 >Feature sequence348 1067 705 gene locus_tag LOCUS_37060 1067 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 3316 1064 gene locus_tag LOCUS_37070 3316 1064 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_37070 >Feature sequence349 3205 206 gene locus_tag LOCUS_37080 3205 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294648.1 protein_id gnl|my_center|LOCUS_37080 >Feature sequence350 435 1430 gene locus_tag LOCUS_37090 435 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 1421 2470 gene locus_tag LOCUS_37100 1421 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 2430 3401 gene locus_tag LOCUS_37110 2430 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 >Feature sequence351 1045 473 gene locus_tag LOCUS_37120 gene rsmD 1045 473 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466716.1 protein_id gnl|my_center|LOCUS_37120 2591 1050 gene locus_tag LOCUS_37130 gene guaA 2591 1050 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_37130 >Feature sequence352 98 793 gene locus_tag LOCUS_37140 98 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 >Feature sequence353 166 339 gene locus_tag LOCUS_37150 166 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 1384 371 gene locus_tag LOCUS_37160 1384 371 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_37160 2220 1819 gene locus_tag LOCUS_37170 2220 1819 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272371.1 protein_id gnl|my_center|LOCUS_37170 2507 3127 gene locus_tag LOCUS_37180 gene bluB 2507 3127 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228822.1 protein_id gnl|my_center|LOCUS_37180 >Feature sequence354 <3259 846 gene locus_tag LOCUS_37190 <3259 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015909439.1:flagellar filament outer layer protein FlaA >Feature sequence355 3186 2425 gene locus_tag LOCUS_37200 3186 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 >Feature sequence356 <3212 2602 gene locus_tag LOCUS_37210 <3212 2602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118674.1:polyphosphate kinase 2 family protein >Feature sequence357 1209 88 gene locus_tag LOCUS_37220 1209 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 2301 1411 gene locus_tag LOCUS_37230 gene hslO 2301 1411 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359370.1 protein_id gnl|my_center|LOCUS_37230 2404 2847 gene locus_tag LOCUS_37240 2404 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 >Feature sequence358 <1 1029 gene locus_tag LOCUS_37250 <1 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_085009790.1:protein translocase subunit SecF >Feature sequence359 914 528 gene locus_tag LOCUS_37260 914 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 2080 947 gene locus_tag LOCUS_37270 2080 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 <3076 2077 gene locus_tag LOCUS_37280 <3076 2077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005660510.1:HTH-type transcriptional repressor PurR >Feature sequence360 1249 512 gene locus_tag LOCUS_37290 1249 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 2204 1389 gene locus_tag LOCUS_37300 2204 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 3037 2201 gene locus_tag LOCUS_37310 3037 2201 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844814.1 protein_id gnl|my_center|LOCUS_37310 >Feature sequence361 2597 1662 gene locus_tag LOCUS_37320 2597 1662 CDS product DUF4434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766063.1 protein_id gnl|my_center|LOCUS_37320 >Feature sequence362 34 1116 gene locus_tag LOCUS_37330 34 1116 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_37330 2689 1187 gene locus_tag LOCUS_37340 2689 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 >Feature sequence363 2412 730 gene locus_tag LOCUS_37350 2412 730 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943604.1 protein_id gnl|my_center|LOCUS_37350 >Feature sequence364 971 537 gene locus_tag LOCUS_37360 gene queF 971 537 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263288.1 protein_id gnl|my_center|LOCUS_37360 1188 1619 gene locus_tag LOCUS_37370 1188 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 >Feature sequence365 803 342 gene locus_tag LOCUS_37380 803 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 1560 871 gene locus_tag LOCUS_37390 1560 871 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_37390 2405 1629 gene locus_tag LOCUS_37400 2405 1629 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966200.1 protein_id gnl|my_center|LOCUS_37400 >Feature sequence366 357 1811 gene locus_tag LOCUS_37410 357 1811 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976070.1 protein_id gnl|my_center|LOCUS_37410 >Feature sequence367 217 1185 gene locus_tag LOCUS_37420 217 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 1273 2586 gene locus_tag LOCUS_37430 1273 2586 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931806.1 protein_id gnl|my_center|LOCUS_37430 >Feature sequence368 617 1537 gene locus_tag LOCUS_37440 617 1537 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_37440 >Feature sequence369 1716 694 gene locus_tag LOCUS_37450 1716 694 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786511.1 protein_id gnl|my_center|LOCUS_37450 2129 1713 gene locus_tag LOCUS_37460 2129 1713 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938185.1 protein_id gnl|my_center|LOCUS_37460 >Feature sequence370 1488 10 gene locus_tag LOCUS_37470 1488 10 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938513.1 protein_id gnl|my_center|LOCUS_37470 1638 2261 gene locus_tag LOCUS_37480 gene azoR1 1638 2261 CDS product FMN-dependent NADH-azoreductase AzoR1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114189.1 protein_id gnl|my_center|LOCUS_37480 >Feature sequence371 2 985 gene locus_tag LOCUS_37490 2 985 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931920.1 protein_id gnl|my_center|LOCUS_37490 985 2028 gene locus_tag LOCUS_37500 985 2028 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120825.1 protein_id gnl|my_center|LOCUS_37500 >Feature sequence372 >Feature sequence373 <2187 559 gene locus_tag LOCUS_37510 <2187 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030494.1:alpha-galactosidase >Feature sequence374 1444 707 gene locus_tag LOCUS_37520 gene kdsB 1444 707 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545187.1 protein_id gnl|my_center|LOCUS_37520 <2152 1492 gene locus_tag LOCUS_37530 <2152 1492 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942727.1:D-glycero-beta-D-manno-heptose-7-phosphate kinase >Feature sequence375 >Feature sequence376 <1899 588 gene locus_tag LOCUS_37540 <1899 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206819.1:methylenetetrahydrofolate reductase C-terminal domain-containing protein >Feature sequence377 311 1135 gene locus_tag LOCUS_37550 311 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550